Entries |
Document | Title | Date |
20080200407 | Methylated cpg polynucleotide - It is an object of the present invention to provide a polynucleotide, which can effectively suppress the immunoreactivity caused by DNA having a CpG motif and which can be used for preventing and/or treating immune-mediated diseases such as arthritis. The present invention provides a polynucleotide comprising a CpG motif wherein guanine is methylated, and a pharmaceutical composition comprising the above-mentioned polynucleotide. | 08-21-2008 |
20080200408 | Deletion mutants of tetrodotoxin-resistant sodium channel alpha subunit - The present invention is directed to deletion mutants of a human sodium channel alpha subunit and methods and compositions for making and using the same. | 08-21-2008 |
20080200409 | Antisense Oligonucleotides For Inducing Exon Skipping and Methods of Use Thereof - Antisense molecules capable of binding to a selected target site in the dystrophin gene to induce exon skipping are described. | 08-21-2008 |
20080200410 | Method for detection of 5T4 RNA in plasma or serum - This invention relates to methods of detecting or inferring the presence of malignant or premalignant cells in a human that express 5T4. Provided are methods for detecting 5T4 RNA in blood, plasma, serum, other bodily fluids, cells, and tissues. The invention thereby provides an aid for the detection, diagnosis, monitoring, treatment, or evaluation of neoplastic disease. | 08-21-2008 |
20080200411 | MEANS AND METHODS FOR DIAGNOSING AND TREATING AFFECTIVE DISORDERS - Nucleic acid molecules encoding an ATP-gated ion channel P2X7R which contains a mutation or a deletion are disclosed. Polypeptides encoded by the nucleic acid molecules and antibodies that specifically are directed to these polypeptides are disclosed. Aptamers that specifically bind the nucleic acid molecules, and primers for selectively amplifying the nucleic acid molecules are provided, kits, compositions, particularly pharmaceutical and diagnostic compositions comprising the nucleic acid molecules, vectors, polypeptides, aptamers, antibodies and/or primers, are provided. Methods for diagnosing affective disorders associated with a non-functional P2X7R protein, an altered ATP-gating of the P2X7R protein, an over or underexpression of the P2X7R protein or associated with the presence of any one of the nucleic acid molecules or polypeptides encoded thereby are disclosed. Additionally, the present invention relates to uses and methods for treating affective disorders employing a functional or non-functional ATP-gated ion-channel P2X7R, such as treatment with modulators of P2X7R activity. | 08-21-2008 |
20080200412 | Astrocyte Elevated Gene-1 And Its Promoter In Treatments For Neurotoxicity And Malignancy - The present invention is based, at least in part, on the discovery that Astrocyte Elevated Gene-1 (‘AEG-1’) expression (i) suppresses the Excitatory Amino Acid Transporter-2 (‘EAAT-2’) promoter, thereby inhibiting glutamate transport; (ii) supports anchorage independent colony formation of cells, in which it is synergistic with the RAS oncogene; and (iii) is increased in a number of different malignancies. The invention, in various embodiments, provides for methods of treatment of malignancies and neurodegenerative disorders using inhibitors of AEG-1 activity, and provides for screening assays for identifying other compounds that have therapeutic benefit. | 08-21-2008 |
20080200413 | RNA APTAMERS AND METHODS FOR IDENTIFYING THE SAME - RNA aptamers and methods for identifying the same are disclosed. The RNA aptamers selectively bind coagulation factors, E2F family members, Ang1 or Ang2, and therapeutic and other uses for the RNA aptamers are also disclosed. | 08-21-2008 |
20080200414 | HCaRG, A Novel Calcium-Regulated Gene - Novel nucleic acids and corresponding encoded proteins are described. Also described are corresponding recombinant vectors and host cells, as well as methods of producing the proteins. Also described are mimetics and antibodies to the proteins as well as compositions comprising the nucleic acid or proteins or a portion thereof. Methods and kits for the detection of a disease, disorder or abnormal physical state caused by abnormal modulation of calcium levels in a patient are also described. Methods for treating a patient having a disease, disorder or abnormal physical state caused by abnormal calcium levels are also described. Methods for assaying abnormal calcium levels are also described, as are methods for screening the efficacy of products for modulating abnormal calcium levels. | 08-21-2008 |
20080200415 | Plant Activation of Insect Toxin - Compositions and methods for protecting a plant from an insect pest are provided. In particular, nucleic acid sequences encoding insect protoxins modified to comprise at least one proteolytic activation site that is sensitive to a plant protease or an insect gut protease are provided. Cleavage of the modified protoxin at the proteolytic activation site by a protease produces an active insect toxin. Methods of using the modified insect protoxin nucleic acid sequences and the polypeptides they encode to protect a plant from an insect pest are provided. Particular embodiments of the invention further provide modified insect protoxin compositions and formulations, expression cassettes, and transformed plants, plant cells, and seeds. | 08-21-2008 |
20080200416 | Modulation of T cell signaling threshold and T cell sensitivity to antigens - MicroRNAs (miRNAs) are a diverse and abundant class of ˜22-nucleotide (nt) endogenous regulatory RNAs that play a variety of roles in animal cells by controlling gene expression at the posttranscriptional level. Increased miR-181a expression in mature T cells is shown to cause a marked increase in T cell activation and augments T cell sensitivity to peptide antigens. Moreover, T cell blasts with higher miR-181a expression become reactive to antagonists. The effects of miR-181a on antigen discrimination are in part achieved by dampening the expression of multiple negative regulators in the T cell receptor (TCR) signaling pathway, including PTPN22 and the dual specificity phosphatases DUSP5 and DUSP6. This results in a reduction in the TCR signaling threshold, thus quantitatively and qualitatively enhancing T cell sensitivity to antigens. | 08-21-2008 |
20080200417 | HIGH EFFICIENCY ENCAPSULATION OF CHARGED THERAPEUTIC AGENTS IN LIPID VESICLES - Methods for the preparation of a lipid-nucleic acid composition are provided. According to the methods, a mixture of lipids containing a protonatable or deprotonatable lipid, for example an amino lipid and a lipid such as a PEG- or Polyamide oligomer-modified lipid is combined with a buffered aqueous solution of a charged therapeutic agent, for example polyanionic nucleic acids, to produce particles in which the therapeutic agent is encapsulated in a lipid vesicle. Surface charges on the lipid particles are at least partially neutralized to provide surface-neutralized lipid-encapsulated compositions of the therapeutic agents. The method permits the preparation of compositions with high ratios of therapeutic agent to lipid and with encapsulation efficiencies in excess of 50%. | 08-21-2008 |
20080200418 | COMPOSITIONS FOR DRUG ADMINISTRATION - A composition having at least one alkyl glycoside and at least one therapeutic agent, wherein the alkylglycoside has an alkyl chain length from about 10 to about 16 carbon atoms and wherein the therapeutic agent is an oligonucleotide. | 08-21-2008 |
20080200419 | Splicing Variant of TGF-beta2 and Uses Thereof - An alternatively spliced form of transforming growth factor-beta2 (TGF-β2), herein denoted Δ6-TGF-β2 is disclosed. Δ6-TGF-β2 differs from TGF-β2 in the sequence of the three C-terminal exons. This novel protein is secreted, induced by cytotoxic stress in hematopoietic stem cells, and specifically blocks the enhancing effects of TGF-β2 on adult stem cells. Δ6-TGF-β2 can be used to protect stem cells from cytotoxic stress, and to enhance maintenance of these cells in vitro during retroviral transduction. In addition, Δ6-TGF-β2 can be used to slow aging and extend longevity. | 08-21-2008 |
20080200420 | In vivo production of small interfering RNAs that mediate gene silencing - The invention provides engineered RNA precursors that when expressed in a cell are processed by the cell to produce targeted small interfering RNAs (siRNAs) that selectively silence targeted genes (by cleaving specific mRNAs) using the cell's own RNA interference (RNAi) pathway. By introducing nucleic acid molecules that encode these engineered RNA precursors into cells in vivo with appropriate regulatory sequences, expression of the engineered RNA precursors can be selectively controlled both temporally and spatially, i.e., at particular times and/or in particular tissues, organs, or cells. | 08-21-2008 |
20080207539 | Self-Processing Rna Expression Cassette - The invention provides a self-processing RNA expression cassette which includes at least one pair of processing units, an RNAi effecter sequence of predetermined length that regulates target gene expression which is flanked by said pair of processing units; and at least one pair of cognate ribozyme cis-cleavage target sites located 5′ and 3′ of the RNAi effecter sequence. The self-processing RNA expression cassette is able to express in vivo and in vitro and the RNAi effecter sequence includes at least one target recognition sequence derived from the Hepatitis B Virus (HBV) X gene (HBx). | 08-28-2008 |
20080207540 | Method For the Identification of Compounds Modulating Reverse Transport of Cholesterol - The invention relates to methods and compounds which can modulate reverse cholesterol transport in a mammal and to screening methods enabling the selection, identification and/or characterization of compounds which can modulate reverse cholesterol transport. The invention also relates to cells, vectors and genetic constructs which can be used to implement said methods, in addition to pharmaceutical compositions intended for the treatment of atherosclerosis. | 08-28-2008 |
20080207541 | Compositions and Methods For Optimizing Cleavage of Rna By Rnase H - The present invention provides compositions and methods for the optimization of cleavage of RNA species by RNase H. In some embodiments, the invention provides oligonucleotides that possess two or more regions of differing conformation, and at least one transitional nucleobase positioned between the regions that is capable of modulating transfer of the helical conformation characteristic of the region bound to the 3′hydroxy thereof, to the region bound to the 5′ hydroxyl thereof. | 08-28-2008 |
20080207542 | RNA inteference mediated inhibition of hepatitis C virus (HVC) gene expression using short interfering nucleic acid (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of gene expression and/or activity. The present invention is also directed to compounds, compositions, and methods relating to traits, diseases and conditions that respond to the modulation of expression and/or activity of genes involved in gene expression pathways or other cellular processes that mediate the maintenance or development of such traits, diseases and conditions. Specifically, the invention relates to double stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against gene expression, including cocktails of such small nucleic acid molecules and lipid nanoparticle (LNP) formulations of such small nucleic acid molecules. The present invention also relates to small nucleic acid molecules, such as siNA, siRNA, and others that can inhibit the function of endogenous RNA molecules, such as endogenous micro-RNA (miRNA) (e.g, miRNA inhibitors) or endogenous short interfering RNA (siRNA), (e.g., siRNA inhibitors) or that can inhibit the function of RISC (e.g., RISC inhibitors), to modulate gene expression by interfering with the regulatory function of such endogenous RNAs or proteins associated with such endogenous RNAs (e.g., RISC), including cocktails of such small nucleic acid molecules and lipid nanoparticle (LNP) formulations of such small nucleic acid molecules. Such small nucleic acid molecules and are useful, for example, in providing compositions to prevent, inhibit, or reduce diseases, traits and conditions that are associated with gene expression or activity in a subject or organism. | 08-28-2008 |
20080207543 | MODIFIED PITUITARY GLAND DEVELOPMENT IN OFFSPRING FROM EXPECTANT MOTHER ANIMALS TREATED WITH GROWTH HORMONE RELEASING HORMONE THERAPY - The intramuscular electroporated injection of a protease-resistant growth hormone-releasing hormone (“GHRH”) cDNA into rat dams at 16 days of gestation resulted in the enhanced long-term growth of the FI offspring. The offspring were significantly heavier by one week of age and the difference was sustained to 10 weeks of age. Consistent with their augmented growth, plasma IGF-I concentration of the FI progeny was increased significantly. The pituitary gland of the offspring was significantly heavier, and contained an increased number of somatotropes (cells producing GH) and lactotrophs (prolactin-secreting cells), and is indicative of an alteration in cell lineages. These unique findings demonstrate that enhanced GHRH expression in pregnant dams can result in intergenerational growth promotion, by altering development of the pituitary gland in the offspring. | 08-28-2008 |
20080207544 | Compositions And Methods For Delivery Of Agents Into Cells - Disclosed herein are novel compositions for delivery of biologically active agents into cells comprising a cationic amphiphile and a complementary lipid composition. Also disclosed are methods of making and using such novel compositions. | 08-28-2008 |
20080207545 | Methods and Compositions for Treating 5Alpha-Reductase Type 1 and Type 2 Dependent Conditions - The invention relates generally to the use of anti-sense oligonucleotides, small interfering RNA, and ribozymes to modulate expression of the human steroid 5α-reductase gene and thereby modulate levels of dihydrotestosterone (DHT). Elevated levels of DHT are associated with various disorders including, but not limited to, skin diseases, hair loss, hirsuitism, and benign prostatic hyperplasia. The invention specifically relates to formulations of these anti-sense oligonucleotides, small interfering RNA, and ribozymes for administration to treat and prevent disorders | 08-28-2008 |
20080207546 | RNA APTAMERS AND METHODS FOR IDENTIFYING THE SAME - RNA aptamers and methods for identifying the same are disclosed. The RNA aptamers selectively bind coagulation factors, E2F family members, Ang1 or Ang2, and therapeutic and other uses for the RNA aptamers are also disclosed. | 08-28-2008 |
20080207547 | COMPOSITIONS AND METHODS FOR THE THERAPY AND DIAGNOSIS OF BREAST CANCER - Compositions and methods for the therapy and diagnosis of cancer, particularly breast cancer, are disclosed. Illustrative compositions comprise one or more breast tumor polypeptides, immunogenic portions thereof, polynucleotides that encode such polypeptides, antigen presenting cell that expresses such polypeptides, and T cells that are specific for cells expressing such polypeptides. The disclosed compositions are useful, for example, in the diagnosis, prevention and/or treatment of diseases, particularly breast cancer. | 08-28-2008 |
20080207548 | COMPOSITIONS AND METHODS FOR THE THERAPY AND DIAGNOSIS OF BREAST CANCER - Compositions and methods for the therapy and diagnosis of cancer, particularly breast cancer, are disclosed. Illustrative compositions comprise one or more breast tumor polypeptides, immunogenic portions thereof, polynucleotides that encode such polypeptides, antigen presenting cell that expresses such polypeptides, and T cells that are specific for cells expressing such polypeptides. The disclosed compositions are useful, for example, in the diagnosis, prevention and/or treatment of diseases, particularly breast cancer. | 08-28-2008 |
20080207549 | GENES AND POLYPEPTIDES RELATING TO HEPATOCELLULAR OR COLORECTAL CARCINOMA - The present application provides novel human genes WDRPUH and KRZFPUH and PPIL1 whose expression is markedly elevated in a great majority of HCC's and colorectal cancers, respectively, compared to corresponding non-cancerous tissues, as well as novel human gene APCDD1 whose expression is elevated in primary colon cancers and down-regulated in response to the transduction of wild-type APC1 into colon cancer cells. The genes and polypeptides encoded by the genes can be used, for example, in the diagnosis of a cell proliferative disease, and as target for developing drugs against the disease. | 08-28-2008 |
20080207550 | IMMUNOMODULATORY POLYNUCLEOTIDES AND METHODS OF USING THE SAME - The invention provides immunomodulatory polynucleotides and methods for immunomodulation of individuals using the immunomodulatory polynucleotides. | 08-28-2008 |
20080207551 | MODIFIED OLIGONUCLEOTIDES CONTAINING DIPHOSPHODIESTER INTERNUCLEOTIDE LINKAGES - The synthesis and biochemical utility of modified oligonucleotides containing diphosphodiester internucleotide linkages. The synthesis of these compounds was carried out using diphosphitylating reagents. Oligonucleotides containing diphosphate diester bridges wherein said oligonucleotides are synthesized via a solid-phase synthesis strategy to form modified oligonucleotides. Diphosphitylating, triphosphitylating, tetraphosphitylating, β-triphosphitylating, bifunctional diphosphitylating, bifunctional triphosphitylating, and bifunctional tetraphosphitylating reagents wherein, the phosphorus atoms are linked together through oxygen, sulfur, amino, or methylene groups and/or are substituted with chlorine, diisopropylamine and cyanoethoxy groups. | 08-28-2008 |
20080207552 | Decoy compositions for treating and preventing brain diseases and disorders - The present invention provides introduction of NF-κB decoy oligodeoxynucleotide into rat cranial nerve through a carotid artery during global brain ischemia. Polymerase chain reaction demonstrated that one hour after global brain ischemia, transfected NF-κB decoy oligodeoxynucleotide effectively suppressed expression of tumor necrosis factor α, interleukin 1β and intracellular adhesion molecule 1 messenger RNAs. Terminal deoxynucleotidyl transferase-mediated deoxyuridine nick-end labeling staining and immunohistochemistry using microtubule-associated protein 2 demonstrated that transfected NF-κB decoy oligodeoxynucleotide significantly attenuated neuronal damage seven days after global brain ischemia. Therapeutic transfection of NF-κB decoy oligodeoxynucleotide during brain ischemia may be effective for attenuation of neuronal damage, suggesting a strategy for protecting the cerebrum from global ischemia. | 08-28-2008 |
20080207553 | Biodegradable Cationic Polymers - Polymers comprising a polyethylenimine, a biodegradable group, and a relatively hydrophobic group are useful for the delivery of bioactive agents to cells. | 08-28-2008 |
20080207554 | 2-5A Analogs and their Methods of Use - This invention relates to the fields of organic chemistry, pharmaceutical chemistry, biochemistry, molecular biology and medicine. In particular it relates to compounds that activate RNaseL, and to the use of the compounds for treating and/or ameliorating a disease or a condition, such as a viral infection. | 08-28-2008 |
20080207555 | HYDROLASE AND METHODS FOR ITS USE - This disclosure provides methods for catalyzing the release of ADP-ribose from poly(ADP-ribose) or O-acetyl-ADP-ribose. Also provided are methods for modifying DNA repair or chromatin structure by introducing into the cell an agent that modifies the activity of an ARH3 polypeptide, or variant or fragment thereof. Further provided are methods for screening molecules involved in the poly(ADP-ribosyl)ation of proteins or O-acetyl-ADP-ribose content, and method for treating disorders by altering activity of an ARH3 protein. | 08-28-2008 |
20080207556 | Product and Process for Inhibition of Biofilm Development - Disclosed are compositions and methods for the inhibition of biofilm formation or reduction of existing or developing biofilms in a patient. These methods also inhibit the aggregation of bacteria that form biofilms in the airways. The methods include administering to a subject that has or is at risk of developing biofilms a compound or formulation that inhibits the formation or polymerization of actin microfilaments or depolymerizes actin microfilaments at or proximal to the site of biofilm formation. Such a compound can be administered in combination with a compound or formulation that inhibits the accumulation or activity of cells that are likely to undergo necrosis at or proximal to the site of biofilm formation (i.e., neutrophils). The methods and compositions can further include the use of anti-DNA and/or anti-mucin compounds, as well as other therapeutic compounds and compositions. | 08-28-2008 |
20080214482 | Retromer-based assays and methods for treating alzheimer's disease - This invention provides a method for determining whether an agent causes an increase in the expression of a retromer complex protein. This invention further provides a method for determining whether an agent causes an increase in the activity of a retromer complex. This invention also provides a method for increasing the expression of a retromer complex protein in a cell. This invention provides a method for treating a subject afflicted with Alzheimer's disease. This invention further provides a pharmaceutical composition as well as an article of manufacture. | 09-04-2008 |
20080214483 | Antisense-oligonucleotides for the treatment of immuno-suppressive effects of transforming growth factor-beta (TGF-beta) - Antisense-oligonucleotides or effective derivatives thereof hybridizing with an area of a gene coding for transforming growth factor-β (TGF-β) comprising the following nucleic acid sequences identified in the sequence listing under SEQ ID NO. 1-56 and 137 or comprising the following nucleic acid sequences identified in the sequence listing under SEQ ID NO. 57 to 136 each of the nucleic acids having a DNA- or RNA-type structure. | 09-04-2008 |
20080214484 | NUCLEIC ACIDS ENCODING SARCOCYSTIS NEURONA ANTIGEN AND USES THEREOF - The present invention provides novel isolated nucleic acids encoding antigenic proteins derived from | 09-04-2008 |
20080214485 | Method of inducing an immune response - A method is provided for inducing or enhancing an immune response in a mammal to a target polypeptide expressed in a plurality of cells of the mammal, which method comprises administering to the mammal an inhibitory nucleic acid which targets a region of a ribonucleic acid (RNA) which encodes said polypeptide. Also provided is a pharmaceutical composition comprising an inhibitory nucleic acid which targets a region of an RNA which encodes a target polypeptide expressed in a plurality of cells of a mammal, such that translation of an aberrant form of the target polypeptide occurs in said cells, said truncated form of the target polypeptide comprising one or more T cell epitopes; together with a pharmaceutically acceptable carrier or diluent. | 09-04-2008 |
20080214486 | RNAi-MEDIATED INHIBITION OF AQUAPORIN 4 FOR TREATMENT OF IOP-RELATED CONDITIONS - RNA interference is provided for inhibition of aquaporin 4 (AQP4) in intraocular pressure-related conditions, including ocular hypertension and glaucoma such as normal tension glaucoma and open angle glaucoma. | 09-04-2008 |
20080214487 | Methods and compositions for treatment of inflammatory disease using cadherin-11 modulating agents - A method for treating inflammatory joint diseases by inhibiting cadherin-11 mediated cellular function using a cadherin-11 modulating agent is provided. Also provided are screening assays for identifying pharmaceutical lead compounds capable of modulating cellular functions of cadherin-11 such as cell proliferation, apoptosis, factor secretion, and binding of cadherin-11 to cadherin-11 counter-receptor inhibiting binding of cadherin-11 to its counter-receptor either in the context of a cell or in soluble form. | 09-04-2008 |
20080214488 | TRIGGERED RNAi - The present application relates to methods and compositions for triggering RNAi. Triggered RNAi is highly versatile because the silencing targets are independent of the detection targets. In some embodiments, a method of silencing a target gene is provided. The method comprises providing an initiator to a cell comprising a detection target and a silencing target gene, wherein the detection target is different from the silencing target gene; providing a first substrate monomer to the cell, wherein the first substrate monomer comprises a silencing target complement region that is substantially complementary to a portion of the silencing target gene, and an initiator complement region that is substantially complementary to a portion of the initiator; and providing a second substrate monomer to the cell, wherein the second substrate monomer comprises a silencing target region that is substantially complementary to the silencing target complement region; wherein binding of the detection target to the initiator initiates formation of an inactivator double-stranded RNA (inactivator dsRNA) which silences the silencing target gene. | 09-04-2008 |
20080214489 | Aptamer-mediated intracellular delivery of oligonucleotides - Compositions and methods to mediate the intracellular and sub-cellular delivery of therapeutic, diagnostic and imaging agents, such as oligonucleotides. The compositions of the invention include nucleic acid conjugates comprising a delivery aptamer that is connected to an oligonucleotide. The delivery aptamer may be connected directly to the oligonucleotide, or may be connected indirectly to the oligonucleotide, such as through a linker. The oligonucleotide may be either a therapeutic, diagnostic or imaging oligonucleotide. The methods of the invention are used to increase potency, or alter distribution, half-life, metabolic fate, toxicity and other characteristics. | 09-04-2008 |
20080221050 | Method for Diagnosing or Predicting Susceptibility to Optic Neuropathy - Disclosed is a set of genetic polymorphisms linked to optic neuropathy including glaucoma and Leber's disease. Those polymorphisms are useful for diagnosing and predicting susceptibility to optic neuropathy. | 09-11-2008 |
20080221051 | Formulations comprising antisense nucleotides to connexins - A therapeutic and/or cosmetic formulation comprising at least one anti-sense polynucleotide to a connexin protein together with a pharmaceutically acceptable carrier or vehicle is useful in site specific down regulation of connexin protein expression, particularly in reduction of neuronal cells death, wound healing, reduction of inflammation, decrease of scar formation and skin rejuvenation and thickening. | 09-11-2008 |
20080221052 | Modulation of Wrn-Mediated Telomere-Initiated Cell Signaling - The use of modulators of WRN is described. Activators of WRN may be used to induce growth arrest, apoptosis or proliferative senescence, whereas inhibitors of WRN may be used to reduce growth arrest, apoptosis or proliferative senescence. Methods of identifying modulators of WRN are also described. | 09-11-2008 |
20080221053 | RNA APTAMERS AND METHODS FOR IDENTIFYING THE SAME - RNA aptamers and methods for identifying the same are disclosed. The RNA aptamers selectively bind coagulation factors, E2F family members, Ang1 or Ang2, and therapeutic and other uses for the RNA aptamers are also disclosed. | 09-11-2008 |
20080221054 | Inhibiting Gene Expression with dsRNA - The present invention relates to the specific inhibition of gene expression in mammals by bringing the target gene into contact with double stranded RNA (dsRNA). | 09-11-2008 |
20080221055 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF HUNTINGTIN GENE - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the Huntingtin gene (HD gene), comprising an antisense strand having a nucleotide sequence which is less than 25 nucleotides in length and which is substantially complementary to at least a part of the HD gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by the expression of the HD gene, or a mutant form thereof, using the pharmaceutical composition; and methods for inhibiting the expression of the huntingtin gene in a cell. | 09-11-2008 |
20080221056 | Early Detection and Prognosis of Colon Cancers - We have developed a transcriptome-wide approach to identify genes affected by promoter CpG island hypermethylation and transcriptional silencing in colorectal cancer (CRC). By screening cell lines and validating tumor specific hypermethylation in a panel of primary human CRC samples, we estimate that nearly 5% of all known genes may be promoter methylated in an individual tumor. When directly compared to gene mutations, we find a much larger number of genes hypermethylated in individual tumors, and much higher frequency of hypermethylation within individual genes harboring either genetic or epigenetic changes. Thus, to enumerate the full spectrum of alterations in the human cancer genome, and facilitate the most efficacious grouping of tumors to identify cancer biomarkers and tailor therapeutic approaches, both genetic and epigenetic screens should be undertaken. The genes we identified can be used inter alia diagnostically to detect cancer, pre-cancer, and likelihood of developing cancer. | 09-11-2008 |
20080221057 | SECRETED PROTEIN CCDC80 REGULATES ADIPOCYTE DIFFERENTIATION - Disclosed herein are methods of modulating adipogenesis. The methods include contacting a cell expressing the Ccdc80 gene with an agent that modulates the expression or activity of the Ccdc80 gene or Ccdc80 protein. Further disclosed herein are methods of treating conditions such as obesity, insulin resistance, and/or type 2 diabetes with Ccdc80 modulators. Also disclosed herein are methods of identifying Ccdc80 modulators. | 09-11-2008 |
20080221058 | Tumor-Specific Vector for Gene Therapy - The invention relates to a vector for the gene therapeutic treatment of tumors, especially in connection with radiotherapy. Said vector is provided with a therapeutic gene in the DNA sequence thereof. The gene is controlled by the promoter for the catalytic subunit of the telomerase or by the promoter for cyclin A. | 09-11-2008 |
20080221059 | NOVEL TREATMENT TOOL FOR CANCER: RNA INTERFERENCE OF BCAS2 - The present invention provides three BCAS2 related nucleotide sequences. The present invention also provides a composition comprising a nucleotide sequence of small interfering RNA of BCAS2 gene. The present invention further provides a method for treating p53 containing cancer comprising administrating a subject with an effective amount of the said composition. | 09-11-2008 |
20080227733 | Method for Treating and Preventing Ischemia-Reperfusion Injury Using Rna Interfering Agent - The present invention is based, at least in part, on the discovery of methods useful in the modulation, e.g., inhibition, of gene expression or protein activity, e.g., apoptosis-related gene expression, e.g., Fas gene expression or cytokine expression, e.g., proinflammatory cytokine expression. In particular, the present invention is based on novel RNA interfering agents, e.g., siRNA in reduction, e.g., prolonged reduction, of apoptosis-related gene expression or cytokine expression in cells. Inhibition of apoptosis-related gene expression or protein activity or cytokine gene expression or protein activity, e.g. by the siRNAs used in the methods of the invention, inhibits ischemia-reperfusion injury. | 09-18-2008 |
20080227735 | Aptamers Selected From Live Tumor Cells and the Use Thereof - The invention relates to aptamers selected from live tumor cells and to the use thereof for diagnosis and treatment of certain cancers and other pathologies. | 09-18-2008 |
20080227736 | Targeting Pseudotyped Retroviral Vectors - The present invention relates to retroviral vectors, particularly lentiviral vectors, pseudotyped with Sindbis envelope and targeted to specific cell types via a targeting moiety linked to the envelope. | 09-18-2008 |
20080227737 | Type 2 diabetes mellitus genes - Methods and compositions related to novel genes associated with type 2 diabetes mellitus. | 09-18-2008 |
20080227738 | Compositions and methods for cell dedifferentiation and tissue regeneration - The present invention provides methods and compositions to dedifferentiate a cell. The ability of the methods and compositions of the present invention to promote the dedifferentiation of differentiated cells, including terminally differentiated cells, can be used to promote regeneration of tissues and organs in vivo. The ability of the methods and compositions of the present invention to promote the dedifferentiation of differentiated cells, including terminally differentiated cells, can further be used to produce populations of stem or progenitor cells which can be used to promote regeneration of tissues and/or organs damaged by injury or disease. Accordingly, the present invention provides novel methods for the treatment of a wide range of injuries and diseases that affect many diverse cell types. | 09-18-2008 |
20080227739 | COMPOSITIONS AND METHODS FOR THE THERAPY AND DIAGNOSIS OF BREAST CANCER - Compositions and methods for the therapy and diagnosis of cancer, particularly breast cancer, are disclosed. Illustrative compositions comprise one or more breast tumor polypeptides, immunogenic portions thereof, polynucleotides that encode such polypeptides, antigen presenting cell that expresses such polypeptides, and T cells that are specific for cells expressing such polypeptides. The disclosed compositions are useful, for example, in the diagnosis, prevention and/or treatment of diseases, particularly breast cancer. | 09-18-2008 |
20080227740 | Compositions and Methods for Elimination of Unwanted Cells - Disclosed are compositions comprising a recombinant nucleic acid vector including a nucleotide sequence encoding a syncytium-inducing polypeptide expressible on a eukaryotic cell surface, and a host cell containing the recombinant vector and expressing the syncytium inducing polypeptide on its cell surface, the vectors and resultant host cells expressing the syncytium inducing polypeptide being useful for selective elimination of unwanted cells. | 09-18-2008 |
20080227741 | ZAP-70 EXPRESSION AS A MARKER FOR CHRONIC LYMPHOCYTIC LEUKEMIA / SMALL LYMPHOCYTIC LYMPHOMA (CLL/SLL) - It has been surprisingly found that ZAP-70 expression, both at the protein and mRNA levels, is indicative of clinical subgroups of CLL/SLL patients. In particular, high ZAP-70 expression is indicative of Ig-unmutated CLL/SLL. Methods are provided for discriminating between clinical subgroups of CLL/SLL, by determining whether subjects overexpress ZAP-70 mRNA or protein. | 09-18-2008 |
20080227742 | Photocleavable oligonucleotide and uses thereof - This invention relates to methods and compositions of oligonucleotide constructs having a photocleavable linker. Specifically, provided herein are methods and compositions utilizing a photocleavable linker, which when exposed to light modulates the expression of genes. | 09-18-2008 |
20080227743 | Compositions and Kits for Treating Influenza - Compositions, kits and methods are provided for the treatment or prophylaxis of influenza. | 09-18-2008 |
20080227744 | BENZOFURAN DERIVED HIV PROTEASE INHIBITORS - Resistance-repellent and multidrug resistant retroviral protease inhibitors are provided. Pharmaceutical composition comprising such compounds, and methods of using such compounds to treat HIV infections in mammals, are also provided. | 09-18-2008 |
20080227745 | Methods and compositions for soluble CPG15 - Disclosed herein are compositions of soluble CPG15 and methods for treating conditions of excessive cell death, such as neurological conditions, using such compositions. Compounds that inhibit the activity of soluble CPG15 are also disclosed herein for the treatment of conditions of undesirable cell survival, such as cancer. | 09-18-2008 |
20080234212 | Materials and Methods for Treatment of Allergic Disease - siRNA molecules are disclosed which target the transcription factor STAT6 and repress the expression of STAT6 mRNA, STAT6 protein and STAT6 function in lung cells. The use of STAT6 specific siRNA molecules in the treatment of allergic diseases of the respiratory tract such as asthma and rhinitis is disclosed. | 09-25-2008 |
20080234213 | Oncogenic regulatory RNAs for diagnostics and therapeutics - A method of identifying regulatory RNAs, including miRNAs, using insertional mutagenesis to generate tumors in mice and determining the human orthologs is disclosed. Further, specific miRNA sequences are identified. The causal nature and expression patterns of these regulatory RNAs and miRNAs in human tumors demonstrate their utility in diagnosis and therapy of cancer. Furthermore, a set of co-mutations that act in conjunction with miRNAs in tumor formation is disclosed. | 09-25-2008 |
20080234214 | Oligonucleotide-Containing Pharmacological Compositions and Their Use - The present invention relates to methods and compositions containing oligonucleotides suitable for administration to humans and other mammals. | 09-25-2008 |
20080234215 | DNA composition and uses thereof - A plasmid DNA that encodes one or more antigenic genes operably linked to a promoter and a truncated retroviral 3′ LTR exhibits both enhanced safety and acceptable efficiency of expression of antigenic proteins. | 09-25-2008 |
20080234216 | TGF-beta type receptor cDNAs encoded products and uses therefor - DNA encoding TGF-β type III receptor of mammalian origin, DNA encoding TGF-β type II receptor of mammalian origin, TGF-β type III receptor, TGF-β type II receptor and uses therefor. | 09-25-2008 |
20080234217 | Inhibitor Nucleic Acids - The present invention provides methods and compositions for attenuating expression of a target gene in vivo. In general, the method includes administering RNAi constructs (such as small-interfering RNAs (i.e., siRNAs) that are targeted to particular mRNA sequences, or nucleic acid material that can produce siRNAs in a cell), in an amount sufficient to attenuate expression of a target gene by an RNA interference mechanism. In particular, the RNAi constructs may include one or more modifications to improve serum stability, cellular uptake and/or to avoid non-specific effect. In certain embodiments, the RNAi constructs contain an aptamer portion. The aptamer may bind to human serum albumin to improve serum half life. The aptamer may also bind to a cell surface protein that improves uptake of the construct. | 09-25-2008 |
20080234218 | Sirna For Inhibiting Il-6 Expression and Composition Containing Them - Disclosed is a double-strand siRNA capable of suppressing interleukin-6 (IL-6) expression, and a pharmaceutical composition containing the same. The siRNA of the present invention and the pharmaceutical composition containing the same may be useful to treat inflammatory diseases, autoimmune diseases, neoplasmic disease and central nervous system diseases, which are all associated with the over-expressed IL-6 level, by lowering an IL-6 level. | 09-25-2008 |
20080234219 | Compositions and Methods for Increasing Bone Mineralization - A novel class or family of TGF-β binding proteins is disclosed. Also disclosed are assays for selecting molecules for increasing bone mineralization and methods for utilizing such molecules. | 09-25-2008 |
20080234220 | Methods and compositions for reducing viral genome amounts in a small target stem cell - Methods and compositions for reducing viral genome amounts in a target cell are provided. In the subject methods, the activity of a miRNA is inhibited in a manner sufficient to reduce the amount of viral genome in the target cell, e.g., by introducing a miRNA inhibitory agent in the target cell. Also provided are pharmaceutical compositions, kits and systems for use in practicing the subject methods. The subject invention finds use in a variety of applications, including the treatment of subjects suffering from a viral mediated disease condition, e.g., an HCV mediated disease condition. | 09-25-2008 |
20080234221 | TRANSFECTION AGENTS - The present invention provides compounds, compositions and methods that enhance the transfer of an agent into a cell. The agents can include polypeptides, polynucleotides such as genes and antisense nucleic acids, and other molecules. In some embodiments, the agents are modulating agents that can modulate a cellular activity or function when introduced into the cell. The compounds, compositions and methods are useful for introducing agents such as genes into individual cells, as well as cells that are present as a tissue or organ. | 09-25-2008 |
20080234222 | Charge Reversal of Polyion Complexes - An ionic polymer is utilized in “recharging” (another layer having a different charge) a condensed polynucleotide complex for purposes of nucleic acid delivery to a cell. The resulting recharged complex can be formed with an appropriate amount of positive or negative charge such that the resulting complex has the desired net charge. | 09-25-2008 |
20080242623 | Microutrophin and Uses Thereof - A microutrophin containing a utrophin having internal deletions (relative to a native utrophin) in the hinge regions and a C-terminal deletion is provided. Also provided are vectors and compositions useful for delivering the microutrophin for the treatment of muscular disorders, including Duchenne Muscular Dystrophy. | 10-02-2008 |
20080242624 | Cyclin D Polynucleotides, Polypeptides and Uses Thereof - The invention provides isolated polynucleotides, specifically Cyclin D polynucleotides, and their encoded proteins that are involved in cell cycle regulation. The invention further provides recombinant expression cassettes, host cells, transgenic plants, and antibody compositions. The present invention provides methods and compositions relating to altering cell cycle protein content and/or composition of plants for the purpose of increasing transformation efficiency. | 10-02-2008 |
20080242625 | Nucleotide-Cochleate Compositions And Methods Of Use - The present invention is directed to cochleate composition that include a nucleotide. The nucleotide may generally be bound via a linker to a component of the cochleate, or to a lipophilic tail. Additionally or alternatively, the nucleotide may be associated with a transfection agent. The present invention also includes methods for making and using the compositions provided herein. | 10-02-2008 |
20080242626 | End-Modified Poly(beta-amino esters) and Uses Thereof - Poly(beta-amino esters) are end-modified to form materials useful in the medical as well as non-medical field. An amine-terminated poly(beta-amino ester) is reacted with an electrophile, or an acrylate-terminated poly(beta-amino ester) is reacted with a nucleophile. The inventive end-modified polymers may be used in any field where polymers have been found useful including the drug delivery arts. The end-modified polymers are particularly useful in delivery nucleic acids such as DNA or RNA. The invention also provides compositions including the inventive end-modified polymers, methods of preparing the inventive polymers, and method of using the inventive polymers. | 10-02-2008 |
20080242627 | NOVEL RNA INTERFERENCE METHODS USING DNA-RNA DUPLEX CONSTRUCTS - The present invention provides novel compositions and methods for suppressing the function or activity of a targeted gene through a novel intracellular piRNA-mediated RNAi mechanism, using RNA-DNA duplex constructs. The invention further provides novel methods and compositions for generating or producing RNA-DNA duplex agents, whose quantity is high enough to be used for the invention's gene silencing transfection and possibly in therapeutics applications. This improved RNA-polymerase chain reaction (RNA-PCR) method utilizes thermocycling steps of promoter-linked DNA or RNA template synthesis, in vitro transcription and then reverse transcription to bring up the amount of RNA-DNA duplexes up to two thousand folds within one round of the above procedure for using in D-RNAi-directed gene silencing. | 10-02-2008 |
20080242628 | Inhibiting Gene Expression with dsRNA - The present invention relates to the specific inhibition of gene expression in mammals by bringing the target gene into contact with double stranded RNA (dsRNA). | 10-02-2008 |
20080242629 | ANTISENSE MODULATION OF APOLIPOPROTEIN B EXPRESSION - Antisense compounds, compositions and methods are provided for modulating the expression of apolipoprotein B. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding apolipoprotein B. Methods of using these compounds for modulation of apolipoprotein B expression and for treatment of diseases associated with expression of apolipoprotein B are provided. | 10-02-2008 |
20080242630 | Fusion proteins of mycobacterium tuberculosis - The present invention relates to compositions and fusion proteins containing at least two | 10-02-2008 |
20080242631 | Impaired wound healing compositions and treatments - Connexin modulation for the treatment of wounds that do not heal at expected rates, including delayed healing wounds, incompletely healing wounds, and chronic wounds, and associated methods, compositions and articles. | 10-02-2008 |
20080242632 | MULTI-TARGETING SHORT INTERFERING RNAs - The present invention relates to novel short interfering RNA (siRNA) molecules that are multi-targeted. More specifically, the present invention relates to siRNA molecules that target two or more sequences. In one embodiment, multi-targeting siRNA molecules are designed to incorporate features of siRNA molecules and features of micro-RNA (miRNA) molecules. In another embodiment, multi-targeting siRNA molecules are designed so that each strand is directed to separate targets. | 10-02-2008 |
20080242633 | Methods of modulating apoptosis and platelet production using variants of cytochrome c - The invention relates to a method for using the gene or protein containing CYCS(Gly42-Ser) to enhance cellular apoptosis. The method can be used to modulate apoptosis to treat conditions associated with an abnormal rate of apoptosis, in particular to treat conditions associated with increased cell growth, for example hyperplasia, hypertrophy, cancer, neoplasia or the like. The invention also relates to the use of the gene or protein containing CYCS(Gly42-Ser) for stimulating platelet release from megakaryocytes, and also to the treatment of thrombocytopenia using the platelets. | 10-02-2008 |
20080242634 | Treatment for neuropathic pain due to spinal cord injury - The present invention is drawn to treatment of neuropathic pain due to spinal cord injury. In this regard, the present invention discloses methods and composition to treat neuropathic pain. | 10-02-2008 |
20080249038 | Bone Morphogenetic Protein (Bmp) 2A and Uses Thereof - The present invention provides compositions and methods for alleviation or reduction of the symptoms and signs associated with damaged neuronal tissues whether resulting from tissue trauma, or from chronic or acute degenerative changes. In particular, some embodiments of the present invention provide one or more pharmaceutical compositions comprising as an active ingredient a BMP2A inhibitor further comprising a pharmaceutically acceptable diluent or carrier. An additional embodiment provides a method for reducing damage to the central nervous system in a patient who has suffered an injury to the central nervous system, comprising administering to the patient a pharmaceutical composition in a dosage sufficient to reduce the damage. Yet another embodiment provides of the use of a BMP2A inhibitor for the preparation of a medicament for promoting or enhancing recovery in a patient who has suffered an injury to the central nervous system. Preferable inhibitors according to some embodiments of the invention are siRNA molecules and neutralizing antibodies. An additional embodiment provides a method for identifying a chemical compound that modulates apoptosis. Further, a process for diagnosing a neurodegenerative disease or an ischemic event in a subject is provided. The preferred methods, materials, and examples that will now be described are illustrative only and are not intended to be limiting; materials and methods similar or equivalent to those described herein can be used in practice or testing of the invention. Other features and advantages of the invention will be apparent from the following detailed description, and from the claims. | 10-09-2008 |
20080249039 | Modified Short Interfering Rna (Modified Sirna) - The present invention is directed to modified siRNA which are significantly impaired in their ability to support cleavage of mRNA when incorporated into a RISC complex. Such modified siRNA may be useful as therapeutic agents, e.g., in the treatment of various cancer forms. More particularly, the modified siRNA comprises a sense strand and an antisense strand, wherein the sense strand contains a modified RNA nucleotide in at least one of positions 8-14, calculated from the 5′-end. | 10-09-2008 |
20080249040 | RNA interference mediated inhibition of sterol regulatory element binding protein 1 (SREBP1) gene expression using short interfering nucleic acid (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of Sterol Regulatory Element-Binding Protein 1 (SREBP1) gene expression and/or activity. The present invention is also directed to compounds, compositions, and methods relating to traits, diseases and conditions that respond to the modulation of expression and/or activity of genes involved in Sterol Regulatory Element-Binding Protein 1 (SREBP1) gene expression pathways or other cellular processes that mediate the maintenance or development of such traits, diseases and conditions. Specifically, the invention relates to double stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against Sterol Regulatory Element-Binding Protein 1 (SREBP1) gene expression, including cocktails of such small nucleic acid molecules and lipid nanoparticle (LNP) formulations of such small nucleic acid molecules. The present invention also relates to small nucleic acid molecules, such as siNA, siRNA, and others that can inhibit the function of endogenous RNA molecules, such as endogenous micro-RNA (miRNA) (e.g, miRNA inhibitors) or endogenous short interfering RNA (siRNA), (e.g., siRNA inhibitors) or that can inhibit the function of RISC (e.g., RISC inhibitors), to modulate SREBP1 gene expression by interfering with the regulatory function of such endogenous RNAs or proteins associated with such endogenous RNAs (e.g., RISC), including cocktails of such small nucleic acid molecules and lipid nanoparticle (LNP) formulations of such small nucleic acid molecules. Such small nucleic acid molecules and are useful, for example, in providing compositions to prevent, inhibit, or reduce metabolic diseases traits and conditions, including but not limited to hyperlipidemia, hypercholesterolemia, cardiovascular disease, atherosclerosis, hypertension, diabetis (e.g., type I and/or type II diabetis), insulin resistance, obesity and/or other disease states, conditions, or traits associated with SREBP1 gene expression or activity in a subject or organism. | 10-09-2008 |
20080249041 | Formulations comprising antisense nucleotides to connexins - A therapeutic and/or cosmetic formulation comprising at least one anti-sense polynucleotide to a connexin protein together with a pharmaceutically acceptable carrier or vehicle is useful in site specific down regulation of connexin protein expression, particularly in reduction of neuronal cells death, wound healing, reduction of inflammation, decrease of scar formation and skin rejuvenation and thickening. | 10-09-2008 |
20080249042 | All-Trans-Retinol: All-Trans-13,14-Dihydroretinol Saturase and Methods of Its Use - Compositions of all-trans-retinol: all-trans-13,14-dihydroretinal saturase and methods of use thereof are provided. | 10-09-2008 |
20080249043 | Methods and Compositions Involving Protein Kinase C-Delta - Disclosed are methods and compositions relating to the use of PKC-δ activators in the treatment of disease. | 10-09-2008 |
20080249044 | Nucleic acid external skin formulation - The present invention provides a nucleic acid external skin formulation having high skin permeability, which is prepared from a polymeric nucleic acid which has high molecular weight and sodium alginate. The nucleic acid external skin formulation is highly skin permeable and delivers its active ingredient nucleic acid to the affected area efficiently. The nucleic acid used may be smaller in amount, and thus, the formulation is also superior in safety and cost. The working mechanism thereof is different from that of the low-molecular weight compounds currently used as an active ingredient for skin anti-inflammatory agents, and thus, the formulation may be applicable to cases where such low-molecular weight medicines are less effective. | 10-09-2008 |
20080249045 | MGAL: A GAL Gene Switch-Based Suite of Methods for Protein Analyses and Protein Expression in Multicellular Organisms and Cells Therefrom - The invention provides methods for detecting and analyzing protein-protein interactions and agonists and antagonists thereof, detecting and analyzing protein sequences, and regulatable gene expression in multicellular organisms or cells therefrom. | 10-09-2008 |
20080249046 | MODIFIED siRNA MOLECULES AND USES THEREOF - The present invention provides chemically modified siRNA molecules and methods of using such siRNA molecules to silence target gene expression. Advantageously, the modified siRNA of the present invention is less immunostimulatory than its corresponding unmodified siRNA sequence and retains full RNAi activity against the target sequence. The present invention also provides nucleic acid-lipid particles comprising a modified siRNA, a cationic lipid, and a non-cationic lipid, which can further comprise a conjugated lipid that inhibits aggregation of particles. Methods for identifying and/or modifying an siRNA having immunostimulatory properties are also provided. | 10-09-2008 |
20080249047 | Modulation of Inflammation Through Modulation of Elavl1/HuR Expression - In the present invention modulation of expression of a member of the Elavl1/Hu family is used to modulate at least translation of specific mRNA. Inducible increase of HuR in murine innate compartments suppresses inflammatory responses in vivo. HuR over-expression induced the translational silencing of specific cytokine mRNAs, despite positive or nominal effects on their corresponding turnover. The present invention uses the fact that HuR acts in a pleiotropic fashion in inflammation through its functional interactions with specific mRNA subsets and negative posttransciptional modules. | 10-09-2008 |
20080249048 | Methods and Compositions for the Treatment of Intestinal Conditions - Methods and compositions for the treatment of intestinal disorders, such as IBD and Crohn's disease, are disclosed. Preferred compositions include siNA. Also disclosed is a method of specifically targeting siNA to treat intestinal disorders by intrarectal administration of siNA compounds. | 10-09-2008 |
20080249049 | Polycationically Charged Polymer and the Use of the Same as a Carrier for Nucleic Acid - A composition for the delivery of nucleic acid to target cells or tissues, which comprises polycationically charged polymer as a carrier of nucleic acid is provided. Said polycationically charged polymer is a polymer which may comprise a charged polymer segment having a main chain based on poly(amino acid), polysaccharide, polyester, polyether, polyurethane or vinyl polymer and having, as a side chain, a group of formula —NH—(CH | 10-09-2008 |
20080249050 | Compounds and methods to enhance rAAV transduction - Agents and methods to alter rAAV transduction are provided. | 10-09-2008 |
20080249051 | Antimicrobial Compounds - The present invention relates to compounds that modulate the shikimate pathway and/or a pathway branching from the shikimate pathway in members of the Amoebida Order. In particular these compounds may be useful in the treatment or prevention of diseases caused or contributed to by members of the Amoebida Order. | 10-09-2008 |
20080249052 | Synthetic mini/micro-dystrophin genes to restore nNOS to the sarcolemma - The present invention provides novel dystrophin mini/micro-genes that retain the essential biological functions of a full-length dystrophin gene. More particularly, the present invention provides to a series of synthetic mini/micro-dystrophin genes capable of restoring neuronal nitric oxide synthase (nNOS) to the sarcolemma. A method as well as a pharmaceutical composition for treatment of Duchenne Muscular Dystrophy (DMD), Becker Muscular Dystrophy (BMD), and X-linked Dilated Cardiomyopathy (XLDC) are also provided. | 10-09-2008 |
20080249053 | Compositions And Methods For Detecting And Treating Neurological Conditions - The present invention relates to the NIPA-1 proteins and nucleic acids encoding the NIPA-1 proteins. The present invention further provides assays for the detection of NIPA-1 polymorphisms and mutations associated with disease states, as well as methods of screening for ligands and modulators of NIPA-1 proteins. | 10-09-2008 |
20080249054 | METHOD OF MEASURING LIPID DROPLETS AND APPLICATIONS OF USING THE SAME - The invention relates to methods of screening agents for the ability to regulate lipid metabolism and using said agents to treat diseases or disorders related to lipid metabolism (e.g., obesity, diabetes [non-insulin and insulin dependent], hypertension, coronary artery disease, hyperlipidemia (e.g., LDL, TAGs), hypolipidemia (e.g., HDL), lipid metabolism disorders, lipid deposition disorders, lipodystrophies). In specific embodiments, the invention relates to using a PAT family protein to screen agents for the ability to regulate lipid metabolism and using the same to treat diseases or disorders related to lipid metabolism. In further embodiments, the invention relates to high throughput screening (HTS) methods that can be used in the drug discovery process for screening agents for the ability to regulate lipid metabolism. | 10-09-2008 |
20080249055 | Use of Seh Inhibitors as Analgesics - The present invention provides methods and compositions for relieving pain and itching, of promoting wound healing, of reducing sickness behavior and of reducing inflammatory bowel disease or acne lesions in a subject by the topical administration of an inhibitor of soluble epoxide hydrolase, or of a cis-epoxyeicosatrienoic acid (“EET”), or by both. | 10-09-2008 |
20080249056 | Methods of Altering an Immune Response Induced by Cpg Oligodeoxynucleotides - It is disclosed herein that agents that affect the activity and/or expression of CXCL16 can be used to alter the uptake of D-type CpG oligodeoxynucleotides (D ODNs). Methods of inducing an immune response are disclosed that include administering agents that increase the activity and/or expression of CXCL16 and a D ODN. Methods of decreasing an immune response to a CpG ODN are also disclosed. These methods include administering an agent that decreases the activity and/or expression of CXCL16. Compositions including one or more D-type ODNs and an agent that modulates that activity and/or expression of CXCL16 are provided. | 10-09-2008 |
20080249057 | Protein kinase C as a target for the treatment of respiratory syncytial virus - The subject invention concerns a method of inhibiting respiratory syncytial virus (RSV) infection in a patient by decreasing the endogenous protein kinase C (PKC) activity within the patient. Preferably, the preventative and therapeutic methods of the present invention involve administration of a PKC inhibitor. The present inventor has determined that decreasing normal endogenous PKC activity is inhibitory to RSV infection of human cells. The subject invention also pertains to pharmaceutical compositions containing a PKC inhibitor and a pharmaceutically acceptable carrier. | 10-09-2008 |
20080249058 | AGENTS THAT REDUCE NEURONAL OVEREXCITATION - The present invention provides methods of identifying candidate agents for treating excitotoxicity-related disorders. The present invention further provides methods for treating excitotoxicity-related disorders. | 10-09-2008 |
20080255064 | Methods for modulating cholecystokinin expression - The invention provides a method for upregulating cholecystokinin (CCK) expression in mammalian pancreatic islets by administrating a CCK upregulating agent. The increased CCK expression activates islet cell proliferation triggering an increase in pancreatic β-cell mass and plasma insulin levels. Accordingly, methods to produce a replenishable supply of islet cells and to ameliorate the symptoms associated with diabetes are also disclosed. | 10-16-2008 |
20080255065 | Small Interfering Rna Molecules Against Ribonucleotide Reductase and Uses Thereof - Small interfering RNA (siRNA) molecules that target a mammalian ribonucleotide reductase gene, and which are capable of inhibiting the expression of their target gene are provided. The siRNA molecules of the invention are capable of attenuating neoplastic cell growth and/or proliferation in vitro and in vivo and, therefore, can be used to attenuate the growth and/or metastasis of various types of mammalian cancers. | 10-16-2008 |
20080255066 | ANTISENSE OLIGONUCLEOTIDE STRATEGIES FOR THE ENHANCEMENT OF CANCER THERAPIES - Effective combinations of antisense agents directed against thymidylate synthase mRNA are provided for use in cancer therapies. Combinations of antisense agents have enhanced activity compared to the activity of the individual antisense agents when used alone. The combinations may be used in conjunction with one or more chemotherapeutic agents to enhance the effects of the chemotherapeutic(s). Such antisense agent combinations constitute improved antisense therapies with application to a variety of cancers or proliferative disorders, including drug resistant cancers. | 10-16-2008 |
20080261903 | Regulation of Kinase, Regulated in Copd Kinase (Rc Kinase) - Reagents which regulate human RC Kinase activity and reagents which bind to human RC Kinase gene products can be used to regulate this protein for therapeutic effects. Such regulation is particularly useful for treating chronic obstructive pulmonary disease, asthma, cancer, and diseases in which cell signaling is defective. | 10-23-2008 |
20080261904 | Chimeric Gapped Oligomeric Compounds - The present invention provides double stranded compositions wherein the first strand comprises three different regions and the second strand is native RNA. Each region has native or modified ribofuranosyl sugar moieties that are different than those of the other two regions. At least a portion of the first oligomeric compound is complementary to and hybridizes to a nucleic acid target. The present invention also provides methods for modulating gene expression using the modified oligomeric compounds and compositions of oligomeric compounds. | 10-23-2008 |
20080261905 | Modified Nucleosides for Rna Interference - The present invention relates to the use of modified nucleotides and single or double stranded oligonucleotides having at least one of said modified nucleotides for performing RNA interference. The modified nucleotides are selected from 6-membered ring containing nucleotides such as hexitol, altritol, O-substituted or O-alkylated altritol, cyclohexenyl, ribo-cyclohexenyl and O-substituted or O-alkylated ribo-cyclohexenyl nucleotides. The present invention also relates to novel modified nucleosides or nucleotides and to the use of the novel modified nucleosides and nucleotides in single or double stranded oligonucleotides for RNA interference, antisense therapy or other applications. | 10-23-2008 |
20080261906 | METHODS AND COMPOSITIONS FOR IDENTIFYING ANTI-HCV AGENTS - The invention features methods and compositions for screening for agents that modulate replication of a virus, particularly Flaviviridae virus (particularly hepatitis C virus (HCV)), where the methods provide for detection of agents that modulate the binding of TBC and NS5A, the inhibition of TBC activity, inhibition of Rab1 activity, and/or the expression of the TBC protein and/or Rab1 protein. The invention also features methods of controlling viral replication, and agents useful in such methods. | 10-23-2008 |
20080261907 | COMPOSITIONS AND METHODS OF SPHINGOSINE KINASE INHIBITORS IN RADIATION THERAPY OF VARIOUS CANCERS - The present invention relates to Sphingosine kinase inhibitors that are useful for treating various cancers. The invention further relates to compositions and methods of SPK inhibitors, including siRNAs, which specifically block gene expression of SPK and potentiates the effect of radiation in the treatment of various cancers. | 10-23-2008 |
20080261908 | MicroRNA-based methods and compositions for the diagnosis, prognosis and treatment of breast cancer - The present invention provides novel methods and compositions for the diagnosis, prognosis and treatment of breast cancer. The invention also provides methods of identifying anti-breast cancer agents. | 10-23-2008 |
20080261909 | Gene Delivery to Organs - Application of a virus with poloxamer alone onto atria results in diffuse epicardial gene transfer with negligible penetration into the myocardium. Progressive increases in protease concentration, however, allow transmural gene transfer. After protease exposure, echocardiographic left atrial diameter does not change. Left atrial ejection fraction decreases on post-operative day 3, but returns to baseline by day 7. At appropriate protease concentrations, tissue tensile strength is unaffected by the procedure. Transmural atrial gene transfer can be effected using this direct “painting” method. | 10-23-2008 |
20080261910 | Diagnostic Methods Based on Polymorphisms of Glucosyltransferase-Like Protein - The present invention arises from the identification of an association between the gene encoding glucosyltransferase-like protein (GT) and osteoarthritis (OA). It therefore relates to diagnostic techniques for determining a patient's susceptibility to develop OA by detecting all or part of the GT gene, its precursors or products (mRNA, cDNA, genomic DNA, or protein). In particular, the invention relates to methods and materials for analysing allelic variation in the GT gene, and to the use of GT polymorphisms in the identification of an individuals' risk to develop OA. The invention is also directed to methods for identifying modulators of OA, which modulate the GT gene or its encoded protein. | 10-23-2008 |
20080261911 | Uses of diphenyl/diphenylamine carboxylic acids - The present invention demonstrates that chemical-induced degradation of Sp proteins by a specific sub-class of non-steroidal anti-inflammatory drugs inhibited cancer cell growth, angiogenesis and metastasis of cancer cells. The inhibitory effects of these compounds were demonstrated in vitro and in vivo. Hence, the results discussed herein indicate that these compounds can be used to inhibit cell growth, angiogenesis, and metastasis in cancers such as pancreatic cancer, esophageal cancer, breast cancer, prostate cancer, colon cancer, bladder cancer, and ovarian cancer. | 10-23-2008 |
20080261912 | Bispecific Antisense Oligonucleotides that Inhibit IGFBP-2 and IGFBP-5 and Methods of Using Same - Bispecific antisense oligonucleotides which consist essentially of a sequence of bases that is complementary to portions of both the gene encoding human IGFBP-2 and the gene encoding human IGFBP-5 are useful in as antisense therapeutics in the treatment of endocrine-regulated cancers. | 10-23-2008 |
20080269147 | RNA interference mediating small RNA molecules - Double-stranded RNA (dsRNA) induces sequence-specific post-transcriptional gene silencing in many organisms by a process known as RNA interference (RNAi). Using a | 10-30-2008 |
20080269148 | Modified Small Interfering Rna Molecules and Methods of Use - The present invention provides double-stranded RNA molecules that mediate RNA interference in target cells, preferably hepatic cells. The invention also provides double-stranded RNA (dsRNA) molecules that are modified to be resistant to nuclease degradation, which inactivates a virus, and more specifically, hepatitis C virus (HCV). The invention also provides a method of using these modified RNA molecules to inactivate virus in mammalian cells and a method of making modified small interfering RNAs (siRNAs) using human Dicer. The invention provides modified RNA molecules that are modified to include a dsRNA or siRNA wherein one or more of the pyrimidines in the RNA molecule are modified to include 2′-Fluorine. The invention also provides dsRNA or siRNA in which all pyrimidines are modified to include a 2′-Fluorine. The invention provides that the 2′-Fluorine dsRNA or siRNA molecule is further modified to include a two base deoxynucleotide “TT” sequence at the 3′end of the molecule. | 10-30-2008 |
20080269149 | Chimeric Vectors - The present invention is based, in part, on the discovery that parvovirus (including AAV) capsids can be engineered to incorporate small, selective regions from other parvoviruses that confer desirable properties. The inventors have discovered that in some cases as little as a single amino acid insertion or substitution from a first parvovirus (e.g., an AAV) into the capsid structure of another parvovirus (e.g., an AAV) to create a chimeric parvovirus is sufficient to confer one or more of the desirable properties of the first parvovirus to the resulting chimeric parvovirus and/or to confer a property that is not exhibited by the first parvovirus or is present to a lesser extent. | 10-30-2008 |
20080269150 | Intra-vascular kidney gene therapy with plasmid encoding BMP-7 - The present invention relates to recombinant vectors expressing the BMP-7 polypeptide in host cells and to pharmaceutical compositions comprising such recombinant vectors. The invention also encompasses methods for prevention and/or treatment of both acute and chronic renal failure in mammals, advantageously in humans, dogs and cats, by intra-vascular kidney administration of the recombinant vectors and pharmaceutical compositions of the invention. | 10-30-2008 |
20080269151 | Fusion proteins of mycobacterium tuberculosis - The present invention relates to fusion proteins containing at least two | 10-30-2008 |
20080269152 | Nucleic acid binding oligonucleotides - The present application pertains to products and methods related to the ability of short nucleotide oligomers to bind the tertiary or globular structure of nucleic acids. This application discloses libraries of short oligomers and methods for using these libraries. | 10-30-2008 |
20080269153 | INCREASED STABILITY OF A DNA FORMULATION BY INCLUDING POLY-L-GLUTAMATE - Aspects of the present invention is related to DNA vaccine formulations having enhanced stability comprising at least one DNA plasmid capable of expressing an antigen in cells of mammal and poly-L-glutamate; wherein the DNA plasmid is present in the vaccine formulation at a concentration of at least 1 mg/ml, and the poly-L-glutamate is present in the amount of weight that is 1% of the amount of DNA plasmid. Some aspects of the present invention is related to methods of stabilizing DNA plasmid in a DNA vaccine formulation. Additionally, the present invention is related to methods for introducing a DNA vaccine formulation having enhanced stability into a cell of a selected tissue in a recipient. | 10-30-2008 |
20080269154 | Novel neurotrophic factor protein and uses thereof - The present invention discloses a novel neurotrophic factor protein, MANF2 and a genetic sequence encoding the same. The molecule will be useful in the development of a range of therapeutics and diagnostics useful in the treatment, prophylaxis and/or diagnosis of MANF2 dependent conditions. The molecule of the present invention is also a useful effector of primary and central neurons, especially dopaminergic neurons at the central nervous system and growth factor genes. | 10-30-2008 |
20080269155 | REMEDY OR PREVENTIVE FOR KIDNEY DISEASE AND METHOD OF DIAGNOSING KIDNEY DISEASE - A novel agent for therapy and/or prevention of kidney diseases as well as a diagnostic method (detection method) of kidney diseases is disclosed. The agent for therapy and/or prevention of kidney diseases comprises as an effective ingredient a substance which inhibits casein kinase 2. The diagnostic method of kidney diseases according to the present invention comprises measuring activity or content of casein kinase 2, or measuring expression amount of casein kinase 2 gene in a sample separated from body. | 10-30-2008 |
20080269156 | Inhibitors of RTP801 and their use in disease treament - The present invention provides novel molecules, compositions, methods and uses for treating microvascular disorders, eye diseases respiratory conditions and hearing disorders based upon inhibition of the RTP801 gene and/or protein. | 10-30-2008 |
20080269157 | Prostate cancer-specific alterations in ERG gene expression and detection and treatment methods based on those alterations - Alterations in ERG gene expression can be observed in patients with prostate cancer. Specific ERG isoforms are associated with, or involved in, prostate cancer. Compositions comprising these isoforms provide therapeutic benefit and can be used in methods of detecting, diagnosing, prognosing, and treating prostate cancer. These compositions provide biomarkers for detecting the expression of combinations of the PSA/KLK3, PMEPA1, NKX3.1, ODC1, AMD1, and ERG genes. | 10-30-2008 |
20080269158 | E2epf Ubiquitin Carrier Protein-Von Hippel-Lindau Interaction and Uses Thereof - The present invention relates to the E2EPF UCP-VHL interaction and the uses thereof, more precisely a method for increasing or reducing VHL activity or level by regulating UCP activity or level to inhibit cancer cell proliferation or metastasis or to increase angiogenesis. The inhibition of UCP activity is accomplished by any UCP activity inhibitor selected from a group consisting of a small interfering RNA (RNAi), an antisense oligonucleotide, and a polynucleotide complementarily binding to mRNA of UCP, a peptide, a peptide mimetics and an antibody, and a low molecular compound. In the meantime, the increase of angiogenesis is accomplished by the following mechanism; UCP over-expression is induced by a gene carrier and thus endogenous VHL is reduced, leading to the stabilization of HIF- | 10-30-2008 |
20080269159 | COMPOSITIONS AND METHODS FOR REGULATION OF SMOOTH MUSCLE CELLS AND BLOOD PRESSURE - The invention encompasses a composition for regulating smooth muscle cells. In particular, the invention encompasses a vector comprising a smooth muscle promoter operably-linked to a nucleic acid encoding a calcium-activated potassium channel. | 10-30-2008 |
20080269160 | INDUCED ACTIVATION IN DENDRITIC CELLS - The present invention is directed to a composition and method which to treat diseases and to enhance a regulated immune response. More particularly, the present invention is drawn to compositions that are based on dendritic cells modified to express an inducible form of a co-stimulatory polypeptide. | 10-30-2008 |
20080274989 | Rna Interference Suppression of Neurodegenerative Diseases and Methods of Use Thereof - The present invention is directed to small interfering RNA molecules (siRNA) targeted against nucleic acid sequence that encodes huntingtin or ataxin-1, and methods of using these siRNA molecules. | 11-06-2008 |
20080274990 | Cog47 Protein and S100beta Gene Polymorphism - The invention concerns a Cog | 11-06-2008 |
20080274991 | Nucleic Acids Against Viruses, in Particular Hiv - The invention provides a nucleic acid molecule comprising a sequence that is complementary to a mutant of a genomic nucleic acid sequence of an organism capable of mutating its genome. The genomic nucleic acid sequence preferably comprises a conserved, essential region. Furthermore, the genomic nucleic acid sequence preferably comprises a coding sequence and a DNA/RNA regulatory sequence. A pharmaceutical composition and a gene delivery vehicle comprising a nucleic acid molecule of the invention is also provided, as well as a method for counteracting an organism comprising providing the organism with the nucleic acid molecule. The organism is preferably additionally provided with a nucleic acid sequence complementary to a genomic nucleic acid sequence of the organism. | 11-06-2008 |
20080274992 | RECOMBINANT MODIFIED ANKARA VIRAL HIV-1 VACCINES - The field of the present invention relates to novel recombinant MVA vectors encoding one or more HIV-1 immunogens as an HIV-1 vaccine candidate and methods of using same. | 11-06-2008 |
20080274993 | Methods and compositions for modulating vascular integrity - The invention provides methods and compositions useful for modulating vascular integrity. | 11-06-2008 |
20080274994 | CARDIAC MYOSIN LIGHT CHAIN KINASE AND METHODS OF USE - The present disclosure provides a cDNA, protein sequence, and genomic structure of the human cardiac isoform of myosin light chain kinase (cMLCK), and describes mutations in the cMLCK gene that are associated with cardiac dysfunction. Methods are provided for identifying individuals who can harbor mutations in the cMLCK gene, or carry alleles that can predisposed them to cardiac dysfunction. Disclosed also is a significant role for cMLCK in modulating cardiac contractility. The cMLCK protein is shown herein to reduce the amplitude of stretch activation and increase the tension production, a property of muscle which has heretofore had an unknown role in cardiac contraction. Moreover, the cMLCK protein is shown to be regionally distributed in the heart, thereby having differential effects on contractility and stretch activation. Methods herein are provided to exploit this effect of cMLCK, to treat individuals who have or are prone to cardiac dysfunction. In addition, methods are provided to identify agents that modulate cMLCK activity, thereby having potential therapeutic importance in the treatment of cardiac dysfunction. | 11-06-2008 |
20080274995 | Suppression of Nuclear Factor-KappaB Dependent Processes Using Oligonucleotides - Antisense oligonucleotides which hybridize with nuclear factor-κB (NF-κB) mRNA and methods of using these oligonucleotides. | 11-06-2008 |
20080274996 | RNAi Probes Targeting Cancer-Related Proteins - RNAi sequences that are useful as therapeutics in the treatment of cancers of various types, including prostate cancer, sarcomas such as osteosarcoma, renal cell carcinoma, breast cancer, bladder cancer, lung cancer, colon cancer, ovarian cancer, anaplastic large cell lymphoma and melanoma; and Alzheimer's disease. These sequences target clusterin, IGFBP-5, IGFBP-2, both IGFBP-2 and -5 simultaneously, Mitf, and B-raf. The invention further provides for the use of these RNAi sequences in the treatment of cancers of various types, including prostate cancer, sarcomas such as osteosarcoma, renal cell carcinoma, breast cancer, bladder cancer, lung cancer, colon cancer, ovarian cancer, anaplastic large cell lymphoma and melanoma; and Alzheimer's disease, and a method of treating such conditions through the administration of the RNA molecules with RNAi activity to an individual, including a human individual in need of such treatment. | 11-06-2008 |
20080280843 | Methods and kits for linking polymorphic sequences to expanded repeat mutations - Methods and kits are provided for determining which single nucleotide polymorphism (“SNP”) variant of an allele of a heterozygous patient is on the same mRNA transcript as a disease-causing mutation that is at a remote region of the gene's mRNA comprising a) an allele-specific reverse transcription reaction using an allele-specific primer, and b) analysis of the resulting cDNA product from the reverse transcription reaction at the region of the mutation to determine the presence or absence of the mutation on this allele-specific cDNA product. | 11-13-2008 |
20080280844 | METHODS AND COMPOSITIONS FOR THE DIAGNOSIS AND TREATMENT OF EWING'S SARCOMA - The present invention relates to methods and compositions for the detection and treatment of Ewing's sarcoma. In particular, the methods of detection relate to measuring in Ewing's sarcoma cells the expression of the NKX2.2 gene, as well as targets genes downstream of NKX2.2. The compositions and method of treatment for Ewing's sarcoma involve therapeutic agents that target the expression of the NKX2.2 gene or block the activity of the NKX2.2 protein. Also provided are methods of screening therapeutic agents that affect the expression of the NKX2.2 gene. | 11-13-2008 |
20080280845 | Compositions and Their Uses Directed to Ptpru - Disclosed herein are compounds, compositions and methods for modulating the expression of PTPRU in a cell, tissue or animal. Also provided are methods of active target segment validation. Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and disorders. Also provided are methods for the prevention, amelioration and/or treatment of diabetes, obesity, insulin resistance, insulin deficiency, hypercholesterolemia, hyperglycemia, hyperlipidemia, hypertriglyceridemia, hyperfattyacidemia, liver steatosis, steatohepatitis, non-alcoholic steatohepatitis, metabolic syndrome, cardiovascular disease and coronary heart disease by administration of antisense compounds targeted to PTPRU. | 11-13-2008 |
20080280846 | 2', 3'-DIDEOXYNUCLEOSIDE ANALOGUES FOR THE TREATMENT OR PREVENTION OF FLAVIVIRIDAE INFECTIONS - A method for the treatment or prevention of Flaviviridae infections, in particular, hepatitis C virus infection, in a host, and in particular, a human, is provided that includes administering an effective amount of a β-L- or β-D-2′,3′-dideoxynucleoside or a pharmaceutically acceptable salt or prodrug thereof, optionally in a pharmaceutically acceptable diluent or excipient. | 11-13-2008 |
20080280847 | PIT-1 AND VASCULAR CALCIFICATION - The present invention relates to methods and compositions comprising small interfering RNAs (siRNAs) to identify nucleotides encoding proteins involved in the co-transport of inorganic phosphate in vascular tissues. Specifically, it relates to the identification of Pit-1 and Pit-2 as key proteins involved in vascular calcification, the deposition of calcium phosphate, in blood vessels. The nucleic acids encoding specific siRNAs and vectors encoding these siRNAs are useful as tools to specifically inhibit the expression of Pit-1, Pit-2, or related proteins in various primary and stably-transformed cell lines, and as tools to explore the roles and functional relationships of these proteins involved in vascular calcification. In addition, they may be useful directly as therapeutic agents in humans delivered to sites of vascular calcification. | 11-13-2008 |
20080280848 | Structures of Active Guide Rna Molecules and Method of Selection - The present invention relates to methods and compositions for modulating RNA silencing efficiency by providing selective RISC (RNA-induced silencing complex) formation. The present invention also relates to methods for identifying nucleic acids and/or determining their structures. | 11-13-2008 |
20080287379 | Oligonucleotide Complex Compositions and Methods of Use as Gene Alteration Tools - Compositions and methods of treatments of cells are provided for altering the phenotype of a cell by administering an oligonucleotide complex to the cell, the complex having two strands and chemical modifications. | 11-20-2008 |
20080287380 | Antisense Oligonucleotides Against Cpla2, Compositions and Uses Thereof - Antisense oligonucleotides against cPLA | 11-20-2008 |
20080287381 | Injectable Agent for the Targeted Treatment of Retinal Ganglion Cells - The present invention relates to the targeted treatment of retinal ganglion cells (RGC). | 11-20-2008 |
20080287382 | Oligoribonucleotides and methods of use thereof for treatment of alopecia, acute renal failure and other diseases - The invention relates to a double-stranded compound, preferably an oligoribonucleotide, which down-regulates the expression of a human p53 gene. The invention also relates to a pharmaceutical composition comprising the compound, or a vector capable of expressing the oligoribonucleotide compound, and a pharmaceutically acceptable carrier. The present invention also contemplates a method of treating a patient suffering from alopecia or acute renal failure or other diseases comprising administering to the patient the pharmaceutical composition in a therapeutically effective dose so as to thereby treat the patient. The alopecia may be induced by chemotherapy or radiotherapy, and the patient may be suffering from cancer, in particular breast cancer. | 11-20-2008 |
20080287383 | NUCLEIC ACID COMPOUNDS FOR INHIBITING ERBB GENE EXPRESSION AND USES THEREOF - The present disclosure provides meroduplex ribonucleic acid molecules (mdRNA) capable of decreasing or silencing ERBB gene expression. An mdRNA of this disclosure comprises at least three strands that combine to form at least two non-overlapping double-stranded regions separated by a nick or gap wherein one strand is complementary to an ERBB mRNA. In addition, the meroduplex may have at least one uridine substituted with a 5-methyluridine, a nucleoside replaced with a locked nucleic acid, or optionally other modifications, and any combination thereof. Also provided are methods of decreasing expression of an ERBB gene in a cell or in a subject to treat an ERBB-related disease. | 11-20-2008 |
20080287384 | Methods of Identifying Agents Having Antiangiogenic Activity - Provided are assays and methods of identifying antiangiogenic agents including contacting an endothelial cell with a putative antiangiogenic agent and assaying for activation of Rap-1 in the endothelial cell. Also provided are methods of inhibiting angiogenesis and treating conditions associated with improper angiogenesis. Compositions comprising activators of Rap-1 and methods of activating the Rap-1 signaling pathway are also provided. Methods of inhibiting chemotaxis and angiogenesis by contacting cells with Rho inhibitors are provided. | 11-20-2008 |
20080287385 | Inhibitor oligonucleotides and their use for specific repression of a gene - A double-strand oligonucleotide including two complementary oligonucleotide sequences forming a hybrid, each including at one of their 3′ or 5′ ends, one to five unpaired nucleotides forming single-strand ends extending beyond the hybrid, one of the oligonucleotide sequences being substantially complementary to a target sequence belonging to a DNA or RNA molecule to be specifically repressed, the target sequence belonging to a DNA or RNA molecule of a gene coding an angiogenic factor. | 11-20-2008 |
20080287386 | Oligoribonucleotides and methods of use thereof for treatment of fibrotic conditions and other diseases - The invention relates to a double-stranded compound, preferably an oligoribonucleotide (siRNA), which down-regulates the expression of a human TGaseII gene at the post-transcriptional level. The invention also relates to a pharmaceutical composition comprising the compound, or a vector capable of expressing the oligoribonucleotide compound, and a pharmaceutically acceptable carrier. The present invention also contemplates a method of treating a patient suffering from a fibrotic disease such as pulmonary, kidney and liver fibrosis or ocular, scarring comprising administering to the patient the pharmaceutical composition in a therapeutically effective dose so as to thereby treat the patient. The invention also relates to treatment of fibrotic and other diseases by use of antibodies to TGaseII polypeptide. | 11-20-2008 |
20080287387 | Method for Producing Sterile Polynucleotide Based Medicaments - The present invention relates to a novel method for producing formulations comprising a polynucleotide, block copolymer and cationic surfactant. The formulations produced by the current method are suitable for use in polynucleotide based medicaments. A suitable method of production disclosed herein additionally comprises cold filtering a mixture of a polynucleotide, block copolymer and cationic surfactant, thereby sterilizing the formulation. The method of the present invention also eliminates the need for thermal cycling of the formulation, thereby reducing the time and expense required to produce large quantities of a formulation during commercial manufacturing. The present invention also relates to novel cationic lipids. | 11-20-2008 |
20080287388 | Human G-Protein Coupled Receptor - A human G-protein coupled receptor polypeptide and DNA (RNA) encoding such polypeptide and a procedure for producing such polypeptide by recombinant techniques is disclosed. Also disclosed are methods for utilizing such polypeptide for identifying antagonists and agonists to such polypeptide. Antagonists and agonists may be used therapeutically to inhibit or stimulate the G-protein coupled receptor. Also disclosed are assays for detecting mutations in the nucleic acid sequence encoding the G-protein coupled receptor. | 11-20-2008 |
20080287389 | Nucleoside analogs in combination therapy of herpes simplex infections - A pharmaceutical product comprising a nucleoside analogue active against herpes simplex virus, such as acyclovir/valaciclovir or peniclovir/famciclovir, and an immunosuppressant, as a combined preparation for simultaneous, separate or sequential use in the treatment and/or prevention of herpes simplex virus infections. | 11-20-2008 |
20080293652 | Combination of Ad-P53 and Chemotherapy for the Treatment of Tumours - The present invention relates to the use of p53 gene therapy to treat recurrent cancers in combination with a radio- or chemotherapy. Patients with recurring cancers are treated with a p53 expression construct followed by subsequent radio- or chemotherapy treatment. Viral and non-viral delivery systems, as well as various radio- and chemotherapy regimens are disclosed. | 11-27-2008 |
20080293653 | Method of treating autoimmune diseases - The invention features a method of inducing an apoptosis-resistant cell to undergo apoptosis, in which the cell is associated with an autoimmune disease such as multiple sclerosis. The method involves sensitizing the cell to apoptosis stimuli by treating the cell with an IAP antisense oligonucleotide, so that the cell undergoes apoptosis at a site of autoimmune disease. | 11-27-2008 |
20080293654 | Therapeutic methods using Smads - Methods of inducing the expression of a Smad in a cell or tissue comprising the step of contacting the cell or tissue capable of expressing the Smad with a bone morphogenic protein are provided. Methods of inducing tissue formation and repairing a tissue defect or regenerating tissue, at a target locus in a mammal comprising the step of administering to the target locus a Smad are also provided. | 11-27-2008 |
20080293655 | Novel tandem siRNAS - The present invention provides novel molecules, compositions, methods and uses for treating microvascular disorders, eye diseases and respiratory conditions based upon inhibition of two or more target genes. | 11-27-2008 |
20080293656 | PROCESSING NUCLEIC ACID - The present invention relates to a method of processing nucleic acid. More particularly, it relates to a method of purifying extra-chromosomal DNA by removing cell debris and/or RNA from a process stream comprising extra chromosomal DNA and a precipitate resulting from preceding cell lysis and/or precipitation reactions. It also relates to nucleic acid, particularly extra chromosomal DNA, purified by a method of the invention; a pharmaceutical composition comprising or consisting of the same and apparatus for said method. | 11-27-2008 |
20080293657 | MODULATION OF THE EXPRESSION OF STAT-1-DEPENDENT GENES - The present invention relates to decoy-oligonucleotides and antisense-oligonucleotides having the nucleic acid sequence according to SEQ ID NO: 1 to 43 as well as the use thereof as medicaments. | 11-27-2008 |
20080293658 | ANTISENSE OLIGONUCLEOTIDES CAPABLE OF INHIBITING THE FORMATION OF CAPILLARY TUBES BY ENDOTHELIAL CELLS - A pharmaceutical composition that blocks angiogenesis comprising as active agent at least one substance selected from the group consisting of (i) a nucleic acid molecule of a gene coding for protein IRS-1, a complementary sequence or a fragment thereof and (ii) a molecule which inhibits expression of a nucleic acid molecule according to (i). | 11-27-2008 |
20080293659 | FC gamma RIIA-specific nucleic acid interference - The present invention provides methods and compositions for attenuating expression of FcγRIIA. In general, the described methodology involves the use of RNAi constructs that are targeted to a FcγRIIA mRNA sequence. | 11-27-2008 |
20080293660 | CHEMICALLY-DEFINED NON-POLYMERIC VALENCY PLATFORM MOLECULES AND CONJUGATES THEREOF - Chemically-defined, non-polymeric valency platform molecules and conjugates comprising chemically-defined valency platform molecules and biological or chemical molecules including polynucleotide duplexes of at least 20 base pairs that have significant binding activity for human lupus anti-dsDNA autoantibodies. | 11-27-2008 |
20080293661 | METHOD FOR TREATING CHRONIC LYMPHOID LEUKEMIA - Embodiments of the invention relates to the treatment of chronic lymphoid leukemia. The invention provides treatment, diagnostic, and drug discovery strategies for chronic lymphoid leukemia. Reconstitution of RhoH expression in vitro inhibits neoplastic proliferation and the process of trans-endothelial migration that underlies much of the pathology of CCL. RhoH reconstitution also limits malignant progression in vivo. Therefore, RhoH reconstitution represents a new therapeutic strategy in the fight against chronic lymphoid leukemia. | 11-27-2008 |
20080293662 | RNAi MODULATION OF THE BCR-ABL FUSION GENE AND USES THEREOF - The invention relates to compositions and methods for modulating the expression of Bcr-Abl, and more particularly to the down-regulation of Bcr-Abl mRNA and Bcr-Abl protein levels by oligonucleotides via RNA interference, e.g., chemically modified oligonucleotides. | 11-27-2008 |
20080293663 | CELLULAR GENES REGULATED BY HIV-1 INFECTION AND METHODS OF USE THEREOF - This invention provides cellular gene products which have anti-apoptotic activity in HIV-1 infected cells and provides agents for the inhibition of the cellular gene products. | 11-27-2008 |
20080300201 | Cell Cycle Arrest and Apoptosis - The HIV-1 accessory gene vpr encodes a conserved 96-amino acid protein that is necessary and sufficient for the HIV-1-induced block of cellular proliferation and induction of apoptosis. Expression of vpr in CD4 | 12-04-2008 |
20080300202 | SUBTRACTIVE TRANSGENICS - Described herein are methods for predictable, highly selective expression of a transgene in a human or non-human animal. The methods comprise subtractive transgenics, wherein the expression pattern of one selective promoter is subtracted from the expression pattern of a second selective promoter. Provided are non-human transgenic animals exhibiting a highly selective expression pattern and methods of producing such animals. Further provided are methods of selective expression of a transgene in an animal, including a human, by administration of viral vectors. | 12-04-2008 |
20080300203 | Stable Quantitation and Detection of Immune Response Levels with Non-Zero Background Peptides - The invention relates to a kit comprising MHC Class I and Class II HLA-coated beads containing specific antigenic peptides for binding to antigen-specific T cells and the appropriate negative control peptides. Also provided are methods for making the coated beads and methods for use. The application of these beads go to the stimulation of peripheral blood cell populations and in vitro-stimulated culture for the elicitation of functional activities such as cell activation and signaling, cytokine secretion, proliferation and cytotoxicity activity. | 12-04-2008 |
20080300204 | Alpha-Synuclein Antibodies and Methods Related Thereto - Disclosed are antibodies specific for alpha-synuclein conformers and methods related thereto. For example, disclosed are methods of diagnosing a neurodegenerative monitoring a neurodegenerative disease treatment using the disclosed antibodies. Assays, kits, and solid supports related to alpha-synuclein and antibodies specific for alpha-synuclein are also disclosed. | 12-04-2008 |
20080300205 | Epigenetic mechanisms re-establish access to long-term memory after neuronal loss - The invention relates to methods and products for enhancing and improving recovery of lost memories. In particular the methods are accomplished through the increase of histone acetylation. | 12-04-2008 |
20080300206 | Alpha-Synuclein Kinase - The invention provides agents and methods for treatment of diseases associated with Lewy body diseases (LBDs) in the brain of a patient. Preferred agents include inhibitors of PLK2 kinase. | 12-04-2008 |
20080300207 | PROTEIN PRODUCTION - The invention concerns the field of protein production and cell culture technology. CERT is identified as a novel in vivo PKD substrate. Phosphorylation on serine 132 by PKD decreases the affinity of CERT towards its lipid target phosphatidylinositol 4-phosphate at Golgi membranes and reduces ceramide transfer activity, identifying PKD as a regulator of lipid homeostasis. The present invention shows that CERT in turn is critical for PKD activation and PKD dependent protein cargo transport to the plasma membrane. The interdependence of PKD and CERT is thus a key to the maintenance of Golgi membrane integrity and secretory transport. | 12-04-2008 |
20080300208 | Isociatrate dehydrogenase and uses therof - The present invention discloses uses for the IDH gene and/or polypeptide and/or modulators thereof in the diagnosis and treatment of apoptosis-related diseases. | 12-04-2008 |
20080300209 | GENE EXPRESSION AND PAIN - The present invention relates to double-stranded oligonucleotides, pharmaceutical compositions thereof, and use of such double-stranded oligonucleotides and pharmaceutical compositions to modulate nociceptive signaling in a cell or prevent and/or treat pain in a patient. | 12-04-2008 |
20080300210 | Method of Controlling Insects and Virus Transmission - The present invention provides methods and compositions for controlling insects and virus transmission, including a genetic construct for inhibiting virus transmission by an arthropod, a transgenic plant, plant cell or plant tissue, a method of preventing transmission of an arthropod-dependent viral plant disease, a method of delivering an active toxic fragment of a | 12-04-2008 |
20080300211 | MICRORNA INHIBITION FOR THE TREATMENT OF INFLAMMATION AND MYELOPROLIFERATIVE DISORDERS - The present disclosure relates to the finding that microRNA-155 plays a role in inflammation, hematopoiesis and myeloproliferation, and that dysregulation of microRNA-155 expression is associated with particular myeloproliferative disorders. Disclosed herein are methods and compositions for diagnosing and treating disorders, including inflammation and myeloproliferation, modulating the levels of expression of one or more genes selected from the group consisting of Cutl1, Arnt1, Picalm, Jarid2, PU.1, Csf1r, HIF1α, Sla, Cepbβ, and Bach1, and the like. | 12-04-2008 |
20080300212 | TREATMENT AND PREVENTION OF HYPERPROLIFERATIVE CONDITIONS IN HUMANS AND ANTISENSE OLIGONUCLEOTIDE INHIBITION OF HUMAN REPLICATION-INITIATION PROTEINS - Antisense oligonucleotides that inhibit expression of human replication- initiation protein as well as methods of preventing or treating hyperproliferative conditions using said oligonucleotides are disclosed. One aspect provides an antisense oligonucleotide that inhibits the expression of human replication-initiation protein and has a sequence complementary to at least a portion of a target sequence encoding a human replication-initiation gene. By administering a therapeutically effective amount of an antisense oligonucleotide or by contacting the hyperproliferating cells with an effective amount of one or more antisense oligonucleotides, expression of replication-initiation protein is inhibited. Methods of screening and testing active antisense oligonucleotides for their ability to inhibit gene expression are also disclosed. | 12-04-2008 |
20080306014 | Agents, compositions and methods for treating pathologies in which regulating an ache-associated biological pathway is beneficial - The present invention provides agents which are capable of regulating the function of a micro-RNA component which can be used to regulate an AChE-associated biological pathway. In addition, the present invention provides methods and pharmaceutical compositions for the treatment of various pathologies related to AChE-associated biological pathways such as apoptosis, aberrant cholinergic signaling, abnormal hematopoietic proliferation and/or differentiation, cellular stress, exposure to inflammatory response-inducing agents, and/or exposure to organophosphates or other AChE inhibitors. | 12-11-2008 |
20080306015 | siRNA targeting proprotein convertase subtilisin/kexin type 9 (PCSK9) - Efficient sequence specific gene silencing is possible through the use of siRNA technology. By selecting particular siRNAs by rational design, one can maximize the generation of an effective gene silencing reagent, as well as methods for silencing genes. Methods, compositions, and kits generated through rational design of siRNAs are disclosed including those directed to PCSK9. | 12-11-2008 |
20080306016 | Nucleic Acid Functionalized Nanoparticles for Therapeutic Applications - Materials and Methods for modulating cellular uptake of functionalized nanoparticles are provided. Also provided are materials and methods for modulating the effectiveness of a therapeutic agent with a functionalized nanoparticle. | 12-11-2008 |
20080306017 | Microrna-Based Methods and Compositions for the Diagnosis, Prognosis and Treatment of Lung Cancer - The present invention provides novel methods and compositions for the diagnosis, prognosis and treatment of lung cancer. The invention also provide methods of identifying anti-lung cancer agents. | 12-11-2008 |
20080306018 | Micro-Rna Expression Abnormalities of Pancreatic, Endocrine and Acinar Tumors - The present invention provides novel methods and compositions for the diagnosis, prognosis and treatment of pancreatic cancer. The invention also provides methods of identifying anti-pancreatic cancer agent. | 12-11-2008 |
20080312169 | Cosmetic use of D-ribose - D-ribose is incorporated into a cosmetic composition and applied to the skin to reduce the length and area of wrinkles and to improve the complexion of the skin. | 12-18-2008 |
20080312170 | Fibrinolysin of Agkistrodon Acutus Venom and its Usage - The present invention relates to a fibrinolysin gene of Agkistrodon acutus, a vector containing the said gene and the host cell which transformed by the vector. The fibrinolysin could be used in treating diseases caused by thrombus. The fibrinolysin FII is purified from the crude venom of Agkistrodon acutus, and the corresponding gene is cloned. It is recommended to produce the fibrionolysin by the yeast expression system. The activity of the fibrionlysin is also determined. The advantages of this invention are that the expression level and activity of the fibrinolysin are both high and the quality of the fibrinolysin is stable. | 12-18-2008 |
20080312171 | Tetracycline-Dependent Regulation of Rna Interference - The present invention relates to a tetracycline dependent gene regulatory system or composition controlling the expression of a target gene in a cell and to methods using said system or composition. The present invention more specifically discloses compositions, vectors and methods allowing tetracycline-controlled expression of short-hairpin RNAs (shRNAs), and demonstrates inducible, reversible and stable RNA interference (RNAi) using the same in a cell. The invention can be used to cause reversible control of the expression of any gene and may therefore find applications in the fields of mammalian, in particular human, genetics and molecular therapeutics, in cell and gene therapy, research as well as in genetic studies using transgenic animals. | 12-18-2008 |
20080312172 | Anti-IL-6 Antibodies, Compositions, Methods and Uses - The present invention relates to at least one novel chimeric, humanized or CDR-grafted anti-IL-6 antibodies derived from the murine CLB-8 antibody, including isolated nucleic acids that encode at least one such anti-IL-6 antibody, vectors, host cells, transgenic animals or plants, and methods of making and using thereof, including therapeutic compositions, methods and devices. | 12-18-2008 |
20080312173 | Treatment of HSV-related pathologies using plasmids that make ssDNA - A composition for treatment of HSV-related pathologies including an expression vector for altering expression of a target sequence in an HSV-infected cell by production of single-stranded cDNA (ssDNA) in the cell in vivo suspended for topical application to an affected site in a suitable delivery vehicle. The expression vector is comprised of a cassette comprising a sequence of interest, an inverted tandem repeat, and a primer binding site 3′ to the inverted tandem repeat, and a reverse transcriptase/RNAse H coding gene, and is transfected into the infected cells for inhibition of HSV replication. The resulting ssDNA binds to the target sequence to alter expression of the target sequence for such purposes as gene activation or inactivation using duplex or triplex binding of nucleic acids, site-directed mutagenesis, interruption of cellular function by binding to specific cellular proteins, or interfering with RNA splicing functions. | 12-18-2008 |
20080312174 | WATER SOLUBLE CROSSLINKED POLYMERS - Compositions for siRNA delivery are described which include water soluble degradable crosslinked cationic polymers having a water soluble polyethylene glycol component, a cationic polyethyleneimine component and a degradable unit component. The composition may be used to deliver siRNA to cells, particularly cancer cells. The composition may be applied to a solid surface such as a multiwell plate so that the delivery of siRNA may be carried out on the solid surface. | 12-18-2008 |
20080312175 | METHODS AND COMPOSITIONS FOR REGULATING HDAC4 ACTIVITY - The present invention provides methods and compositions for modulating HDAC4 activity and modulating the activity of proteins downstream of HDAC4 in the muscle transcriptional pathway in a cell by modulating HDAC4 activity. Further provided are methods and compositions for treating muscle atrophy and/or inflammation by inhibiting HDAC4 activity. | 12-18-2008 |
20080312176 | GENE SILENCING - Methods are disclosed for gene silencing (e.g. post transcriptional gene silencing) in an organism using small RNA molecules. | 12-18-2008 |
20080312177 | SERCA2 THERAPEUTIC COMPOSITIONS AND METHODS OF USE - The present invention provides methods for treating urinary incontinence, urethral sphincter dysfunction and/or bladder dysfunction by delivering a therapeutic adeno-associated virus (AAV)-SERCA2 composition to a subject in need thereof. | 12-18-2008 |
20080312178 | Human G-Protein Receptor HGBER32 - Human G-protein coupled receptor polypeptides and DNA (RNA) encoding such polypeptides and a procedure for producing such polypeptides by recombinant techniques is disclosed. Also disclosed were methods for utilizing such polypeptides for identifying antagonists and agonists to such polypeptides and methods of using the agonists and antagonists therapeutically to treat conditions related to the underexpression and overexpression of the G-protein coupled receptor polypeptides, respectively. Also disclosed are diagnostic methods for detecting a mutation in the G-protein coupled receptor nucleic acid sequences and an altered level of the soluble form of the receptors. | 12-18-2008 |
20080312179 | High level expression of recombinant human erythropoietin having a modified 5'-UTR - The present invention provides an expression construct capable of producing high levels of erythropoietin in mammalian cells. More particularly, the expression construct includes an erythropoietin coding region fused to a unique 5′-UTR sequence and a truncated 3′-UTR. The present invention also provides methods of synthesizing large amounts of erythropoietin and in increasing serum erythropoietin level in individuals in need thereof. | 12-18-2008 |
20080318882 | Method of Delivery of Nucleic Acids to Peripheral Neurons - The invention provides for methods for delivering a nucleic acid into a peripheral neuron by identifying a target neuron in a dorsal root ganglion and intrathecally delivering a vector comprising the nucleic acid to the dorsal root ganglion neuron. The nucleic acid may encode a neurotrophic factor that may be used to treat a peripheral neuropathy or, in conjunction with a nerve guide conduit, to treat a transected peripheral nerve. | 12-25-2008 |
20080318883 | Anti-aging supplement - An anti-aging supplement is disclosed having effective amounts of β1,3D glucan, deoxyribonucleic acid, and body's hyaluronan-yielding row material composed of at least one amino sugar selected from a group consisting of N-acetylglucosamine and glucosamine salts. | 12-25-2008 |
20080318884 | Methods for Altering Gene Expression and Methods of Treatment Utilizing Same - The present disclosure describes methods for altering the expression of a target gene comprising a rare cluster of codons, including, but not limited to, trinucleotide repeats. The method utilizes, in part, on amino acid deprivation or the limiting of specific charged tRNAs. The methods for altering target gene expression may be used in treatment methods to treat diseases in a subject organism in need of such treatment. Such methods for altering target gene expression have not been heretofore recognized in the art. Exemplary diseases that may be treated using the methods of the present disclosure include any disease where altering the expression of the target gene would provide treatment. Such diseases include all forms of cancer, ageing, infectious disease, metabolic disorders, inflammation, neurological disorders, diabetes, psychiatric disorders and diseases associated with trinucleotide repeats. | 12-25-2008 |
20080318885 | Method for Modulating Responsiveness to Steroids - The present invention makes it possible to enhance steroid efficacy in a steroid refractory patient afflicted with an inflammatory condition not responding or responding poorly or inadequately to anti-inflammatory treatment, by administering an effective amount of an oligonucleotide having the sequence | 12-25-2008 |
20080318886 | Methods of Increasing Cancer Sensitivity to Chemotherapeutic Agents Using Chimeric ISF35 - A method of treating cancer by administering ISF35 or analogous constructs. The treatment can allow an increased sensitivity to treatment with a chemotherapeutic agent. | 12-25-2008 |
20080318887 | Antiproliferative activity of G-rich oligonucleotides and method of using same to bind to nucleolin - Compositions and methods for modulating tumor proliferation in an individual are provided. The methods employ nucleolin-binding agents, such as aptamers. The aptamers of the present invention can be used to modulate the proliferation of malignant, dysplastic, hyperproliferative, and/or metastatic cells through interference with molecular interactions and functions of nucleolin in the tumor cell. | 12-25-2008 |
20080318888 | Antiproliferative activity of g-rich oligonucleotides and method of using same to bind to nucleolin - Compositions and methods for modulating tumor proliferation in an individual are provided. The methods employ nucleolin-binding agents, such as aptamers. The aptamers of the present invention can be used to modulate the proliferation of malignant, dysplastic, hyperproliferative, and/or metastatic cells through interference with molecular interactions and functions of nucleolin in the tumor cell. | 12-25-2008 |
20080318889 | Antiproliferative activity of G-rich oligonucleotides and method of using same to bind to nucleolin - Compositions and methods for modulating tumor proliferation in an individual are provided. The methods employ nucleolin-binding agents, such as aptamers. The aptamers of the present invention can be used to modulate the proliferation of malignant, dysplastic, hyperproliferative, and/or metastatic cells through interference with molecular interactions and functions of nucleolin in the tumor cell. | 12-25-2008 |
20080318890 | Antiproliferative activity of G-rich oligonucleotides and method of using same to bind to nucleolin - Compositions and methods for modulating tumor proliferation in an individual are provided. The methods employ nucleolin-binding agents, such as aptamers. The aptamers of the present invention can be used to modulate the proliferation of malignant, dysplastic, hyperproliferative, and/or metastatic cells through interference with molecular interactions and functions of nucleolin in the tumor cell. | 12-25-2008 |
20080318891 | Antisense oligonucleotides against thymidylate synthase - Antisense oligonucleotides targeted to sequences in thymidylate synthase (TS) mRNA. In particular the invention relates to antisense oligonucleotides targeted to sequences in the 3′ end of TS mRNA, which are both cytostatic on their own when administered to human tumour cell lines, and which also enhance the toxicity of anticancer drugs. The invention further relates to a combination product comprising an antisense oligonucleotide in combination with an anticancer agent such as Tomudex or pemetrexed and to the use of such a combination product in the treatment of cancer. | 12-25-2008 |
20080318892 | METHODS AND FORMULATIONS FOR PROTECTING CELLS, AND FOR TREATING DISEASES AND CONDITIONS BY OPTIMIZING THE INTRACELLULAR CONCENTRATION OF NAD - Pharmaceutical and cosmetic formulations and methods for optimizing the intracellular concentrations of NAD are provided. The present methods and compounds relate to the use of PBEF, PRPP and various forms of nicotinamide, individually or in combination, for therapeutic, cyto-protective, cosmetic and anti-aging purposes. PBEF, PRPP and nicotinamide, individually or in combination, as administered according to the invention, increase the metabolic fitness, health and performance of the cell, and thereby increase the cell's level of health during its lifecycle. By way of the present formulations and methods, optimizing the intracellular concentration of NAD+ facilitates a balance among the numerous intracellular interactions of NAD+, and its related pathways, such that the health of the cell and its resistance to stress and trauma are increased. This increased robustness attendant to the invention also facilitates the delay of apoptosis. | 12-25-2008 |
20080318893 | Blockade of Calcium Channels - Knock-down of L-type calcium channel beta subunit (LTCCβ) attenuates the hypertrophic response both in vitro and in vivo without compromising systolic performance. Knock-down can be accomplished by administration of a vector encoding a short hairpin RNA which specifically modulates expression of LTCCβ. Suppression of the LTCCβ expression represents a therapeutic modality for cardiac hypertrophy. | 12-25-2008 |
20080318894 | RNA ANTAGONIST COMPOUNDS FOR THE MODULATION OF HER3 - The invention relates to oligomer compounds (oligomers), which target HER3 mRNA in a cell, leading to reduced expression of HER3 and/or HER2 and/or EGFR. Reduction of HER3 and/or HER2 and/or EGFR expression is beneficial for a range of medical disorders, such hyperproliferative disorders (e.g., cancer). The invention provides therapeutic compositions comprising oligomers and methods for modulating the expression of HER3 and/or HER2 and/or EGFR using said oligomers, including methods of treatment. | 12-25-2008 |
20080318895 | INTRANASAL DELIVERY OF NUCLEIC ACID MOLECULES - Aerosol delivery of nucleic acids to the lungs using viral vectors, polymers, surfactants, or excipients has been described. Compositions for intranasal administration are described that contain nucleic acids without viral or plasmid vectors and with little to no polymers, surfactants, or excipients. In one embodiment, the composition for intranasal delivery consists essentially of at least one nucleic acid and an aqueous solution. Suitable nucleic acids for intranasal delivery include, but are not limited to, dsDNA, dsRNA, ssDNA, ssRNA, short interfering RNA, micro-RNA, and antisense RNA Methods for treatment, diagnosis, or prevention of at least one symptom or manifestation of a lung disease are also described consisting of administration by intranasal delivery an effective amount of a composition containing a nucleic acid. The composition may be formulated as a liquid or aerosol or other acceptable formulation for intranasal administration. | 12-25-2008 |
20080318896 | Methods and Compositions for Controlling of Efficacy of RNA Silencing - Based at least in part on an understanding of the mechanisms by which small RNAs (e.g., naturally-occurring miRNAs) mediate RNA silencing in plants, rules have been established for determining, for example, the degree of complementarity required between an RNAi-mediating agent and its target, i.e., whether mismatches are tolerated, the number of mismatches tolerated, the effect of the position of the mismatches, etc. Such rules are useful, in particular, in the design of improved RNAi-mediating agents which allow for more exact control of the efficacy of RNA silencing. | 12-25-2008 |
20090005329 | NUCLEIC ACID BASED LADDER COPOLYMERS - The present invention relates to a copolymer termed a ladder copolymer because it has two backbones that serve as legs/sides of a ladder structure. These two backbones, one of which is a nucleic acid or nucleic acid-like polymer, are linked together as the legs/sides of a ladder are linked together by the rungs. | 01-01-2009 |
20090005330 | Methods and Compositions to Inhibit P2x7 Receptor Expression - Methods and compositions for the downregulation of P2X7 receptor expression or activity are disclosed. Preferred compositions comprise siNA. The methods and compositions are useful in the treatment of diseases characterised by increased 112X7 receptor activity, such as neuronal degeneration, Alzheimer's disease, inflammatory diseases, and some cancers. | 01-01-2009 |
20090005331 | AChE antisense oligonucleotide as an anti-inflammatory agent - Disclosed is a novel use for AChE antisense oligonucleotides as anti-inflammatory agents, wherein said oligonucleotides are preferably as denoted by SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:7. Methods of treatment of inflammatory conditions, as well as fever, and particularly inflammation-associated neuropathies such as Guillain-Barré Syndrome, are described. | 01-01-2009 |
20090005332 | Compositions and Methods for Modulating Gene Expression Using Self-Protected Oligonucleotides - The present invention is directed to novel nucleic acid molecules which include a region complementary to a target gene and one or more self-complementary regions, and the use of such nucleic acid molecules and compositions comprising the same to modulate gene expression and treat a variety of diseases and infections. | 01-01-2009 |
20090005333 | REDUCING CULLING IN HERD ANIMALS GROWTH HORMONE RELEASING HORMONE (GHRH) - One aspect of the current invention is a method of decreasing an involuntary cull rate in farm animals, wherein the involuntary cull results from infection, disease, morbidity, or mortality. Additionally, milk production, animal welfare, and body condition scores are improved by utilizing methodology that administers the isolated nucleic acid expression construct encoding a GHRH or functional biological equivalent to an animal through a parenteral route of administration. Following a single dose of nucleic acid expression vector, animals are healthier and effects are demonstrated long term without additional administration(s) of the expression construct. | 01-01-2009 |
20090005334 | Nucleic acid derivatives - A compound which comprises a backbone having a plurality of chiral carbon atoms, the backbone bearing a plurality of ligands each being individually bound to a chiral carbon atom of the plurality of chiral carbon atoms, the ligands including one or more pair(s) of adjacent ligands each containing a moiety selected from the group consisting of a naturally occurring nucleobase and a nucleobase binding group, wherein moieties of the one or more pair(s) are directly linked to one another via a linker chain; building blocks for synthesizing the compound; and uses of the compound, particularly in antisense therapy. | 01-01-2009 |
20090005335 | COMPOUNDS FOR THE MODULATION OF BETA-CATENIN EXPRESSION - The invention relates to oligomer compounds (oligomers), which target beta-catenin mRNA in a cell, leading to reduced expression of beta-catenin. Reduction of beta-catenin expression is beneficial for a range of medical disorders, such as hyperproliferative disorders, such as cancer. The invention provides therapeutic compositions comprising oligomers and methods for modulating the expression of beta-catenin using said oligomers, including methods of treatment. | 01-01-2009 |
20090005336 | Use of the microRNA miR-1 for the treatment, prevention, and diagnosis of cardiac conditions - Among >300 miRNAs known to date, miR-1 is considered muscle-specific. Here we show that that miR-1 overexpressed in individuals with coronary artery disease, and when overexpressed, it exacerbated arrhythmogenesis in both infarcted and normal hearts of rats whereas elimination of miR-1 by its antisense inhibitor relieved it. MiR-1 rendered slowed conduction and depolarized membrane by post-transcriptionally repressing KCNJ2 and GJA1 genes, likely accounting for its arrhythmogenic potential. Thus, miR-1 may have important pathophysiological functions in heart, being a novel antiarrhythmic target useful in the treatment and prevention of various cardiac pathologies. | 01-01-2009 |
20090005337 | Pde11a Mutations in Adrenal Disease - The invention provides previously uncharacterized variants of PDE11A that are correlated with a newly discovered form of Cushing Syndrome that presents at a young age. The invention also provides methods useful to research, screen for, treat, or prevent diagnose the disease using the PDE11A variants, as well as other methods relating thereto. | 01-01-2009 |
20090012016 | Short Interfering Rna and Micro-Rna Compounds and Methods of Designing, Making, and Using the Same - Methods of identifying, designing and synthesizing uniquely targeting siRNA nucleotide sequences for a target mRNA sequence of a target species are disclosed. Methods of identifying, designing and synthesizing miRNA nucleotide sequences that does not function as a siRNA nucleotide sequence for mRNA of a target species are disclosed. Method of inhibiting expression of a target mRNA molecule are disclosed sequence. siRNA molecules including uniquely targeting siRNA molecules and RISCs comprising the same are disclosed. miRNA molecules that do not function as siRNA nucleotide sequences for mRNA of a target species are disclosed. | 01-08-2009 |
20090012017 | Polypeptide Complex that Regulates Cell Cycle and Anergy - An active ubiquitin E3 ligase, GRAIL, is crucial in the induction of anergy in cells of the immune system, and in the regulation of cellular proliferation. GRAIL is shown to associate with, and be regulated by Otubain isoforms, including OTUBAIN-1 (DOG, the Destabilizer of GRAIL) and an alternative reading frame splice variant of OTUBAIN-1 (SOG, the Stabilizer of GRAIL). These proteins play opposing roles in the regulation of GRAIL auto-ubiquitination and consequently on its ability to induce anergy and regulate cellular proliferation. DOG serves as an adaptor protein, recruiting the DUB USP8. One major substrate for USP8 is the Ras exchange factor Ras-GRF1, and this protein can be found in a complex with USP8 and GRAIL, which complex is ubiquitinated by GRAIL. | 01-08-2009 |
20090012018 | Inhibition of pancretic cancer cell growth - The present invention relates to compositions and methods for inhibition of signal transduction pathways in cancer cells. In particular, the present invention provides methods and compositions comprising Wnt and Hedgehog pathway inhibitors for reducing proliferation of adenocarcinoma cells. | 01-08-2009 |
20090012019 | Methods and Compositions Related to TR4 - Disclosed are compositions and methods related to TR4 and aging. | 01-08-2009 |
20090012020 | Inhibiting formation of atherosclerotic lesions - The invention features a method of inhibiting formation of atherosclerotic lesions by administering to a mammal, e.g., a human patient who has been identified as suffering from or at risk of developing atherosclerosis, a compound that reduces expression or activity of AFABP. | 01-08-2009 |
20090012021 | Delivery of Sirna by Neutral Lipid Compositions - The present invention relates to the fields of molecular biology and drug delivery. In certain embodiments, the present invention provides methods for the delivery of a siNA (e.g., a siRNA) to a cell via a neutral (non-charged) liposome. These methods may be used to treat a disease, such as cancer. | 01-08-2009 |
20090012022 | Hybrid Interfering Rna - The invention relates to a hybrid interfering RNA molecule comprising a duplex RNA and a single stranded DNA molecule and its use in the ablation of mRNA and in polymerase chain reactions. | 01-08-2009 |
20090012023 | DECOY-OLIGNUCLEOTIDE INHIBITION OF CD40-EXPRESSION - The present invention relates to decoy oligonucleotides with the nucleic acid sequence according to SEQ ID NO: 1 to 36 and their use as pharmaceutical agents. | 01-08-2009 |
20090012024 | Stem Cell Markers - We disclose gene markers of stem cells, typically prostate stem cells, and in particular cancer stem cells, for example prostate cancer stem cells; therapeutic agents and diagnostic assays based on said stem cell genes; and including screening assays to identify therapeutic agents. | 01-08-2009 |
20090012025 | Methods and Compositions for Treatment of Sepsis - Methods of treatment of sepsis are disclosed. These methods comprise administering to a subject a composition comprising at least one siRNA directed against at least one gene encoding a pro-apoptotic polypeptide. The pro-apoptotic polypeptide, in some aspects, can be other than Fas or caspase-8. In some embodiments, an siRNA can be directed against a pro-apoptotic component of the mitochondrial pathway, such as a pro-apoptotic bcl-2 protein. In some aspects, an siRNA can be directed against a BH3-only bcl-2 protein, while in other aspects, siRNAs can be directed against multi BH domain Bcl-2 family members such as bax and bak. In some embodiments, an siRNA can be directed against a death receptor pathway molecule such as FADD. In various configurations, a composition can also comprise a cationic lipid such as DOTAP, or nanoparticles comprising a cyclodextrin-containing polycation and a polymer such as a poly(ethylene glycol). | 01-08-2009 |
20090012026 | Association Between the Tdoa Gene and Osteoarthritis - The present invention arises from the identification of an association between the TDOA gene and osteoarthritis (OA). It therefore relates to diagnostic techniques for determining a patient's susceptibility to develop OA by detecting all or part of the TDOA gene, its precursors or products (mRNA, cDNA, genomic DNA, or protein). In particular, the invention relates to methods and materials for analysing allelic variation in the TDOA gene, and to the use of TDOA polymorphisms in the identification of an individuals' risk to develop OA. The TDOA protein has been found to bind to α-paxillin, a protein involved in integrin signal transduction which itself is a process with strong links to OA. The invention is thus also directed to methods for identifying modulators of OA, which modulate the TDOA gene or interfere with TDOA:α-paxillin binding. | 01-08-2009 |
20090012027 | BIODEGRADABLE POLYPHOSPHORAMIDATES FOR CONTROLLED RELEASE OF BIOACTIVE SUBSTANCES - The present invention is directed to a series of new polycationic biodegradable polyphosphoramidates. Process for making the polymers, compositions containing these polymers and bioactive ligands to enhance the cellular uptake ad intracellular trafficking, articles and methods for delivery of drugs and genes using these polymers are described. A gene delivery system based on these polymers is prepared by complex coacervation of nucleic acid (DNA or RNA) with polymers. Targeting ligands and molecules that could facilitate gene transfer can be conjugated to polymers to achieve selective and enhanced gene delivery. The current invention also provides a complex composition with buffering capacity. | 01-08-2009 |
20090012028 | Polyglutamic acids functionalized by cationic groups and hydrophobic groups and applications thereof, in particular therapeutic applications thereof - The present invention relates to novel biodegradable materials based on modified polyamino acids that are useful in particular in the vectorization of active principle(s) (APs). The invention is also directed to novel pharmaceutical, cosmetic, health-food or plant-protection compositions based on these polyamino acids. | 01-08-2009 |
20090012029 | Cyst Nematode Resistant Transgenic Plants - Compositions and methods for providing cyst nematode resistance are provided. One aspect provides transgenic plants or cells comprising an inhibitory nucleic acid specific for one or more cyst nematode esophageal gland cell polypeptides. Other aspects provide transgenic plants or cells resistant to at least two different cyst nematode species. | 01-08-2009 |
20090012030 | RNAi-MEDIATED INHIBITIN OF HTRA1 FOR TREATMENT OF MACULAR DEGENERATION - RNA interference is provided for inhibition of HTRA1 mRNA expression for treating patients with an HTRA1-mediated ocular disorder. In particular, methods are provided for treating age-related macular degeneration (AMD) and using interfering RNA molecules that attenuate expression of HTRA1 in patients having AMD or at risk of developing AMD. | 01-08-2009 |
20090012031 | EZH2 Cancer Markers - The present invention relates to therapeutic targets for cancer. In particular, the present invention relates to small molecules and nucleic acids that target EZH2 expression in prostate cancer. | 01-08-2009 |
20090012032 | GENES AND POLYPEPTIDES RELATING TO HUMAN COLON CANCERS - The present application provides novel human genes RNF43 whose expression is markedly elevated in colorectal cancers, as well as CXADRL1 and GCUD1 whose expression is markedly elevated in gastric cancers compared to corresponding non-cancerous tissues. The genes and polypeptides encoded by the genes can be used, for example, in the diagnosis of a cell proliferative disease, and as target molecules for developing drugs against the disease. | 01-08-2009 |
20090012033 | Delivery of Biologically Active Materials Using Core-Shell Tecto(Dendritic Polymers) - The present invention concerns core-shell tecto (dendritic polymers) that are associated with biologically active materials (such as nucleic acids for use for RNAi and in transfection). Also included are formulations for their use. The constructs are useful for the delivery of drugs to an animal or plant and may be in vivo, in vitro or ex vivo. | 01-08-2009 |
20090018092 | Reducing Nephropathy with Inhibitors of Soluble Epoxide Hydrolase and Epoxyeicosanoids - The invention provides uses and methods for reducing nephropathy in persons with diabetes mellitus (particularly Type 2 diabetes), in persons with metabolic syndrome, in persons with triglyceride levels over 215 mg/dL, and in persons with a cholesterol level over 200 mg/dL, by administering an inhibitor of soluble epoxide hydrolase (“sEH”). Optionally, a cis-epoxyeicosantrienoic acid (“EET”) can be administered with the sEH inhibitor. The invention further provides for using EETs in conjunction with one or more sEH inhibitors to reduce hypertension, and for compositions of EETs coated with a material insoluble in an acid of pH 3 but soluble in a solution with a pH of 7.4 or higher. | 01-15-2009 |
20090018093 | Nucleic Acid Ligands Specific to Immunoglobuline E and Their Use as Atopic Disease Therapeutics - The invention discloses aptamers capable of binding to Immunoglobulin E (“IgE”) useful as therapeutics in and diagnostics of atopic disease and/or other diseases or disorders in which IgE has been implicated. The invention further relates to materials and methods for the administration of aptamers capable of binding to IgE. | 01-15-2009 |
20090018094 | INHIBITION OF BRAIN ENZYMES INVOLVED IN CEREBRAL AMYLOID ANGIOPATHY AND MACULAR DEGENERATION - A method of treating or inhibiting progress of dementia and/or macular degeneration in a mammal involves administering compositions containing siRNA to heme oxygenase-1 (HO-1) or heme oxygenase-2 (HO-2), a matrix metalloproteinase (MMP) inhibitor, a caspase inhibitor, or a metalloporphyrin in a manner that permits access to brain sites and/or the macula of the patient. | 01-15-2009 |
20090018095 | Fusion proteins of mycobacterium tuberculosis - The present invention relates to compositions and fusion proteins containing at least two | 01-15-2009 |
20090018096 | Methods For Regulating The Growth And/Or Survival Of Tumor Cells And Stem Cells By Modulating The Expression Or Function Of The Transcription Factor ATF5 - The present invention provides methods for regulating the growth and/or survival of tumor cells and stem cells by modulating the expression or function of ATF5. The present invention also provides methods for promoting or suppressing differentiation of stem/progenitor cells, for producing differentiated cells and for isolating/purifying differentiated cells, including neural cells. Also provided are differentiated cells, cell populations and transgenic animals comprising same and uses of same. The present invention further provides methods for treating nervous tissue degeneration and for identifying an agent for use in treating nervous tissue degeneration. Methods for promoting apoptosis in neoplastic cells and for treating or preventing tumors, and identifying agents for use in treating or preventing tumors are also provided by the present invention. The present invention further provides methods for identifying agents that inhibit ATF5, agents identified by these methods. Also provided are methods for diagnosing tumors, for assessing the efficacy of therapy to treat tumors and for assessing the prognosis of a subject who has a neural tumor. Finally, the present invention provides a kits for use in detecting and treating tumors. | 01-15-2009 |
20090018097 | MODIFICATION OF DOUBLE-STRANDED RIBONUCLEIC ACID MOLECULES - A double-stranded RNA (dsRNA) molecule comprising between about 15 base pairs and about 40 base pairs, wherein at least one ribonucleotide of the dsRNA is a 5′-methyl-pyrimidine and/or at least one 2′-O-methyl ribonucleotide, and a method of improving ribonuclease stability, reducing off-target effects of a double stranded siRNA molecule, or of reducing interferon responsiveness of a double stranded siRNA molecule using such dsRNA. | 01-15-2009 |
20090018098 | TARGETING THE ABSENCE: HOMOZYGOUS DNA DELETIONS AS SIGNPOSTS FOR CANCER THERAPY - The present application relates to methods and compositions for targeting a homozygous DNA deletion (HD) in cells. Methods, structures, vectors and compositions for activating a payload in cells having an HD are provided. In some embodiments, the method comprises administering, to a population of cells comprising at least one cell having an HD, a nucleic acid vector encoding two complementary protein fusion molecules and a payload such that the payload is selectively activated only in cells having a HD. HDs are attractive “negative” targets for cancer therapy because of their immutability and prevalence in cancer cells. Thus, in some embodiments methods of treating cancer by specifically delivering a payload, such as a toxin, to cancer cells comprising one or more particular HDs are provided. | 01-15-2009 |
20090018099 | PROTEIN PRODUCTION - The invention concerns the field of protein production and cell culture technology. CERT is identified as a novel in vivo PKD substrate. Phosphorylation on serine 132 by PKD decreases the affinity of CERT towards its lipid target phosphatidylinositol 4-phosphate at Golgi membranes and reduces ceramide transfer activity, identifying PKD as a regulator of lipid homeostasis. The present invention shows that CERT in turn is critical for PKD activation and PKD dependent protein cargo transport to the plasma membrane. The interdependence of PKD and CERT is thus a key to the maintenance of Golgi membrane integrity and secretory transport. | 01-15-2009 |
20090018100 | MATERIALS AND METHODS FOR TREATING OCULAR-RELATED DISORDERS - The present invention is directed to a method of prophylactically or therapeutically treating an animal for at least one ocular-related disorder, e.g., ocular neovascularization or age-related macular degeneration. The method comprises contacting an ocular cell with an expression vector comprising a nucleic acid sequence encoding an inhibitor of angiogenesis and the same or different nucleic acid sequence encoding a neurotrophic agent. The method also can comprise contacting an ocular cell with different expression vectors, each comprising a nucleic acid sequence encoding an inhibitor of angiogenesis and/or a nucleic acid sequence encoding a neurotrophic agent. In addition, the present invention provides a viral vector comprising a nucleic acid sequence encoding pigment epithelium-derived factor (PEDF) or a therapeutic fragment thereof. | 01-15-2009 |
20090023670 | Regulation of Transgene Expression by RNA Interference - Expression of transgenes delivered into a host organism cells can be regulated by RNA effector molecules delivered to or present in the host organism cells. Regulation can be mediated by delivery of RNA interference inducing molecules that target the transgene mRNA or by incorporating engineered RNA effector binding sites into the transgene. Temporary or long term regulation of expression can be achieved depending on the nature and dosing of RNA effector. | 01-22-2009 |
20090023671 | Rnai Agents for Maintenance of Stem Cells - The present invention provides compositions and methods suitable for delivering RNAi agents against genetic targets in stem cells so as to direct cell growth and differentiation. | 01-22-2009 |
20090023672 | AGE-2 APTAMER - An AGE-2 aptamer which binds to a glyceraldehyde-derived advanced glycation end product (AGE-2) but not to human serum albumin and comprises at least 35 bases and in which the cytosine content in the bases is at least 35%, or the guanine content in the bases is at least 32%. Since the AGE-2 aptamer can be used for detecting AGE-2, it can be used as a reagent for detection/diagnosis, and an agent for prevention/treatment of AGE-2 involved diseases such as: diabetic complications such as diabetic retinopathy, diabetic nephropathy, and diabetic neuropathy; neurodegenerative diseases such as Alzheimer's disease; and proliferation, metastasis, and invasion of malignant tumors. | 01-22-2009 |
20090023673 | LIPID CONTAINING FORMULATIONS - Compositions and methods useful in administering nucleic acid based therapies, for example association complexes such as liposomes and lipoplexes are described. | 01-22-2009 |
20090023674 | snRNA gene-like transcriptional units and uses thereof - By a computer search for upstream promoter elements (DSE, PSE) typical of small nuclear RNA (snRNA) genes, we have identified a number of previously unrecognized, putative transcription units whose predicted products are novel noncoding RNAs with homology to protein-coding genes. By elucidating the function of one of them, we provide evidence for the existence of a sense/antisense-based gene regulation network where part of the Pol III transcriptome could control its Pol II counterpart. | 01-22-2009 |
20090023675 | RNA Interference Mediated Inhibition of Gene Expression Using Chemically Modified Short Interfering Nucleic Acid (siNA) - The present invention concerns methods and reagents useful in modulating gene expression in a variety of applications, including use in therapeutic, diagnostic, target validation, and genomic discovery applications. Specifically, the invention relates to synthetic chemically modified small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against target nucleic acid sequences. The small nucleic acid molecules are useful in the treatment of any disease or condition that responds to modulation of gene expression or activity in a cell, tissue, or organism. | 01-22-2009 |
20090023676 | RNA Interference Mediated Inhibition of MAP Kinase Gene Expression or Expression of Genes Involved in MAP Kinase Pathway Using Short Interfering Nucleic Acid (SiNA) - The present invention concerns methods and reagents useful in modulating MAP kinase gene expression in a variety of applications, including use in therapeutic, diagnostic, target validation, and genomic discovery applications. Specifically, the invention relates to small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against c-JUN, JNK, p38, and ERK gene expression, useful in the treatment of cancer, inflammation, obesity and insulin resistance (e.g. Type I and Type II diabetes). | 01-22-2009 |
20090029929 | Decoy Nucleic Acid to Synoviolin Gene Promoter - The present invention provides a decoy nucleic acid for the Synoviolin gene promoter. Also provided is the decoy nucleic acid can inhibit the promoter activity by binding to the transcription factor of the Synoviolin gene promoter. It also provides a decoy nucleic acid as expressed in (a) a decoy nucleic acid consisting of a nucleotide sequence as shown in SEQ ID NO: 11 or 12; and it also provides (b) a decoy nucleic acid consisting of a nucleotide sequence as shown in SEQ ID NO: 11 or 12 having deletion, substitution or addition of one or several nucleotides and has the function of inhibiting Synoviolin gene promoter activity. | 01-29-2009 |
20090029930 | Methods of gene therapy using nucleic acid sequences for ATP-binding cassette transporter - The present invention provides nucleic acid and amino acid sequences of an ATP binding cassette transporter and mutated sequences thereof associated with macular degeneration. Methods of detecting agents that modify ATP-binding cassette transporter comprising combining purified ATP binding cassette transporter and at least one agent suspected of modifying the ATP binding cassette transporter an observing a change in at least one characteristic associated with ATP binding cassette transporter. Methods of detecting macular degeneration is also embodied by the present invention. | 01-29-2009 |
20090029931 | Topical administrations of antisense compounds to vla-4 for the treatment of respiratory conditions - A method for the treatment and/or prophylaxis of an animal having a respiratory disease or condition associated with airway hyperresponsiveness, eosinophilia, neutrophilia, leukocytes or overproduction of mucus and/or with the expression of integrin α4 comprising administering to the animal a composition comprising from. 0.001 to 1000 μg per kg body weight of the animal of an antisense compound targeted to a nucleic acid molecule encoding integrin α4. | 01-29-2009 |
20090029932 | Identification and use of miRNAs for differentiating myeloid leukemia cells - The invention relates to the use of nucleic acid miRNA derived molecules for producing a drug for treating a myelogenous leukemia and to a method for identifying therapeutic agents or the efficient combination thereof for inducing the differentiation of myelogenous leukemia cells. | 01-29-2009 |
20090029933 | INHIBITOR OF PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR ALPHA COACTIVATOR 1 - The present invention refers to the use of an antisense DNA oligonucleotide for the messenger RNA of the PGC-1α protein, useful as drug for the treatment of diabetes mellitus, insulin resistance and metabolic syndrome. More specifically, the present invention deals with a compound used as drug, through enteral or parenteral route, preferably, with the property of inhibiting the protein expression peroxisome proliferator-activated receptor alpha Coactivator 1 (PGC-1α) leading to the reduction of the blood glucose levels. It deals, therefore, with a pharmacological compound that promotes, in diabetic and insulin-resistant individuals, improvement of the glucose serum levels, increase of the plasmatic insulin concentration and reduction of insulin resistance. The present invention presents a more effective control of the glucose levels and acts beneficially on other complications associated to the Diabetes and obesity conditions, according to tests performed in animal models. In this manner, the principal advantage of the present invention over others alike already existing in the market is the effectiveness that controls blood glucose levels and the fact of acting beneficially on other complications that accompany the disease. | 01-29-2009 |
20090029934 | RNA interference in respiratory epithelial cells - The present invention is directed to small interfering RNA molecules targeted against a gene of interest in respiratory epithelial cells, and methods of using these RNA molecules. | 01-29-2009 |
20090029935 | Centrosomal proteins and secretion - Described are methods for modulating cellular secretion, and methods for identifying novel modulators of cellular secretion, that target centrosomal proteins. | 01-29-2009 |
20090029936 | METHODS AND COMPOSITIONS FOR THE SPECIFIC INHIBITION OF GENE EXPRESSION BY DOUBLE-STRANDED RNA - The invention is directed to compositions and methods for selectively reducing the expression of a gene product from a desired target gene in a cell, as well as for treating diseases caused by the expression of the gene. More particularly, the invention is directed to compositions that contain double stranded RNA (“dsRNA”), and methods for preparing them, that are capable of reducing the expression of target genes in eukaryotic cells. The dsRNA has a first oligonucleotide sequence that is between 25 and about 30 nucleotides in length and a second oligonucleotide sequence that anneals to the first sequence under biological conditions. In addition, a region of one of the sequences of the dsRNA having a sequence length of at least 19 nucleotides is sufficiently complementary to a nucleotide sequence of the RNA produced from the target gene to trigger the destruction of the target RNA by the RNAi machinery. | 01-29-2009 |
20090029937 | BIODEGRADABLE CATIONIC POLYMER GENE TRANSFER COMPOSITIONS AND METHODS OF USE - The invention provides biodegradable, cationic compositions based on cationic α-amino acid-containing PEA, PEUR and PEU polymers for use in preparation of non-viral gene transfer compositions. In the invention gene transfer compositions a poly nucleic acid is condensed with the polymer to form a soluble unit wherein the electrical charge of the poly nucleic acid is neutralized by the polymers. The invention gene transfer compositions can be used to transfect target cells by contact with the target cells. | 01-29-2009 |
20090029938 | OLIGONUCLEOTIDE COMPOSITIONS AND METHODS FOR TREATING DISEASE INCLUDING INFLAMMATORY CONDITIONS - The invention relates to therapeutic antisense oligonucleotides directed against genes coding for phosphodiesterase (PDEs) and the use of these in combination. These antisense oligonucleotides may be used as analytical tools and/or as therapeutic agents in the treatment of disease associated with reduced cellular cAMP in a patient, such as inflammatory diseases of the respiratory tract including, for example, asthma, chronic obstructive pulmonary disease (COPD), acute respiratory distress syndrome, bronchitis, chronic bronchitis, silicosis, pulmonary fibrosis, lung allograft rejection, allergic rhinitis and chronic sinusitis as well as other conditions in which an increase in cyclic AMP or a decrease in PDE levels is beneficial. | 01-29-2009 |
20090036392 | COMPOSITION COMPRISING BIODEGRADABLE HYDRATING CERAMICS FOR CONTROLLED DRUG DELIVERY - The present invention relates to a drug carrier composition comprising i) one or more biodegradable hydrating ceramics ii) one or more expandable agents, and iii) sorbed aqueous medium which in solid form has a ruptured structure. The function of the expandable agent is to create a ruptured structure in the solidified composition, either a foam-like structure or a disintegrated structure where it is split into a large number of parts, particles, units, granules or pieces, so as to obtain an enlarged apparent surface area that is exposed to degradation or erosion upon administration. Suitable substances to obtain this surface enlarging effect are gas-forming agents or swelling agents, gelling agents or disintegrants, here referred to as expandable agents. The expandable agents may be bioresorbable or non-bioresorbable. | 02-05-2009 |
20090036393 | Vesicular monoamine transporter gene therapy in Parkinson's disease - The present invention provides methods and compositions for the therapeutic intervention of Parkinson's disease. More particularly, methods of making and sequestering dopamine are disclosed. Additionally, methods of genetically modifying donor cells by gene transfer for grafting into the central nervous system to treat defective, diseased or damaged cells are disclosed. Methods and compositions for carrying out such gene transfer and grafting are described. | 02-05-2009 |
20090036394 | GRP 146 Receptor - We disclose GPR146 G-protein coupled receptor (GPCR) polypeptides comprising the amino acid sequence shown in SEQ ID NO. 3 or SEQ ID NO: 5, and homologues, variants and derivatives thereof. Nucleic acids capable of encoding GPR146 polypeptide are also disclosed, in particular, those comprising the nucleic acid sequences shown in SEQ ID No. 1A, SEQ ID No.1 B, SEQ ID No.2 or SEQ ID NO: 4. The GPR146 receptor is useful in the diagnosis and therapy of dyslipidaemias. | 02-05-2009 |
20090036395 | RNA INTERFERENCE SUPPRESSION OF NEURODEGENERATIVE DISEASES AND METHODS OF USE THEREOF - The present invention is directed to RNA interference (RNAi) molecules targeted against a nucleic acid sequence that encodes poly-glutamine repeat diseases, and methods of using these RNAi molecules. | 02-05-2009 |
20090036396 | RNAi-RELATED INHIBITION OF TNFalpha SIGNALING PATHWAY FOR TREATMENT OF OCULAR ANGIOGENESIS - RNA interference is provided for inhibition of tumor necrosis factor α (TNFα) by silencing TNFα cell surface receptor TNF receptor-1 (TNFR1) mRNA expression, or by silencing TNFα converting enzyme (TACE/ADAM17) mRNA expression. Silencing such TNFα targets, in particular, is useful for treating patients having a TNFα-related condition or at risk of developing a TNFα-related condition, such as ocular angiogenesis, retinal ischemia, and diabetic retinopathy. | 02-05-2009 |
20090036397 | RNAi-RELATED INHIBITION OF TNFa SIGNALING PATHWAY FOR TREATMENT OF MACULAR EDEMA - RNA interference is provided for inhibition of tumor necrosis factor α (TNFα) by silencing TNFα cell surface receptor TNF receptor-1 (TNFR1) mRNA expression, or by silencing TNFα converting enzyme (TACE/ADAM17) mRNA expression. Silencing such TNFα targets, in particular, is useful for treating patients having or at risk of developing macular edema. | 02-05-2009 |
20090036398 | Human G-Protein Coupled Receptor (HETGQ23) - Human G-protein coupled receptor polypeptides and DNA (RNA) encoding such polypeptides and a procedure for producing such polypeptides by recombinant techniques is disclosed. Also disclosed were methods for utilizing such polypeptides for identifying antagonists and agonists to such polypeptides and methods of using the agonists and antagonists therapeutically to treat conditions related to the underexpression and overexpression of the G-protein coupled receptor polypeptides, respectively. Also disclosed are diagnostic methods for detecting a mutation in the G-protein coupled receptor nucleic acid sequences and an altered level of the soluble form of the receptors. | 02-05-2009 |
20090042824 | Methods and Kits for Linking Polymorphic Sequences to Expanded Repeat Mutations - Methods and kits are provided for determining which single nucleotide polymorphism (“SNP”) variant of an allele of a heterozygous patient is on the same allele as a disease-causing mutation that is at a remote region of the gene's mRNA comprising a) an allele specific reverse transcription reaction using an allele specific primer which recognizes one SNP variant, wherein further the 3′ end of the primer is positioned at the SNP nucleotide position, and b) analysis of the resulting cDNA product from the reverse transcription reaction at the region of the mutation to determine the presence or absence of the mutation on this allele specific cDNA product, wherein the allele specific primer is shorter than about 20 nucleotides. | 02-12-2009 |
20090042825 | Composition, method of preparation & application of concentrated formulations of condensed nucleic acids with a cationic lipopolymer - Compositions, methods, and applications that increase the efficiency of nucleic acid transfection are provided. In one aspect, a pharmaceutical composition may include at least about 0.5 mg/ml concentration of a nucleic acid condensed with a cationic lipopolymer suspended in an isotonic solution, where the cationic lipopolymer includes a cationic polymer backbone having cholesterol and polyethylene glycol covalently attached thereto, and wherein the molar ratio of cholesterol to cationic polymer backbone is within a range of from about 0.1 to about 10, and the molar ratio of polyethylene glycol to cationic polymer backbone is within a range of from about 0.1 to about 10. The composition further may include a filler excipient. | 02-12-2009 |
20090042826 | Use of the AXL receptor for diagnosis and treatment of renal disease - The invention is directed to a process of identifying a compound capable of inhibiting the activity of a human Axl receptor that comprises contacting the Axl receptor or cells expressing the Axl receptor with the compound; measuring the Axl receptor activity in the presence of the compound; and comparing the activity measured to that measured in the absence of the compound under controlled conditions, wherein a decrease identifies the compound as being capable of inhibiting the activity. Therapeutic and diagnostic applications are also described. | 02-12-2009 |
20090042827 | ANTIVIRAL OLIGONUCLEOTIDES TARGETING HBV - Random sequence oligonucleotides that have antiviral activity are described, along with their use as antiviral agents. In many cases, the oligonucleotides are greater than 40 nucleotides in length. Also described are methods for the prophylaxis or treatment of a viral infection in a human or animal, and a method for the prophylaxis treatment of cancer caused by oncoviruses in a human or animal. The methods typically involve administering to a human or animal in need of such treatment, a pharmacologically acceptable, therapeutically effective amount of at least oligonucleotide that does not act by a sequence complementary mode of action. | 02-12-2009 |
20090042828 | METHODS AND COMPOSITIONS FOR TREATING GAIN-OF-FUNCTION DISORDERS USING RNA INTERFERENCE - The present invention relates to novel methods for treating dominant gain-of-function diseases. The invention provides methods for targeting regions of the copper zinc superoxide dismutase (SOD1), which causes inherited amyotrophic lateral sclerosis (ALS), with RNAi agent. The invention further provides RNAi resistant replacement genes containing mismatches with their respective RNAi agents. The invention also provides for vectors that express RNAi agent and RNAi resistant replacement gene of the present invention. | 02-12-2009 |
20090042829 | Nucleic Acid-Lipopolymer Compositions - Compositions, methods, and applications that increase the efficiency of nucleic acid transfection are provided. In one aspect, a pharmaceutical composition may include at least about 0.5 mg/ml concentration of a nucleic acid condensed with a cationic lipopolymer suspended in an isotonic solution, where the cationic lipopolymer includes a cationic polymer backbone having cholesterol and polyethylene glycol covalently attached thereto, and wherein the molar ratio of cholesterol to cationic polymer backbone is within a range of from about 0.1 to about 10, and the molar ratio of polyethylene glycol to cationic polymer backbone is within a range of from about 0.1 to about 10. The composition further may include a filler excipient. | 02-12-2009 |
20090042830 | NOVEL ONCOGENE, RECOMBINANT PROTEIN DERIVED THEREFROM, AND USES THEREOF - The present invention identifies the total nucleotide sequence of a novel oncogene from human, which is directly involved in such a cancerization mechanism as for cervical cancer induced by HPV infection of cervical epithelial cell and the amino acid sequence of an oncogenic protein encoded thereby, and to provide a full-length polynucleotide encoding a peptide chain of the oncogenic protein derived from the novel oncogene, which can be used for recombinant production of the oncogenic protein, and the peptide chain of the oncogenic protein produced recombinantly therewith. Specifically, the present invention provides a novel oncogene polynucleotide from human involving development of cervical cancer, comprising a nucleotide sequence encoding an amino acid sequence of SEQ. ID. No. 1, particularly a polynucleotide of the nucleotide sequence of SEQ. ID. No. 2. | 02-12-2009 |
20090048191 | Therapeutic molecules for modulating stability of vegf - This present invention discloses nucleic acid compositions and methods that are useful for treating ischemic conditions in animals, particularly in mammals such as humans. Specifically, the invention discloses nucleic acid molecules comprising or encoding a sequence that modulates the stability of a transcript from a vascular endothelial growth factor gene, as well as pharmaceutical compositions containing such molecules, which arm useful for modulating angiogenesis or vascularization, especially in methods for treating ischemic conditions. | 02-19-2009 |
20090048192 | Double Strand Compositions Comprising Differentially Modified Strands for Use in Gene Modulation - The present invention provides double stranded compositions wherein each strand is modified to have a motif defined by positioning of β-D-ribonucleosides and sugar modified nucleosides. More particularly, the present compositions comprise one strand having an alternating motif and another strand having a hemimer motif, a blockmer motif, a fully modified motif or a positionally modified motif. At least one of the strands has complementarity to a nucleic acid target. The compositions are useful for targeting selected nucleic acid molecules and modulating the expression of one or more genes. In preferred embodiments the compositions of the present invention hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA. The present invention also provides methods for modulating gene expression. | 02-19-2009 |
20090048193 | Administration of the REG1 anticoagulation system - An improved method of administration of an aptamer and antidote system to regulate blood coagulation in a host is provided based on weight adjusted or body mass index-adjusted dosing of the components of the system to provide a desired pharmacodynamic response. In addition, a method of reversing activity of the aptamer to a desired extent is provided where an antidote dose is based solely on its relationship to the aptamer dose. | 02-19-2009 |
20090048194 | Vagal Afferent Neurons as Targets for Treatment - A method of identifying a compound capable of reducing or preventing prolonged sensory neuron hyper-excitability comprising the steps of: (a) administering the compound to an experimental non-human animal having prolonged sensory neuron hyper-excitability; (b) generating an expression profile of the genes modulated in the Nodose Ganglia (NG) of the animal of step (a); (c) comparing the expression profile obtained in (b) with the expression profile of a corresponding panel of genes expressed in the NG of an experimental non-human animal having no prolonged sensory neuron hyper-excitability; wherein a positive correlation of the expression profiles is indicative that the compound is capable of reducing or preventing prolonged sensory neuron hyper-excitability in NG. | 02-19-2009 |
20090048195 | COMPOSITIONS AND METHODS OF SPHINGOSINE KINASE INHIBITORS FOR USE THEREOF IN CANCER THERAPY - The present invention relates to Sphingosine kinase inhibitors that are useful for treating various cancers. The invention specifically relates to compositions and methods of SPK inhibitors, including siRNAs, which specifically block gene expression of SPK and induce apoptosis in a variety of cancers. | 02-19-2009 |
20090048196 | Membrane receptor for retinol binding protein mediates cellular uptake of vitamin A, methods of use and compositions - Provided is a method of diagnosing a condition associated with abnormal uptake of a retinoid comprising determining the amount of STRA6 expressed by a suspect cell and comparing the amount of expressed STRA6 in the suspect cell with the amount of expressed STRA6 in a normal cell. Also provided is a method for treating a condition associated with excessive uptake or insufficient uptake of a retinoid comprising administering to a subject in need thereof an amount of a drug effective for lowering or increasing expression or activity of STRA6 in cells. Also provided is a method of screening for a compound which alters the uptake of a retinoid by a cell comprising exposing the cell to the compound and determining if the expression or activity of STRA6 is altered. | 02-19-2009 |
20090048197 | Lipid Nanoparticle Based Compositions and Methods for the Delivery of Biologically Active Molecules - The present invention relates to novel cationic lipids, transfection agents, microparticles, nanoparticles, and short interfering nucleic acid (siNA) molecules. The invention also features compositions, and methods of use for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of gene expression and/or activity in a subject or organism. Specifically, the invention relates to novel cationic lipids, microparticles, nanoparticles and transfection agents that effectively transfect or deliver biologically active molecules, such as antibodies (e.g., monoclonal, chimeric, humanized etc.), cholesterol, hormones, antivirals, peptides, proteins, chemotherapeutics, small molecules, vitamins, co-factors, nucleosides, nucleotides, oligonucleotides, enzymatic nucleic acids, antisense nucleic acids, triplex forming oligonucleotides, 2,5-A chimeras, dsRNA, allozymes, aptamers, decoys and analogs thereof, and small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), and RNAi inhibitor molecules, to relevant cells and/or tissues, such as in a subject or organism. Such novel cationic lipids, microparticles, nanoparticles and transfection agents are useful, for example, in providing compositions to prevent, inhibit, or treat diseases, conditions, or traits in a cell, subject or organism. The compositions described herein are generally referred to as formulated molecular compositions (FMC) or lipid nanoparticles (LNP). | 02-19-2009 |
20090048198 | COMPOSITIONS AND METHODS FOR NUCLEIC ACID DELIVERY SYSTEMS - The present invention relates to compositions and methods for use in delivering nucleic acids and other agents into cells and tissues. In particular, the present invention provides lipid mixtures at the gel-liquid crystalline phase transition providing superior lipofection activity for transferring materials into cells and tissues. | 02-19-2009 |
20090048199 | Hibernation-Related Genes and Proteins, Activators and Inhibitors Thereof and Methods of Use - The present invention concerns methods and compositions for identifying genes and/or proteins involved in hibernation, activators and/or inhibitors of such genes or proteins, and methods of therapeutic use of such activators and/or inhibitors for treatment of a wide variety of diseases and/or medical conditions. In particular embodiments, such hibernation-related genes may include, but are not limited to, Adfp, Atr4, Cact, Myl6, Ca3, Ckm, Rps2, Lgmn, Fabpa, Fabph and Cyp51a1. Compounds that regulate the activities or functions of the Adfp, Atf4, Cact, Myl6, Ca3, Ckm, Rps2, Lgmn, Fabpa, Fabph and Cyp51a1 genes are known in the art and may be used for therapeutic treatment of diseases involving cardiovascular, gastrointestinal, respiratory, neurologic or immunologic function. | 02-19-2009 |
20090048200 | GPR 26 G-Protein Coupled Receptor - We disclose GPR26 G-protein coupled receptor (GPCR) polypeptides comprising the amino acid sequence shown in SEQ ID NO. 3 or SEQ ID NO: 5, and homologues, variants and derivatives thereof. Nucleic acids capable of encoding GPR26 polypeptide are also disclosed. The GPR26 receptor is useful in the diagnosis and therapy of mental illness. | 02-19-2009 |
20090048201 | USE OF TARGETED CROSS-LINKED NANOPARTICLES FOR IN VIVO GENE DELIVERY - The in vivo delivery of nucleic acids is targeted by delivery of the nucleic acid in a complex with cross-linked nanoparticles; where the nanoparticles comprise cross-linked neutral amphipathic molecules, cationic amphipathic molecules and targeting amphipathic molecules. Optionally the cationic and targeting amphipathic molecules are also cross-linked. A targeting moiety present on the targeting amphipathic molecule provides for selective delivery of the complex to a predetermined target site, e.g. blood vessels, endothelial cells, tumor cells, liver cells, and the like. | 02-19-2009 |
20090054361 | Pot1 alternative splicing variants - The present invention provides methods an compositions for diagnosis and treatment of carcinomas with aberrant expression patterns of POT 1. The invention also provides methods of identifying compounds that may modulate the cellular expression of POT 1. The invention further provides methods for treating subjects suffering from or at risk of developing a colorectal carcinoma. | 02-26-2009 |
20090054362 | COMPOUNDS - The present invention provides novel aptamer derivatives which are useful in binding to and neutralising viruses. Pharmaceutical formulations comprising the aptamers and the use of the aptamers in screening for useful compounds are also provided. | 02-26-2009 |
20090054363 | Genetic markers and methods for detecting and treating cancers - The present invention provides genetic markers, SOX5 and SPARC, for distant metastasis and poor prognosis of detection of the high risk potential for cancer patients. In addition, the present invention also provides a method to predict the risk potential for cancer patients with distant metastasis and poor prognosis. This method comprises obtaining a tissue sample from a patient, evaluating the expression levels of the SOX5 and/or SPARC genetic markers in the sample; and comparing the expression levels of genetic markers with those of non-cancerous tissues. The patient is determined to have the high risk of distant metastasis or poor prognosis when the expression level of SOX5 is higher, or when the expression level of SPARC is lower, than that of non-cancerous tissue. Furthermore, the identified genetic marker SOX5 and/or SPARC can also be used for cancer targeted therapy, because down regulation of SOX5 and/or up regulation of SPARC expression in NOD-SCID can retard tumor growth and inhibit cell proliferation, migration, invasion and metastasis. | 02-26-2009 |
20090054364 | Methods and compositions for delivery of pharmaceutical agents - Methods and compositions for delivering pharmaceutical agents into cells, in particular urothelial cells of the bladder, are provided. In the methods and compositions of the invention, a solubilized cholesterol composition is used to facilitate delivery of pharmaceutical agents. Preferably, the cholesterol is solubilized by a cyclodextrin (e.g., methyl-β-cyclodextrin) and the pharmaceutical agent comprises a polynucleotide and either a cationic lipid, a cationic polymer or a dendrimer. Improved methods for transfecting polynucleotides into cells thus are also provided, using cationic lipids, cationic polymers or dendrimers and solubilized cholesterol, wherein the transfection efficiency is enhanced compared to use of cationic lipids, cationic polymers or dendrimers alone. Preferred methods of the invention involve transfecting polynucleotides into urothelial cells, preferably for therapeutic treatment of bladder cancer using, for example, a polynucleotide(s) encoding an interleukin(s), an interferon(s), a colony stimulating factor(s) and/or a tumor suppressor(s). | 02-26-2009 |
20090054365 | RNAi-MEDIATED INHIBITION OF AQUAPORIN 1 FOR TREATMENT OF OCULAR NEOVASCULARIZATION - RNA interference is provided for inhibition of aquaporin 1 (AQP1) to treat conditions associated with neovascularization. | 02-26-2009 |
20090054366 | RNAi MEDIATED KNOCKDOWN OF NUMA FOR CANCER THERAPY - This invention relates to the use of short interfering nucleic acid molecules (siRNA) to inhibit Nuclear Mitotic Apparatus Protein (NuMA) gene expression and their use in treatment of disease, including cancer. | 02-26-2009 |
20090054367 | MYCOBACTERIAL ANTIGENS EXPRESSED UNDER LOW OXYGEN TENSION - A method is provided for identifying mycobacterial genes that are induced or up-regulated under continuous culture conditions defined by a dissolved oxygen tension of up to 10% air saturation measured at 37° C. when compared with a dissolved oxygen tension of at least 40% air saturation measured at 37° C. Said induced or up-regulated genes form the basis of nucleic acid vaccines, or provide targets to allow preparation of attenuated mycobacteria for vaccines against mycobacterial infections. Similarly, peptides encoded by said induced or up-regulated genes are employed in vaccines. In a further embodiment, the identified genes/peptides provide the means for identifying the presence of a mycobacterial infection in a clinical sample by nucleic acid probe or antibody detection. | 02-26-2009 |
20090054368 | Substituted gemini surfactant compounds - The compositions, systems, and methods relate to substituted and asymmetric gemini surfactants for use in delivering biologically active agents, such as nucleic acids, to a subject. The described compositions, systems, and methods are useful for gene therapy. | 02-26-2009 |
20090062224 | Therapeutic use of cpg oligodeoxynucleotide for skin disease - Disclosed is the therapeutic use of CpG oligodeoxynucleotides for skin diseases. The CpG oligodeoxynucleotides (CpG ODNs) of the present invention show excellent immunoactive effects against skin diseases in both cases of CpG ODNs with a phosphorothioate backbone and CpG ODNs with a phosphodiester backbone. | 03-05-2009 |
20090062225 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF A GENE FROM THE JC VIRUS - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a gene from the JC Virus (JC virus genome), comprising an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of a gene from the JC Virus. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by JC virus expression and the expression of a gene from the JC Virus using the pharmaceutical composition; and methods for inhibiting the expression of a gene from the JC Virus in a cell. | 03-05-2009 |
20090062226 | Method and Compositions for Inhibiting MAGE Protein Interaction With KAP-1 - Method for inhibiting tumor cell formation or tumor cell growth, and method for inducing apoptosis in sperms, the method comprising administering to a patient in need thereof an antagonist that inhibits the binding of MAGE protein to KAP-1, thereby inhibiting MAGE gene function. Also disclosed are pharmaceutical compositions comprising the same, and method for screening a substance that inhibits MAGE protein binding to KAP-1. | 03-05-2009 |
20090062227 | METHODS AND COMPOSITIONS FOR INDUCING APOPTOSIS BY STIMULATING ER STRESS - The present invention provides a method for inducing apoptosis in selected cells by aggravating ER-stress. The aggravation of ER-stress is achieved in a specific manner by inhibiting SERCA (sarcoplasmic/endoplasmic reticulum calcium ATPase), leading to elevated level of cytoplasmic calcium concentration, yet without inhibiting the activity of COX-2 (cyclooxygenase-2) or triggering the release of histamine. Induction of apoptosis may be enhanced by first inducing or further aggravating ER-stress through inhibition of proteasome or proteases. Also provided are compounds and compositions useful as ER-stress aggravating agents, methods for screening, selecting, identifying and designing the same and methods for treating diseased conditions by inducing apoptosis through specific and selective aggravation of ER-stress. | 03-05-2009 |
20090062228 | piRNA and uses related thereto - The invention relates to small single stranded RNAs and analogs thereof (collectively “piRNA” herein), compositions comprising such piRNAs, and their uses in regulating target gene expression or as markers for certain disease states. | 03-05-2009 |
20090062229 | METHOD AND COMPOSITION FOR REDUCING THE EXPRESSION OF ROCK-II - Methods and compositions for reducing the expression of Rho-associated, coiled-coil containing protein kinase 2 (ROCK-II) are provided. | 03-05-2009 |
20090062230 | NOVEL CATIONIC 17 ALPHA-SUBSTITUTED-ESTRADIOL DERIVATIVES USEFUL AS ANTI-CANCER AGENT - The present invention provides a novel series of cationic, lipid-based, 17α-substituted-estradiol derivatives. The present invention further provides a process for the preparation of a novel series of 17α-substituted-estradiol derivatives. The invention also provides information about highly selective anticancer activities of these molecules in estrogen responsive cell lines. The compound elicits high level of toxicity to gynecological cancer cell lines such as MCF-7, T47D (estrogen receptor positive cell lines), MDA-MB-468 (estrogen receptor knock-out cell line), Hela (cervical cancer). The present class of cationic lipid-based, estradiol derivatives is likely to find specific use in developing target specifically deliverable anticancer drugs for the treatment of gynecological cancers that are most prevalent in women population irrespective of ethnicity. | 03-05-2009 |
20090069256 | Enhancing protein expression - Modified polynucleotide compositions providing enhanced gene expression and methods for preparing said compositions are disclosed. Methods of using the compositions, such as in screening assays, diagnostic tools, kits, etc. and for prevention and/or treatment of diseases and disorders are also disclosed. | 03-12-2009 |
20090069257 | Method of achieving persistent Transgene expression - Non-inflammatory vector compositions are provided that are suitable for repeated transgene delivery and that result in persistent transgene expression. The compositions are non-inflammatory, the present compositions are suitable for readministration and do not induce expression-limiting immune or inflammatory responses. Thus, these compositions are useful in methods of repeated administration to achieve persistent transgene expression, and are especially suited to treating genetic, acquired and inflammation-associated conditions. | 03-12-2009 |
20090069258 | RECOMBINANT ANTIBODIES SPECIFIC FOR BETA-AMYLOID ENDS, DNA ENCODING AND METHODS OF USE THEREOF - DNA encoding a recombinant antibody molecule end-specific for an amyloid-beta peptide, pharmaceutical compositions thereof, and a method for preventing or inhibiting progression of Alzheimer's Disease by introducing such a DNA molecule into brain cells to express the recombinant antibody molecule and prevent the accumulation of amyloid-beta peptides in the cerebrospinal fluid. | 03-12-2009 |
20090069259 | Treatment of neuropathic pain with zinc finger proteins - A variety of zinc finger proteins (ZFPs) and methods utilizing such proteins are provided for use in treating neuropathic pain. ZFPs that bind to a target site in genes that are aberrantly expressed in subjects having neuropathic pain are described. In addition, ZFPs that bind to a target site in genes expressed at normal levels in subjects experiencing neuropathic pain, modulation of whose expression results in decreased pain perception, are also provided. For example, genes that are over-expressed in the dorsal root ganglia (DRG) of pain patients (e.g., VR1, TRKA and/or Nav1.8) can be repressed, whereas genes that are under-expressed in the same populations can be activated. | 03-12-2009 |
20090069260 | METHOD FOR PRODUCING A NUCLEIC-ACID-CONTAINING COMPLEX PREPARATION - The present invention relates to a method of preparing a nucleic-acid-containing complex formulation which can be sterilized by filtration and administered intravenously to a human, and can retain stability of polynucleotides included in the nucleic-acid-containing complex formulation. The invention also relates to a method of preparing a nucleic-acid-containing complex formulation, comprising the following steps: mixing a solution comprising two separate single-stranded polynucleotides (for example, poly I and poly C) capable of forming a double strand and a solution comprising a cationic carrier or the ingredients thereof to form the cationic carrier, and performing a dispersion treatment on the mixture. | 03-12-2009 |
20090069261 | GENE THERAPY FOR SPINAL CORD DISORDERS - This disclosure provides methods and compositions for treating disorders or injuries that affect motor function and control in a subject. In one aspect, the invention provides a method to deliver a transgene to a subject's spinal cord by administering a recombinant neurotropic viral vector containing the transgene. The viral vector delivers the transgene to a region of the deep cerebellar nuclei region of the brain. Also provided are compositions and methods to deliver a transgene to a subject's spinal cord by administering a recombinant neurotropic viral vector containing the transgene to the motor cortex region of the subject's brain. | 03-12-2009 |
20090069262 | Cationic Oligonucleotides, Automated Methods for Preparing Same and Their Uses - The invention relates to oligonucleotide-oligocation molecules A | 03-12-2009 |
20090069263 | 4'-THIOARABINONUCLEOTIDE-CONTAINING OLIGONUCLEOTIDES, COMPOUNDS AND METHODS FOR THEIR PREPARATION AND USES THEREOF - Oligonucleotides comprising one or more 4′-thioarabinonucleotides are described, as well as uses thereof for applications such as antisense- and RNAi-based gene silencing. 4′-thioarabinose-based phosphoramidite and H-phosphonate compounds are also described, as well as uses thereof for the synthesis of oligonucleotides comprising one or more 4′-thioarabinonucleotides. | 03-12-2009 |
20090069264 | TOXOPLASMA GONDII NUCLEIC ACID MOLECULES - The present invention relates to immunogenic | 03-12-2009 |
20090069265 | siRNA targeting inner centromere protein antigens (INCENP) - Efficient sequence specific gene silencing is possible through the use of siRNA technology. By selecting particular siRNAs by rational design, one can maximize the generation of an effective gene silencing reagent, as well as methods for silencing genes. Methods, compositions, and kits generated through rational design of siRNAs are disclosed including those directed to nucleotide sequences for INCENP. | 03-12-2009 |
20090069266 | METHODS AND COMPOSITIONS FOR NUCLEIC ACID TRANSFER INTO CELLS - The present invention provides compositions and methods for increasing the transfer of nucleic acids into cells. In particular, the present invention provides for the use of inhibitors of HDAC6, a cytoplasmic histone deacetylase present in mammalian cells by, for example, small molecules or siRNA treatment, in increasing gene transfer and/or expression in cells in vitro and in vivo for research and gene therapy applications. | 03-12-2009 |
20090075921 | Bone/joint disease sensitivity gene and use thereof - The present invention provides the prophylaxis and treatment of bone and joint diseases by regulating the expression or activity of calmodulin, the prophylaxis and treatment of bone and joint diseases by regulating the expression or activity of asporin, and a diagnostic method for genetic susceptibility to bone and joint diseases by detecting polymorphisms in the CALM1 gene and/or the asporin gene, and the like. | 03-19-2009 |
20090075922 | Nucleic Acid Ligands Which Bind to Hepatocyte Growth Factor/Scatter Factor (HGF/SF) or its Receptor c-met - The invention provides nucleic acid ligands to hepatocyte growth factor/scatter factor (HGF) and its receptor c-met. The nucleic acid ligands of the instant invention are isolated using the SELEX method. SELEX is an acronym for Systematic Evolution of Ligands by EXponential enrichment. The nucleic acid ligands of the invention are useful as diagnostic and therapeutic agents for diseases in which elevated HGF and c-met activity are causative factors. | 03-19-2009 |
20090075923 | Methods of treatment of renal disease - The invention is directed to a process of identifying a compound capable of inhibiting the activity of a human Ax1 receptor that comprises contacting the Ax1 receptor or cells expressing the Ax1 receptor with the compound; measuring the Ax1 receptor activity in the presence of the compound; and comparing the activity measured to that measured in the absence of the compound under controlled conditions, wherein a decrease identifies the compound as being capable of inhibiting the activity. Therapeutic and diagnostic applications are also described. | 03-19-2009 |
20090075924 | MODULATION OF APOLIPOPROTEIN (a) EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of apolipoprotein(a). The compositions comprise oligonucleotides, targeted to nucleic acid encoding apolipoprotein(a). Methods of using these compounds for modulation of apolipoprotein(a) expression and for diagnosis and treatment of disease associated with expression of apolipoprotein(a) are provided. | 03-19-2009 |
20090075925 | Methods and Compositions Related to APOBEC-1 Expression - Disclosed are methods and compositions related to ACF and to APOBEC-1. | 03-19-2009 |
20090075926 | METHOD FOR IDENTIFYING AND MANIPULATING CELLS - The present application discloses a method of isolating or selecting stem cells from a mixed population containing stem cells, which includes the population of cells with a ligand specific for a truncated MUC1 receptor, wherein the presence of the truncated MUC1 receptor on the cells indicates that they are stem cells. | 03-19-2009 |
20090075927 | SWEET TASTE RECEPTORS - This invention provides novel genes and polypeptides of the sweet receptor family, methods for production of the polypeptides, methods for screening compounds that specifically bind to and/or modulate the activity of these polypeptides; and antibodies specific for the polypeptides. | 03-19-2009 |
20090075928 | G-QUARTET OLIGONUCLEOTIDES THAT TARGET HYPOXIA-INDUCIBLE FACTOR 1-a (HIF1a ) - The present invention concerns particular G-quartet oligonucleotides that are employed for the treatment and/or prevention of cancer. In specific cases, the G-quartet oligonucleotides inhibit HIF-1α. | 03-19-2009 |
20090075929 | IG20 SPLICE VARIANTS THERAPEUTICS FOR CANCER - Methods and compositions inhibit the growth of cancer cells by selectively down-regulating the expression of an IG20 splice variant including MADD. Specific knock-down of MADD splice variant resulted in the apoptosis of cancer cells. Interfering RNAs including small hairpin RNAs (shRNA) to down-regulate MADD expression in vivo are disclosed. Inhibition of MADD phosphorylation by Akt results in activation of cancer cell death. Down-regulation of MADD expression results in switching to apoptotic mode due to lack of MAPK activation upon TNF-α-based induction. | 03-19-2009 |
20090082288 | METHODS AND COMPOSITIONS FOR THE TREATMENT OF UVEITIS - Pharmaceutical compositions are disclosed that are of use for the treatment of uveitis. These compositions include a suppressive oligonucleotide. These compositions including an immunosuppressive oligonucleotide can be used for the treatment of uveitis, including anterior, posterior, and diffuse uveitis. | 03-26-2009 |
20090082289 | Adenoviral vectors having a protein IX deletion - This invention provides a recombinant adenovirus expression vector characterized by the partial or total deletion of the adenoviral protein IX DNA and having a gene encoding a foreign protein or a functional fragment or mutant thereof. Transformed host cells and a method of producing recombinant proteins and gene therapy also are included within the scope of this invention. | 03-26-2009 |
20090082290 | Intra-vascular kidney gene therapy with plasmid encoding BMP-7 - The present invention relates to recombinant vectors expressing the BMP-7 polypeptide in host cells and to pharmaceutical compositions comprising such recombinant vectors. The invention also encompasses methods for prevention and/or treatment of both acute and chronic renal failure in mammals, advantageously in humans, dogs and cats, by intra-vascular kidney administration of the recombinant vectors and pharmaceutical compositions of the invention. | 03-26-2009 |
20090082291 | Methods of treatment of acute renal failure - The invention relates to a double-stranded compound, preferably an oligoribonucleotide, which down-regulates the expression of a human p53 gene. The invention also relates to a pharmaceutical composition comprising the compound, or a vector capable of expressing the oligoribonucleotide compound, and a pharmaceutically acceptable carrier. The present invention also contemplates a method of treating a patient suffering from alopecia or acute renal failure or other diseases comprising administering to the patient the pharmaceutical composition in a therapeutically effective dose so as to thereby treat the patient. The alopecia may be induced by chemotherapy or radiotherapy, and the patient may be suffering from cancer, in particular breast cancer. | 03-26-2009 |
20090082292 | ANTISENSE OLIGONUCLEOTIDES CAPABLE OF INHIBITING THE FORMATION OF CAPILLARY TUBES BY ENDOTHELIAL CELLS AND METHODS OF TREATING OPHTHALMIC AND DERMATOLOGICAL DISEASES - A pharmaceutical composition blocks angiogenesis and contains as an active agent at least one nucleotide sequence from nucleic acid molecule SEQ ID NO. 3, fragments thereof containing at least twelve contiguous nucleotides and derivatives thereof; and nucleic acid sequences containing at least twelve contiguous nucleotides of the nucleic acid molecule SEQ ID NO 30 and derivatives thereof. | 03-26-2009 |
20090082293 | TECHNIQUES AND COMPOSITIONS FOR TREATING CARDIOVASCULAR DISEASE BY IN VIVO GENE DELIVERY - Methods are provided for treating patients with cardiovascular disease, including heart disease and peripheral vascular disease. The preferred methods of the present invention involve in vivo delivery of genes, encoding angiogenic proteins or peptides, to the myocardium or to peripheral ischemic tissue, by introduction of a vector containing the gene into a blood vessel supplying the heart or into a peripheral ischemic tissue. | 03-26-2009 |
20090082294 | Diagnosis, prevention and treatment of cancer - Nucleic acid molecules useful in the treatment of cancer are provided. The nucleic acid molecules may include a short interfering ribonucleic acid molecule directed against fer mRNA. A kit for the treatment of cancer including a short interfering ribonucleic acid molecule of the presently described subject matter, as well as a pharmaceutical composition containing a short interfering ribonucleic acid molecule, is also provided. In addition, a method of treating cancer in an individual in which expression of fer in cells or tissues of an individual is inhibited using a short interfering ribonucleic acid molecule is provided. | 03-26-2009 |
20090082295 | COMBINATIONS AND METHODS OF USING AN IMMUNOMODULATORY OLIGODEOXYNUCLEOTIDE - The present invention relates to combination therapies for the treatment of cancer. The combination of agents include oligonucleotides and one or more chemotherapeutic agents. | 03-26-2009 |
20090082296 | MYCOBACTERIAL ANTIGENS EXPRESSED DURING LATENCY - A method is provided for identifying mycobacterial genes that are induced or up-regulated under culture conditions that are nutrient-starving and which maintain mycobacterial latency, said conditions being obtainable by batch fermentation of a mycobacterium for at least 20 days post-inoculation, when compared with culture conditions that are not nutrient-starving and which support exponential growth of said mycobacterium. Said induced or up-regulated genes form the basis of nucleic acid vaccines, or provide targets to allow preparation of attenuated mycobacteria for vaccines against mycobacterial infections. Similarly, peptides encoded by said induced or up-regulated genes are employed in vaccines. In a further embodiment, the identified genes/peptides provide the means for identifying the presence of a mycobacterial infection in a clinical sample by nucleic acid probe or antibody detection. | 03-26-2009 |
20090082297 | Compositions and Methods for Regulating Gene Expression - Methods, compositions and kits for selectively increasing the expression of a target gene are provided. | 03-26-2009 |
20090082298 | Methods for producing microRNAs - The invention relates to recombinant vectors for inducible and/or tissue specific expression of double-stranded RNA molecules that interfere with the expression of a target gene. In certain embodiments, the invention relates to the use of Tet (tetracycline)-responsive RNA Polymerase II (Pol II) promoters (e.g., TetON or TetOFF) to direct inducible knockdown in certain cells of an integrated or an endogenous gene, such as p53. The invention also relates to a method for producing transgenic animals (e.g., mice) expressing inducible (such as tetracycline-regulated), reversible, and/or tissue-specific double-stranded RNA molecules that interfere with the expression of a target gene. | 03-26-2009 |
20090082299 | CODON OPTIMIZED IL-15 AND IL-15R-ALPHA GENES FOR EXPRESSION IN MAMMALIAN CELLS - The present invention provides for nucleic acids improved for the expression of interleukin-15 (IL-15) in mammalian cells. The invention further provides for methods of expressing IL-15 in mammalian cells by transfecting the cell with a nucleic acid sequence comprising a codon optimized IL-15 sequence. The present invention further provides expression vectors, and IL-15 and IL 15 receptor alpha combinations (nucleic acid and protein) that increase IL-15 stability and potency in vitro and in vivo. The present methods are useful for the increased bioavailability and biological effects of IL-15 after DNA, RNA or protein administration in a subject (e.g. a mammal, a human). | 03-26-2009 |
20090082300 | MODULATION OF TRANSTHYRETIN EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of transthyretin. The compositions comprise oligonucleotides, targeted to nucleic acid encoding transthyretin. Methods of using these compounds for modulation of transthyretin expression and for diagnosis and treatment of diseases and conditions associated with expression of transthyretin are provided. | 03-26-2009 |
20090082301 | GENE THERAPY FOR RENAL FAILURE - The present invention relates to recombinant vectors expressing the BMP-7 polypeptide in host cells and to pharmaceutical compositions comprising such recombinant vectors. The invention also encompasses methods for prevention and/or treatment of both acute and chronic renal failure in mammals, advantageously in dogs and cats, by administration of the recombinant vectors and pharmaceutical compositions of the invention. | 03-26-2009 |
20090082302 | MODULATION OF EIF4E-BP2 EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of eIF4E-BP2. The compositions comprise oligonucleotides, targeted to nucleic acid encoding eIF4E-BP2. Methods of using these compounds for modulation of eIF4E-BP2 expression and for diagnosis and treatment of diseases and conditions associated with expression of eIF4E-BP2 are provided. | 03-26-2009 |
20090082303 | DRUG FOR PREVENTING AND TREATING ATHEROSCLEROSIS - The present invention relates to a prophylactic/therapeutic agent for atherosclerosis comprising GM3 synthase inhibitor or inhibitor for expression of GM3 synthase gene, a diagnostic product for atherosclerosis comprising antibody to GM3 synthase, a method of diagnosis for atherosclerosis using antibody to GM3 synthase and others, an use of GM3 or GM3 synthase for diagnostic marker of atherosclerosis, and the like. | 03-26-2009 |
20090088398 | RECOMBINANT ADENOVIRAL VECTORS AND METHODS OF USE - This invention provides a recombinant adenovirus expression vector characterized by the partial or total deletion of the adenoviral protein IX DNA and having a gene encoding a foreign protein or a functional fragment or mutant thereof. Transformed host cells and a method of producing recombinant proteins and gene therapy also are included within the scope of this invention. Thus, for example, the adenoviral vector of this invention can contain a foreign gene for the expression of a protein effective in regulating the cell cycle, such as p53, Rb, or mitosin, or in inducing cell death, such as the conditional suicide gene thymidine kinase. (The latter must be used in conjunction with a thymidine kinase metabolite in order to be effective.) | 04-02-2009 |
20090088399 | Use of Light Sensitive Genes - The invention relates to the use of a light-gated ion channel for the manufacture of a medicament for the treatment of blindness and a method for expressing said cell specific fashion, e.g. in ON-bipolar cells, ON-ganglion cells, or AII amacrine cells. | 04-02-2009 |
20090088400 | PROSTAGLANDIN E2 MODULATION AND USES THEREOF - Methods, uses, kits and products are described for the prognosis, diagnosis, prevention and treatment of myotronic dystrophy type 1 (DM1), and more particularly for the prognosis, diagnosis, prevention and treatment of the congenital form of myotronic dystrophy type 1 (cDM1), based on changes in/modulation of prostaglandin E | 04-02-2009 |
20090088401 | In-situ cancer autovaccination with intratumoral stabilized dsRNA viral mimic - An improved autovaccination method designed to prevent or treat various neoplastic diseases by inducing a systemic immune response against a tumor and its remote metastases, consisting of the induction of an immunogenic cell death in one or more targeted tumor sites with local radiation therapy, cryotherapy, heat, chemotherapy or various other treatments, followed by intratumoral/peritumoral injection of dsRNAs (poly-ICLC in particular) in the same tumor site. | 04-02-2009 |
20090088402 | NOVEL AGENT FOR INDUCING APOPTOSIS COMPRISING MSX1 OR A GENE ENCODING THE SAME AS AN ACTIVE INGREDIENT - The present invention relates to a novel use of Msx1 protein or a nucleotide encoding the same for inducing apoptosis. The Msx1 of the present invention induces apoptosis through direct interaction with p53 via a homeodomain and such interaction leads to increased stability, and/or nuclear localization of p53 in cells. The Msx1 or homeodomain thereof can be effectively used for the treatment of tumors, in which wild-type p53 protein has lost its function by some mechanism that inactivates p53 proteins. | 04-02-2009 |
20090093424 | Markers for melanoma - A method of diagnosing melanoma and/or monitoring melanoma progression, in particular for determining whether the melanoma is likely to have metastatic capabilities, in a subject includes the steps of in a test sample determining the methylation status of FABP5 wherein methylation of the gene indicates a positive diagnosis of melanoma and/or increased methylation of the gene indicates the progression of melanoma. Methods of monitoring melanoma progression may also incorporate measuring the expression levels of FABP5, with low levels of expression indicating a positive diagnosis of melanoma and/or lower levels of expression being indicative of progression of melanoma. Methods of treating melanoma in a subject comprise administering a therapeutically effective amount of a DNA methyltransferase inhibitor or a histone deacetylase inhibitor to the subject such that expression of FABP5 is increased. Microarrays for use in these diagnostic methods and compound screening methods based around monitoring methylation and/or expression of FABP5 are also envisaged. | 04-09-2009 |
20090093425 | TRANSDUCIBLE DELIVERY OF NUCLEIC ACIDS BY REVERSIBLE PHOSPHOTRIESTER CHARGE NEUTRALIZATION PROTECTING GROUPS - This disclosure relates to nucleic acid constructs modified to have a reduced net anionic charge. In some aspects the constructs comprise phosphodiester and/or phosphothioate protecting groups. The disclosure also provide methods of making and using such constructs. | 04-09-2009 |
20090093426 | RNAI MODULATION OF SCAP AND THERAPEUTIC USES THEREOF - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a SCAP gene (Human SCAP gene), comprising an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of a SCAP gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by Human SCAP expression and the expression of a SCAP gene using the pharmaceutical composition; and methods for inhibiting the expression of a SCAP gene in a cell. | 04-09-2009 |
20090093427 | Articular Cartilage Gene Therapy with Recombinant Vector Encoding BMP-7 - The present invention relates to recombinant vectors expressing the BMP-7 polypeptide in host cells and to pharmaceutical compositions comprising such recombinant vectors. The invention also encompasses methods for prevention and/or treatment of osteoarthritis in mammals, advantageously in humans, dogs, horses and cats, by intra-articular administration of the recombinant vectors and pharmaceutical compositions of the invention. | 04-09-2009 |
20090093428 | Nucleotide vector, composition containing such vector, and vaccine for immunization against hepatitis - Nucleotide vector composition containing such vector and vaccine for immunization against hepatitis. Nucleotide vector comprising at least one gene or one complementary DNA coding for at least a portion of a virus, and a promoter providing for the expression of such gene in muscle cells. The gene may be the S gene of the hepatitis B virus. A nucleotide vector composition when administered to even chronic HBV carriers is capable of breaking T cell tolerance to the surface antigens of hepatitis B virus. A vaccine preparation containing said bare DNA is injected into the host previously treated with a substance capable of inducing a coagulating necrosis of the muscle fibers. | 04-09-2009 |
20090093429 | COMBINATION THERAPY FOR TREATING CANCER - The invention relates to treatment of primary and secondary tumors using a therapeutic combination including ionizing radiation and gene therapy comprising mutant-LIGHT. Methods of treating a tumor and inducing an anti-tumor immune response are also provided. | 04-09-2009 |
20090093430 | Biomarkers and methods for identification of agents useful in the treatment of affective disorders - Potential therapeutic, agent for the prevention, treatment or amelioration of an affective disorder, such as a bipolar disorder, depression or anxiety disorder are identified. Also provided are methods for diagnosing and monitoring affective disorders. The methods are based on changes in expression of one or more genes that are differentially expressed in affective disorders. | 04-09-2009 |
20090093431 | RNA INTERFERENCE MEDIATED INHIBITION OF NOGO AND NOGO RECEPTOR GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This inventon relates to compounds, compositions, and methods useful for modulating NOGO and/or NOGO receptor gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of NOGO and/or NOGO receptor gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of NOGO and/or NOGO receptor genes, such as NOGO-A, NOGO-B, NOGO-C, NOGO-66 receptor, NI-35, NI-220, NI-250, myelin-associated glycoprotein, tenascin-R, and NG-2 | 04-09-2009 |
20090093432 | TUMOR INHIBITION BY MODULATING SPROUTY EXPRESSION OR ACTIVITY - Methods are provided for identifying compounds that decrease the expression or activity of an overexpressed Sprouty protein in certain cancers. Such compounds can be useful for treating cancers in which a Sprouty protein is overexpressed. Also provided are therapeutic formulations and pharmaceutical formulations for treating cancers characterized by overexpression of a Sprouty protein. | 04-09-2009 |
20090093433 | SENSE mRNA THERAPY - The present invention describes novel methods for the stabilization of mRNA. These alterations increase stability of mRNA and enable its use in sense RNA therapy to transiantly express proteins in a cell. Accordingly, the present invention is directed to methods for making such modifications, compositions comprising such modifications, and the use of such compositions in treating disease states. | 04-09-2009 |
20090093434 | USE OF EIF-5A1 SIRNA TO PROTECT ISLETS CELLS FROM APOPTOSIS AND TO PRESERVE THEIR FUNCTIONALITY - The present invention relates to methods for improving the viability, recovery and functionality of islets that are separated from a donor organ for subsequent transplantation and more particularly relates to the use of eIF-5A1 siRNAs to enhance the viability and functionality of islets. | 04-09-2009 |
20090093435 | RNA INTERFERENCE MEDIATED INHIBITION OF GRB2 ASSOCIATED BINDING PROTEIN (GAB2) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating associated binding protein (GAB2) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of associated binding protein (GAB2) gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of GAB2 genes. The small nucleic acid molecules are useful in the treatment of cancer, malignant blood disease (leukemia), inflammatory diseases or conditions, allergic diseases or conditions, or proliferative diseases or conditions. | 04-09-2009 |
20090093436 | RNA INTERFERENCE MEDIATED INHIBITION OF VASCULAR CELL ADHESION MOLECULE (VCAM) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating vascular cell adhesion molecule gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of vascular cell adhesion molecule gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of vascular cell adhesion molecule genes, such as vascular cell adhesion molecule-1 (VCAM-1). | 04-09-2009 |
20090093437 | RNA INTERFERENCE MEDIATED INHIBITION OF CHECKPOINT KINASE-1 (CHK-1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating checkpoint kinase (e.g., checkpoint kinase-1 or CHK-1) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of checkpoint kinase gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of checkpoint kinase genes. | 04-09-2009 |
20090093438 | RNA INTERFERENCE MEDIATED INHIBITION OF XIAP GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating XIAP gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of XIAP gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of XIAP genes. | 04-09-2009 |
20090093439 | RNA INTERFERENCE MEDIATED INHIBITION OF CHROMOSOME TRANSLOCATION GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating chromosomal translocation gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of chromosomal translocation gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of BCR-ABL, ERG, EWS-ERG, TEL-AML1, EWS-FLI1, TLS-FUS, PAX3-FKHR, and/or AML1-ETO fusion genes. | 04-09-2009 |
20090099107 | Methods and Compositions for Inhibition of Nuclear Factor kappaB - A series of p105-based NF-κB super repressors, designated p-105(sr), have been designed. The p105(sr), no longer generates p50 and undergoes signal-induced degradation, effectively inhibiting all NF-κB activities. Additionally, p105(sr) significantly enhances tumor necrosis factor alpha (TNF-α)-mediated killing of MT1/2 skin papilloma cells when p50 homodimer activity is elevated. p105(sr) is an effective NF-κB super repressor with a broader range than other currently available IkBα super repressors. The novel repressor can be used in cells where a noncanical NF-κB activity is dominant or multiple NF-κB activities are activated. | 04-16-2009 |
20090099108 | OLIGONUCLEOTIDE DECOYS AND METHODS OF USE - The present invention describes reagents and methods for using a concatemerized double-stranded oligonucleotide molecules (CODN) for transcription factor decoys. In one embodiment, the concatemers consist of a variable number of end-to-end repeated copies of a short (more than 5, 10, 15, 20, 2, 3035, 40, 45, 50, 75, 100, or more by but generally less than about 3 kb) dsDNA containing a sequence or sequences that act as transcription factor decoys. The present invention also provides for the use of the polymers for CODN/polymer complexes to a specific cell type; thus the agent can be made organ, tissue and/or cell-type specific. In another embodiment, the present invention provides for use of the CODN's in vitro or in vivo, in isolated cells or intact animals in which specific blockade of transcription factors or delivery of DNA or other biological effector is desirable. In one embodiment, this includes use as a research tool, including studies of specific genes and studies to identify specific genes regulated by the transcription factors targeted. In another embodiment, the present invention provides for using polyamides for NF-kB-specific CODN delivery in the treatment of myocardial ischemia/reperfusion and myocardial infarction, heart failure and hypertrophy, cardioprotection, stroke, neuroprotection, sepsis, arthritis, asthma, heritable inflammatory disorders, cancer, heritable immune dysfunctions, inflammatory processes, whether caused by disease or injury or infection, oxidative stress to any organ whether caused by disease, surgery or injury. The decoys may be any transcription factors, including, but not limited to, NF-kB, AP-I, ATF2, ATF3, SP 1 and others. | 04-16-2009 |
20090099109 | INTERFERING RNAS AGAINST THE PROMOTER REGION OF P53 - The present invention relates to the inhibition of p53 transcription by interfering with the activity of a p53 promoter using inhibitory double-stranded RNAs. Use of these inhibitory RNAs in the treatment of cancers also is disclosed. | 04-16-2009 |
20090099110 | Antiviral oligonucleotides - Random sequence oligonucleotides that have antiviral activity are described, along with their use as antiviral agents. In many cases, the oligonucleotides are greater than 40 nucleotides in length. Also described are methods for the prophylaxis or treatment of a viral infection in a human or animal, and a method for the prophylaxis treatment of cancer caused by oncoviruses in a human or animal. The methods typically involve administering to a human or animal in need of such treatment, a pharmacologically acceptable, therapeutically effective amount of at least oligonucleotide that does not act by a sequence complementary mode of action. | 04-16-2009 |
20090099111 | Methods and Compositions for the Treatment of Eye Disorders with Increased Intraocular Pressure - The present invention relates to methods and compositions that decrease intraocular pressure (IOP) of the eye. The compositions of the invention comprise short interfering nucleic acid molecules (siNA) including, but not limited to, siRNA that decrease expression of genes associated with production or drainage of intraocular fluid. The compositions of the invention can be used in the preparation of a medicament for the treatment of an eye conditions displaying increased IOP such as glaucoma, infection, inflammation, uveitis, and diabetic retinopathy. The methods of the invention comprise the administration to a patient in need thereof an effective amount of one or more siNAs of the invention. | 04-16-2009 |
20090099112 | Methods and Compositions for the Treatment of Eye Disorders with Increased Intraocular Pressure - The present invention relates to methods and compositions that decrease intraocular pressure (IOP) of the eye. The compositions of the invention comprise short interfering nucleic acid molecules (siNA) including, but not limited to, siRNA that decrease expression of genes associated with production or drainage of intraocular fluid. The compositions of the invention can be used in the preparation of a medicament for the treatment of an eye conditions displaying increased IOP such as glaucoma, infection, inflammation, uveitis, and diabetic retinopathy. The methods of the invention comprise the administration to a patient in need thereof an effective amount of one or more siNAs of the invention. | 04-16-2009 |
20090099113 | Methods and Compositions for the Treatment of Eye Disorders with Increased Intraocular Pressure - The present invention relates to methods and compositions that decrease intraocular pressure (IOP) of the eye. The compositions of the invention comprise short interfering nucleic acid molecules (siNA) including, but not limited to, siRNA that decrease expression of genes associated with production or drainage of intraocular fluid. The compositions of the invention can be used in the preparation of a medicament for the treatment of an eye conditions displaying increased IOP such as glaucoma, infection, inflammation, uveitis, and diabetic retinopathy. The methods of the invention comprise the administration to a patient in need thereof an effective amount of one or more siNAs of the invention. | 04-16-2009 |
20090099114 | Methods and Compositions for the Treatment of Eye Disorders with Increased Intraocular Pressure - The present invention relates to methods and compositions that decrease intraocular pressure (IOP) of the eye. The compositions of the invention comprise short interfering nucleic acid molecules (siNA) including, but not limited to, siRNA that decrease expression of genes associated with production or drainage of intraocular fluid. The compositions of the invention can be used in the preparation of a medicament for the treatment of an eye conditions displaying increased IOP such as glaucoma, infection, inflammation, uveitis, and diabetic retinopathy. The methods of the invention comprise the administration to a patient in need thereof an effective amount of one or more siNAs of the invention. | 04-16-2009 |
20090099115 | RNA INTERFERENCE MEDIATED INHIBITION OF MYC AND/OR MYB GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating Myc and/or Myb gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of Myc and/or Myb gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of Myc and/or Myb (e.g., c-Myc, N-Myc, L-Myc, c-Myb, a-Myb, b-Myb, and v-Myb) genes. The small nucleic acid molecules are useful in the treatment of cancer and other diseases and disorders. | 04-16-2009 |
20090099116 | RNA INTERFERENCE MEDIATED INHIBITION OF FOS GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating c-Fos gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of c-Fos gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of c-Fos genes. The small nucleic acid molecules are useful in the treatment of cancer, proliferative diseases or conditions, inflammatory diseases or conditions, allergic diseases or conditions, infectious diseases or conditions, autoimmune diseases or conditions, or transplantation/allograft rejection in a subject or organism. | 04-16-2009 |
20090099117 | RNA INTERFERENCE MEDIATED INHIBITION OF MYOSTATIN GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating myostatin (GDF8) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of myostatin gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of myostatin genes. | 04-16-2009 |
20090099118 | RNA INTERFERENCE MEDIATED INHIBITION OF STEAROYL-CoA DESATURASE (SCD) GENE EXPRESSION USING SHORT INTERFERING NUCELIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating Stearoyl-CoA desaturase (SCD) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of Stearoyl-CoA desaturase (SCD) gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of Stearoyl-CoA desaturase (SCD) genes. | 04-16-2009 |
20090099119 | RNA INTERFERENCE MEDIATED INHIBITION OF RAS GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating RAS, e.g. K-RAS, H-RAS, and/or N-RAS gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of RAS, e.g. K-RAS, H-RAS, and/or N-RAS gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of RAS genes, such as K-RAS, H-RAS, and/or N-RAS. | 04-16-2009 |
20090099120 | RNA INTERFERENCE MEDIATED INHIBITION OF MUSCARINIC COLINERGIC RECEPTOR GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - The present invention relates to compounds, compositions, and methods useful for modulating the expression of genes associated with respiratory and pulmonary disease, such as cholinergic muscarinic receptor genes, using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of cholinergic muscarinic receptor genes, or other genes involved in pathways of cholinergic muscarinic receptor gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of M3 muscarinic acetylcholine receptor or cholinergic receptor muscarinic 3 (CHRM3). | 04-16-2009 |
20090099121 | RNA INTERFERENCE MEDIATED INHIBITION OF MATRIX METALLOPROTEINASE 13 (MMP13) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating matrix metalloproteinase (e.g., MMP13) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of MMP13 genes. | 04-16-2009 |
20090099122 | USE OF CpG OLIGODEOXYNUCLEOTIDES TO INDUCE EPITHELIAL CELL GROWTH - This disclosure provides a method of inducing epithelial cell growth. The method includes administering an effective amount of a K-type CpG oligonucleotide, thereby inducing epithelial cell growth. The epithelial cell can be in vivo or in vitro. Methods are also provided for inducing wound healing in a subject. The methods include administering to the subject a therapeutically effective amount of at least on K-type CpG ODN. | 04-16-2009 |
20090099123 | Antisense microRNA and uses therefor - Provided herein are methods to suppress specificity protein (Sp) activity in a cell associated with a cell proliferative disease. The methods are effective to inhibit a microRNA in the cell using an antisense microRNA oligonucleotide which results in an increase in expression of a specificity protein (Sp) suppressor gene thereby inducing Sp degradation, apoptosis or growth arrest by releasing inhibitors of G2/M (Myt-1) or inhibition. Also provided are methods of treating a cancer using the antisense microRNA oligonucleotide. In addition the present invention provides antisense microRNA-27a oligonucleotides useful in the methods described herein. | 04-16-2009 |
20090099124 | SHORT INTERFERING RNA AS AN ANTIVIRAL AGENT FOR HEPATITIS C - Hepatitis C virus (HCV) is a major cause of chronic liver disease and affects over 270 million individuals worldwide. The HCV genome is a single-stranded RNA that functions as both a messenger RNA and replication template, making it an attractive target for the study of RNA interference. Double-stranded short interfering RNA (siRNA) molecules designed to target the HCV genome are disclosed herein. | 04-16-2009 |
20090099125 | PAN CANCER ONCOLYTIC VECTORS AND METHODS OF USE THEREOF - Replication-competent adenoviral vectors which selectively replicate in cancer cells are provided. The replication-competent viral vectors comprise an E2F responsive promoter and/or a telomerase promoter operatively linked to an adenoviral coding region. The replication-competent adenoviral vectors effectively replicate in a variety of types of cancer cells and find broad utility in the treatment of cancer. | 04-16-2009 |
20090105169 | ALLELE-SPECIFIC SILENCING OF DISEASE GENES - The present invention is directed to small interfering RNA molecules (siRNA) targeted against an allele of interest, and methods of using these siRNA molecules. | 04-23-2009 |
20090105170 | Multiple Heat Shock Elements - A DNA molecule is provided which comprises at least 2 consensus sequences, each consensus sequence consisting of 3 pentameric units, said pentameric units having a sequence XGAAY or an inverse sequence Y′TTCX′, X being selected from the group consisting of A, T, G, and C, and Y of at least one, preferably two, still preferred all three, of said 3 pentameric units of at least one consensus sequence being selected from the group consisting of A, T, and C, the Y of the remaining pentameric units of said at least one consensus sequence being selected from the group consisting of A, T, G, and C, whereby in the case that said DNA molecule comprises more than 6 consensus sequences, Y of all pentameric units is selected from the group consisting of A, T, G, and C. | 04-23-2009 |
20090105171 | Methods for Regenerating and Repairing Damaged Tissues Using Adrenomedullin - [Problems to be Solved] An objective of the present invention is to provide methods for regenerating or repairing damaged tissues using adrenomedullin. Another objective is to provide pharmaceutical agents that comprise adrenomedullin as an active ingredient for regenerating or repairing damaged tissues. | 04-23-2009 |
20090105172 | Stabilized Aptamers to PSMA and Their Use as Prostate Cancer Therapeutics - The present invention provides stabilized, high affinity nucleic acid ligands to PSMA. Methods for the identification and preparation of novel, stable, high affinity ligands to PSMA using the SELEX™ method with 2′-O-methyl substituted nucleic acids, and cell surface SELEX™ are described herein. Also included are methods and compositions for the treatment and diagnosis of disease characterized by PSMA expression, using the described nucleic acid ligands. | 04-23-2009 |
20090105173 | Prevention and treatment of acute renal failure and other kidney diseases by inhibition of p53 by siRNA - The invention relates to a double-stranded compound, preferably an oligoribonucleotide, which down-regulates the expression of a human p53 gene. The invention also relates to a pharmaceutical composition comprising the compound, or a vector capable of expressing the oligoribonucleotide compound, and a pharmaceutically acceptable carrier. The present invention also contemplates a method of treating a patient suffering from acute renal failure or other kidney diseases comprising administering to the patient the pharmaceutical composition in a therapeutically effective dose so as to thereby treat the patient. | 04-23-2009 |
20090105174 | NUCLEIC ACIDS HYBRIDIZABLE TO MICRO RNA AND PRECURSORS THEREOF - Methods and compositions relating to nucleic acids targeting certain miRNA molecules are disclosed. The nucleic acids are useful in methods of increasing nuclear concentration of FKHR protein, decreasing cell viability, and treating cancer. | 04-23-2009 |
20090105175 | Methods and Compositions for the Treatment of Eye Disorders with Increased Intraocular Pressure - The present invention relates to methods and compositions that decrease intraocular pressure (IOP) of the eye. The compositions of the invention comprise short interfering nucleic acid molecules (siNA) including, but not limited to, siRNA that decrease expression of genes associated with production or drainage of intraocular fluid. The compositions of the invention can be used in the preparation of a medicament for the treatment of an eye conditions displaying increased IOP such as glaucoma, infection, inflammation, uveitis, and diabetic retinopathy. The methods of the invention comprise the administration to a patient in need thereof an effective amount of one or more siNAs of the invention. | 04-23-2009 |
20090105176 | Methods and Compositions for the Treatment of Eye Disorders with Increased Intraocular Pressure - The present invention relates to methods and compositions that decrease intraocular pressure (IOP) of the eye. The compositions of the invention comprise short interfering nucleic acid molecules (siNA) including, but not limited to, siRNA that decrease expression of genes associated with production or drainage of intraocular fluid. The compositions of the invention can be used in the preparation of a medicament for the treatment of an eye conditions displaying increased IOP such as glaucoma, infection, inflammation, uveitis, and diabetic retinopathy. The methods of the invention comprise the administration to a patient in need thereof an effective amount of one or more siNAs of the invention. | 04-23-2009 |
20090105177 | MODULATION OF DIACYLGLYCEROL ACYLTRANSFERASE 1 EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of diacylglycerol acyltransferase 1. The compositions comprise oligonucleotides, targeted to nucleic acid encoding diacylglycerol acyltransferase 1. Methods of using these compounds for modulation of diacylglycerol acyltransferase 1 expression and for diagnosis and treatment of disease associated with expression of diacylglycerol acyltransferase 1, such as obesity and obesity-related conditions, are provided. | 04-23-2009 |
20090105178 | RNA INTERFERENCE MEDIATED INHIBITION OF PLATELET-DERIVED ENDOTHELIAL CELL GROWTH FACTOR (ECGF1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating platelet-derived endothelial cell growth factor and/or receptor (ECGF1 and/or ECGF1r) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of ECGF1 and/or ECGF1r gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of ECGF1 and/or ECGF1r genes. | 04-23-2009 |
20090105179 | DRUG CARRIERS - Compositions that can include a cationic polymeric carrier, targeting agent, and therapeutic agent are disclosed herein. The therapeutic agent may have a therapeutic activity such as inhibiting fibrosis within a target organ or tissue or inhibiting the growth of a cancer cell. | 04-23-2009 |
20090105180 | Ex vivo and in vivo expression of the thrombomodulin gene for the treatment of cardiovascular and peripheral vascular diseases - The present invention relates to methods and compositions for treatment of cardiovascular and peripheral vascular diseases using ex vivo and in vivo gene delivery technologies. One aspect of the present invention relates to a method for treating a vascular disease by introducing a DNA sequence encoding a TM protein or its variant into a segment of a blood vessel ex vivo using a gutless adenovirus vector. Another aspect of the present invention is to provide a gutless adenovirus vector carrying a transgene, such as a gene encoding TM protein or its variant. | 04-23-2009 |
20090105181 | Modulation of sodium channels by nicotinamide adenine dinucleotide - The present invention relates to the use of oxidized nicotinamide adenine dinucleotide (NAD | 04-23-2009 |
20090105182 | RNAi-MEDIATED INHIBITION OF STROMAL CELL-DERIVED FACTOR 1-RELATED TARGETS FOR TREATMENT OF NEOVASCULARIZATION-RELATED CONDITIONS - RNA interference is provided for inhibition of stromal cell-derived factor 1 (SDF1)-related targets in pathologic neovascularization-related conditions, including those cellular changes resulting from the signal transduction activity of the SDF1 targets that lead directly or indirectly to ocular neovascularization, abnormal angiogenesis, retinal vascular permeability, retinal edema, diabetic retinopathy particularly proliferative diabetic retinopathy, diabetic macular edema, exudative age-related macular degeneration, sequela associated with retinal ischemia, and posterior segment neovascularization, for example. | 04-23-2009 |
20090105183 | Pharmaceutical composition containing decoy and method of using the same - A pharmaceutical composition for performing treatment against a skin disease, the pharmaceutical composition comprising at least one decoy and a pharmaceutically acceptable carrier. The at least one decoy may be selected from the group consisting of an NF-κB decoy, a STAT-1 decoy, a GATA-3 decoy, a STAT-6 decoy, an AP-1 decoy and an Ets decoy. The at least one decoy may be an oligonucleotide including at least two decoys bonded to each other, the at least two decoys being selected from the group consisting of an NF-κB decoy, a STAT-1 decoy, a GATA-3 decoy, a STAT-6 decoy, an AP-1 decoy and an Ets decoy. The skin disease may be atopic dermatitis, psoriasis vulgaris, contact dermatitis, keloid, bedsore, ulcerative colitis, or Crohn's disease. | 04-23-2009 |
20090111762 | METHOD OF DIAGNOSING AND TREATING CANCER USING B-CATENIN SPLICE VARIANTS - The invention relates to method of diagnosing and treating cancer, in particular β-catenin related cancers. The invention further relates to methods of identifying CTNNB1 related cancer CTNNB1 therapeutics. | 04-30-2009 |
20090111763 | LOADABLE POLYMERIC PARTICLES FOR BONE AUGMENTATION AND METHODS OF PREPARING AND USING THE SAME - Particles are provided for use in therapeutic and/or diagnostic procedures. The particles include poly[bis(trifluoroethoxy)phosphazene] and/or a derivatives thereof which may be present throughout the particles or within an outer coating of the particles. The particles may also include a core having a hydrogel formed from an acrylic-based polymer. Such particles may be provided for placement within defects in bone within the body of a mammal to augment structural support and facilitate osteogenesis without causing adverse reactions therein. The hydrogel core may further be used as a delivery vehicle for therapeutic agents to treat or retard pathologic processes within the bone defect during healing. | 04-30-2009 |
20090111764 | Mitochondrial selection - Systems, methods, compositions and apparatus relating to genome, chromosome, and mitochondria selection are disclosed. | 04-30-2009 |
20090111765 | COMPOSITIONS AND METHODS FOR IMMUNOSTIMULATORY RNA OLIGONUCLEOTIDES - The present invention provides 4-nucleotide (4mer) RNA motifs that confer immunostimulatory activity, in particular, IL-12-inducing activity to a single-stranded RNA oligonucleotide. The present invention also provides single-stranded RNA oligonucleotides, including antisense RNA, with high or low immunostimulatory activity. The present invention further provides the use of the RNA oligonucleotides of the invention for therapeutic purposes. | 04-30-2009 |
20090111766 | RAAV VECTOR-BASED COMPOSITIONS AND METHODS FOR THE PREVENTION AND TREATMENT OF MAMMALIAN DISEASES - Disclosed are recombinant adeno-associated viral (rAAV) vector compositions that are expressed in selected mammalian cells, such as pancreatic islets cells, and that encode one or more mammalian serpin or cytokine polypeptides having therapeutic efficacy in the amelioration, treatment and/or prevention of interleukin deficiencies, such as for example diabetes, and related diseases of the pancreas. Also disclosed are methods and compositions for preventing diabetes in a mammal, reducing the rate of disease progression, and ameliorating the symptoms of diabetes in humans at risk for developing such conditions. | 04-30-2009 |
20090111767 | MODULATION OF INSULIN LIKE GROWTH FACTOR I RECEPTOR EXPRESSION - The present invention provides compositions and methods for modulating the expression of growth factor gene. In particular, this invention relates to compounds, particularly oligonucleotide compounds, which, in preferred embodiments, hybridize with nucleic acid molecules encoding the Insulin Like Growth Factor I receptor (IGF-I receptor or IGF-IR) and in particular human IGF-IR. Such compounds are exemplified herein to modulate proliferation which is relevant to the treatment of proliferative and inflammatory skin disorders and cancer. It will be understood, however, that the compounds can be used for any other condition in which the IGF-IR is involved including inflammatory conditions. | 04-30-2009 |
20090111768 | Regulators of protein misfolding and neuroprotection and methods of use - Polynucleotide molecules and the proteins encoded by the molecules, diagnostic and treatment methods for neurological disorders characterized by protein aggregation are provided. Genes are described herein that affect the misfolding of, and subsequent aggregation of, aggregation-prone proteins such as alpha-synuclein and have implications for the diagnosis and treatment of neurological diseases related to protein aggregation such as Parkinson's disease. Knockdown of expression of the genes described herein using RNAi results in alpha-synuclein protein aggregation in a | 04-30-2009 |
20090118205 | Antisense Oligonucleotides Directed to Ribonucleotide Reductase R2 and uses Thereof in the Treatment of Cancer - The present invention provides antisense oligonucleotides directed to a mammalian ribonucleotide reductase R2 gene and combinations of the antisense oligonucleotides with one or more chemotherapeutic agents for use in the treatment of cancer. | 05-07-2009 |
20090118206 | RNA INTERFERENCE FOR THE TREATMENT OF GAIN-OF-FUNCTION DISORDERS - The present invention relates to the discovery of an effective treatment for a variety of gain-of-function diseases, in particular, Huntington's disease (HD). The present invention utilizes RNA Interference technology (RNAi) against polymorphic regions in the genes encoding various gain-of-function mutant proteins resulting in an effective treatment for the gain-of-function disease. | 05-07-2009 |
20090118207 | Use of apoptosis-specific eIF-5A siRNA to down regulate expression of proinflammatory cytokines to treat sepsis - The present invention relates to apoptosis specific eucaryotic initiation factor 5A (eIF-5A), referred to as apoptosis-specific eIF-5A or eIF5-A1, nucleic acids and polypeptides and methods for down regulating pro-inflammatory cytokines in a mammal by administering siRNA against eIF-5A1 to the mammal to treat/prevent sepsis and/or hemorrhagic shock. | 05-07-2009 |
20090118208 | Composition and methods of RNAI therapeutics for treatment of cancer and other neovascularization diseases - Compositions and methods are provided for treatment of diseases involving unwanted neovascularization (NV). The invention provides treatments that control NV through selective inhibition of pro-angiogenic biochemical pathways, including inhibition of the VEGF pathway gene expression and inhibition localized at pathological NV tissues. Tissue targeted nanoparticle compositions comprising polymer conjugates and nucleic acid molecules that induce RNA interference (RNAi) are provided. The nanoparticle compositions of the invention can be used alone or in combination with other therapeutic agents such as VEGF pathway antagonists. The compositions and methods can be used for the treatment of NV diseases such as cancer, ocular disease, arthritis, and inflammatory diseases. | 05-07-2009 |
20090118209 | Use of the slug gene as a genetic marker in functions mediated by SCF (stem cell factor) and applications - The Slug gene mediates the functions of SCF linking and its c-kit receptor which means that the Slug gene, the Slug gene's cDNA, Slug protein and/or drugs or substances that activate the expression of the Slug gene can be used as therapeutic agents in the mobilization of hematopoyetic stem cells for transplants or gene therapy, in the ex vivo expansion of hematopoyetic stem cells and/or in the treatment of masculine sterility problems. | 05-07-2009 |
20090118210 | Epididymal lipocalin gene and uses thereof - Isolated nucleic acids comprising a lipocalin gene promoter region, isolated nucleic acids comprising a human lipocalin gene, isolated nucleic acids encoding a lipocalin polypeptide, isolated lipocalin polypeptides, and uses thereof. The disclosed lipocalin nucleic acids and polypeptides can be used to generate a mouse model of male infertility, for drug discovery screens, and for therapeutic treatment of fertility-related conditions. | 05-07-2009 |
20090118212 | METHODS FOR PRODUCING AND USING IN VIVO PSEUDOTYPED RETROVIRUSES - The present invention provides novel pseudotyped retroviral vectors that can transduce human and other cells. Vectors are provided that are packaged efficiently in packaging cells and cell lines to generate high titer recombinant virus stocks expressing novel envelope glycoproteins. The present invention further relates to compositions for gene therapy. | 05-07-2009 |
20090118213 | RNA ANTAGONIST COMPOUNDS FOR THE INHIBITION OF APO-B100 EXPRESSION - Oligonucleotides directed against the Apo-B100 gene are provided for modulating the expression of Apo-B100. The compositions comprise oligonucleotides, particularly antisense oligonucleotides, targeted to nucleic acids encoding the Apo-B100. Methods of using these compounds for modulation of Apo-B100 expression and for the treatment of diseases associated with either overexpression of Apo-B100, expression of mutated Apo-B100 or both are provided. Examples of diseases are cancer such as lung, breast, colon, prostate, pancreas, lung, liver, thyroid, kidney, brain, testes, stomach, intestine, bowel, spinal cord, sinuses, bladder, urinary tract or ovaries cancers. The oligonucleotides may be composed of deoxyribonucleosides or a nucleic acid analogue such as for example locked nucleic acid or a combination thereof. | 05-07-2009 |
20090118214 | Compositions for conferring tolerance to viral disease in social insects, and the use thereof - Compositions and methods for reducing susceptibility to infectious disease in bees using RNA interference technology, and more particularly, prevention and treatment of viral infections in honeybees such as Israel acute paralysis virus (IAPV) by feeding of pathogen-specific dsRNA. Further, multiple-pathogen specific dsRNA is disclosed. | 05-07-2009 |
20090118215 | Bioresorbable Controlled-Release Composition - A novel method for the preparation of a highly densified and at least partly, preferably fully or almost fully hydrated ceramic for use in the preparation of a pharmaceutical composition notably for controlled-release of one or more therapeutically, prophylactically and/or diagnostically active substance. The method involves a concomitant step of hydrating and densifying a bioresorbable and hydratable ceramic such as calcium sulphate. The invention also relates to compositions comprising such a highly densified ceramic. The pharmaceutical composition is useful for targeted and controlled local prolonged release of active substances, e.g. anti-cancer agents, whereby the spectrum and severity of side effects are minimized due to an optimized local concentration-time profile. | 05-07-2009 |
20090118216 | ANAPLASTIC LYMPHOMA KINASE (ALK) AS ONCOANTIGEN FOR LYMPHOMA VACCINATION - Use of intracytoplasmatic domain of Anaplastic Lymphoma Kinase (ALK) protein and/or a nucleic acid molecule encoding for the intracytoplasmatic domain of Anaplastic Lymphoma Kinase (ALK) protein, of any species, for the preparation of a medicament, preferably a vaccine, for the treatment and/or prevention of a tumor in a subject, preferably a lymphoma. | 05-07-2009 |
20090118217 | Genetic polymorphisms associated with myocardial infarction, methods of detection and uses thereof - The present invention is based on the discovery of genetic polymorphisms that are associated with myocardial infarction. In particular, the present invention relates to nucleic acid molecules containing the polymorphisms, variant proteins encoded by such nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and proteins, and methods of using the nucleic acid and proteins as well as methods of using reagents for their detection. | 05-07-2009 |
20090118218 | Biocompatible Hydrogels - A biocompatible macromer composition is provided which includes a first polymer possessing a first nucleoside, and a second polymer possessing a second nucleoside that is complementary to the first nucleoside and capable of undergoing base pairing with the first nucleoside. The biocompatible macromer composition can be used as an adhesive or sealant in human and/or animal medical applications. | 05-07-2009 |
20090118219 | FLEA GABA RECEPTOR SUBUNIT NUCLEIC ACID MOLECULES - The present invention relates to flea GABA receptor subunit nucleic acid molecules; to flea GABA receptor subunit proteins encoded by such nucleic acid molecules; to antibodies raised against such proteins; and to compounds that inhibit the activity of such proteins. The present invention also includes methods to obtain such proteins, nucleic acid molecules, antibodies, and inhibitory compounds. The present invention also includes therapeutic compositions comprising such proteins, nucleic acid molecules, antibodies and inhibitory compounds, particularly those that specifically inhibit flea GABA receptor subunit activity, as well as the use of such therapeutic compositions to treat animals. | 05-07-2009 |
20090124564 | Compositions and methods for regulating apoptosis - Methods and pharmaceutical compositions for regulating apoptosis and treating pathologies associated with disregulated apoptosis are provided. Specifically the present invention provides agents capable of modulating the expression of an MCD-containing protein (e.g., Mtch2) capable of tBID binding activity and/or the tBID binding activity of the MCD-containing protein. | 05-14-2009 |
20090124565 | COMPOSITION COMPRISING AT LEAST ONE NUCLEOSIDIC MOIETY AS A THERAPEUTIC AGENT, AND CKC - Composition comprising at least one nucleosidic moiety and cetalkonium chloride and pharmaceutical use thereof for prevention, treatment or relief of eye, lung, and/or respiratory tract conditions. | 05-14-2009 |
20090124566 | METHODS AND COMPOSITIONS FOR THE TREATMENT OF ERYTHROCYTE DISEASES - Methods to determine the susceptibility of a subject to erythrocyte diseases are provided. The methods comprise determining the miRNA compositions of erythrocytes from the subject. The present invention has discovered that erythrocytes comprise microRNA (miRNA) populations and the populations can be profiled or analyzed and used to determine the susceptibility for disease. The miRNA compositions can also be used to determine the severity of erythrocyte disease, and the features and clinical phenotypes of the erythrocyte disorders. Also provided are pharmaceutical compositions comprising erythrocyte miRNAs and methods for the treatment of a subject with an erythrocyte disease. In other embodiments of the invention, the miRNAs can be used to increase the life-span of erythrocytes through the introduction of an erythrocyte miRNA. | 05-14-2009 |
20090124567 | Influenza Therapeutic - The present invention provides methods and compositions for inhibiting influenza infection and/or replication based on the phenomenon of RNA interference (RNAi) well as systems for identifying effective siRNAs and shRNAs for inhibiting influenza virus and systems for studying influenza virus infective mechanisms. The invention also provides methods and compositions for inhibiting infection, pathogenicity and/or replication of other infectious agents, particularly those that infect cells that are directly accessible from outside the body, e.g., skin cells or mucosal cells. In addition, the invention provides compositions comprising an RNAi-inducing entity, e.g., an siRNA, shRNA, or RNAi-inducing vector targeted to an influenza virus transcript and any of a variety of delivery agents. The invention further includes methods of use of the compositions for treatment of influenza. | 05-14-2009 |
20090124568 | USE OF STEM CELLS TO GENERATE INNER EAR CELLS - This invention relates generally to methods and compositions for inducing stem cell or progenitor cell differentiation, and more particularly to methods and compositions for inducing differentiation of stem cells and/or progenitor cells into cells that function within the inner ear. | 05-14-2009 |
20090124569 | INHIBITION AND TREATMENT OF PROSTATE CANCER METASTASIS - The present invention provides compounds and methods of inhibiting and treating metastatic prostate cancer. The compounds include MEK4 inhibitors. In another aspect the invention provides methods of identifying inhibitors of metastatic prostate cancer by screening for inhibitors of MEK4. | 05-14-2009 |
20090124570 | Methods and Compositions for Facilitating Tissue Repair and Diagnosing, Preventing, and Treating Fibrosis - Compositions and methods for facilitating tissue repair by enhancing the actions of BIGH3 or at least one of its downstream effector molecules in injured tissue, and for the diagnosis, prophylactic and therapeutic treatment of fibrosis by inhibiting the actions of BIGH3 or at least one of its downstream effector molecules, such as PU.1 transcription factor and MMP14. Other disclosed methods include methods of screening and/or identifying compounds useful for facilitating tissue repair, treating fibrosis, or for altering the accumulation or deposition of collagen, comprising contacting BIGH3 or its downstream effector molecules, such as PU.1 or MMP14, with a substance and subsequently determining the effects of the substance on the activity of BIGH3, PU.1, or MMP14. | 05-14-2009 |
20090124571 | METHOD FOR THE SYNTHESIS OF OLIGONUCLEOTIDE DERIVATIVES - Method for the synthesis of nucleotide derivatives wherein molecules of interest are grafted on the oligonucleotide with the help of a “click chemistry” reaction between an azide function on the molecule of interest and an alkyne function on the oligonucleotide, or between an alkyne function on the molecule of interest and an azide function on the oligonucleotide. | 05-14-2009 |
20090131345 | Medicament and method for treating recurrent spontaneous abortion - The present invention discloses a pharmaceutical composition for treating a subject with immunological recurrent spontaneous abortion which comprises a therapeutically effective amount of a substance capable of lowering the in vivo level of antinuclear antibody. Particularly, the substance is chromosome No. 2 or fragment thereof containing fibronectin encoding gene derived from the spouse of said subject, or a mixture of chromosome No. 2 or fragment thereof containing fibronectin encoding gene derived from a plurality of males. The present invention also discloses a method for treating immunological recurrent spontaneous abortion. | 05-21-2009 |
20090131346 | ANTIBODY AND METHOD FOR IDENTIFICATION OF DENDRITIC CELLS - Method for identifying myeloid or plasmacytoid dendritic cells provided by a mammal, stimulated or unstimulated, comprising the steps of: a) preparing a cell sample; b) contracting the cell sample myeloid or plasmacytoid dendritic cells to form a complex; c) detecting the complex; characterized in that the phosphatase is the Receptor type Tyrosine Phosphatase Gamma Protein (PTPRG), acting as a specific marker of said dendritic cells, and in that the compound is a polypeptide capable of selectively bind to the PTPRG or to a fragment thereof or to a oligonucleotide complementary to a PTPRG mRNA logonucleotide in such a manner as to allow the selective recognizing of the dendritic cells in the cell sample. | 05-21-2009 |
20090131347 | IMMUNIZATION-FREE METHODS FOR TREATING ANTIGEN-STIMULATED INFLAMMATION IN A MAMMALIAN HOST AND SHIFTING THE HOST'S ANTIGEN IMMUNE RESPONSIVENESS TO A TH1 PHENOTYPE - The invention relates to methods for preventing or reducing antigen-stimulated, granulocytemediated inflammation in tissue of an antigen-sensitized mammal host by delivering an immunostimulatory oligonucleotide to the host. In addition, methods for using the immunostimulatory oligonucleotides to boost a mammal host's immune responsiveness to a sensitizing antigen (without immunization of the host by the antigen) and shifting the host's immune responsiveness to a Th1 phenotype to achieve various therapeutic ends are provided. Kits for practicing the methods of the invention are also provided. | 05-21-2009 |
20090131348 | MICRORNAS DIFFERENTIALLY EXPRESSED IN PANCREATIC DISEASES AND USES THEREOF - The present invention concerns methods and compositions for identifying a miRNA profile for a particular condition, such as pancreatic disease, and using the profile in assessing the condition of a patient. | 05-21-2009 |
20090131349 | Methods and Compositions for Modulating Body Weight and for Treating Weight Disorders and Related Diseases - Methods of modulating body weight and/or fat content of a subject, methods of treating or preventing weight disorders and methods of treating or preventing weight disorder related diseases are disclosed. The methods include modifying an activity or expression of a protein tyrosine phosphatase epsilon (PTPe) so as to modulate the body weight and/or fat content of the subject. Pharmaceutical compositions and articles of manufacture useful in practice of the methods are further disclosed. | 05-21-2009 |
20090131350 | Hybrid Hepatocyte Growth Factor Gene Having High Expression Efficiency of Two Heterotypes of Hepatocyte Growth Factor - The present invention relates to a hybrid Hepatocyte Growth Factor (HGF) gene which is prepared by inserting an inherent or foreign intron between exons 4 and 5 in HGF cDNA, which has a base sequence of SEQ ID NO: 2. The gene has high expression efficiency and simultaneously expresses two heterotypes of HGF and dHGF (deleted variant HGF). Further the gene may be used for treating or preventing ischemic or liver diseases. | 05-21-2009 |
20090131351 | Methods, compositions, and kits for modulating tumor cell proliferation - The present invention relates to compositions, methods, and kits for modulating tumor proliferation using G-rich oligonucleotides and one or more chemotherapeutic agents. | 05-21-2009 |
20090131352 | Aptamers comprising arabinose modified nucleotides - Nucleic acid ligands (or aptamers) that form a G-tetrad containing at least one arabinose modified nucleotide are provided. Preferably, the arabinose modified nucleotide is 2′-deoxy-2′-fluoroarabinonucleotide (FANA) nucleotide. Methods of using aptamers the aptamers of the claimed invention are also provided. | 05-21-2009 |
20090131353 | Diagnosis and Treatment of Chronic Lymphocytic Leukemia (CLL) - The present invention provides diagnostic methods and kits for diagnosis of chronic lymphocytic leukemia (CLL) by determining expression levels of isoforms of cyclic nucleotide phosphodiesterases (PDEs) associated with CLL particularly, PDE7B and/or PDE3B, and a ratio of mRNA expression of PDE7B to PDE3B. The present invention provides that CLL lymphocytes uniformly expressed high levels of PDE7B and low levels of PDE3B relative to those of normal lymphocytes. A method of treatment and a pharmaceutical composition for CLL comprising one or more therapeutic agents capable of modulating expression or activity levels of isoforms of PDEs associated with CLL, and/or reversing the ratio of PDE7B/PDE3B mRNA expression levels are also provided. | 05-21-2009 |
20090131354 | miR-126 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION - The present invention concerns methods and compositions for identifying genes or genetic pathways modulated by miR-126, using miR-126 to modulate a gene or gene pathway, using this profile in assessing the condition of a patient and/or treating the patient with an appropriate miRNA. | 05-21-2009 |
20090131355 | MULTICISTRONIC VECTORS AND METHODS FOR THEIR DESIGN - Embodiments of the present invention relate to multicistronic vectors and methods for their design. Methods and compositions of the invention include a vector including at least two cistrons, wherein a first cistron includes a first promoter and a first nucleic acid sequence encoding one or more therapeutic agents, and wherein a second cistron comprises a second promoter and a second nucleic acid sequence encoding one or more RNA molecules that interfere with the expression of a biological response modifier or the therapeutic agent, wherein the expression of the first sequence is under control of the first promoter and expression of the second sequence is under control of the second promoter. | 05-21-2009 |
20090131356 | miR-15, miR-26, miR-31, miR-145, miR-147, miR-188, miR-215, miR-216, miR-331, mmu-miR-292-3P REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION - The present invention concerns methods and compositions for identifying genes or genetic pathways modulated by miR-15, miR-26, miR-31, miR-145, miR-147, miR-188, miR-215, miR-216, miR-331, mmu-miR-292-3p, and using nucleic acid comprising all or part of the miR-15, miR-26, miR-31, miR-145, miR-147, miR-188, miR-215, miR-216, miR-331, mmu-miR-292-3p sequences to modulate a gene or gene pathway, using this profile in assessing the condition of a patient and/or treating the patient with an appropriate miRNA. | 05-21-2009 |
20090131357 | Compositions and methods for preventing and treating cancer via modulating UBE1L, ISG15 and/or UBP43 - Compositions and methods of using compositions that induce UBE1L or a ubiquitin-like protein ISG15, or inhibit a deconjugase UBP43 to degrade oncogenic proteins and enhance apoptosis of cancer (neoplastic) or pre-cancerous (pre-neoplastic) cells are provided. Methods for the prevention or treatment of cancer via administration of these compositions are also provided. | 05-21-2009 |
20090131358 | LOW DENSITY LIPOPROTEIN RECEPTOR-MEDIATED siRNA DELIVERY - The invention provides interfering RNA molecule-ligand conjugates useful as a delivery system for delivering interfering RNA molecules to a cell in vitro or in vivo. The conjugates comprise a ligand that can bind to a low density lipoprotein receptor (LDLR) or LDLR family member. Therapeutic uses for the conjugates are also provided. | 05-21-2009 |
20090131359 | ANTIFIBROTIC THERAPY - The present invention relates to methods of treating severe or rapidly progressing pulmonary fibrosis in a subject in need of a treatment thereof. The methods comprise increasing the activity of pulmonary and activation-regulated chemokine (CCL18) in the lungs of the subject, whereby increasing CCL18 activity modulates the activity of at least one antifibrotic factor in the lungs of the subject. The present invention also relates to methods of screening test procedures that may be capable of treating severe or rapidly progressing pulmonary fibrosis. | 05-21-2009 |
20090131360 | Tripartite RNAi constructs - The present invention provides compositions and methods for inhibiting expression of a target gene in a cell. The process comprises introduction of double-stranded tripartite RNAi constructs into the cells and reducing the expression of the corresponding messenger RNA in the cells. The constructs, which may be packaged in or delivered as sequestered RNAi constructs, differ from the canonical siRNA in that they comprise a tripartite structure which follows the general formula of having (1) an RNAi core (either native or abbreviated), (2) one or more terminal moieties attached to the RNAi core and optionally (3) a linker between the RNAi core and the terminal moiety. Once packaged into sequestration vehicles, the constructs are activated for gene regulation by the application of certain forms of energy | 05-21-2009 |
20090131361 | Novel Use of MLN51 Gene and Protein - The present invention relates to novel uses of the MLN 51 gene or protein. The MLN 51 gene and protein is closely related to the development of rheumatoid arthritis, particularly chronic synovitis. | 05-21-2009 |
20090131362 | USE OF DEFIBROTIDE FOR THE INHIBITION OF HEPARANASE - A study has been carried out to verify the effect of Defibrotide on the activity and expression of Heparanase enzyme on myeloma tumor cells (U266) and human microvascular endothelial cells (HMEC). The study has demonstrated that defibrotide can be effectively used for the manufacture of a medicament for the treatment of diseaseses which are positively affected by the inhibition of Heparanse and/or by the downregulation of Heparanse gene expression, such as diabetes. | 05-21-2009 |
20090137500 | RNA interference mediated inhibition of gene expression using chemically modified short interfering nucleic acid (siNA) - The present invention concerns methods and reagents useful in modulating gene expression in a variety of applications, including use in therapeutic, diagnostic, target validation, and genomic discovery applications. Specifically, the invention relates to synthetic chemically modified small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against target nucleic acid sequences. The small nucleic acid molecules are useful in the treatment of any disease or condition that responds to modulation of gene expression or activity in a cell, tissue, or organism. | 05-28-2009 |
20090137501 | Resistance Genes - Genes involved in immune resistance to infection and uses thereof are described. In particular genes which are involved in resistance to HIV infection and in slowing disease progression in infected individuals are described. | 05-28-2009 |
20090137502 | Riproximin, a Novel Type II Ribosome-Inactivating Protein and Uses Thereof - Described is a novel type II ribosome-inactivating protein, riproximin, as well as nucleic acid molecules encoding said protein. Furthermore, therapeutic uses of riproximin are described. | 05-28-2009 |
20090137503 | Pharmacological modulation of telomere length in cancer cells for prevention and treatment of cancer - Acyclic nucleoside analogs such as acyclovir, ganciclovir, penciclovir and the corresponding pro-drugs, i.e., valacyclovir, valganciclovir and famciclovir, respectively have been identified as inhibitors or antagonists of both telomerase (encoded by TERT) and reverse transcriptase encoded by L-1 (LINE-1) RT, and as useful for treating or preventing cancers induced or mediated by the two enzymes. Method of treating or preventing such cancers in patients involves administration of a therapeutically effective amount of a composition having an inhibitor or antagonist of the reverse transcriptases in cells of the patients. The inhibitor or antagonist blocks lengthening of telomeres in telomerase positive and telomerase negative cells. Methods and kits for detecting pathologically proliferating cells expressing TERT and L1RT are also disclosed. | 05-28-2009 |
20090137504 | MICRORNA TARGET SITE BLOCKING OLIGOS AND USES THEREOF - The present invention related to nucleic acids designed to prevent the binding of endogenous or exogenous microRNA and diagnostic and therapeutic uses thereof. | 05-28-2009 |
20090137505 | Method for Predicting and Identifying Target mRnas Controlled By Functional Rnas and Method of Using the Same - It is intended to identify or estimate miRNAs and one or more target genes (target mRNAs) targeted thereby. | 05-28-2009 |
20090137506 | RNA Interference Mediated Inhibition of Cyclic Nucleotide Type 4 Phosphodiesterase (PDE4B) Gene Expression Using Short Interfering Nucleic Acid (siNA) - The invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of cyclic nucleotide type 4 phosphodiesterase (PDE4B) gene expression and/or activity, including PDE4B1, PDE4B2, and PDE4B3. The invention relates to double stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA), and multifunctional siNA molecules capable of mediating RNA interference (RNAi) against cyclic nucleotide type 4 phosphodiesterase (PDE4B) gene expression, including cocktails of such small nucleic acid molecules and lipid nanoparticle (LNP) formulations of such small nucleic acid molecules. Such small nucleic acid molecules are useful, for example, in providing compositions to prevent, inhibit, or reduce inflammatory, respiratory, and autoimmune diseases, traits, and conditions, and/or other disease states associated with PDE4B gene expression or activity in a subject or organism. | 05-28-2009 |
20090137507 | RNA INTERFERENCE MEDIATED INHIBITION OF ANGIOPOIETIN GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating Angiopoietin gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of Angiopoietin gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of Angiopoietin genes, such as Angiopoietin-1 (Ang-1), Angiopoietin-2 (Ang-2), Angiopoietin-3 (Ang-3), and Angiopoietin-4 (Ang-4). | 05-28-2009 |
20090137508 | RNA INTERFERENCE MEDIATED INHIBITION OF POLYCOMB GROUP PROTEIN EZH2 GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating polycomb group protein EZH2 gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of polycomb group protein EZH2 gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of polycomb group protein EZH2 genes, such as EZH2. | 05-28-2009 |
20090137509 | RNA INTERFERENCE MEDIATED INHIBITION OF PROLIFERATION CELL NUCLEAR ANTIGEN (PCNA) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating PCNA gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of PCNA gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of PCNA genes. The small nucleic acid molecules are useful in the treatment of cancer or restenosis or other proliferative diseases, disorders, or conditions. | 05-28-2009 |
20090137510 | RNA INTERFERENCE MEDIATED INHIBITION OF NF-KAPPA B/ REL-A GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating NF-kappa B, REL-A, REL-B, REL, NKkappaB1, or NFkappaB2 gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of NF-kappa B, REL-A, REL-B, REL, NKkappaB1, or NFkappaB2 gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of NF-kappa B, REL-A, REL-B, REL, NKkappaB1, or NFkappaB2 genes, such as NF-kappa B and/or REL-A. | 05-28-2009 |
20090137511 | RNA INTERFERENCE MEDIATED INHIBITION OF PLACENTAL GROWTH FACTOR GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating placental growth factor (e.g., PGF-1 or PlGF-1, PGF-2 or PlGF-2, and/or PGF-3 or PlGF-3) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of placental growth factor gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of placental growth factor genes. | 05-28-2009 |
20090137512 | RNA Interference Mediated Inhibition of Cyclin D1 Gene Expression Using Short Interfering Nucleic Acid (siNA) - This invention relates to compounds, compositions, and methods useful for modulating cyclin (e.g., cyclin D1) and/or cyclin dependent kinase (CDK) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of cyclin (e.g., cyclin D1) and/or cyclin dependent kinase (CDK) gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of cyclin (e.g., cyclin D1) and/or cyclin dependent kinase (CDK) genes. | 05-28-2009 |
20090137513 | RNA Interference Mediated Inhibition of Acetyl-CoA-Carboxylase Gene Expression Using Short Interfering Nucleic Acid (siNA) - This invention relates to compounds, compositions, and methods useful for modulating acetyl-CoA carboxylase gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of acetyl-CoA carboxylase gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of acetyl-CoA carboxylase genes. | 05-28-2009 |
20090137514 | METHODS AND COMPOSITIONS FOR SILENCING GENES WITHOUT INDUCING TOXICITY - The present invention provides methods of post-transcriptional gene silencing which involve the use of a first dsRNA having substantial sequence identity to a target nucleic acid and a short, second dsRNA which inhibits dsRNA-mediated toxicity. These methods can be used to prevent or treat a disease or infection by silencing a gene associated with the disease or infection. The invention also provides methods for identifying nucleic acid sequences that modulate a detectable phenotype, including the function of a cell, the expression of a gene, or the biological activity of a target polypeptide. | 05-28-2009 |
20090137516 | COMPOSITIONS AND METHODS OF TREATING DYSLIPIDEMIA - The invention relates to the treatment of subjects for the purpose of reducing serum LDL, VLDL, triglycerides and fatty acids, by administering agents which reduce the activity of the bile acid pathway component SHP. Methods and pharmaceutical preparations comprising such agents are provided. | 05-28-2009 |
20090137517 | SENSITIZING A CELL TO CANCER TREATMENT BY MODULATING THE ACTIVITY OF A NUCLEIC ACID ENCODING RPS27L PROTEIN - The present invention refers to a method of sensitizing a cell to cancer treatment comprising modulating the activity of a nucleic acid which encodes the RPS27L protein by use of an oligonucleotide which is a RNAi agent or an antisense nucleotide molecule. The oligonucleotides of the present invention can be used in combination with at least one cytostatic drug for, e.g., chemotherapy. The present invention further refers to an expression vector comprising an oligonucleotide used in the method of the present invention as well as to a pharmaceutical comprising the oligonucleotides together with at least one chemotherapeutic agent used in the method of the present invention. | 05-28-2009 |
20090137518 | Therapeutic Antiangiogenic Endostatin Compositions - Endostatin compositions capable of inhibiting endothelial cell proliferation, inhibiting angiogenesis and causing tumor regression are described. Specifically, amino acid sequences of endostatin proteins and nucleic acid sequences coding for endostatin proteins are provided. | 05-28-2009 |
20090137519 | SEMI-SOFT C-CLASS IMMUNOSTIMULATORY OLIGONUCLEOTIDES - The invention relates to specific C-Class semi-soft CpG immunostimulatory oligonucleotides that are useful for stimulating an immune response. In particular the oligonucleotides are useful for treating allergy, such as allergic rhinitis and asthma, cancer and infectious disease, such as hepatitis B and hepatitis C. | 05-28-2009 |
20090143319 | Transcription factor decoy - Double-stranded oligonucleotides useful as decoy oligonucleotides having a high binding ability to a transcription factor and having a reduced cytotoxicity are disclosed. Each of the double-stranded oligonucleotides is formed by hybridization of a sense strand oligonucleotide of the following Formula A: | 06-04-2009 |
20090143320 | Kinase suppressor of Ras inactivation for therapy of Ras mediated tumorigenesis - The present invention relates to methods and compositions for the specific inhibition of kinase suppressor of Ras (KSR). In particular, the invention provides genetic approaches and nucleic acids for the specific inhibition of KSR, particularly of KSR expression. The invention relates to antisense oligonucleotides and the expression of nucleic acid which is substantially complementary to KSR RNA. Oligonucleotide and nucleic acid compositions are provided. The invention provides methods to inhibit KSR, including inhibition of KSR expression. Methods for blocking gf Ras mediated tumorigenesis, metastasis, and for cancer therapy are provided. Methods for conferring radiosensitivity to cells are also provided. | 06-04-2009 |
20090143321 | NUCLEIC ACID AGENTS FOR DOWNREGULATING H19 AND METHODS OF USING SAME - The present invention provides isolated oligonucleotides capable of down-regulating a level of H19 mRNA in cancer cells. Articles of manufacture comprising agents capable of downregulating H19 mRNA in combination with an additional anti-cancer treatment are disclosed as well as methods of treating cancer by administering same. | 06-04-2009 |
20090143322 | CELL TRANSFECTING FORMULATIONS OF SMALL INTERFERING RNA RELATED COMPOSITIONS AND METHODS OF MAKING AND USE - Compositions incorporating small interfering ribonucleic acid (siRNA) and certain lipid-conjugated polyamide compound-based delivery vehicles that are particularly useful in the delivery siRNA and other polynucleotides to cells. Also, methods of making and using the compositions. | 06-04-2009 |
20090143323 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF A GENE FROM THE EBOLA - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a gene from the Ebola virus. | 06-04-2009 |
20090143324 | RNA INTERFERENCE MEDIATED INHIBITION OF INTERLEUKIN AND INTERLEUKIN RECEPTOR GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating interleukin and/or interleukin receptor gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of interleukin and/or interleukin receptor gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of interleukin and/or interleukin receptor genes such as IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-1, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, and IL-27 genes and IL-1R, IL-2R, IL-3R, IL-4R, IL-5R, IL-6R, IL-7R, IL-8R, IL-9R, IL-10R, IL- | 06-04-2009 |
20090143325 | RNA INTERFERENCE MEDIATED INHIBITION OF INTERLEUKIN AND INTERLEUKIN RECEPTOR GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating interleukin and/or interleukin receptor gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of interleukin and/or interleukin receptor gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of interleukin and/or interleukin receptor genes, IL-1, IL-2, IL-3, IL-4, IL-5, IL-6, IL-7, IL-8, IL-9, IL-10, IL-11, IL-12, IL-13, IL-14, IL-15, IL-16, IL-17, IL-18, IL-19, IL-20, IL-21, IL-22, IL-23, IL-24, IL-25, IL-26, and IL-27 genes and IL-1R, IL-2R, IL-3R, IL-4R, IL-5R, IL-6R, IL-7R, IL-8R, IL-9R, IL-10R, IL-11R, IL-12R, IL-13R, IL-14R, IL-15R, IL-16R, IL-17R, IL-18R, IL-19R, IL-20R, IL-21R, IL-22R, IL-23R, IL-24R, IL-25R, IL-26R, and IL-27R. | 06-04-2009 |
20090143326 | MICROMIRs - The present invention relates to very short heavily modified oligonucleotides which target and inhibit microRNAs in vivo, and their use in medicaments and pharmaceutical compositions. | 06-04-2009 |
20090143327 | General composition framework for ligand-controlled regulatory systems - The invention provides an improved design for the construction of extensible nucleic acid-based, ligand-controlled regulatory systems, and the nucleic acid regulatory systems resulting therefrom. The invention contemplates improving the design of the switches (ligand-controlled regulatory systems) through the design of an information transmission domain (ITD). The improved ITD eliminates free-floating ends of the switching and the competing strands, and localizes competitive hybridization events to a contiguous strand of competing and switching strands in a strand-displacement mechanism-based switch, thereby improving the kinetics of strand-displacement. The improved regulatory systems have many uses in various biological systems, including gene expression control or ligand-concentration sensing. | 06-04-2009 |
20090149401 | AMIDE AND PEPTIDE DERIVATIVES OF TETRAALKYLENEPENTAMINES AS TRANSFECTION AGENTS - This invention relates to newly identified pentamine based surfactant compounds, to the use of such compounds and to their production. The invention also relates to the use of the pentamine based compounds to facilitate the transfer of polynucleotides into cells. | 06-11-2009 |
20090149402 | PHARMACEUTICAL COMPOSITION FOR TREATING CANCER OR DIABETES - A pharmaceutical composition for treating cancer or diabetes which contains the following double-stranded RNA (A) or (B):
| 06-11-2009 |
20090149403 | siRNA silencing of genes expressed in cancer - The present invention provides nucleic acid-lipid particles comprising siRNA molecules that silence genes expressed in cancer (e.g., Eg5, EGFR or XIAP) and methods of using such nucleic acid-lipid particles to silence Eg5, EGFR or XIAP gene expression. | 06-11-2009 |
20090149404 | Oligonucleotide analogues and methods utilizing the same - A method for the prevention or treatment in a mammal of a disease preventable or treatable by the pharmacologically useful antisense or antigene activity of an oligonucleotide analogue or a pharmacologically acceptable salt thereof in the body of said mammal, which method comprises administering to said mammal in need of such prevention or treatment a pharmaceutically effective amount of an oligonucleotide analogue comprising two or more nucleoside units, wherein at least one of said nucleoside units is a structure of the formula (2): | 06-11-2009 |
20090149405 | Virus-like particle containing a Dengue virus recombinant replicon - The present invention relates virus-like particle vaccine containing dengue virus recombinant replicon as its core and its preparation method. Such vaccine can efficiently express antigen in the infected tells. Because dengue virus can infect dendritic cells, it can efficiently present antigen and has immunity effects. Further, different dengue virus types can be used to repeatedly produce efficient immune response, which strengthen body's immune response against the pathogen containing such antigen. Such vaccine can prevent and cure cancer and viral diseases. | 06-11-2009 |
20090149406 | Plasmid PXL3179 or NV1FGF - A prokaryotic recombinant host cell comprising a heterologous replication initiation protein that activates a conditional origin of replication and an extrachromosomal DNA molecule comprising a heterologous therapeutic gene and a conditional origin of replication whose functionality in the prokaryotic recombinant host cell requires a replication initiating protein which is foreign to the host cell is described. The host cell may comprise a pir gene having at least one mutation, which may occur in the pir gene copy number control region, the pir gene leucine zipper-like motif, or the pir gene DNA binding region. | 06-11-2009 |
20090149407 | RNA INTERFERENCE MEDIATED TREATMENT OF ALZHEIMER'S DISEASE USING SHORT INTERFERING NUCLEIC ACID (siNA) - The present invention concerns methods and reagents useful in modulating BACE gene expression in a variety of applications, including use in therapeutic, diagnostic, target validation, and genomic discovery applications. Specifically, the invention relates to small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against beta-secretase (BACE), amyloid precursor protein (APP), pin-1, presenillin 1 (PS-1) and/or presenillin 2 (PS-2) gene expression and/or activity. The small nucleic acid molecules are useful in the treatment of Alzheimer's disease and any other condition that responds to modulation of BACE, APP, pin-1, PS-1 and/or PS-2 expression or activity. | 06-11-2009 |
20090149408 | RNA INTERFERENCE MEDIATED INHIBITION OF TELOMERASE GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating telomerase gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of telomerase gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of telomerase genes, such as telomerase template RNA (TERC/TR), or a telomerase protein (TERT). | 06-11-2009 |
20090149409 | Tetracycline-Regulated Adeno-Associated Viral (AAV) Vectors for Gene Delivery to the Nervous System - A vector and a method are provided for delivering a nucleic acid to a nervous system cell. The vector includes a first nucleic acid, a second nucleic acid, inverted terminal repeats of adeno-associated virus, and a tetracycline-off regulatable promoter system that includes a first promoter operably linked to the first nucleic acid and a second promoter operably linked to the second nucleic acid. The promoters drive expression in opposite directions and away from the inverted terminal repeats. The method includes providing a recombinant adeno-associated viral (rAAV) vector and administering the vector to a nervous system cell. Expression of a product from the first nucleic acid is regulatable by the promoter system. | 06-11-2009 |
20090149410 | Methods, compositions, and kits relating to chitinases and chitinase-like molecules and inflammatory disease - The present invention includes compositions and methods for the treatment of inflammatory disease (e.g. asthma, COPD, inflammatory bowel disease, atopic dermatitis, atopy, allergy, allergic rhinitis, scleroderma, and the like), relating to inhibiting a chitinase-like molecule. The invention further includes methods to identify new compounds for the treatment of inflammatory disease, including, but not limited to, asthma, COPD and the like. This is because the present invention demonstrates, for the first time, that expression of IL-13, and of a chitinase-like molecule, mediates and/or is associated with inflammatory disease and that inhibiting the chitinase-like molecule treats and even prevents, the disease. Thus, the invention relates to the novel discovery that inhibiting a chitinase-like molecule treats and prevents an inflammatory disease. | 06-11-2009 |
20090149411 | IMMUNOSTIMULATORY OLIGONUCLEOTIDES WITH MODIFIED BASES AND METHODS OF USE THEREOF - Immunomodulatory oligonucleotide compositions are disclosed. These oligonucleotides comprise an immunostimulatory hexanucleotide sequence comprising a modified cytosine. These oligonucleotides can be administered in conjunction with an immunomodulatory peptide or antigen. Methods of modulating an immune response upon administration of the oligonucleotide comprising a modified immunostimulatory sequence are also disclosed. | 06-11-2009 |
20090149412 | Method for Inhibition of Phospholamban Activity for the Treatment of Cardiac Disease and Heart Failure - The present invention provides a method for the treatment of heart failure through the use of small peptide complexes and recombinant proteins which function to enhance contractility in failing hearts and reduce blood pressure in individuals with hypertension by inhibiting the interaction between phospholamban and sacroplasmic reticulum Ca | 06-11-2009 |
20090149413 | RORS as Modifiers of the p21 Pathway and Methods of Use - Human ROR genes are identified as modulators of the p21 pathway, and thus are therapeutic targets for disorders associated with defective p21 function. Methods for identifying modulators of p21, comprising screening for agents that modulate the activity of ROR are provided. | 06-11-2009 |
20090149414 | rAAV EXPRESSION SYSTEMS AND COMPOSITIONS - Disclosed are improved VP2-modified recombinant adeno-associated viral (rAAV) vectors, expression systems, and rAAV virions that are fully virulent, yet lack functional VP2 protein expression. Also disclosed are pharmaceutical compositions, virus particles, host cells, and pharmaceutical formulations that comprise these modified vectors useful in the expression of therapeutic proteins, polypeptides, peptides, antisense oligonucleotides and/or ribozymes in the cells and tissues of selected mammals, including, for example, human tissues and host cells. | 06-11-2009 |
20090156519 | Modified KSA and Uses Thereof - The present invention relates to a nucleic acid encoding a polypeptide and the use of the nucleic acid or polypeptide in preventing and/or treating cancer. In particular, the invention relates to improved vectors for the insertion and expression of foreign genes encoding tumor antigens for use in immunotherapeutic treatment of cancer. | 06-18-2009 |
20090156520 | Composition and method for in vivo and in vitro attenuation of gene expression using double stranded RNA - Introduction of double stranded RNA into cells, cell culture, organs and tissues, and whole organisms, particularly vertebrates, specifically attenuates gene expression. | 06-18-2009 |
20090156521 | Gpr17 modulators,method of screening and uses thereof - The invention provides GPR17 modulators, methods of screening and use thereof for diagnosis and therapy of diseases or dysfunctions involving GPR17 activation, particularly ischemic brain damage. | 06-18-2009 |
20090156522 | Pancreatic Cancer Genes - The present invention provides the art with the DNA coding sequences of polynucleotides that are up-or-down-regulated in cancer and dysplasia. These polynucleotides and encoded proteins or polypeptides can be used in the diagnosis or identification of cancer and dysplasia. Inhibitors of the up-regulated polynucleotides and proteins can decrease the abnormality of cancer and dysplasia. Enhancing the expression of down-regulated polynucleotides or introducing down-regulated proteins to cells can decrease the growth and/or abnormal characteristics of cancer and dysplasia. | 06-18-2009 |
20090156523 | METHODS AND COMPOSITIONS FOR MODULATING FOXO1 ACTIVITY AND INSULIN SIGNALING - The invention provides methods for modulating insulin signaling pathway and methods for treating insulin resistance. The methods employ agents which modulate FOXO1 subcellular localization. The invention also provides methods of screening for compounds that modulate insulin signaling related activities such as gluconeogenesis and cell proliferation. | 06-18-2009 |
20090156524 | Novel siRNAS and methods of use thereof - The invention relates to compounds, in particular siRNAs, which inhibit the expression of specific human genes. The invention also relates to pharmaceutical compositions comprising such compounds and a pharmaceutically acceptable carrier. The present invention also provides a method of treating and/or preventing the incidence or severity of various diseases or conditions associated with the genes and/or symptoms associated with such diseases or conditions comprising administering to a subject in need of treatment for such disease or condition and/or symptom the compound or the pharmaceutical composition in a therapeutically effective dose so as to thereby treat the subject. The invention also provides antibodies which inhibit specified human polypeptides and pharmaceutical compositions comprising one or more such antibodies. | 06-18-2009 |
20090156525 | Low-Density Lipoprotein Receptor-Related Protein 2 Clears Amyloid-Beta Peptide A cross the Blood-Brain Barrier via Apolipoprotein J - Low-density lipoprotein receptor-related protein 2 (LRP2) is a potential receptor to regulate the level of apolipoprotein J (apoJ) in the central nervous system, which is the major carrier of amyloid-β peptide (Aβ). ApoJ is cleared from brain interstitial fluid (ISF) and cerebrospinal fluid (CSF) by LRP2-mediated transcytosis across epithelial and endothelial barriers. At physiological ISF/CSF levels, apoJ is rapidly transported by LRP2 across the blood-brain barrier (BBB). Importantly, apoJ also substantially enhances clearance from the brain of amyloidogenic Aβ isoforms (i.e., higher β-sheet content such as Aβ42) as apoJ-Aβ by LRP2-mediated transport. | 06-18-2009 |
20090156526 | COMPOSITIONS AND METHODS FOR MODULATION OF LMNA EXPRESSION - Disclosed herein are compounds, compositions and methods for modulating the expression of LMNA in a cell, tissue or animal. Also provided are methods of target validation. Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and disorders. Further provided are methods of identifying cis splicing regulatory elements of a selected mRNA using the disclosed compounds. | 06-18-2009 |
20090156527 | ANTIVIRAL OLIGONUCLEOTIDES TARGETING VIRAL FAMILIES - Random sequence oligonucleotides that have antiviral activity are described, along with their use as antiviral agents. In many cases, the oligonucleotides are greater than 40 nucleotides in length. Also described are methods for the prophylaxis or treatment of a viral infection in a human or animal, and a method for the prophylaxis treatment of cancer caused by oncoviruses in a human or animal. The methods typically involve administering to a human or animal in need of such treatment, a pharmacologically acceptable, therapeutically effective amount of at least oligonucleotide that does not act by a sequence complementary mode of action. | 06-18-2009 |
20090156528 | RNA INTERFERENCE MEDIATED INHIBITION OF HEPATITIS C VIRUS (HCV) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - The present invention concerns methods and reagents useful in modulating hepatitis C virus (HCV) gene expression in a variety of applications, including use in therapeutic, diagnostic, target validation, and genomic discovery applications. Specifically, the invention relates to small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against hepatitis C virus (HCV) gene expression and/or activity. The small nucleic acid molecules are useful in the treatment and diagnosis of HCV infection, liver failure, hepatocellular carcinoma, cirrhosis and any other disease or condition that responds to modulation of HCV expression or activity. | 06-18-2009 |
20090156529 | RNAi Inhibition of Alpha-ENaC Expression - The invention relates to compositions and methods for modulating the expression of alpha-ENaC, and more particularly to the downregulation of alpha-ENaC expression by chemically modified oligonucleotides. | 06-18-2009 |
20090156530 | Norepinepherine Transporter Mutants and Uses Thereof - The present invention provides norepinepherine transporter (NET) mutants which display altered phosphorylation at site T30 and altered receptor trafficking. Methods for the use of the NET mutants, e.g., screening of compounds which alter NET trafficking, are also provided. A transgenic animal such as a mouse may comprise a NET mutant of the present invention. | 06-18-2009 |
20090156531 | Use of Inhibitors of Scinderin and/or Ephrin-A1 for Treating Tumors - The invention relates to the use of inhibitors of the expression or the activity of scinderin and/or of ephrin-A1 inhibitors for increasing the susceptibility of tumor cells to CTL killing. Such inhibitors may be for instance interfering RNAs targeting the scinderin gene and/or interfering RNAs targeting the ephrin-A1 gene. | 06-18-2009 |
20090156532 | SNP BINDING SITE FOR microRNAs IN HLA-G - Analysis of microRNA interference with HLA-G expression identified the HLA-G 3′UTR SNP+3142G/C that disrupts a target for microRNA 148 (miR148) and is associated with asthma. The polymorphism is associated with protection from (or susceptibility to) moderate to severe viral infection in the first 3 years of life and asthma by age 6, with an interaction with mother's affection status (asthma). A SNP in the 3′-Untranslated Region (UTR) of HLA-G influences the targeting of 3 micro(mi)RNAs to the gene. Allele-specific targeting of these miRNAs accounts, at least in part, for the association between HLA-G and the risk of asthma. | 06-18-2009 |
20090156533 | RNA INTERFERENCE MEDIATED INHIBITION OF STROMAL CELL-DERIVED FACTOR-1 (SDF-1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of stromal cell-derived factor-1 (SDF-1) gene expression and/or activity. The present invention is also directed to compounds, compositions, and methods relating to traits, diseases and conditions that respond to the modulation of expression and/or activity of genes involved in SDF-1 gene expression pathways or other cellular processes that mediate the maintenance or development of such traits, diseases and conditions. Specifically, the invention relates to small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating or that mediate RNA interference (RNAi) against SDF-1 gene expression. Such small nucleic acid molecules are useful, for example, in providing compositions for treatment of traits, diseases and conditions that can respond to modulation of SDF-1 expression in a subject, such as ocular disease, cancer and proliferative diseases and any other disease, condition, trait or indication that can respond to the level of SDF-1 in a cell or tissue. | 06-18-2009 |
20090156534 | GLOBIN LENTIVIRAL VECTORS FOR TREATMENT OF DISEASE - The invention provides compositions and methods for the treatment or prevention of disease, including, for example, β-thalassemia, anemias (e.g., sickle cell anemia) and other hemoglobinopathologies. | 06-18-2009 |
20090156535 | MicroRNAs for Modulating Herpes Virus Gene Expression - An algorithm for identification of microRNA (miRNA) targets within viral and cellular RNA is disclosed. Also disclosed are essential herpes virus genes whose transcripts contain one or more targets of miRNAs encoded by herpes viruses or by host cells as predicted by the algorithm, and the use of such targets, miRNAs and their derivatives for modulating viral replication and latency. | 06-18-2009 |
20090156536 | AIMP2-DX2 Gene and SiRNA Targeting AIMP2-DX2 - The present invention relates to a variant of AIMP2 lacking exon 2 gene, named as AIMP2-DX2 gene, which is specifically expressed in cancer cells. The AIMP2-DX2 gene and siRNA targeting AIMP2-DX2 can be successfully used in the development of diagnosis and treatment of cancer. | 06-18-2009 |
20090156537 | COMPOSITIONS AND METHODS FOR DIAGNOSING AND TREATING ASTHMA OR OTHER ALLERGIC OR INFLAMMATORY DISEASES - The present invention provides compositions and methods useful for detecting or treating asthma or other allergic or inflammatory diseases. In one aspect, the methods of the present invention include inhibiting the activity or expression of a component of an arginine metabolic pathway in tissues affected by asthma or other allergic or inflammatory diseases. In many embodiments, the component being inhibited is a cationic amino acid transporter, an arginase, or a component downstream of the arginase. In many other embodiments, the activity or expression of the component is inhibited by an agent that binds to the component. In still many other embodiments, the activity or expression of the component is inhibited by an agent that binds a polynucleotide encoding the component. | 06-18-2009 |
20090156538 | MODULATION OF ENDOTHELIAL LIPASE EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of endothelial lipase. The compositions comprise oligonucleotides, targeted to nucleic acid encoding endothelial lipase. Methods of using these compounds for modulation of endothelial lipase expression and for diagnosis and treatment of disease associated with expression of endothelial lipase are provided. | 06-18-2009 |
20090156539 | ANTISENSE OLIGONUCLEOTIDES (ODN) AGAINST SMAD7 AND USES THEREOF IN MEDICAL FIELD - The invention relates to antisense oligonucleotidic sequences (ODN) against Smad7 suitably modified, and their uses in medical field as therapeutic biological agents, in particular in the treatment of chronic inflammatory bowel disease, such as Crohn's disease and ulcerative colitis. | 06-18-2009 |
20090156540 | METHOD FOR DIAGNOSING AND/OR PREDICTING THE DEVELOPMENT OF AN ALLERGIC DISORDER AND AGENTS FOR TREATING AND/OR PREVENTING SAME - The present invention relates to genes whose level of expression is different in allergic animals compared with non-allergic animals. In particular, the present invention relates to a method for predicting the development of an allergic disorder in a mammal by determining the gene expression pattern of a panel of specific sequences comprising CAMK2D and CDH1 within a nucleic acid pool that have been predetermined to either increase or decrease in response to allergy. | 06-18-2009 |
20090156541 | DBAIT AND USES THEREOF - The invention relates to compositions and methods for interfering with the DNA repair of double strand breaks (DSBs). The invention discloses novel double-stranded nucleic acid molecules. that act as baits and hijack the holocomplex of enzymes responsible of DNA DSB sensing, signaling and/or repair pathways, in particular the non homologous end joining (NHEJ) pathway of DSB repair. | 06-18-2009 |
20090156542 | MCP-1 Binding Nucleic Acids And Use Thereof - The present invention is related to a nucleic acid molecule capable of binding to MCP-1, whereby the nucleic acid molecule is for use as a medicament for the treatment and/or prevention of a chronic disease or chronic disorder, preferably selected from the group consisting of chronic respiratory disease, chronic kidney disease and systemic lupus erythematosus. | 06-18-2009 |
20090156543 | METHODS AND COMPOSITIONS RELATING TO EXPRESSION FACTORS - The invention describes an expression factor and methods for inhibiting the growth of cells, for enhancing the activity of a drug, and for inhibiting the virulence of microbes. Methods of screening for expression factor inhibitors are also described. The compositions comprise at least one expression factor inhibitor and may further comprise at least one drug. | 06-18-2009 |
20090163429 | RNA APTAMERS AND METHODS FOR IDENTIFYING THE SAME - RNA aptamers and methods for identifying the same are disclosed. The RNA aptamers selectively bind coagulation factors, E2F family members, Ang1 or Ang2, and therapeutic and other uses for the RNA aptamers are also disclosed. | 06-25-2009 |
20090163430 | FUNCTIONS AND TARGETS OF LET-7 MICRO RNAS - The present invention concerns methods and compositions for treating or assessing treatment of diseases related to mis-expression of genes or genetic pathways that can be modulated by let-7. Methods may include evaluating patients for genes or genetic pathways modulated by let-7, and/or using an expression profile to assess the condition of a patient or treating the patient with an appropriate miRNA. | 06-25-2009 |
20090163431 | COMPOSITIONS AND METHODS FOR MODULATION OF PDX-1 - Methods and compositions for inhibiting PDX-1 are provided according to the present invention. An anti-PDX-1 agent included in inventive methods and compositions includes an antibody, an aptamer, an antisense oligonucleotide, a ribozyme and/or an inhibitory compound. Methods of inhibiting PDX-1 expression in a tumor cell are provided by the present invention which include contacting a tumor cell with an effective amount of an anti-PDX- | 06-25-2009 |
20090163432 | Therapeutic Agent for Corneal Diseases - The present invention relates to a treatment agent for a disease or a disorder caused by a reduction in corneal endothelial cells, comprising as an active component at least one nucleic acid molecule inhibiting the expression of a connexin 43 gene. | 06-25-2009 |
20090163433 | ANTHELMINTIC AND/OR INSECTICIDE DEVELOPMENT - The use of a nucleic acid molecule encoding FAS in a nematode or arthropod, or a fragment or variant thereof, to identify or produce FAS as a target for: endectocide; anthelmintic and/or insecticide; development. | 06-25-2009 |
20090163434 | miR-20 Regulated Genes and Pathways as Targets for Therapeutic Intervention - The present invention concerns methods and compositions for identifying genes or genetic pathways modulated by miR-20a, using miR-20a to modulate a gene or gene pathway, using this profile in assessing the condition of a patient and/or treating the patient with an appropriate miRNA. | 06-25-2009 |
20090163435 | miR-200 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION - The present invention concerns methods and compositions for identifying genes or genetic pathways modulated by miR-200, using miR-200 to modulate a gene or gene pathway, using this profile in assessing the condition of a patient and/or treating the patient with an appropriate miRNA. | 06-25-2009 |
20090163436 | METHODS FOR DELIVERY OF NUCLEIC ACIDS - This invention features methods and compositions for delivery of nucleic acids (e.g., DNA, RNA, PNA, and hybrids thereof) to cells. The nucleic acid delivery complexes of the invention permit biologically active nucleic acids to be delivered to cells and organisms in vitro and in vivo in a manner and form that allows the nucleic acids to carry out their desired biological function. | 06-25-2009 |
20090163437 | STEADY-STATE SUBCUTANEOUS ADMINISTRATION OF APTAMERS - An improved method of administration of an aptamer and modulator system to regulate blood coagulation in a host is provided wherein the aptamer is administered subcutaneously and the modulator is administered either subcutaneously or intravenously. This method for sustained aptamer activity using intermittent subcutaneous injections further allows for titrated modulation of the aptamer activity by administration of the modulator. | 06-25-2009 |
20090163438 | GANKYRIN - Gankyrin having the amino acid sequence as set forth in SEQ ID NO: 2, or modified gankyrin comprising an amino acid sequence modified by the deletion and/or addition of one or a plurality of amino acids and/or the substitution with other amino acids in the amino acid sequence of SEQ ID NO: 2 and retaining the biological activity of gankyrin, a gene encoding it, and a method of preparing said protein and uses thereof. | 06-25-2009 |
20090170792 | Peptide ligands - A peptide consisting of or comprising an amino acid sequence selected from a ) Px1X2X3 T [SEQ.ID.NO.:11]; b) PSX4S [SEQ.ID.NO.:2]; C) QX5X6X7Q [SEQ.ID.NO.:3]; d) SX8S [SEQ-ID.NO.:4], in which X1, X2 and X3, which may be the same or different, each represents an amino acid residue; X4 represents an amino acid residue; and x 5 and X7, which may be the same or different, each represents an amino acid residue, X6 represents an amino acid residue having an amide side chain; and X8 represent an amino acid having an aliphatic side chain, which peptide binds to dendritic cells and also to other types of cells. The peptide may be used a target non-viral and viral vectors to such cells. | 07-02-2009 |
20090170793 | ARTIFICIAL RIBOSWITCH FOR CONTROLLING PRE-MRNA SPLICING - The present invention relates to riboswitches that have been engineered to regulate pre-mRNA splicing. In particular, the insertion of a high affinity theophylline binding aptamer into the 3′ splice site region, 5′ splice site region, or branchpoint sequence (BPS) of a pre-mRNA modulates RNA splicing in the presence of theophylline. Accordingly, the aspects of the present invention include, but are not limited to, theophylline-dependent riboswitches which modulate RNA splicing, methods of modulating RNA splicing using theophylline and its corresponding riboswitches, methods of improving/identifying theophylline-dependent riboswitches, methods of treating diseases associated with or caused by abnormal RNA splicing. | 07-02-2009 |
20090170794 | Small interfering rnas that efficiently inhibit viral expression and methods of use thereof - The invention provides methods, compositions, and kits comprising small interfering RNA (shRNA or siRNA) which are useful for inhibition of viralmediated gene expression. Small interfering RNAs as described herein may be used in methods of treatment of HCV infection. ShRNA and siRNA constructs that target the internal ribosome entry site (IRES) sequence of HCV are described. | 07-02-2009 |
20090170795 | Kit of parts designed for implementing an antitumoral or antiviral treatment in a mammal - The present invention relates to a kit of parts comprising a nucleic acid sequence encoding a permease and a drug comprising one nucleobase moiety or a precursor thereof. The present invention further relates to a kit of parts comprising a precursor of a drug comprising a gene coding a permease and a nucleic acid sequence comprising a suicide gene. The present invention also relates to a vector comprising a gene coding a permease and a suicide gene. | 07-02-2009 |
20090170796 | Histone Demethylation Mediated By The Nuclear Amine Oxidase Homolog LSD1 - LSD1, a homolog of nuclear amine oxidases, functions as a histone demethylase and transcriptional co-repressor. LSD1 specifically demethylates histone H3 lysine 4, which is linked to active transcription. Lysine demethylation occurs via an oxidation reaction that generates formaldehyde. Importantly, RNAi inhibition of LSD1 causes an increase in H3 lysine 4 methylation and concomitant de-repression of target genes, suggesting that LSD1 represses transcription via histone demethylation. The results thus identify a histone demethylase conserved from | 07-02-2009 |
20090170797 | Hunk, a snfi-related kinase essential for mammary tumor metastasis - This invention relates generally to a novel serine/threonine protein kinase, specifically to hormonally up-regulated, neu-tumor-associated kinase (HUNK); and to the role of HUNK in tumor metastasis, primary tumor development, and the prediction of tumor behavior. | 07-02-2009 |
20090170798 | Highly safe intranasally administrable gene vaccines for treating alzheimer's disease - An objective of the present invention is to provide a safe and effective vaccine therapy for Alzheimer's disease. A minus strand RNA viral vector carrying amyloid gene was constructed, and administered intranasally to 24- to 25-months-old APP transgenic mice. The level of serum anti-A 42 antibody was determined and showed to be markedly higher than the control. The results of histological investigation showed that the administration of a vector of the present invention markedly reduced senile plaques in all of the frontal lobe, parietal lobe, and hippocampus. The brain A level was also markedly reduced. Furthermore, the administration of a vector of the present invention did not result in lymphocyte infiltration in the central nervous system. | 07-02-2009 |
20090170799 | MODULATION OF C-REACTIVE PROTEIN EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of C-reactive protein. The compositions comprise oligonucleotides, targeted to nucleic acid encoding C-reactive protein. Methods of using these compounds for modulation of C-reactive protein expression and for diagnosis and treatment of disease associated with expression of C-reactive protein are provided. | 07-02-2009 |
20090170800 | GENETIC CONSTRUCTS AND COMPOSITIONS COMPRISING RRE AND CTE AND USES THEREOF - Genetic constructs that comprise a coding sequence for HIV-1 Rev, and a coding sequence for a desired protein are disclosed. Compositions that comprise at least two nucleic acid molecules in which at least one nucleic acid molecule comprises a coding sequence for HIV-1 Rev, and at least one nucleic acid molecule comprises a coding sequence for a desired protein are disclosed. In such genetic constructs and compositions comprising nucleic acid molecules, the coding sequence for the desired protein comprises at least a portion of coding sequence for an HIV structural protein that includes an RRE and at least one CTE. Methods of inducing an immune response against an immunogen in an individual, methods of delivering proteins to an individual and methods of producing proteins are also disclosed. | 07-02-2009 |
20090170801 | METHODS OF TREATMENT OF CARDIOVASCULAR AND CEREBROVASCULAR DISEASES WITH FUCOIDAN - A method for treating an ischemic cardiovascular or cerebrovascular disease comprising administrating to a patient in the need of such treatment a pharmaceutical composition comprising fucoidan. | 07-02-2009 |
20090170802 | METHOD FOR PRODUCING POLYMERS - The invention relates to a method for producing polymers, in particular synthetic nucleic acid double strands of optional sequence, comprising the steps:
| 07-02-2009 |
20090176722 | Androgen-regulated PMEPA1 gene and polypeptides - This invention relates to the androgen-regulated gene, PMEPA1, and proteins encoded by this gene, including variants and analogs thereof. Also provided are other androgen-regulated nucleic acids, a polynucleotide array containing these androgen-regulated nucleic acids, and methods of using the polynucleotide array in the diagnosis and prognosis of prostate cancer. | 07-09-2009 |
20090176723 | Methods and compositions involving miRNA and miRNA inhibitor molecules - The present invention concerns methods and compositions for introducing miRNA activity or function into cells using synthetic nucleic acid molecules. Moreover, the present invention concerns methods and compositions for identifying miRNAs with specific cellular functions that are relevant to therapeutic, diagnostic, and prognostic applications wherein synthetic miRNAs and/or miRNA inhibitors are used in library screening assays. | 07-09-2009 |
20090176724 | Methods and Compositions for the Diagnosis, Prognosis and Treatment of Cancer - The invention is relates to splice variants of basal transcription factors and other transcriptional modulators, the use of expression analyses of the same as a diagnostic and prognostic tool, and the targeting of such splice variants for therapeutic purposes, particularly in relation to the treatment of cancer. | 07-09-2009 |
20090176725 | CHEMICALLY MODIFIED SHORT INTERFERING NUCLEIC ACID MOLECULES THAT MEDIATE RNA INTERFERENCE - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of gene expression and/or activity. The present invention is also directed to compounds, compositions, and methods relating to traits, diseases and conditions that respond to the modulation of expression and/or activity of genes involved in gene expression pathways or other cellular processes that mediate the maintenance or development of such traits, diseases and conditions. Specifically, the invention relates to double stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against gene expression, including cocktails of such small nucleic acid molecules and lipid nanoparticle (LNP) formulations of such small nucleic acid molecules. The present invention also relates to small nucleic acid molecules, such as siNA, siRNA, and others that can inhibit the function of endogenous RNA molecules, such as endogenous micro-RNA (miRNA) (e.g., miRNA inhibitors) or endogenous short interfering RNA (siRNA), (e.g., siRNA inhibitors) or that can inhibit the function of RISC (e.g., RISC inhibitors), to modulate gene expression by interfering with the regulatory function of such endogenous RNAs or proteins associated with such endogenous RNAs (e.g., RISC), including cocktails of such small nucleic acid molecules and lipid nanoparticle (LNP) formulations of such small nucleic acid molecules. Such small nucleic acid molecules and are useful, for example, in providing compositions to prevent, inhibit, or reduce diseases, traits and conditions that are associated with gene expression or activity in a subject or organism. | 07-09-2009 |
20090176726 | METHODS FOR TREATING MITF-RELATED DISORDERS - Methods for treating melanoma and other MITF-related disorders by administering a compound that causes an increase in HIF-1 level or activity (e.g., by increasing the level of HIF-1I in a cell) within cells. Such methods include administration of a compound that is a hydroxylase inhibitor, e.g., a prolyl hydroxylase inhibitor that reduces hydroxylation of HIF-1I thereby causing an increase in HIF-1I in the cell. Such treatment can lead to a decrease in MITF activity or expression. | 07-09-2009 |
20090176727 | DOUBLE-STRANDED RNA STRUCTURES AND CONSTRUCTS, AND METHODS FOR GENERATING AND USING THE SAME - The present invention relates to novel double-stranded RNA (dsRNA) structures and dsRNA expression constructs, methods for generating them, and methods of utilizing them for silencing genes. Desirably, these methods specifically inhibit the expression of one or more target genes in a cell or animal (e.g., a mammal such as a human) without inducing toxicity. These methods can be used to prevent or treat a disease or infection by silencing a gene associated with the disease or infection. The invention also provides methods for identifying nucleic acid sequences that modulate a detectable phenotype, such as the function of a cell, the expression of a gene, or the biological activity of a target polypeptide. | 07-09-2009 |
20090176728 | Treatment of CNS Conditions - Methods and compositions for the treatment of pathologic conditions of the central nervous system (CNS) by means of intranasal administration of a composition that modulates, by means of RNA interference, the expression and/or activity of genes involved in above-mentioned conditions. | 07-09-2009 |
20090176729 | METHOD OF TREATING NEURODEGENERATIVE DISEASE - Aspects featured in the invention relate to compositions and methods for inhibiting alpha-synuclein (SNCA) gene expression, such as for the treatment of neurodegenerative disorders. An anti-SNCA agent featured herein that targets the SNCA gene can have been modified to alter distribution in favor of neural cells. | 07-09-2009 |
20090181907 | Drug Comprising As The Active Ingredient Proliferative Vector Containing Survivin Promoter - It is intended to provide a drug to be used in gene therapy which specifically targets abnormal cells such as tumor cells and destroys the same for healing. Namely, a drug comprising, as the active ingredient, a proliferative vector which contains a Survivin promoter proliferating depending on the expression of Survivin. This drug may be used in order to treat tumor. In this drug, use may be made of an adenovirus as the vector. In the adenovirus of this drug, an endogenous promoter of an E1A domain may be substituted with a Survivin promoter. | 07-16-2009 |
20090181908 | METHODS AND COMPOSITIONS FOR TREATING KERATIN HYPERPROLIFERATIVE DISORDERS - A method for keratin hyperproliferation disorders such as corns, calluses, or keratosis pilaris (KP) by administering to a subject experiencing the disorder a therapeutically effective amount of an RNA sequence which inhibits expression of a gene encoding for a keratin selected from the group consisting of K6a, K6b, K16, K17, and combinations thereof. | 07-16-2009 |
20090181909 | Vasopressin-Binding L-Nucleic Acid - The invention relates to a vasopressin-binding nucleic acid, characterized in that the nucleic acid has a Box | 07-16-2009 |
20090181910 | METHOD OF PREVENTION AND ALLEVIATION OF TOXICITY BY MODULATION OF IRF3 - The invention provides compounds, compositions, animal models, drug screening methods, pharmaceutical compositions, and methods of treatment which relate to the modulation of the metabolism of xenobiotic compounds by administering agents which act on IRF3 or an IRF3 control pathway to modulate the activity, expression, or levels of cytochrome P450 enzymes involved in the metabolism of xenobiotic compounds in a subject. | 07-16-2009 |
20090181911 | Role of gax in alzheimer neurovascular dysfunction - Neurovascular disorder critically contributes to the development and pathogenesis of Alzheimer's disease (AD). Transcriptional profiling of human brain endothelial cells (BEC) defines a subset of age-independent genes significantly altered in AD including the homebox gene GAX whose expression controls vascular phenotype and is low in AD. By using viral-mediated GAX gene silencing and transfer, restoring GAX expression in AD BEC is angio-genic, transcriptionally suppresses the AFX1 forkhead transcription factor-mediated apoptosis, and increases the levels of a major amyloid β-peptide (Aβ) clearance receptor, the low density lipoprotein receptor-related protein 1 (LRP-1) at the blood-brain barrier. In a mouse model of Alzheimer's disease, deletion of the Gax gene results in reductions in brain capillary density and the resting cerebral blood flow, loss of angiogenic brain response to hypoxia, and an impaired Aβ brain efflux caused by reduced LRP-1 levels. The link of GAX gene to AD neurovascular dysfunction provides new mechanistic and therapeutic insights into AD. | 07-16-2009 |
20090181912 | GLP/1/EXENDIN 4 IgG Fc FUSION CONSTRUCTS FOR TREATMENT OF DIABETES - The invention is a method and composition for the prevention and treatment of type I and type II diabetes in a subject. The composition comprises an IgG-Fc fusion protein where the fusion protein comprises GLP-1, mutant GLP-1, or exendin-4. | 07-16-2009 |
20090186842 | Methods and compositions for inhibition of viral replication - The present invention is directed to methods and compositions that are effective in the inhibition of viral replication. In particular, the methods and compositions are effective at interfering with the activity of host cell proteins required in viral replication. For example, an embodiment of the invention is directed to methods and compositions comprising RNA sequences to which the host cell proteins TIAR and/or TIA-1 bind. | 07-23-2009 |
20090186843 | RNA sequence-specific mediators of RNA interference - The present invention relates to a Drosophila in vitro system which was used to demonstrate that dsRNA is processed to RNA segments 21-23 nucleotides (nt) in length. Furthermore, when these 21-23 nt fragments are purified and added back to Drosophila extracts, they mediate RNA interference in the absence of long dsRNA. Thus, these 21-23 nt fragments are the sequence-specific mediators of RNA degradation. A molecular signal, which may be their specific length, must be present in these 21-23 nt fragments to recruit cellular factors involved in RNAi. This present invention encompasses these 21-23 nt fragments and their use for specifically inactivating gene function. The use of these fragments (or chemically synthesized oligonucleotides of the same or similar nature) enables the targeting of specific mRNAs for degradation in mammalian cells, where the use of long dsRNAs to elicit RNAi is usually not practical, presumably because of the deleterious effects of the interferon response. This specific targeting of a particular gene function is useful in functional genomic and therapeutic applications. | 07-23-2009 |
20090186844 | SiRNA DELIVERY INTO MAMMALIAN NERVE CELLS - The present invention relates to methods of affecting expression of a target gene, suitably brain-derived neurotrophic factor (BDNF) or related genes in a nerve cell in the central nervous system of a mammal. The method includes formulating and delivering an siRNA composition to a target site on the mammal to affect expression of the target gene in the nerve cell, wherein the target site is cerebrospinal space or muscle tissue innervated by a nerve cell, to down-regulate the target gene. Also disclosed are kits for use in practicing the novel methods of in vivo siRNA.delivery into target cells and gene regulation. | 07-23-2009 |
20090186845 | INTERFERING RNA MOLECULES - The present invention is related to a ribonucleic acid comprising a double stranded structure whereby the double-stranded structure comprises a first strand and a second strand, whereby the first strand comprises a first stretch of contiguous nucleotides and whereby said first stretch is at least partially complementary to a target nucleic acid, and the second strand comprises a second stretch of contiguous nucleotides whereby said second stretch is at least partially identical to a target nucleic acid, and whereby the double stranded structure is blunt ended. | 07-23-2009 |
20090186846 | Methods to reprogram splice site selection in pre-messenger RNAs - The present invention relates to a method of modulating splice site selection, splicing and alternative, the method comprising the step of hybridizing an oligonucleotide-protein conjugate to a target pre-mRNA molecule in a cell or cell extract, wherein the oligonucleotide-protein conjugate comprises an oligonucleotide moiety which comprises at least two distinct sequence elements: (i) a nucleic acid sequence that is complementary to a specific region upstream of the splice site in the target pre-mRNA molecule; and (ii) an extension containing a protein binding site sequence element for covalently binding a protein; wherein the protein moiety comprises a protein capable of modulating splicing of the splice site upon binding with the protein binding site. | 07-23-2009 |
20090186847 | ANTISENSE ANTIVIRAL COMPOUNDS AND METHODS FOR TREATING A FILOVIRUS INFECTION - The invention provides antisense antiviral compounds and methods of their use and production in inhibition of growth of viruses of the Filoviridae family, and in the treatment of a viral infection. The compounds and methods relate to the treatment of viral infections in mammals including primates by Ebola and Marburg viruses. The antisense antiviral compounds are morpholino oligonucleotides having: a) a nuclease resistant backbone, b) 15-40 nucleotide bases, and c) a targeting sequence of at least 15 bases in length that hybridizes to a target region selected from the following: i) the Ebola virus AUG start site region of VP24; ii) the Ebola virus AUG start site region of VP35; iii) the Marburg virus AUG start site region of VP24; or iv) the Marburg virus AUG start site region of NP. | 07-23-2009 |
20090186848 | ANTISENSE ANTIVIRAL COMPOUNDS AND METHODS FOR TREATING A FILOVIRUS INFECTION - The invention provides antisense antiviral compounds and methods of their use and production in inhibition of growth of viruses of the Filoviridae family, and in the treatment of a viral infection. The compounds and methods relate to the treatment of viral infections in mammals including primates by Ebola and Marburg viruses. The antisense antiviral compounds are morpholino oligonucleotides having: a) a nuclease resistant backbone, b) 15-40 nucleotide bases, and c) a targeting sequence of at least 15 bases in length that hybridizes to a target region selected from the following: i) the Ebola virus AUG start site region of VP24; ii) the Ebola virus AUG start site region of VP35; iii) the Marburg virus AUG start site region of VP24; or iv) the Marburg virus AUG start site region of NP. | 07-23-2009 |
20090186849 | ANTISENSE ANTIVIRAL COMPOUNDS AND METHODS FOR TREATING A FILOVIRUS INFECTION - The invention provides antisense antiviral compounds and methods of their use and production in inhibition of growth of viruses of the Filoviridae family, and in the treatment of a viral infection. The compounds and methods relate to the treatment of viral infections in mammals including primates by Ebola and Marburg viruses. The antisense antiviral compounds are morpholino oligonucleotides having: a) a nuclease resistant backbone, b) 15-40 nucleotide bases, and c) a targeting sequence of at least 15 bases in length that hybridizes to a target region selected from the following: i) the Ebola virus AUG start site region of VP24; ii) the Ebola virus AUG start site region of VP35; iii) the Marburg virus AUG start site region of VP24; or iv) the Marburg virus AUG start site region of NP. | 07-23-2009 |
20090192100 | NOVEL USE OF SPIEGELMERS - The present invention relates to the use of a L-nucleic acid as intracellularly active agent. | 07-30-2009 |
20090192101 | CANCER-SPECIFIC PROMOTERS - The present invention regards cancer-specific control sequences that direct expression of a polynucleotide encoding a therapeutic gene product for treatment of the cancer. Specifically, the invention encompasses breast cancer-specific and ovarian cancer-specific control sequences. Two breast cancer-specific sequences utilize specific regions of fatty acid synthase and claudin 4 promoters, particularly in combination with a two-step transcription amplification sequence and/or a post-transcriptional control sequence. Two ovarian cancer-specific sequences utilize specific regions of hTERT and survivin promoters, particularly in combination with a two-step transcription amplification sequence and/or a post-transcriptional control sequence. In more particular embodiments, these polynucleotides are administered in combination with liposomes. | 07-30-2009 |
20090192102 | miR-21 REGULATED GENES AND PATHWAYS AS TARGETS FOR THERAPEUTIC INTERVENTION - The present invention concerns methods and compositions for identifying genes or genetic pathways modulated by miR-21, using miR-21 to modulate a gene or gene pathway, using this profile in assessing the condition of a patient and/or treating the patient with an appropriate miRNA. | 07-30-2009 |
20090192103 | Multitargeting Interfering RNAs Having Two Active Strands And Methods For Their Design And Use - Interfering RNA molecules are now designed and produced with specificity for multiple binding sequences present in distinct genetic contexts in one or more pre-selected target RNA molecules and are used to modulate expression of the target sequences. The multitargeting interfering RNA molecules have two strands that target multiple target sites on one or more pre-selected RNA molecules. Such a multitargeting interfering RNA approach provides a powerful tool for gene regulation. | 07-30-2009 |
20090192104 | RNA INTERFERENCE MEDIATED INHIBITION OF HYPOXIA INDUCIBLE FACTOR 1 (HIF1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating hypoxia inducible factor (e.g., HIF1) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of HIF1 gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of HIF1 genes. | 07-30-2009 |
20090192105 | RNA INTERFERENCE MEDIATED INHIBITION OF INTERCELLULAR ADHESION MOLECULE (ICAM) GENE EXPRESSION USING SHORT INTERFERING NUCELIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating intercellular adhesion molecule (ICAM) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of ICAM gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of ICAM genes. | 07-30-2009 |
20090192106 | MODULATION OF eIF4E EXPRESSION - Oligomeric compounds, compositions and methods are provided for modulating the expression of eIF4E. The antisense compounds may be single- or double-stranded and are targeted to nucleic acid encoding eIF4E. Methods of using these compounds for modulation of eIF4E expression and for diagnosis and treatment of diseases and conditions associated with expression of eIF4E are provided. | 07-30-2009 |
20090192107 | Breast Cancer Markers - A method for the detection of the presence of or the risk of cancer in a patient, comprising, with reference to a normal control, the step of: (i) detecting the expression level of a gene characterised by any of the nucleotide sequences identified herein as SEQ ID No. 1 to SEQ ID No. 10, in a sample isolated from a patient, wherein an increased expression level of the gene characterised by any of SEQ ID Nos. 1 to 6 and 10, or a decreased expression level of the gene characterised by any of SEQ ID Nos. 7 to 9, indicates the presence of or the risk of cancer in the patient from whom the sample was isolated. | 07-30-2009 |
20090192108 | Gene overexpressed in cancer - Disclosed are a protein encoded by a gene having a nucleotide sequence represented by any of SEQ ID NOs: 1 to 65 or a fragment thereof, an antibody recognizing the protein or antigen-binding fragment thereof, and a polynucleotide having a sequence comprising at least 12 consecutive nucleotides of a nucleotide sequence represented by any of SEQ ID NOs: 1 to 65 or a nucleotide sequence complementary thereto. The gene and the protein of the invention is useful for diagnosing and treating cancer. | 07-30-2009 |
20090192109 | Compositions for diagnosis and therapy of diseases associated with aberrant expression of Kremen and/or Wnt - The present invention relates to a composition useful for the diagnosis and therapy of diseases associated with aberrant expression of the gene encoding the receptor Kremen 1 and/or Kremen 2 e.g. tumors or diseases of the kidneys, bones and eyes, lipid and glucose metabolism and obesity. The present invention also relates to a pharmaceutical composition containing a compound which is capable of modifying (a) the expression of the gene encoding Kremen 1 and/or Kremen 2 or (b) the activity of the Kremen 1 and/or Kremen 2 receptor. | 07-30-2009 |
20090192110 | RNA ANTAGONIST COMPOUNDS FOR THE MODULATION OF PIK3CA EXPRESSION - The present invention relates to oligomeric compounds (oligomers), which target PIK3CA mRNA in a cell, leading to reduced expression of PIK3CA. Reduction of PIK3CA expression is beneficial for the treatment of certain medical disorders, such as hyperproliferative diseases (e.g., cancer). The invention provides therapeutic compositions comprising oligomers and methods for modulating the expression of PIK3CA using said oligomers, including methods of treatment. | 07-30-2009 |
20090192111 | miR-124 Regulated Genes and Pathways as Targets for Therapeutic Intervention - The present invention concerns methods and compositions for identifying genes or genetic pathways modulated by miR-124, using miR-124 to modulate a gene or gene pathway, using this profile in assessing the condition of a patient and/or treating the patient with an appropriate miRNA. | 07-30-2009 |
20090192112 | COMPOSITIONS AND METHODS FOR TREATING CANCER - The present invention relates to therapeutic targets for cancer. In particular, the present invention relates to small molecules and nucleic acids that target ATDC (TRIM29) expression in cancer with ATDC overexpression. | 07-30-2009 |
20090192113 | Interfering RNA Duplex Having Blunt-Ends and 3`-Modifications - The present invention relates to double-stranded RNA compounds with at least one blunt end comprising at least one 3′-end of formula | 07-30-2009 |
20090192114 | miR-10 Regulated Genes and Pathways as Targets for Therapeutic Intervention - The present invention concerns methods and compositions for identifying genes or genetic pathways modulated by miR-10, using miR-10 to modulate a gene or gene pathway, using this profile in assessing the condition of a patient and/or treating the patient with an appropriate miRNA. | 07-30-2009 |
20090192115 | USE OF COMPOUNDS THAT INTERFERE WITH THE HEDGEHOG SIGNALING PATHWAY FOR THE MANUFACTURE OF A MEDICAMENT FOR PREVENTING, INHIBITING, AND/OR REVERSING OCULAR DISEASES RELATED WITH OCULAR NEOVASCULARIZATION - The use of compounds that interfere with the hedgehog signaling pathway for the manufacture of a medicament for preventing, inhibiting, and/or reversing ocular diseases related with ocular neovascularization. Particularly, the above-mentioned diseases are (wet) age-related macular degeneration, (proliferative) diabetic retinopathy, neovascular glaucoma, retinal vein occlusion, or retinopathy of prematurity (ROP). | 07-30-2009 |
20090192116 | COMPOSITIONS AND METHODS FOR THE SUPPRESSION OF TARGET POLYNUCLEOTIDES FROM THE FAMILY APHIDIDAE - Methods and compositions are provided which employ a silencing element that, when ingested by a pest, such as a pest from the Aphididae family, they are capable of decreasing the expression of a target sequence in the pest. In specific embodiments, the decrease in expression of the target sequence controls the pest and thereby the methods and compositions are capable of limiting damage to a plant. The present invention provides target polynucleotides for specific protein classes and also target polynucleotides as set forth in SEQ ID NOS:1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or active variants or fragments thereof, wherein a decrease in expression of one or more the sequences in the target pest controls the pest (i.e., has insecticidal activity). Further provided are silencing elements which when ingested by the pest decrease the level of the target polypeptide and thereby control the pest. In specific embodiment, the pest is | 07-30-2009 |
20090192117 | COMPOSITIONS AND METHODS FOR THE SUPPRESSION OF TARGET POLYNUCLEOTIDES FROM LYGUS - Methods and compositions are provided which employ a silencing element that, when ingested by a pest, such as a pest from the | 07-30-2009 |
20090192118 | TAK1-D MEDIATED INDUCTION OF CELL DEATH IN HUMAN CANCER CELLS BY SPECIFIC SEQUENCE SHORT DOUBLE-STRANDED RNAS - The splicing variant D of the TAK1 gene is activated by short double-stranded RNAs in a sequence specific manner. Activation of TAK1-D leads to the downstream activation of the p38 MAPK and of SAPK/JNK but not the NFκB pathway. The current invention therefore provides a method of inducing apoptosis and/or cell cycle arrest in a cancer cell comprising contacting said cell with an agonist of Tak1-D function. The invention further provides a method of modulating inflammation and the treatment of cancer by the administration of an agonist of Tak1-D function or expression. In yet another aspect, the invention provides a method of inducing p38 MAPK and SAPK/JNK signaling in a cell comprising contacting said cell with an agonist of Tak1-D function or expression. | 07-30-2009 |
20090203635 | HXAAA01 Polynucleotides - The present invention relates to novel human secreted proteins and isolated nucleic acids containing the coding regions of the genes encoding such proteins. Also provided are vectors, host cells, antibodies, and recombinant methods for producing human secreted proteins. The invention further relates to diagnostic and therapeutic methods useful for diagnosing and treating diseases, disorders, and/or conditions related to these novel human secreted proteins. | 08-13-2009 |
20090209478 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF THE HAMP GENE - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the HAMP gene (HAMP gene), comprising an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of the HAMP gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by HAMP gene expression and the expression of the HAMP gene using the pharmaceutical composition. | 08-20-2009 |
20090209479 | THIOCARBON-PROTECTING GROUPS FOR RNA SYNTHESIS - Aspects of the invention include 2′ protected nucleoside monomers that are protected at the 2′ site with thiocarbon protecting groups. Thiocarbon protecting groups of interest include thiocarbonate, thionocarbonate, dithiocarbonate groups, as well as thionocarbamate protecting groups. Aspects of the invention further include nucleic acids that include the protecting groups of the invention, as well as methods of synthesizing nucleic acids using the protecting groups of the invention. | 08-20-2009 |
20090215711 | Novel compositions and methods in cancer - The present invention relates to novel sequences for use in detection, diagnosis and treatment of cancers, especially lymphomas. The invention provides cancer-associated (CA) polynucleotide sequences whose expression is associated with cancer. The present invention provides CA polypeptides associated with cancer that present novel therapeutic targets against cancer. The present invention further provides diagnostic compositions and methods for the detection of cancer. The present invention provides monoclonal and polyclonal antibodies specific for the CA polypeptides. The present invention also provides diagnostic tools and therapeutic compositions and methods for screening, prevention and treatment of cancer. | 08-27-2009 |
20090239815 | Novel human microRNAs associated with cancer - The invention provides new sequences for human microRNAs associated with cancer which may be used as molecular markers for cancer diagnostics or as therapeutic targets or agents. | 09-24-2009 |
20090239816 | Multitargeting Interfering RNAs And Methods Of Their Use And Design - Interfering RNA molecules are now designed and produced with specificity for multiple binding sequences present in distinct genetic contexts in one or more pre-selected target RNA molecules and are used to modulate expression of the target sequences. Such a multitargeting interfering RNA approach provides a powerful tool for gene regulation. | 09-24-2009 |
20090247482 | 50 Human Secreted Proteins - The present invention relates to novel human secreted proteins and isolated nucleic acids containing the coding regions of the genes encoding such proteins. Also provided are vectors, host cells, antibodies, and recombinant methods for producing human secreted proteins. The invention further relates to diagnostic and therapeutic methods useful for diagnosing and treating diseases, disorders, and/or conditions related to these novel human secreted proteins. | 10-01-2009 |
20090264381 | NUCLEIC ACID AND CORRESPONDING PROTEIN ENTITLED 151P3D4 USEFUL IN TREATMENT AND DETECTION OF CANCER - A novel gene (designated 151P3D4) and its encoded protein, and variants thereof, are described wherein 151P3D4 exhibits tissue specific expression in normal adult tissue, and is aberrantly expressed in the cancers listed in Table I. Consequently, 151P3D4 provides a diagnostic, prognostic, prophylactic and/or therapeutic target for cancer. The 151P3D4 gene or fragment thereof, or its encoded protein, or variants thereof, or a fragment thereof, can be used to elicit a humoral or cellular immune response; antibodies or T cells reactive with 151P3D4 can be used in active or passive immunization. | 10-22-2009 |
20090286753 | NOVEL OLIGONUCLEOTIDE COMPOSITIONS AND PROBE SEQUENCES USEFUL FOR DETECTION AND ANALYSIS OF MICRORNAS AND THEIR TARGET MRNAS - The invention relates to ribonucleic acids and oligonucleotide probes useful for detection and analysis of microRNAs and their target mRNAs, as well as small interfering RNAs (siRNAs). | 11-19-2009 |
20090291906 | Oligomeric Compounds And Compositions For Use In Modulation Of Small Non-Coding RNAs - Compounds, compositions and methods are provided for modulating the expression and function of small non-coding RNAs. The compositions comprise oligomeric compounds, targeted to small non-coding RNAs. Methods of using these compounds for modulation of small non-coding RNAs as well as downstream targets of these RNAs and for diagnosis and treatment of disease associated with small non-coding RNAs are also provided. | 11-26-2009 |
20090291907 | Oligomeric Compounds And Compositions For Use In Modulation Of Small Non-Coding RNAs - Compounds, compositions and methods are provided for modulating the expression and function of small non-coding RNAs. The compositions comprise oligomeric compounds, targeted to small non-coding RNAs. Methods of using these compounds for modulation of small non-coding RNAs as well as downstream targets of these RNAs and for diagnosis and treatment of disease associated with small non-coding RNAs are also provided. | 11-26-2009 |
20090298787 | Dsrna as Insect Control Agent - The present invention relates to methods for controlling pest infestation using double standard RNA molecules. The invention provides methods for making transgenic plants that express the double stranded RNA molecules, as well as pesticidal agents and commodity products produced by the inventive plants. | 12-03-2009 |
20090306005 | COMPOUNDS AND METHODS FOR MODULATING EXPRESSION OF PCSK9 - The present disclosure describes short antisense compounds, including such compounds comprising chemically-modified high-affinity monomers 8-16 monomers in length. Certain such short antisense compound are useful for the reduction of target nucleic acids and/or proteins in cells, tissues, and animals with increased potency and improved therapeutic index. Thus, provided herein are short antisense compounds comprising high-affinity nucleotide modifications useful for reducing a target RNA in vivo. Such short antisense compounds are effective at lower doses than previously described antisense compounds, allowing for a reduction in toxicity and cost of treatment. In addition, the described short antisense compounds have greater potential for oral dosing. | 12-10-2009 |
20090203765 | MODULATION OF EIF4E-BP2 EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of eIF4E-BP2. The compositions comprise oligonucleotides, targeted to nucleic acid encoding eIF4E-BP2. Methods of using these compounds for modulation of eIF4E-BP2 expression and for diagnosis and treatment of diseases and conditions associated with expression of eIF4E-BP2 are provided. | 08-13-2009 |
20090203766 | vWF aptamer formulations and methods for use - The invention relates to the formulation, dosing, administration and use of an aptamer antagonist therapeutic that binds to von Willebrand Factor. | 08-13-2009 |
20090203767 | INHIBITION STAT-1 - The present invention relates to inhibitors of the transcription factor STAT-1, their use as therapeutic means as well as their use for the prevention or therapy of cardio-vascular complications like restenosis after percutaneous angioplasty or stenosis of venous bypasses, the graft versus host reaction, the ischemia/refusion-related damage in the context of surgical interventions and organ transplantation respectively, immunological hypersensitivity reactions, in particular the allergic rhinitis, the drug and food allergies, in particular urticaria and celiac disease (sprue), contact eczema and the immune complex diseases, in particular alveolitis, arthritis, glomerulonephritis and allergic vasculitis, inflammatory chondro- and osteopathies, in particular arthrosis, gout, ostitis and osteomyelitis, polyneuritis as well as acute and subacute respectively, infection contingent and in particular post-infectious inflammatory diseases, in particular bronchitis, endocarditis, hepatitis, myocarditis, nephritis, pericarditis, peritonitis and pancreatitis, including the septic shock. | 08-13-2009 |
20090209618 | Pyruvate dehydrogenase kinases as therapeutic targets for cancer and ischemic diseases - The invention provides therapeutic and prophylactic compounds and methods for altering the activity of pyruvate dehydrogenase kinase (e.g. PDK1, PDK2, PDK3, PDK4). Such therapies are useful for the treatment of neoplasia. The invention further provides therapeutic and prophylactic compounds and methods of altering pyruvate dehydrogenase activity to treat or prevent cell death related to ischemia. | 08-20-2009 |
20090209619 | Depression of herg k+ channel function in mammallan cells and applications to the control of cancer cells division - The use of an HERG channel inhibitor for controlling the proliferation of cancer cells. Examples of such HERG channel inhibitors include dofetilide, cisapride, E-4031 and a siRNA molecule targeting a sequence involved in the expression of an HERG channel. Other ERG channels are also targets for these inhibitors. | 08-20-2009 |
20090209620 | Direct Reversal Of The Suppressive Function Of CD4+Regulatory T Cells Via Toll-Like Receptor 8 Signaling | 08-20-2009 |
20090209621 | Compositions and methods for decreasing microrna expression for the treatment of neoplasia - The invention generally features compositions and methods that are useful for treating or diagnosing a neoplasia. The invention is based in part on the observation that c-Myc activated expression of a cluster of six miRNAs on human chromosome 13. Accordingly, the invention provides therapeutic compositions and methods for altering the expression of a microRNA of the invention thereby treating a neoplasia, as well as compositions and methods for diagnosing a neoplasia. | 08-20-2009 |
20090209622 | Diagnosis of anxiety disorders - The invention relates to methods for diagnosing a genetic predisposition or susceptibility for anxiety disorders in a human. The methods include detecting particular markers at the human RGS2 locus in a sample obtained from the human. The invention also relates to the improved diagnosis that is based on the analysis of haplotypes for the RGS2 locus. | 08-20-2009 |
20090209623 | Anti-sense nucleic acid derived from organism - Disclosed are: a method for producing an anti-sense nucleic acid which has a wide variation in nucleotide sequences and excellent anti-sense properties at a low cost in a simple manner and in a large scale; and a cosmetic composition or pharmaceutical composition comprising the anti-sense nucleic acid. A method is discovered which can produce a low molecular weight nucleic acid having anti-sense properties from a nucleic acid starting material derived from an organism at a high yield by using a probe nucleic acid having at least a part of the nucleotide sequence of a target gene. An anti-sense nucleic acid produced by using a nucleic acid derived from an organism as a starting material; and a method for producing the anti-sense nucleic acid. | 08-20-2009 |
20090209624 | COMPOSITIONS AND THEIR USES FOR GENE THERAPY OF BONE CONDITIONS - In certain preferred embodiments, the present invention provides compositions and methods for the treatment of bone conditions associated with low bone density. In preferred embodiments, the present invention provides compositions and methods for the treatment of osteoprotegerin-responsive conditions. | 08-20-2009 |
20090209625 | MODULATION OF CHREBP EXPRESSION - Disclosed herein are compounds, compositions, and methods for modulating the expression of ChREBP in a cell, tissue or animal. Also provided are methods of target validation. Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and conditions. | 08-20-2009 |
20090209626 | Duplex Oligonucleotides with Enhanced Functionality in Gene Regulation - Disclosed are methods of enhancing functionality of duplex oligonucleotides and compositions made by the methods. The duplex oligonucleotides include siRNAs, miRNA mimics, and piRNA mimics which contain modified nucleotides and mismatches between the two strands of the molecule at specific nucleotide positions. | 08-20-2009 |
20090209627 | RNAi-MEDIATED INHIBITION OF CONNEXIN 43 FOR TREATMENT OF IOP-RELATED CONDITIONS - RNA interference is provided for inhibition of connexin 43 (Cx43) in intraocular pressure-related conditions, including ocular hypertension and glaucoma such as normal tension glaucoma and open angle glaucoma. | 08-20-2009 |
20090209628 | MULTIPLE RNAi EXPRESSION CASSETTES FOR SIMULTANEOUS DELIVERY OF RNAi AGENTS RELATED TO HETEROZYGOTIC EXPRESSION PATTERNS - The present invention provides compositions and methods suitable for expressing y-x multiple-RNAi agents against an allele or alleles of interest in cells, tissues or organs of interest in vitro and in vivo so as to treat diseases. | 08-20-2009 |
20090215859 | Compositions and methods for modulating dhr96 - Disclosed are compositions and methods for modulating DHR96 activity and identifying molecules that modulate DHR96 activity. | 08-27-2009 |
20090215860 | COMPOSITIONS AND METHODS FOR REGULATING GENE TRANSCRIPTION - The invention is directed to compositions and methods for RNA-mediated gene regulation, e.g., transcription regulation, e.g., by transcriptional silencing of genes. In one aspect, the invention provides methods using siRNAs directed at a transcription regulator, e.g., a promoter or enhance sequence, of a gene target molecule. In one aspect, this results in in vivo DNA methylation and/or modification of associated chromatin (e.g., histone proteins) accompanied by and/or partial or complete transcription gene silencing in a cell, such as a mammalian cell, e.g., a human cell. | 08-27-2009 |
20090215861 | Antisense oligonucleotides for treating allergy and neoplastic cell proliferation - Antisense oligonucleotides for treating and/or preventing at least one of asthma, allergy, hypereosinophilia, general inflammation and cancer are provided. The oligonucleotides are directed against nucleic acid sequences coding for a receptor selected from the group consisting of a CCR3 receptor and a common sub-unit of IL-3, IL-5 and GM-CSF receptors. | 08-27-2009 |
20090215862 | Micro rna - Micro RNA capable of interacting with the 3′ untranslated region of kit protein mRNA is useful in treating kit-dependent tumours, and inhibitors therefor are useful in treating suppressed haematopoiesis in cancer patients or abnormal erythropoiesis in β-thalassemia, for example. | 08-27-2009 |
20090215863 | Gene Silencing of Protease Activated Receptor 1(Par1) - The present invention relates to nucleic acid molecules, vectors, compositions, and methods useful for modulating protease-activated receptor 1 gene expression via RNA interference. In particular, the instant invention features small interfering RNA (siRNA) and short hairpin RNA (shRNA) molecules and methods for modulating the expression of protease-activated receptor 1 gene. | 08-27-2009 |
20090215864 | Oligoribonucleotide inhibitors of NRF2 and methods of use thereof for treatment of cancer - The invention provides novel double stranded oligoribonucleotides that inhibit the Nrf2 gene. The invention also provides a pharmaceutical composition comprising one or more such oligoribonucleotides, and a vector capable of expressing the oligoribonucleotide. The present invention also relates to methods and compositions for treating or preventing the incidence or severity of a cancerous disease, particularly various lung cancers. | 08-27-2009 |
20090215865 | Nucleic Acid Molecules and Collections Thereof, Their Application and Identification - The invention provides a method for characterising a sample comprising nucleic acid derived from a cell. The method comprises determining whether a sample comprises at least a minimal sequence of at least one new microRNA (miRNA) according to the invention or a mammalian ortholog thereof and characterizing the sample on the basis of the presence or absence of the miRNA. The invention further provides new nucleic acid molecules and collections thereof and their use in therapeutic and diagnostic applications. The invention furthermore provides a method for identifying a miRNA molecule or a precursor molecule thereof. | 08-27-2009 |
20090221670 | Method for diagnosis and treatment of a mental disease - The present invention relates to association of one or more polymorphisms located in the human NHP2L1, PACSIN2, SERHL, PIPPIN, BRD1, EP300, FAM19A5 and/or GPR24 genes to the occurrence of schizophrenia and/or bipolar disorder. The invention relates both to methods for diagnosing a predisposition to said diseases and for treating subjects having said diseases. | 09-03-2009 |
20090221671 | MODULATION OF LMW-PTPASE EXPRESSION - Disclosed herein are compounds, compositions and methods for modulating the expression of LMW-PTPase in a cell, tissue or animal. Also provided are methods of target validation. Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and disorders. Also provided are methods for the prevention, amelioration and/or treatment of diabetes, insulin resistance, insulin deficiency, hypercholesterolemia, hyperglycemia, dyslipidemia, hyperlipidemia, hypertriglyceridemia, and hyperfattyacidemia. In some embodiments, the diabetes is type II diabetes by administration of antisense compounds targeted to LMW-PTPase. | 09-03-2009 |
20090221672 | Biomarker for Prostate Cancer - The present invention provides a protein-based biomarker, Protein C Inhibitor (PCI) that is useful in qualifying prostate cancer status in a patient. In particular, the biomarker of this invention is useful to classify a subject sample as prostate cancer or non-prostate cancer. The biomarker can be detected by SELDI mass spectrometry. | 09-03-2009 |
20090221673 | Compositions and Methods for Regulating RNA Translation via CD154 CA-Dinucleotide Repeat - Compositions and methods for regulating CD154 gene expression are provided that rely on the interaction of hnRNP L with the CA-dinucleotide rich sequence of the 3′-untranslated region of CD154. | 09-03-2009 |
20090221674 | COMPOSITIONS AND METHODS FOR THERAPY AND DIAGNOSIS OF CANCER - The present invention is directed to siRNA molecules which specifically target and cause RNAi-induced degradation of mRNA from TPTE genes, so that the protein product of the TPTE gene is not produced or is produced in reduced amounts. The siRNA compounds and compositions of the invention are useful for treating diseases which require inhibition of TPTE expression for their treatment, in particular cancer pathologies. The present invention also includes methods which make possible to assess and/or prognose the metastatic behaviour of a cancer disease and/or the occurrence of a relapse of cancer. | 09-03-2009 |
20090221675 | USE OF IEX-1 FOR THE TREATMENT OF GLIOMA TUMORS - The present invention relates to a nucleic acid molecule encoding for IEX-1 polypeptide as a medicament. In a further aspect the present invention relates to a nucleic acid molecule encoding for IEX-1 polypeptide for the manufacture of a medicament for the treatment of gliomas. | 09-03-2009 |
20090221676 | GLUCOSE-TRANSPORT RELATED GENES, POLYPEPTIDES, AND METHODS OF USE THEREOF - Methods and compositions for modulating glucose transport are provided herein. | 09-03-2009 |
20090221677 | Methods for Reducing Body Fat and Increasing Lean Body Mass by Reducing Stearoyl-COA Desaturase 1 Activity - It is disclosed here that inhibiting the activity of the enzyme stearoyl-CoA desaturase (SCD1) in an animal causes the animal to have less body fat and greater lean body mass. The lower of SCD1 activity level can be accomplished by inhibiting activity of the enzyme or lowering levels of active enzyme in the subject. | 09-03-2009 |
20090221678 | Compositions and Methods for Treatment of Prostate and Other Cancers - Therapeutic agents which target heat shock protein (hsp) 27 in vivo are used to provide treatment to individuals, particularly human individuals, suffering from prostate cancer and other cancers that overexpress hsp27. A therapeutic agent, for example an antisense oligonucleotide or RNAi nucleotide inhibitor with sequence specificity for hsp27 mRNA, for example human hsp27 mRNA, is administered to an individual suffering from prostate cancer or some other cancer expressing elevated levels of hsp 27 in a therapeutically effective amount. The therapeutic agent is suitably formulated into a pharmaceutical composition which includes a pharmaceutically acceptable carrier, and packaged in dosage unit form. A preferred dosage unit form is an injectable dosage unit form. | 09-03-2009 |
20090239931 | RNA INTERFERENCE MEDIATED INHIBITION OF PROTEIN TYROSINE PHOSPHATASE-1B (PTP-1B) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating protein tyrosine phosphatase-1B (PTP-1B) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of PTP-1B gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of PTP-1B genes. Such small nucleic acid molecules are useful, for example, for treating, preventing, inhibiting, or reducing obesity, insulin resistance, diabetes (eg. type II and type I diabetes) in a subject or organism, and for any other disease, trait, or condition that is related to or will respond to the levels of PTP-1B in a cell or tissue, alone or in combination with other treatments or therapies. | 09-24-2009 |
20090239932 | Antisense oligonucleotides against protein kinase isoforms alpha, beta and gamma - Antisense compounds are provided for inhibiting PKB (protein kinase B) alpha, beta and gamma. The antisense compounds display high potency and selectivity. The antisense compounds do not suffer from problems of dimerisation or self-hybridization and have also been selected to not affect other enzymes. The antisense compounds may be used singularly or in combination to inhibit one, two or all of PKB alpha, beta and gamma and hence treat conditions in which these enzymes are important. | 09-24-2009 |
20090239933 | HEPATITIS C ANTIVIRALS - The present invention relates to deoxyribozymes targeting and cleaving HCV RNA. More particularly, the present invention relates to deoxyribozymes and composition used for the inhibition of HCV replication and HCV-related diseases. | 09-24-2009 |
20090239934 | Anti-Myosin Va siRNA and Skin Depigmentation - The present invention relates to novel isolated siRNAs comprising a sense RNA strand and a complementary antisense RNA strand which together form an RNA duplex, characterized in that the sense RNA strand comprises a sequence which has at most one nucleotide that is distinct in relation to a fragment of 14 to 30 contiguous nucleotides of the nucleotide sequence of exon F of the gene encoding the myosin Va protein, and also to compositions comprising at least one such siRNA, and to the use of at least one such siRNA as a cosmetic or therapeutic agent for skin depigmentation. | 09-24-2009 |
20090239935 | RNA-HELICASE AS A MARKER FOR RARE TUMORS - Method for the diagnosis of diseases in a mammal, preferably in a human, wherein a probe from the mammal is examined with a view to an elevated level of RNA helicase and the elevated level of RNA helicase indicates the disease. The disease refers to esophagus carcinoma, pancreas carcinoma, stomach carcinoma, hepatocellular carcinoma, hepatoblastoma and cholangiocellular carcinoma. | 09-24-2009 |
20090239936 | Prophylactic and Therapeutic Agent for Cancer - A Ras, Raf, MEK, ERK or RSK inhibitor, namely a P-glycoprotein expression inhibitor or a BCRP expression inhibitor, can be screened by utilizing the MAPK signaling activity as an indicator. It becomes possible to provide an anticancer agent which is reduced in resistance acquisition, and also provide an agent for preventing the resistance against an anticancer agent, which can enhance the therapeutic effect of the anticancer agent against cancer. | 09-24-2009 |
20090247604 | RNAi Therapeutics for Treatment of Eye Neovascularization Diseases - Compositions and methods for treating ocular disease are provided. Specifically, siRNA molecules and mixtures of siRNA molecules are provided that inhibit angiogenesis and/or neovascularization. The compositions and methods are suitable for treating ocular diseases associated with angiogenesis and/or neovascularization. | 10-01-2009 |
20090247605 | Treating diseases mediated by metalloprotease-shed proteins - This invention relates to the identification of membrane-associated proteins shed by metalloproteinases and in particular by TNF-alpha converting enzyme (TACE), to the use of such metalloproteinase-shed proteins in assays for TACE agonists and antagonists, and to the use of metalloproteinase agonists and antagonists, and particularly TACE agonists and antagonists, in the treatment of diseases mediated by certain shed proteins. | 10-01-2009 |
20090247606 | RNA Interference Mediated Inhibition of Adenosine A1 Receptor (ADORA1) Gene Expression Using Short Interfering Nucleic Acid (siNA) - The present invention concerns methods and reagents useful in modulating adenosine A1 receptor (ADORA1) gene expression in a variety of applications, including use in therapeutic, diagnostic, target validation, and genomic discovery applications. Specifically, the invention relates to small interfering RNA (siRNA) molecules capable of mediating RNA interference (RNAi) against ADORA1 and related receptors. | 10-01-2009 |
20090247607 | dsRNA COMPOSITIONS AND METHODS FOR TREATING HPV INFECTION - The invention relates to a double-stranded ribonucleic acid (dsRNA) for treating human papilloma virus (HPV) infection. The dsRNA comprises an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of an HPV Target gene selected from among HPV E1, HPV E6 and the human E6AP gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by HPV infection and the expression of the E6AP gene using the pharmaceutical composition; and methods for inhibiting the expression of the HPV Target genes in a cell. | 10-01-2009 |
20090247608 | Targeting Lipids - The present invention provides targeting lipids of structure | 10-01-2009 |
20090247609 | SM-PROTEIN BASED SECRETION ENGINEERING - The present invention concerns the field of cell culture technology. It describes a novel method for enhancing the secretory transport of proteins in eukaryotic cells by heterologous expression of Munc18c, Sly1 or other members of the SM protein family. This method is particularly useful for the generation of optimized host cell systems with enhanced production capacity for the expression and manufacture of recombinant protein products. | 10-01-2009 |
20090247610 | INTEGRASE COFACTOR - The present invention provides nucleic acid molecules which include a region specifically interacting with the nucleic acid encoding the LEDGF/P75 protein or the nucleic acid encoding a fragment of a LEDGF/P75 protein and methods and uses of such nucleic acid molecules. | 10-01-2009 |
20090247611 | METHOD OF TREATING A CANCER WITH A SURVIVIN ANTISENSE OLIGONUCLEOTIDE AND PACLITAXEL - Provided is a method of treating cancer of the stomach, comprising administering to a patient a therapeutically effective combination of a Survivin antisense oligonucleotide and paclitaxel. | 10-01-2009 |
20090253769 | Inhibitors of mammalian hdac 11 useful for treating hdac 11 mediated disorders - The present invention, relies, in part, on the discovery of the role of HDAC 11 in various cell proliferative disorders including cancer. In the main, the invention provides for methods of inhibiting HDAC 11 as a means of treating cell proliferative disorders. Reagents for use in inhibiting human HDAC 11 are also provided. | 10-08-2009 |
20090253770 | Target gene mimitin of myc - A new diagnosis or treatment of cancer is provided. The present invention provides a protein Mimitin which is a target of a cancer gene myc protein, a variant thereof and a fragment thereof, as well as a polynucleotide molecule encoding them. An inhibitory substance of biological activity of the present invention, which is afforded by the binding of a polynucleotide molecule encoding a Mimitin protein and Myc provides a useful means for the diagnosis, prophylaxis or treatment of cancer. | 10-08-2009 |
20090253771 | INHIBITION OF GLIOTOXIN - The present invention relates to the inhibition of the interaction between Gliotoxin (GT) and its intracellular target for the prevention and/or treatment of fungal infections. Further, novel methods and systems for identifying antifungal agents are disclosed. | 10-08-2009 |
20090253772 | RNA INTERFERENCE MEDIATED INHIBITION OF CXCR4 GENE EXPRESSION USING SHORT INTERFERING NUCELEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating chemokine receptor (CXCR) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of CXCR gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of CXCR genes such as CXCR4 and CXCR7A. | 10-08-2009 |
20090253773 | RNA INTERFERENCE MEDIATED INHIBITION OF TNF AND TNF RECEPTOR GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating tumor necrosis factor and/or tumor necrosis factor receptor gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of tumor necrosis factor and/or tumor necrosis factor receptor gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of tumor necrosis factor and/or tumor necrosis factor receptor genes, (TNF and/or TNF receptor). | 10-08-2009 |
20090253774 | RNA INTERFERENCE MEDIATED INHIBITION OF PLATELET DERIVED GROWTH FACTOR (PDGF) AND PLATELET DERIVED GROWTH FACTOR RECEPTOR (PDGFR) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating platelet derived growth factor (PDGF) and/or platelet derived growth factor receptor (PDGFr) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of platelet derived growth factor (PDGF) and/or platelet derived growth factor receptor (PDGFr) gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of platelet derived growth factor (PDGF) and/or platelet derived growth factor receptor (PDGFr) genes, such as PDGF and/or PDGFr. | 10-08-2009 |
20090253775 | Compositions and Methods for Therapy and Diagnosis of Cancer and Cancer Metastasis - The present invention relates to methods which make possible to assess and/or prognose a cancer disease, the metastatic behaviour of a cancer disease and/or the occurrence of a relapse of cancer. In particular, the methods of the invention make possible to assess and/or prognose the occurrence of cancer metastasis, in particular distant metastasis. Preferably, the methods of the invention allow to discriminate malign from benign conditions. | 10-08-2009 |
20090253776 | siRNA targeting gremlin - Efficient sequence specific gene silencing is possible through the use of siRNA technology. By selecting particular siRNAs by rational design, one can maximize the generation of an effective gene silencing reagent, as well as methods for silencing genes. Methods, compositions, and kits generated through rational design of siRNAs are disclosed including those directed to CKSF1B1. | 10-08-2009 |
20090258923 | Carrier Composition for Nucleic Acid Transport - An object of the present invention is to provide a nucleic acid delivery carrier composition of low toxicity and high safety, the carrier composition, when used to administer a nucleic acid such as an siRNA into an animal-derived cell or organism, being capable of delivering efficiently the nucleic acids into the cells while protecting it from being degraded; and a nucleic acid deliver composition containing the carrier and a nucleic acid. | 10-15-2009 |
20090258924 | METHODS, COMPOSITIONS AND DRUG DELIVERY SYSTEMS FOR INTRAOCULAR DELIVERY OF siRNA MOLECULES - Biocompatible intraocular drug delivery systems in the form of an implant for intraocular administration of siRNA molecules. The drug delivery systems may be placed in an eye to treat or reduce the occurrence of one or more ocular conditions, such as retinal damage, including glaucoma and proliferative vitreoretinopathy among others. | 10-15-2009 |
20090258925 | NATURAL ANTISENSE AND NON-CODING RNA TRANSCRIPTS AS DRUG TARGETS - Small interfering RNA (siRNA) knock down antisense transcripts, and regulate the expression of their sense partners. This regulation can either be discordant (antisense knockdown results in sense transcript elevation) or concordant (antisense knockdown results in concomitant sense transcript reduction). | 10-15-2009 |
20090258926 | Methods and Compositions for Delivering siRNA into Mammalian Cells - Complex comprising a peptide carrier of SEQ ID NO:1 GALFLGFLGAAGSTMGAWSQPKR | 10-15-2009 |
20090258927 | Method for the Modulation of Function of Transcription Factors - There is provided a method of modulating the function of transcription factor by administering an effective amount of an oligonucleotide containing optimal nucleotide binding sites for the transcription factor. A therapeutic agent having an effective amount of an oligonucleotide for modulating function of transcription factors and a pharmaceutically acceptable carrier is also provided. Also provided is a treatment of patients having illnesses in which the activation of transcription factors play a role by administering to a patient an effective amount of an oligonucleotide which competitively binds the related transcription factor. | 10-15-2009 |
20090258928 | METHODS AND COMPOSITIONS FOR DIAGNOSING AND MODULATING HUMAN PAPILLOMAVIRUS (HPV) - The present invention concerns methods and compositions for treating a patient having, suspected of having, or at risk of obtaining a HPV infection. | 10-15-2009 |
20090258929 | Compositions and Methods for Modulating mTOR Signaling - The present invention relates to the use of antagonists of the mTOR signaling pathway and its constituent members (e.g., antagonists of MAPKAP) for the treatment, amelioration, and diagnosis of PI3K/AKT/mTOR-related disorders, e.g., cancers. The present invention also relates to methods of using modulators of mTOR (e.g., modulators of MAPKAP) for the treatment, amelioration, and diagnosis of PI3K/AKT/mTOR-related disorders, e.g., cancers. Assays for the identification of modulators of mTOR, MAPKAP, and hVPS34 are also provided. | 10-15-2009 |
20090264501 | Methods and Compositions to Inhibit P2x7 Receptor Expression - Methods and compositions for the downregulation of P2X7 receptor expression or activity are disclosed. Preferred compositions comprise siNA. The methods and compositions are useful in the treatment of diseases characterised by increased 112X7 receptor activity, such as neuronal degeneration, Alzheimer's disease, inflammatory diseases, and some cancers. | 10-22-2009 |
20090264502 | COMPOSITIONS AND THEIR USES DIRECTED TO HSP27 - Disclosed herein are compounds, compositions and methods for modulating the expression of HSP27 in a cell, tissue or animal. Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and disorders. | 10-22-2009 |
20090264503 | SHORT INTERFERENCE RIBONUCLEIC ACIDS FOR TREATING ALLERGIC DISEASES - Provided herein are compounds, methods and compositions for treating allergic diseases. In particular, an isolated double stranded short interfering ribonucleic acid (siRNA) with a ribonucleotide sequence complementary to at least a portion of a target gene RNA such as an airway inflammation related-gene RNA, thereby resulting in the cleavage of the expressed target gene RNA via RNA interference mechanism, and is useful as a medicament for treating allergy by alleviating or minimizing airway inflammation of a subject. | 10-22-2009 |
20090264504 | RNA INTERFERENCE MEDIATED INHIBITION OF HUMAN IMMUNODEFICIENCY VIRUS (HIV) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating human immunodeficiency virus (HIV) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of human immunodeficiency virus (HIV) gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of HIV genes. The small nucleic acid molecules are useful in the treatment of HIV infection, AIDS, and/or diseases and conditions related to HIV infection and/or AIDS in a subject or organism. | 10-22-2009 |
20090264505 | METHODS AND COMPOSITIONS FOR RNAI MEDIATED INHIBITION OF GENE EXPRESSION IN MAMMALS - Methods and compositions are provided for modulating, e.g., reducing, expression of a target sequence in mammals and mammalian cells. In the subject methods, an effective amount of an RNAi agent, e.g., an interfering ribonucleic acid (such as an siRNA or shRNA) or a transcription template thereof, e.g., a DNA encoding an shRNA, is introduced into a target cell, e.g., by being administered to a mammal that includes the target cell, e.g., via a hydrodynamic administration protocol. Also provided are RNAi agent pharmaceutical preparations for use in the subject methods. The subject methods and compositions find use in a variety of different applications, including academic and therapeutic applications. | 10-22-2009 |
20090264506 | DELIVERY OF POLYNUCLEOTIDE AGENTS TO THE CENTRAL NERVOUS SYSTEM - The present invention provides a method for delivering polynucleotide agents, particularly oligonucleotides, to the CNS of a mammal by way of a neural pathway originating in the nasal cavity or through a neural pathway originating in an extranasal tissue that is innervated by the trigeminal nerve. | 10-22-2009 |
20090270479 | Genetic and Epigenetic Alterations In the Diagnosis and Treatment of Cancer - Methylation of DNA in regions involved in transcriptional regulation can induce the binding of ICBP90 and the subsequent formation of multiprotein complexes which alter gene transcription. DNA methylation in tumor suppressor genes, or in other genes which are involved in mitigating tumorigenesis, can induce binding of ICBP90 to those genes. Bound ICBP90 can interact with a pRb2/p130 regulatory complexes to remodel chromatin and inhibit transcription of the gene. DNA methyltransferases, ICBP90, and the proteins comprising the pRb2/p130 complex are therefore therapeutic targets for the treatment of cancer. Abnormalities in these proteins can also be markers of cancerous or precancerous conditions. | 10-29-2009 |
20090270480 | Markers and Methods for Assessing and Treating Psoriasis and Related Disorders - A method for prognostic or diagnostic assessment of a skin-related disorder, such as psoriasis, in a subject correlates the presence, absence, and/or magnitude of a gene in a sample with a reference standard to determine the presence and/or severity of the disorder, and/or the response to treatment for the disorder. The method enables identification of the effectiveness of candidate therapies. | 10-29-2009 |
20090270481 | MODIFIED siRNA MOLECULES AND USES THEREOF - The present invention provides chemically modified siRNA molecules and methods of using such siRNA molecules to silence target gene expression. Advantageously, the modified siRNA of the present invention is less immunostimulatory than its corresponding unmodified siRNA sequence and retains RNAi activity against the target sequence. The present invention also provides nucleic acid-lipid particles comprising a modified siRNA, a cationic lipid, and a non-cationic lipid, which can further comprise a conjugated lipid that inhibits aggregation of particles. The present invention further provides methods of silencing gene expression by administering a modified siRNA to a mammalian subject. Methods for identifying and/or modifying an siRNA having immunostimulatory properties are also provided. | 10-29-2009 |
20090275631 | THERAPEUTIC ANTISENSE OLIGONUCLEOTIDE COMPOSITION FOR THE TREATMENT OF INFLAMMATORY BOWEL DISEASE - Disclosed herein is a method for the sustained amelioration and/or treatment of ulcerative colitis comprising rectal administration of a compound comprising an antisense oligonucleotide having the sequence 5′-GCCCAAGCTGGCATCCGTCA-3′, ISIS 2302. The method results in a decrease in the indications of ulcerative colitis for an extended period (greater than 90 days) after the conclusion of the administration of the composition. The composition is well tolerated and systemic exposure is minimal. | 11-05-2009 |
20090275632 | Methods of diagnosis and treatment - A method of diagnosing a disease in which an miRNA is expressed at a lower level comprises, in a test sample obtained from a subject, determining the methylation status of at least one gene encoding the miRNA in the sample, wherein the presence of methylation is indicative of the presence of the disease. Methylation of the gene causes a down regulation in expression which may also be monitored. Related methods and kits are also described based upon methylation of miRNA encoding genes. The primary miRNA of interest is 124a miRNA. | 11-05-2009 |
20090275633 | Novel Tumour Suppressor - A method of diagnosing cancer includes the steps of, in a sample obtained from a subject, determining the level or activity of HDAC2. A reduced level or activity of HDAC2 is indicative of cancer. HDAC2 protein expression is preferably determined. Indirect determination of HDAC2 expression is also possible, preferably by looking at the expression of genes selected from NCOA4, CTSB, TBCD, PPP2R4 and CORO1C. Methods for predicting the probability of successful treatment of cancer using a hydroxamic acid based HDAC inhibitor and for selecting suitable cancer treatment regimens can also be based upon determining the level or activity of HDAC2. Methods of treatment of cancer may be based upon use of carboxylic acid based HDAC inhibitors or by reconstituting HDAC2 activity. | 11-05-2009 |
20090275634 | ANTISENSE OLIGONUCLEOTIDES AGAINST ACETYLCHOLINESTERASE FOR TREATING INFLAMMATORY DISEASES - The present invention relates to novel uses of antisense oligonucleotides targeted to the coding region of acetylcholinesterase (AChE) for treating inflammatory disorders other than inflammatory disorders of the central nervous system or the peripheral nervous system innervating voluntary muscles. More particularly, the present invention relates to uses of antisense oligodexoynucleotides targeted to AChE mRNA for treating inflammatory disease of the gastrointestinal tract including inflammatory bowel disease. | 11-05-2009 |
20090275635 | SCREENING METHOD - The invention provides a method of modulating Wnt signalling comprising modulating Trabid activity. Preferably modulating Trabid activity comprises inhibiting; Trabid activity. The invention also provides a method of reducing TCF transcription, said method comprising reducing Trabid activity. A method for identifying a-modulator of Trabid said method comprising; providing a Trabid substrate comprising a detectable moiety coupled to a tag moiety by ubiquitin; immobilising first and second portions of said substrate; adding a candidate modulator to the first said portion; contacting first and second portions with Trabid; incubating to allow Trabid action, assaying cleavage of ubiquitin by separation of tag from detectable moiety, wherein separation of an amount of detectable moiety from said first portion which is different from the amount of detectable moiety separated from said second portion identifies said candidate as a modulator of Trabid. The invention provides uses of Trabid and of Trabid inhibitors as-medicaments. | 11-05-2009 |
20090275636 | PICORNAVIRUS AND USES THEREOF - The invention is directed to a a clade of newly isolated and identified picornaviruses associated with respiratory infection, and isolated nucleic acids sequences and peptides thereof. The invention also relates to antibodies against antigens derived from the picornavirus. The invention also relates to iRNAs which target nucleic acid sequences of the picornavirus. The invention is related to methods for detecting the presence or absence of picornavirus in a subject. The invention is also related to immunogenic compositions for inducing an immune response against picornavirus in a subject. | 11-05-2009 |
20090275637 | PROTEIN TYROSINE PHOSPHATASE INHIBITORS - The present invention provides compositions and methods for binding and/or modulating enzymatic activity of human protein tyrosine phosphatases such as PTP1B. Additionally, the invention provides methods of identifying and using such nucleic acid ligands. | 11-05-2009 |
20090275638 | Compositions and Methods for Inhibiting Expression of XBP-1 Gene - The invention relates to a double-stranded ribonucleic acid (dsRNA) targeting X-Box Protein 1 (XBP-1), and methods of using the dsRNA to inhibit expression of XBP-1. | 11-05-2009 |
20090275639 | USP47 INHIBTORS AND METHODS TO INDUCE APOPTOSIS - The present invention relates to USP47 (ubiquitin specific protease 47) inhibitors and methods for inducing apoptosis or cell death in a target cell. In certain embodiments, the invention relates to methods and kits to screen for related agents that induce apoptosis. Additionally, the invention relates to assays for screening compounds capable of acting as USP47 inhibitors. | 11-05-2009 |
20090275640 | siRNA targeting inner centromere protein antigens (INCENP) - Efficient sequence specific gene silencing is possible through the use of siRNA technology. By selecting particular siRNAs by rational design, one can maximize the generation of an effective gene silencing reagent, as well as methods for silencing genes. Methods, compositions, and kits generated through rational design of siRNAs are disclosed including those directed to nucleotide sequences for INCENP. | 11-05-2009 |
20090275641 | RNAi-Mediated Inhibition of RHO Kinase for Treatment of Ocular Disorders - RNA interference is provided for inhibition of Rho kinase mRNA expression for treating patients with ocular disorders, particularly for treating intraocular pressure, ocular hypertension and glaucoma. Rho kinase mRNA targets include mRNA for ROCK1 and ROCK2. | 11-05-2009 |
20090281163 | REGULATORY ELEMENTS THAT MEDIATE RETINAL CELL-SPECIFIC GENE EXPRESSION - Isolated nucleic acid molecules including regulatory elements that direct retinal-cell specific expression are provided. Methods for treating or preventing retinal disorders in a subject are also provided. | 11-12-2009 |
20090281164 | RNA INTERFERENCE MEDIATED INHIBITION OF RESPIRATORY SYNCYTIAL VIRUS (RSV) EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating sespiratory syncytial virus (RSV) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of RSV gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of RSV genes, including cocktails of such small nucleic acid molecules and lipid nanoparticle formulations of such small nucleic acid molecules cocktails thereof. The application also relates to methods of treating diseases and conditions associated with RSV gene expression, such as RSV infection, respiratory failure, bronchiolitis and pneumonia, as well as providing dosing regimens and treatment protocols. | 11-12-2009 |
20090281165 | Antisense oligonucleotide against human acetylcholinesterase (AChE) and uses thereof - The invention relates to an antisense oligonucleotide targeted to the coding region of the human acetylcholinesterase (AChE), which selectively suppresses the AChE-R isoform of the enzyme. The antisense oligonucleotide is intended for use in the treatment and/or prevention of neuromuscular disorders, preferably myasthenia gravis. In addition, it can penetrate the blood-brain barrier (BBB) and destroy AChE-R within central nervous system neurons, while also serving as a carrier to transport molecules across the BBB. | 11-12-2009 |
20090281166 | Treatment of Cancer by Inhibition of HSP27 - A cancer is evaluated for selection of appropriate therapy by evaluating a sample of cancerous tissue to determine an expression of level of phosphatase and tensin homologue deleted from chromosome 10 (PTEN); and in the case where the expression level of functional PTEN is below a threshold level, identifying the cancer as susceptible to an active agent that inhibits the expression of heat shock protein 27 (hsp27). The evaluation may be included as part of a method of treatment, in which an hsp27 inhibitor is selected as a therapeutic agent when the PTEN level is below the threshold. | 11-12-2009 |
20090281167 | COMPOSITIONS AND METHODS RELATED TO MIRNA MODULATION OF NEOVASCULARIZATION OR ANGIOGENESIS - The present invention concerns methods and compositions for diagnosing and/or treating vascular diseases including cancer, cardiac diseases, vascular diseases of the eye, and inflammatory diseases. The methods involve measuring the levels of one or multiple miRNAs in patient samples and using the test results to diagnose and/or predict an optimal treatment regimen for the patient. Compositions described in the invention include nucleic acids that function as miRNAs or miRNA inhibitors that can be introduced to a patient to reduce or increase vascularization as needed. | 11-12-2009 |
20090286849 | MODULATION OF INSULIN LIKE GROWTH FACTOR I RECEPTOR EXPRESSION - The present invention provides compositions and methods for modulating the expression of growth factor gene. In particular, this invention relates to compounds, particularly oligonucleotide compounds, which, in preferred embodiments, hybridize with nucleic acid molecules encoding the Insulin Like Growth Factor I receptor (IGF-I receptor or IGF-IR) and in particular human IGF-IR. Such compounds are exemplified herein to modulate proliferation which is relevant to the treatment of proliferative and inflammatory skin disorders and cancer. It will be understood, however, that the compounds can be used for any other condition in which the IGF-IR is involved including inflammatory condition. | 11-19-2009 |
20090286850 | Inhibition of EMT induction in tumor cells by anti-cancer agents - The present invention provides methods of identifying an agents that inhibit tumor cells from undergoing an epithelial to mesenchymal transition, impair tumor cell mobility, and thus inhibit tumorigenicity. The present invention also provides compositions comprising said agents, and methods for their preparation and use. The present invention also provides methods for inhibiting tumor cells in a patient from undergoing an epithelial to mesenchymal transition by administration of inhibitors of PAK2 kinase, that optionally also inhibit PAK1 kinase. Such methods may be employed in combination with other anti-cancer agents such as EGFR or IGF-1R kinase inhibitors. | 11-19-2009 |
20090286851 | Compositions and Methods for Delivering RNAI Using Lipoproteins - This invention relates to new compositions comprising at least one of a single or double stranded oligonucleotide, where said oligonucleotide has been conjugated to a lipophile and to which the conjugated oligonucleotide has been preassembled with lipoproteins. These compositions are effectively in delivering oligonucleotides to mammalian tissue where they effect gene silencing. | 11-19-2009 |
20090292002 | NUCLEOTIDE AND AMINO ACID SEQUENCES RELATING TO RESPIRATORY DISEASES AND OBESITY - This invention relates to genes identified from human chromosome 12q23-qter, which are associated with various diseases, including asthma. The invention also relates to the nucleotide sequences of these genes, isolated nucleic acids comprising these nucleotide sequences, and isolated polypeptides or peptides encoded thereby. The invention further relates to vectors and host cells comprising the disclosed nucleotide sequences, or fragments thereof, as well as antibodies that bind to the encoded polypeptides or peptides. Also related are ligands that modulate the activity of the disclosed genes or gene products. In addition, the invention relates to methods and compositions employing the disclosed nucleic acids, polypeptides or peptides, antibodies, and/or ligands for use in diagnostics and therapeutics for asthma and other diseases. | 11-26-2009 |
20090292003 | CELL PENETRATING PEPTIDES FOR INTRACELLULAR DELIVERY OF MOLECULES - The present invention concerns cell-penetrating peptides which comprise an amino acid sequence consisting of GLX | 11-26-2009 |
20090292004 | Methods to identify compounds useful for the treatment of proliferative and differentiative disorders - The present invention relates to the discovery and characterization of activity of Fbp1, a substrate-targeting ubiquitin ligase subunit. The invention encompasses interactions between Fbp1 and its substrates, including Fbp5, β-Catenin, and IκBα. The invention also encompasses interactions between the Fbp1 isoform β-Trcp2 and its substrates, including Fbp5, b-Catenin, and IκBα. The present invention relates to screening assays that use Fbp1 and/or β-Trcp2 to identify potential therapeutic agents such as small molecules, compounds or derivatives which modulate Fbp1 and/or β-Trcp2 activity for the treatment of proliferative and differentiative disorders, including infertility, cancer, major opportunistic infections, immune disorders, certain cardiovascular diseases, and inflammatory disorders. The invention also encompasses methods to diagnose and treat Fbp1-related infertility disorders. The invention further encompasses therapeutic protocols and pharmaceutical compositions designed to target Fbp1 and its substrates for the treatment of infertility. | 11-26-2009 |
20090292005 | GALACTOSE DERIVATIVE, DRUG CARRIER AND MEDICINAL COMPOSITION - The object of the present invention is to provide a novel and useful galactose derivative, which is a component of a drug carrier by which a medicine can be efficiently transferred into the liver, a drug carrier comprising the derivative, and a pharmaceutical composition comprising the drug carrier and a medicine. | 11-26-2009 |
20090292006 | COMPOUNDS AND METHODS FOR MODULATING EXPRESSION OF DGAT2 - The present disclosure describes short antisense compounds, including such compounds comprising chemically-modified high-affinity monomers 8-16 monomers in length. Certain such short antisense compound are useful for the reduction of target nucleic acids and/or proteins in cells, tissues, and animals with increased potency and improved therapeutic index. Thus, provided herein are short antisense compounds comprising high-affinity nucleotide modifications useful for reducing a target RNA in vivo. Such short antisense compounds are effective at lower doses than previously described antisense compounds, allowing for a reduction in toxicity and cost of treatment. In addition, the described short antisense compounds have greater potential for oral dosing. | 11-26-2009 |
20090292007 | Inhibition of TACE or amphiregulin for the Modulation of EGF Receptor Signal Transactivation - The present invention relates to the modulation of transactivation of receptor tyrosine kinases by G protein or G protein-coupled receptor (GPCR) mediated signal transduction in a cell or an organism comprising inhibiting the activity of the metalloprotease TACE/ADAM17 and/or the activity of the receptor tyrosine kinase ligand amphiregulin. | 11-26-2009 |
20090292008 | Compositions and Methods for Treatment of Prostate and Other Cancers - Therapeutic agents which target heat shock protein (hsp) 27 in vivo are used to provide treatment to individuals, particularly human individuals, suffering from prostate cancer and other cancers that overexpress hsp27. A therapeutic agent, for example an antisense oligonucleotide or RNAi nucleotide inhibitor with sequence specificity for hsp27 mRNA, for example human hsp27 mRNA, is administered to an individual suffering from prostate cancer or some other cancer expressing elevated levels of hsp27 in a therapeutically effective amount. The therapeutic agent is suitably formulated into a pharmaceutical composition which includes a pharmaceutically acceptable carrier, and packaged in dosage unit form. A preferred dosage unit form is an injectable dosage unit form. | 11-26-2009 |
20090292009 | MODULATION OF STAT 6 EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of STAT 6. The compositions comprise oligonucleotides, targeted to nucleic acid encoding STAT 6. Methods of using these compounds for modulation of STAT 6 expression and for diagnosis and treatment of disease associated with expression of STAT 6 are provided. | 11-26-2009 |
20090298909 | Multiple RNA Polymerase III Promoter Expression Constructs - Expression constructs comprising at least two different RNA polymerase III promoters, wherein each promoter is operably linked to a nucleic acid sequence encoding an RNA effector molecule, are disclosed herein. Further provided are expression constructs comprising multiple polymerase III promoters operably linked to sequences encoding short hairpin RNA molecules, which may comprise single and/or multiple fingers. The provided constructs are useful for in vivo delivery of RNA molecules effective in gene silencing, including of viral genes including HBV and HCV. | 12-03-2009 |
20090298910 | REGULATION OF EPIGENETIC CONTROL OF GENE EXPRESSION - Methods are provided for the identification of compounds that selectively modulate epigenetic changes in gene expression. Compounds, compositions, kits or assays devices, and methods are provided for modulating the expression, endogenous levels or the function of small non-coding RNAs cognate to or transcribed by heterochromatic regions subject to epigenetic regulation (i.e., promoters, enhancers, centromeres, telomeres, origins of DNA replication, imprinted loci, or loci marked by dosage-compensation), and for modulating the formation or function of heterochromatin in cells, tissues or animals. | 12-03-2009 |
20090298911 | SIRNA HAVING ANTIVIRAL ACTIVITY AGAINST NONPOLIO ENTEROVIRUS - The present invention relates to an siRNA (small interfering RNA) having antiviral activity against nonpolio enteroviruses, and a pharmaceutical composition comprising same as an active ingredient for preventing and treating diseases caused by nonpolio enterovirus infection. | 12-03-2009 |
20090298912 | Arginase II: A Target treatment of aging heart and heart failure - The instant invention provides methods and compositions for the treatment of cardiac dysfunction. Specifically, the invention provides methods and compositions for modulating Arginase II for the treatment of cardiac dysfunction. | 12-03-2009 |
20090298913 | SMALL INTERFERING OLIGONUCLEOTIDES COMPRISING ARABINOSE MODIFIED NUCLEOTIDES - Small interfering ribonucleic acid duplexes that inhibit gene expression containing at least one arabinose modified nucleotide are provided. Preferably, the duplexes contain ribonucleotides at least one arabinose modified nucleotide is 2′-deoxy-2′-fluoroarabinonucleotide (FANA) nucleotide. | 12-03-2009 |
20090298914 | RNA Interference Mediated Inhibition of Severe Acute Respiratory Syndrome (SARS) Virus Gene Expression Using Short Interfering Nucleic Acid (siNA) - The present invention comprises compounds, compositions, and methods useful for modulating the expression of genes associated with respiratory and pulmonary disease, such as severe acute respiratory syndrome (SARS) virus genes, using short interfering nucleic acid (siNA) molecules. This invention also comprises compounds, compositions, and methods useful for modulating the expression and activity of SARS virus genes, or other genes involved in pathways of SARS virus gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of SARS virus RNA. | 12-03-2009 |
20090298915 | TOPICAL DRUG DELIVERY - Poly-pseudo-lysine conjugates have been shown to be able to penetrate into human skin and are proposed for both therapeutic and cosmetic treatments by topical application, e.g. change of skin pigmentation. | 12-03-2009 |
20090298916 | Pharmaceutical compositions for treatment of microRNA related diseases - The present invention provides compositions and methods of treatment of diseases that are sensitive to drugs that downregulate the function of microRNA's, mRNA, non-coding RNA, or viral genomes. In particular, it has been discovered that a very long term effect of an anti microRNA oligonucleotide may be obtained when administered to a primate. Therefore, the present invention relate to pharmaceutical compositions and methods for treatment of primates, including humans wherein the compositions are administered with a long time interval. | 12-03-2009 |
20090306176 | Use Of Low Doses Of Oligonucleotides Antisense To TGF-Beta, VEGF, Interleukin-10, C-Jun, C-Fos Or Prostaglandin E2 Genes In The Treatment Of Tumors - This invention is related to the use of at least one oligonucleotide with a length of from about 8 to about 30 nucleotide building blocks for manufacturing a pharmaceutical preparation for the prophylaxis and/or the treatment of diseases, that are modulated by TGF-beta2, TGF-beta1, TGF-beta3, VEGF, interleukin-10, c-jun, c-fos, and/or prostaglandin E2 in a mammal, wherein said oligonucleotide hybridizes with a messenger RNA of a TGF-beta2, TGF-beta1, TGF-beta3, VEGF, interleukin-10, c-jun, c-fos and/or prostaglandin E2 gene and wherein said preparation comprises said oligonucleotide in a concentration of about 1 microM to about 25 microM. | 12-10-2009 |
20090306177 | Modulation of Immunostimulatory Properties of Short Interfering Ribonucleic Acid (Sirna) by Nucleotide Modification - Double-stranded short interfering ribonucleic acid (siRNA) are modified to reduce or eliminate their immunostimulatory effect without significantly affecting their gene silencing effect. Modified siRNA include one or more 2′ sugar modifications and, optionally, internucleotide linkages on the sense strand. Compositions containing the modified siRNA and methods of making and using the modified siRNA are disclosed. New and previously characterized siRNA can be synthesized to incorporate modifications according to the invention. | 12-10-2009 |
20090306178 | CONJUGATED DOUBLE STRAND COMPOSITIONS FOR USE IN GENE MODULATION - The present invention provides conjugated double stranded compositions wherein each strand is modified to have a motif defined by positioning of β-D-ribonucleosides and/or sugar modified nucleosides. More particularly, the present compositions comprise a linked conjugate group on one strand and a non hybridizing region of 2′-modified nucleosides on the other strand. Each strand further comprises one or more phosphorothioate internucleoside linkage. The compositions are useful for targeting selected nucleic acid molecules and modulating the expression of one or more genes. In preferred embodiments the compositions of the present invention hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA. The present invention also provides methods for modulating gene expression. | 12-10-2009 |
20090306179 | COMPOUNDS AND METHODS FOR MODULATING EXPRESSION OF GCGR - The present disclosure describes short antisense compounds, including such compounds comprising chemically-modified high-affinity monomers 8-16 monomers in length. Certain such short antisense compound are useful for the reduction of target nucleic acids and/or proteins in cells, tissues, and animals with increased potency and improved therapeutic index. Thus, provided herein are short antisense compounds comprising high-affinity nucleotide modifications useful for reducing a target RNA in vivo. Such short antisense compounds are effective at lower doses than previously described antisense compounds, allowing for a reduction in toxicity and cost of treatment. In addition, the described short antisense compounds have greater potential for oral dosing. | 12-10-2009 |
20090306180 | COMPOUNDS AND METHODS FOR MODULATING EXPRESSION APOB - The present disclosure describes short antisense compounds, including such compounds comprising chemically-modified high-affinity monomers 8-16 monomers in length. Certain such short antisense compound are useful for the reduction of target nucleic acids and/or proteins in cells, tissues, and animals with increased potency and improved therapeutic index. Thus, provided herein are short antisense compounds comprising high-affinity nucleotide modifications useful for reducing a target RNA in vivo. Such short antisense compounds are effective at lower doses than previously described antisense compounds, allowing for a reduction in toxicity and cost of treatment. In addition, the described short antisense compounds have greater potential for oral dosing. | 12-10-2009 |
20090306181 | Compositions and methods for evaluating and treating heart failure - The invention relates to compositions, formulations, kits, and methods useful for the treatment and evaluation of heart disease in an individual. | 12-10-2009 |
20090306182 | RNA INTERFERENCE MEDIATED INHIBITION OF MAP KINASE GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating mitogen activated protein kinase (MAP kinase) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of MAP kinase gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of MAP kinase genes, such as Jun amino-terminal kinase (e.g., JNK-1, JNK-2), p38 (MAPK 14), ERK (e.g., ERK-1, ERK-2) and/or c-Jun. | 12-10-2009 |
20090306183 | Compositions and Methods for the Treatment of Diseases Associated with Aberrant Cilia Assembly and Regulation - Compositions and methods are provided for identifying agents which have efficacy for the treatment of disorders related to aberrant cilial structure and function, including polycystic kidney disease. | 12-10-2009 |
20090306184 | RNA INTERFERENCE MEDIATED INHIBITION OF HEPATITIS C VIRUS (HCV) EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of gene expression and/or activity. The present invention is also directed to compounds, compositions, and methods relating to traits, diseases and conditions that respond to the modulation of expression and/or activity of genes involved in gene expression pathways or other cellular processes that mediate the maintenance or development of such traits, diseases and conditions. Specifically, the invention relates to double stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against gene expression, including cocktails of such small nucleic acid molecules and lipid nanoparticle (LNP) formulations of such small nucleic acid molecules. The present invention also relates to small nucleic acid molecules, such as siNA, siRNA, and others that can inhibit the function of endogenous RNA molecules, such as endogenous micro-RNA (miRNA) (e.g, miRNA inhibitors) or endogenous short interfering RNA (siRNA), (e.g., siRNA inhibitors) or that can inhibit the function of RISC (e.g., RISC inhibitors), to modulate gene expression by interfering with the regulatory function of such endogenous RNAs or proteins associated with such endogenous RNAs (e.g., RISC), including cocktails of such small nucleic acid molecules and lipid nanoparticle (LNP) formulations of such small nucleic acid molecules. Such small nucleic acid molecules and are useful, for example, in providing compositions to prevent, inhibit, or reduce diseases, traits and conditions that are associated with gene expression or activity in a subject or organism. | 12-10-2009 |
20090306185 | Nanogenomics for medicine: siRNA engineering - Described herein are materials and methods for the delivery of siRNA and the production of nanoparticles useful for the delivery of siRNA. Methods of treating a disease or disorder using the nanoparticles described herein also are disclosed. | 12-10-2009 |
20090306186 | NOVEL TISSUE PROTECTIVE ERYTHROPOIETIN RECEPTOR (NEPOR) AND METHODS OF USE - There is disclosed a molecular composition(s) of a novel tissue protective erythropoietin (EPO) binding receptor protein complex, termed NEPOR. Presence of NEPOR components on a tumour allows EPO to impinge on the survival of associated cells thereby enhancing tumour progression and negatively effecting patient survival. Presence of NEPOR represents a prognostic biomarker for poorer patient outcome. Thus, methods are provided for stratifying patients having a tumour as suitable (i.e. NEPOR not present) or non-suitable (i.e., NEPOR present) for EPO treatment, comprising: (a) isolating a tissue sample from an individual who is receiving or is a candidate for receiving erythropoietin, (b) determining the level of expression of the NEPOR gene(s) (mRNA) and/or the presence of the NEPOR gene product (protein) from the isolated tissue, and (c) correlating the presence of an NEPOR gene expression product or the presence of NEPOR protein to a physiological response to the treatment with erythropoietin. Furthermore, by disclosing the molecular compositions of NEPOR species, there are disclosed methods for rationally identifying/designing NEPOR modulating therapeutics. Methods also are provided for treating neurological insults such as stroke (via enhancement of NEPOR activity) and cancer (via down-regulation of cyto-protective signaling from NEPOR). | 12-10-2009 |
20090312393 | CANCER THERAPY USING BCL-XL-SPECIFIC SINA - The invention relates to a double-stranded short interfering nucleic acid (siNA) molecule specific to the Bcl-X | 12-17-2009 |
20090312394 | Protection against and treatment of age related macular degeneration - Methods and reagents in relation to the diagnosis, protection and treatment of Age Related Macular Degeneration (AMD). In particular, the methods and reagents in relation to RNA; determined to provide a strong protection to a subject against development of AMD. | 12-17-2009 |
20090312395 | Assay - RAN and RAN Binding Protein 1 have been determined to be markers of invasive and metastatic potential of a tumour cell. There is described methods and kits for the detection of the level of RAN and RAN Binding Protein 1 and the use thereof. | 12-17-2009 |
20090312396 | METHODS FOR CANCER TREATMENT USING TAK1 INHIBITORS - The invention includes, in part, a method of inhibiting lymphoid tumour cell proliferation by contacting the lymphoid with a TAK1 inhibitor. | 12-17-2009 |
20090312397 | RNAi Modulation Of ApoB And Uses Thereof - The invention relates to compositions and methods for modulating the expression of apolipoprotein B, and more particularly to the downregulation of apolipoprotein B by chemically modified oligonucleotides. | 12-17-2009 |
20090318531 | Small Interfering RNA Specific For HCV And Therapeutic Agent For Hepatitis C Comprising The Same - The present invention relates to a therapeutic reagent for hepatitis C comprising HCV specific short interfering RNA (siRNA) as an effective ingredient. The siRNA of the invention is a double-stranded RNA specific for the nucleotide sequence of HCV which induces viral RNA degradation in mammalian cells and thereby inhibits HCV protein expression and replication. The method of the invention, which includes the step of administrating the synthetic siRNA or a DNA vector encoding the RNA, is thus effective for the treatment of HCV carrier by inhibiting HCV gene expression and replication. | 12-24-2009 |
20090318532 | COMPOUNDS AND METHODS FOR MODULATING EXPRESSION OF PTP1B - The present disclosure describes short antisense compounds, including such compounds comprising chemically-modified high-affinity monomers 8-16 monomers in length. Certain such short antisense compound are useful for the reduction of target nucleic acids and/or proteins in cells, tissues, and animals with increased potency and improved therapeutic index. Thus, provided herein are short antisense compounds comprising high-affinity nucleotide modifications useful for reducing a target RNA in vivo. Such short antisense compounds are effective at lower doses than previously described antisense compounds, allowing for a reduction in toxicity and cost of treatment. In addition, the described short antisense compounds have greater potential for oral dosing. | 12-24-2009 |
20090318533 | Annexin A9 (ANXA9) Biomarker and Therapeutic Target in Epithelial Cancer - Amplification of the ANXA9 gene in human chromosomal region 1q21 in epithelial cancers indicates a likelihood of both in vivo drug resistance and metastasis, and serves as a biomarker indicating these aspects of the disease. ANXA9 can also serve as a therapeutic target. Interfering RNAs (iRNAs) (such as siRNA and miRNA) and shRNA adapted to inhibit ANXA9 expression, when formulated in a therapeutic composition, and delivered to cells of the tumor, function to treat the epithelial cancer. | 12-24-2009 |
20090318534 | METHODS AND COMPOSITIONS FOR THE TREATMENT OF SKIN DISEASES AND DISORDERS - The disclosure demonstrates the role of cathelicidin, serine protease and/or vitamin D3 in rosacea pathology. | 12-24-2009 |
20090318535 | BETA -TrCP1, BETA -TrCP2 AND RSK1 OR RSK2 INHIBITORS AND METHODS FOR SENSITIZING TARGET CELLS TO APOPTOSIS - The invention relates to modulating BimEL levels (Bcl-2-Interacting Mediator of cell death, Extra Long isoform) to sensitize cancer cells to cell death or apoptosis. In certain embodiments, the invention relates to increasing BimEL levels. In certain embodiments, the invention relates to inhibitors of at least one of β-TrCP1/2 or RSK1/2 proteins that sensitize tumor cells to chemotherapy-induced death or apoptosis. Additionally, the invention relates to cancer therapies, diagnostics, and methods for identifying novel drugs or drug candidates for increasing BimEL levels. | 12-24-2009 |
20090318536 | METHODS FOR TREATING HYPERCHOLESTEROLEMIA - Disclosed herein are antisense compounds and methods for decreasing LDL-C in an individual having elevated LDL-C. Additionally disclosed are antisense compounds and methods for treating, preventing, or ameliorating hypercholesterolemia and/or atherosclerosis. Further disclosed are antisense compounds and methods for decreasing coronary heart disease risk. Such methods include administering to an individual in need of treatment an antisense compound targeted to a PCSK9 nucleic acid. The antisense compounds administered include gapmer antisense oligonucleotides. | 12-24-2009 |
20090318537 | SILENCING OF TGF BETA TYPE II RECEPTOR EXPRESSION BY SIRNA - The present application is directed to siRNA-based silencing of the type II receptor of TGFβ. siRNAs that target this receptor abrogate the receptor protein and transcript, TGFβ-mediated processes such as fibronectin assembly and cell migration also are inhibited and the molecules of the invention are efficacious in reducing the inflammatory response and matrix deposition. These findings show that siRNAs can be successfully delivered both in vitro and in vivo to regulate the TGFβ type II receptor level and modulate wound response. Methods and compositions exploiting the findings of the present invention have a wide-ranging application, extending from treatment of disorders of the eye to other organs and tissues throughout the body. | 12-24-2009 |
20090318538 | POLYMERIC OLIGONUCLEOTIDE PRODRUGS - Polymer conjugates containing nucleotides and/or oligonucleotides are disclosed. | 12-24-2009 |
20090326040 | ANTISENSE MODULATION OF APOLIPOPROTEIN B EXPRESSION - Methods for the rapid and long-term lowering of lipid levels in human subjects and for the treatment of conditions associated with elevated LDL-cholesterol and elevated apolipoprotein B are provided. | 12-31-2009 |
20090326041 | COMPOUNDS AND METHODS FOR MODULATING EXPRESSION OF SGLT2 - The present disclosure describes short antisense compounds, including such compounds comprising chemically-modified high-affinity monomers 8-16 monomers in length. Certain such short antisense compound are useful for the reduction of target nucleic acids and/or proteins in cells, tissues, and animals with increased potency and improved therapeutic index. Thus, provided herein are short antisense compounds comprising high-affinity nucleotide modifications useful for reducing a target RNA in vivo. Such short antisense compounds are effective at lower doses than previously described antisense compounds, allowing for a reduction in toxicity and cost of treatment. In addition, the described short antisense compounds have greater potential for oral dosing. | 12-31-2009 |
20090326042 | COMPOUNDS AND METHODS FOR MODULATING EXPRESSION OF CRP - The present disclosure describes short antisense compounds, including such compounds comprising chemically-modified high-affinity monomers 8-16 monomers in length. Certain such short antisense compound are useful for the reduction of target nucleic acids and/or proteins in cells, tissues, and animals with increased potency and improved therapeutic index. Thus, provided herein are short antisense compounds comprising high-affinity nucleotide modifications useful for reducing a target RNA in vivo. Such short antisense compounds are effective at lower doses than previously described antisense compounds, allowing for a reduction in toxicity and cost of treatment. In addition, the described short antisense compounds have greater potential for oral dosing. | 12-31-2009 |
20090326043 | Method and Compound for Antiviral (HIV) Therapy - Disclosed is an anti-viral therapeutic that inactivates the Human Immunodeficiency Virus (HIV) RNA by siDNA. The siDNA antiviral therapeutic is effective in the treatment and inactivation of cell free virus particles before infection and/or in the treatment and prevention of HIV infections inside the cell. The invention exploits the HIV RNase H activity of the reverse transcriptase which is essential for viral replication, causing premature cleavage and degradation of the viral RNA genome. | 12-31-2009 |
20090326044 | RNAi-Mediated Inhibition of Ocular Targets - RNA interference is provided for inhibition of ocular hypertension target mRNA expression for lowering elevated intraocular pressure in patients with open-angle glaucoma or ocular hypertension. Ocular hypertension targets include carbonic anhydrase II, IV, and XII; β1- and β2 adrenergic receptors; acetylcholinesterase; Na | 12-31-2009 |
20090326045 | COMPOSITIONS AND METHODS FOR TOPICAL DELIVERY OF OLIGONUCLEOTIDES - The present invention relates to compositions and methods which enhance the delivery of oligonucleotides and other nucleosidic moieties via topical routes of administration. Preferred compositions include liposomes or penetration enhancers for the delivery of such moieties to dermal and/or epidermal tissue in an animal for investigative, therapeutic or prophylactic purposes. | 12-31-2009 |
20090326046 | METHODS AND COMPOSITIONS FOR THE SPECIFIC INHIBITION OF GENE EXPRESSION BY DOUBLE-STRANDED RNA - The invention is directed to compositions and methods for selectively reducing the expression of a gene product from a desired target gene in a cell, as well as for treating diseases caused by the expression of the gene. More particularly, the invention is directed to compositions that contain double stranded RNA (“dsRNA”), and methods for preparing them, that are capable of reducing the expression of target genes in eukaryotic cells. The dsRNA has a first oligonucleotide sequence that is between 25 and about 30 nucleotides in length and a second oligonucleotide sequence that anneals to the first sequence under biological conditions. In addition, a region of one of the sequences of the dsRNA having a sequence length of at least 19 nucleotides is sufficiently complementary to a nucleotide sequence of the RNA produced from the target gene to trigger the destruction of the target RNA by the RNAi machinery. | 12-31-2009 |
20100004313 | Modified Poloxamers for Gene Expression and Associated Methods - Nucleotide delivery polymers, compositions, and associated methods for the enhancement of gene delivery and expression in solid tissues are provided. In one aspect, for example, a nucleotide delivery polymer may include a poloxamer backbone having a metal chelator covalently coupled to at least one terminal end of the poloxamer backbone. In another aspect, the nucleotide expression polymer has a metal chelator coupled to at least two terminal ends of the poloxamer backbone. | 01-07-2010 |
20100004314 | USE OF SIRNA TO ACHIEVE DOWN REGULATION OF AN ENDOGENOUS GENE IN COMBINATION WITH THE USE OF A SENSE CONSTRUCT TO ACHIEVE EXPRESSION OF A POLYNUCLEOTIDE - The present invention relates to the combinatorial use of an siRNA targeted against an endogenous gene to knock out or knock down expression of the endogenous gene in a host and a delivery of a polynucleotide encoding the gene in a delivery vehicle/expression vector to the host to provide expression in the host of the protein encoded by the polynucleotide. | 01-07-2010 |
20100004315 | Biodegradable Cross-Linked Branched Poly(Alkylene Imines) - Disclosed is a cross-linked branched poly(alkylenimine) and compositions thereof and nucleotide molecules. Also disclosed are methods for preparing the cross-linked branched poly(alkylenimine). | 01-07-2010 |
20100004316 | MULTIFUNCTIONAL CARRIERS FOR THE DELIVERY OF NUCLEIC ACIDS AND METHODS OF USE THEREOF - Described herein are multifunctional compounds useful as devices for the delivery of nucleic acids to cells. Also described herein are methods for using the multifunctional compounds. | 01-07-2010 |
20100004317 | METHODS AND COMPOSITIONS FOR THE SPECIFIC INHIBITION OF GENE EXPRESSION BY DOUBLE-STRANDED RNA - The invention is directed to compositions and methods for selectively reducing the expression of a gene product from a desired target gene in a cell, as well as for treating diseases caused by the expression of the gene. More particularly, the invention is directed to compositions that contain double stranded RNA (“dsRNA”), and methods for preparing them, that are capable of reducing the expression of target genes in eukaryotic cells. The dsRNA has a first oligonucleotide sequence that is between 25 and about 30 nucleotides in length and a second oligonucleotide sequence that anneals to the first sequence under biological conditions. In addition, a region of one of the sequences of the dsRNA having a sequence length of at least 19 nucleotides is sufficiently complementary to a nucleotide sequence of the RNA produced from the target gene to trigger the destruction of the target RNA by the RNAi machinery. | 01-07-2010 |
20100004318 | METHODS AND COMPOSITIONS FOR THE SPECIFIC INHIBITION OF GENE EXPRESSION BY DOUBLE-STRANDED RNA - The invention provides compositions and methods for selectively reducing the expression of a gene product from a desired target gene, as well as treating diseases caused by expression of the gene. The method involves introducing into the environment of a cell an amount of a double-stranded RNA (dsRNA) such that a sufficient portion of the dsRNA can enter the cytoplasm of the cell to cause a reduction in the expression of the target gene. The dsRNA has a first oligonucleotide sequence that is between 26 and about 30 nucleotides in length and a second oligonucleotide sequence that anneals to the first sequence under biological conditions. In addition, a region of one of the sequences of the dsRNA having a sequence length of from about 19 to about 23 nucleotides is complementary to a nucleotide sequence of the RNA produced from the target gene. | 01-07-2010 |
20100010064 | Cancer treatment by combined inhibition of proteasome and telomerase activities - A method and kit for inhibiting the proliferation of cancer cells are disclosed, based on a combination of a proteasome inhibitor and a telomerase inhibitor. When used in cancer therapy, the two compounds in combination enhance the anti-cancer treatment efficacy obtained with the proteasome inhibitor alone or the telomerase inhibitor alone. Preferably, efficacy is supraadditive or synergistic in nature relative to the combined effects of the individual agents, with minimal exacerbation of side effects. | 01-14-2010 |
20100010065 | Methods and Compositions for Cellular Reprogramming - Compositions and methods useful for the treatment of aberrant programming diseases, particularly those associated with aberrant apoptosis are disclosed | 01-14-2010 |
20100010066 | Optimized Methods For Delivery Of DSRNA Targeting The PCSK9 Gene - This invention relates to optimized methods for treating diseases caused by PCSK9 gene expression. | 01-14-2010 |
20100010067 | ARGININE-CONJUGATED BIOREDUCIBLE POLY(DISULFIDE AMINE) POLYMERS FOR GENE DELIVERY SYSTEM - An arginine-grafted bioreducible poly(disulfide amine) (“ABP”) as a reagent for efficient and nontoxic gene delivery is described. ABP forms positively charged nano-particles of less than 200 nm with siRNA. ABP is biodegraded under reducing conditions, such as in the cytoplasm. ABP exhibits much higher transfection efficiency than polyethyleneimine in mammalian cells and exhibits no cytotoxicity. ABP is an effective delivery vehicle for gene silencing with siRNA and may be used for treating cancer. | 01-14-2010 |
20100016404 | STRUCTURAL-BASED INHIBITORS OF THE GLUTATHIONE BINDING SITE IN ALDOSE REDUCTASE, METHODS OF SCREENING THEREFOR AND METHODS OF USE - Provided herein are methods of treating a pathophysiological state or symptoms thereof resulting from aldose reductase-mediated signaling in a cytotoxic pathway in a subject using an inhibitor of aldose reductase. Particularly, specific inhibitors may be a small-interfering RNA (siRNA) or may be inhibitors of glutathione-aldehyde binding to aldose reductase which are designed via at least computer modeling of the ternary AR:NADPH:DCEG structure. Also, methods of treating a cancer or suppressing metastasis thereof using the siRNAs and aldose reductase inhibitors are provided. | 01-21-2010 |
20100016405 | Compositions and Methods for Inhibiting Expression of the MYC Gene - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the MYC gene (MYC gene), comprising an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of the MYC gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by MYC gene expression and the expression of the MYC gene using the pharmaceutical composition. | 01-21-2010 |
20100016406 | Antisense RNA for Treating Cancer and Inhibition of Metastasis and Vectors for Antisense Sequestration - Provided is the use of antisense RNA and methods for the treatment, diagnosis and prophylaxis of cancer comprising administering said antisense RNA, particularly miRs 15 and 16 to a patient in need thereof. | 01-21-2010 |
20100016407 | Combined Telomerase Inhibitor and Gemcitabine for the Treatment of Cancer - A method and kit for inhibiting the proliferation of cancer cells are disclosed, based on a combination of a gemcitabine and a telomerase inhibitor. When used in cancer therapy, the two compounds in combination enhance the anti-cancer treatment efficacy obtained with gemcitabine alone or the telomerase inhibitor alone. Preferably, efficacy is supraadditive or synergistic in nature relative to the combined effects of the individual agents, with minimal exacerbation of side effects. | 01-21-2010 |
20100016408 | MODULATING THE CDC14B-CDH1-PLK1 AXIS AND METHODS FOR SENSITIZING TARGET CELLS TO APOPTOSIS - The invention relates to modulating Cdc14B levels (cell division cycle 14 homolog B) and/or Cdh1 (Fzr1 protein, CDC20-like 1b, or fizzy-related protein) levels to sensitize cells to DNA damage by increasing the abundance of Plk1 (polo-like kinase 1) in a target cell. In certain embodiments, the invention relates to modulating Plk1 levels, and in particular to increasing Plk1 levels, to sensitize target cells such as cancer cells to cell death or apoptosis. In certain embodiments, the invention relates to inhibitors of Cdc14B and Cdh1 that sensitize tumor cells to chemotherapy or radiation induced cell death or apoptosis. In addition to applications relating to cancer therapies and diagnostics, the Plk1 modulators and assays will be employed for identifying novel drugs or drug candidates useful for various proliferative and/or differentiative disorders such as major opportunistic infections, immune disorders, cardiovascular diseases and inflammatory disorders. | 01-21-2010 |
20100022618 | Long interfering nucleic acid duplexes targeting multiple RNA targets - Long interfering nucleic acid (iNA) duplexes, which are at least 30 nucleotides in length, which have at least one nick or nucleotide gap in the antisense or the sense strands or in both the sense and antisense strands. These long iNA duplexes do not induce an interferon response when transfected into mammalian cells. The antisense strands can target two separate mRNAs or two segments of one mRNA. | 01-28-2010 |
20100022619 | COMPOSITIONS AND THEIR USES DIRECTED TO PTPR ALPHA - Disclosed herein are compounds, compositions and methods for modulating the expression of PTPR.alpha. in a cell, tissue or animal. Also provided are methods of target validation. Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and disorders. Also provided are methods for the prevention, amelioration and/or treatment of airway hyperresponsiveness and pulmonary inflammation by administration of antisense compounds targeted to PTPR.alpha. | 01-28-2010 |
20100022620 | EPITOPE REDUCTION THERAPY - The present invention provides the use of an inhibitor of glycolipid biosynthesis in the manufacture of a medicament for the treatment of a glycolipid-mediated autoimmune disease. | 01-28-2010 |
20100022621 | CONSTRUCTION AND USE OF TRANSFECTION ENHANCER ELEMENTS - Nucleic acids comprising a nucleic acid moiety and two or more transfection enhancer elements (TEE's) according to the general formula (I): Hydrophobic moiety—pH-responsive hydrophilic moiety, wherein said pH sensitive hydrophilic moiety of said TEE is independently a weak acid having a pka of between 4 and 6.5 or is a zwitterionic structure comprising a combination of acidic groups with weak basis having a pKa of between 4.5 and 7. | 01-28-2010 |
20100022622 | Dbait and its Standalone Uses Thereof - The invention relates to compositions and methods for interfering with the DNA repair of double strand breaks (DSBs). The invention discloses double-stranded nucleic acid molecules that act as baits and hijack the holocomplex of enzymes responsible of DNA DSB sensing, signaling and/or repair pathways, in particular the non-homologous end joining (NHEJ) pathway of DSB repair. The invention discloses the use of these molecules as a standalone anticancer drug in an efficient amount to be introduced in the tumor cell nuclei in order to trigger their death. | 01-28-2010 |
20100022623 | Methods and Compositions for the Treatment of Eye Disorders with Increased Intraocular Pressure - The present invention relates to methods and compositions that decrease intraocular pressure (IOP) of the eye. The compositions of the invention comprise short interfering nucleic acid molecules (siNA) including, but not limited to, siRNA that decrease expression of genes associated with production or drainage of intraocular fluid. The compositions of the invention can be used in the preparation of a medicament for the treatment of an eye conditions displaying increased IOP such as glaucoma, infection, inflammation, uveitis, and diabetic retinopathy. The methods of the invention comprise the administration to a patient in need thereof an effective amount of one or more siNAs of the invention. | 01-28-2010 |
20100022624 | Methods of Treating Smooth Muscle Cell Disorders - The present invention provides methods of detecting cells showing smooth muscle differentiation. The present invention further provides methods of detecting tumor cells. The present invention further provides compositions and methods for treating smooth muscle cell disorders. | 01-28-2010 |
20100022625 | Structural-based inhibitors of the glutathione binding site in aldose reductase, methods of screening therefor and methods of use - Provided herein is a crystallized ternary structure of aldose reductase (AR) bound to NADPH and γ-glutamyl-S-(1,2-dicarboxyethyl)cysteinylglycine (DCEG). Also provided are specific inhibitors of glutathione-aldehyde binding to aldose reductase which are designed via at least computer modeling of the ternary AR:NADPH:DCEG structure and methods of designing and of screening the inhibitors for inhibition of glutathione-aldehyde binding to aldose reductase. In addition methods of treating a pathophysiological state or symptoms thereof resulting from aldose reductase-mediated signaling in a cytotoxic pathway using a small interfering RNA (siRNA) or the designed inhibitors. | 01-28-2010 |
20100029746 | Treatment or prevention of oto-pathologies by inhibition of pro-apoptotic genes - The invention relates to one or more inhibitors, in particular siRNAs, which down-regulate the expression of human pro-apoptotic genes. The invention also relates to a pharmaceutical composition comprising the compound, or a vector capable of expressing the compound, and a pharmaceutically acceptable carrier. The present invention also contemplates a method of treating or preventing the incidence or severity of hearing impairment (or balance impairment), particularly hearing impairment associated with cell death of the inner ear hair cells or outer ear hair cells, comprising administering to the patient the pharmaceutical composition in a therapeutically effective dose so as to thereby treat the patient. | 02-04-2010 |
20100029747 | METHODS AND COMPOSITIONS FOR INHIBITING THE FUNCTION OF POLYNUCLEOTIDE SEQUENCES - A therapeutic composition for inhibiting the function of a target polynucleotide sequence in a mammalian cell includes an agent that provides to a mammalian cell an at least partially double-stranded RNA molecule comprising a polynucleotide sequence of at least about 200 nucleotides in length, said polynucleotide sequence being substantially homologous to a target polynucleotide sequence. This RNA molecule desirably does not produce a functional protein. The agents useful in the composition can be RNA molecules made by enzymatic synthetic methods or chemical synthetic methods in vitro; or made in recombinant cultures of microorganisms and isolated therefrom, or alternatively, can be capable of generating the desired RNA molecule in vivo after delivery to the mammalian cell. In methods of treatment of prophylaxis of virus infections, other pathogenic infections or certain cancers, these compositions are administered in amounts effective to reduce or inhibit the function of the target polynucleotide sequence, which can be of pathogenic origin or produced in response to a tumor or other cancer, among other sources. | 02-04-2010 |
20100029748 | Metastasis Promoting Genes and Proteins - Two sets of genes and their encoded proteins, one set of 17 genes/proteins and one set of 18 genes/proteins that can be used in predicting the risk of cancer metastasis to the brain, and as a screening assay to identify the suitable treatments for brain metastases. Genes/proteins within the sets that are found to be differentially expressed relative to a control value are suitable targets for therapy. | 02-04-2010 |
20100035963 | Oligoribonucleotides and Methods of use Thereof for Treatment of Cardiovascular Disease - The invention relates to a double-stranded compound, preferably an oligoribonucleotide, which down-regulates the expression of one or more cardiovascular-related gene. The invention also relates to a pharmaceutical composition comprising the compound, or a vector capable of expressing the oligoribonucleotide compound, and a pharmaceutically acceptable carrier. The present invention also contemplates a method of treating a patient suffering from a cardiovascular disorder or other diseases comprising administering to the patient the pharmaceutical composition in a therapeutically effective dose so as to thereby treat the patient. | 02-11-2010 |
20100035964 | ANTISENSE MODULATION OF CONNECTIVE TISSUE GROWTH FACTOR EXPRESSION - Antisense compounds, compositions and methods are provided for modulating the expression of connective tissue growth factor. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding connective tissue growth factor. Methods of using these compounds for modulation of connective tissue growth factor expression and for treatment of diseases associated with expression of connective tissue growth factor are provided. | 02-11-2010 |
20100035965 | SIRNA INHIBITION OF P13K P85, PA110, AND AKT2 AND METHODS OF USE - The present invention provides polynucleotides, compositions including polynucleotides, and the uses thereof for treating cancer in a subject. The polynucleotides silence the expression of coding regions that encode polypeptides such as p85α, p110α, and Akt2. The cancers treatable using the methods described herein include colorectal cancer, breast cancer, lung cancer, and metastases thereof. | 02-11-2010 |
20100035966 | METHODS AND COMPOSITIONS FOR REGULATING CELL CYCLE PROGRESSION - In one aspect, a method is provided of inhibiting proliferation of a mammalian cell comprising introducing into said cell an effective amount of at least one at least one small interfering RNA agent (iRNA), wherein said iRNA comprises a nucleotide sequence of at least 15 nucleotides, wherein the nucleotide sequence comprises a seed region consisting of nucleotide positions 1 to 12, wherein position 1 represents the 5′ end of the iRNA nucleotide sequence and wherein said seed region comprises a nucleotide sequence of at least six contiguous nucleotides that is complementary to six contiguous nucleotides within positions 1 to 12 of a nucleotide sequence, wherein position 1 represents the 5″end of the nucleotide sequence, wherein the nucleotide sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7 and SEQ ID NO:8. In some embodiments, the method comprises introducing at least one iRNA that inhibits the expression of at least one miR-16 responsive gene selected from TABLE 5 into the mammalian cell. | 02-11-2010 |
20100035967 | MODULATION OF TOLL-LIKE RECEPTOR 9 EXPRESSION BY ANTISENSE OLIGONUCLEOTIDES - Antisense oligonucleotide compounds, compositions and methods are provided for down regulating the expression of TLR9. The compositions comprise antisense oligonucleotides targeted to nucleic acids encoding TLR9. The compositions may also comprise antisense oligonucleotides targeted to nucleic acids encoding TLR9 in combination with other therapeutic and/or prophylactic compounds and/or compositions. Methods of using these compounds and compositions for down-regulating TLR9 expression and for prevention or treatment of diseases wherein modulation of TLR9 expression would be beneficial are provided. | 02-11-2010 |
20100035968 | MEDIATED CELLULAR DELIVERY OF LNA OLIGONUCLEOTIDES - The present invention relates to novel modified oligomeric compounds and to methods of making and using such compounds. The invention further relates to methods of enhancing the cellular uptake of oligomeric compounds comprising conjugating a metal chelator to those. | 02-11-2010 |
20100035969 | RNAi INHIBITION OF CTGF FOR TREATMENT OF OCULAR DISORDERS - RNA interference is provided for inhibition of connective tissue growth factor mRNA expression in ocular disorders involving CTGF expression. Ocular disorders involving aberrant CTGF expression include glaucoma, macular degeneration, diabetic retinopathy, choroidal neovascularization, proliferative vitreoretinopathy and wound healing. Such disorders are treated by administering interfering RNAs of the present invention. | 02-11-2010 |
20100041732 | METHODS FOR IDENTIFYING COMPOUNDS THAT INHIBIT HIV INFECTION - This invention provides novel methods for identifying agents that inhibit HIV infection. The anti-HIV agents are identified by screening test compounds for ability to down-regulate the kinase activity or the expression of a PAK3 molecule. Such PAK3 modulators can be further examined for their activity in inhibiting HIV infection. These novel anti-HIV agents are useful in the prevention or treatment of HIV infection and conditions associated with HIV infection. | 02-18-2010 |
20100041733 | NOVEL RNAi THERAPEUTIC FOR TREATMENT OF HEPATITIS C INFECTION - Small interfering RNAs (siRNAs) or small hairpin RNA (shRNAs) and compositions comprising same are provided that specifically target human cyclophilin A (CyPA) to effectively inhibit Hepatitis C(HCV) infection in a cell. Such siRNA and shRNAs may have a length of from about 19 to about 29 contiguous nucleotides corresponding to a specific region of human cyclophilin A (CyPA) cDNA of from about nucleotide 155 to about nucleotide 183 having particular potency against CyPA and HCV. Such siRNA and shRNAs may be formulated as naked compositions or as pharmaceutical compositions. DNA polynucleotides, plasmids, and viral or non-viral vectors are also provided that encode siRNA or shRNA molecules, which may be delivered directly to cells or in combination with known delivery agents, such as lipids, polymers, encapsulated lipid particles, such as liposomes. Methods for treating, managing inhibiting, preventing, etc., HCV infection using such siRNA and shRNAs and compositions comprising same are also provided. | 02-18-2010 |
20100041734 | MODULATION OF TOLL-LIKE RECEPTOR 7 EXPRESSION BY ANTISENSE OLIGONUCLEOTIDES - Antisense oligonucleotide compounds, compositions and methods are provided for down regulating the expression of TLR7. The compositions comprise antisense oligonucleotides targeted to nucleic acids encoding TLR7. The compositions may also comprise antisense oligonucleotides targeted to nucleic acids encoding TLR7 in combination with other therapeutic and/or prophylactic compounds and/or compositions. Methods of using these compounds and compositions for down-regulating TLR7 expression and for prevention or treatment of diseases wherein modulation of TLR7 expression would be beneficial are provided. | 02-18-2010 |
20100041735 | MODULATION OF TOLL-LIKE RECEPTOR 3 EXPRESSION BY ANTISENSE OLIGONUCLEOTIDES - Antisense oligonucleotide compounds, compositions and methods are provided for down regulating the expression of TLR3. The compositions comprise antisense oligonucleotides targeted to nucleic acids encoding TLR3. The compositions may also comprise antisense oligonucleotides targeted to nucleic acids encoding TLR3 in combination with other therapeutic and/or prophylactic compounds and/or compositions. Methods of using these compounds and compositions for down-regulating TLR3 expression and for prevention or treatment of diseases wherein modulation of TLR3 expression would be beneficial are provided. | 02-18-2010 |
20100041736 | Isolated MCPIP and Methods of Use - A monocyte chemoattractant protein (MCP-1)-inducible protein, MCPIP, its polynucleotide and amino acid sequences from mouse and human, and methods for its use are disclosed. | 02-18-2010 |
20100048670 | Stable and Long-Lasting siRNA Expression Vectors and the Applications Thereof - The invention relates to a siRNA expression vector that can inhibit or eliminate the expression of a target gene in a mammalian cell, said vector comprising: a bacterial cassette containing a bacterial origin of replication and a bacterial selection marker M1; a eucaryotic cell selection cassette comprising a marker M2 for selecting eucaryotic cells under the control of an appropriate promoter; a cassette EBV comprising at least one fragment of the antigen EBNA-1, at least one fragment FR, and at least one fragment of the region DYAD; and a siRNA transcription cassette comprising at least one region coding for a siRNA corresponding to the target gene to be inhibited or eliminated, under the control of elements for regulating transcription in mammalian cells, said regulating elements including at least one promoter capable of transcribing a siRNA in mammalian cells, and a transcription terminator. The invention also relates to the applications of one such expression vector. | 02-25-2010 |
20100048671 | INHIBITION OF THE 44 KILODALTON ISOFORM OF PIM-1 KINASE RESTORES APOPTOSIS INDUCED BY CHEMOTHERAPEUTIC DRUGS IN CANCER CELLS - The present invention relates to a newly discovered 44 kD isoform of Pim-1 kinase made in human cells, and to the gene and messenger RNA for the 44 kilodalton isoform. The invention further describes methods and compounds for treating, especially prostate and hematopoietic cancer, by inhibiting expression of the 44 kD isoform of Pim-1 kinase, or its ability to phosphorylate Etk kinase and breast cancer resistance protein (BCRP). | 02-25-2010 |
20100048672 | COMPOSITIONS FOR TRANSFECTION OF OLIGONUCLEOTIDES ACTIVE FOR GENE SILENCING AND THEIR BIOLOGICAL AND THERAPEUTICAL APPLICATIONS - The invention relates to compositions of transfection comprising an oligonucleotide and an amphiphilic cationic molecule of formula (I) wherein, —X is N—R | 02-25-2010 |
20100048673 | OLIGONUCLEOTIDES AFFECTING EXPRESSION OF PHOSPHODIESTERASES - The invention relates to therapeutic antisense oligonucleotides directed against genes encoding phosphodiesterases (PDE) and the use of these antisense oligonucleotides in combination. These antisense oligonucleotides may be used as analytical tools and/or as therapeutic agents in the treatment of disease associated with reduced cellular cAMP in a patient, such as inflammatory diseases of the respiratory tract including, for example, asthma, chronic obstructive pulmonary disease (COPD), acute respiratory distress syndrome, bronchitis, chronic bronchitis, silicosis, pulmonary fibrosis, lung allograft rejection, allergic rhinitis and chronic sinusitis as well as other conditions in which an increase in cyclic AMP or a decrease in PDE levels is beneficial. | 02-25-2010 |
20100048674 | Role of miRNA in T cell leukemia - The ability of miR-181a to support active signaling between Notch and pre-TCR pathways by coordinately dampening negative regulators of these pathways allows the use of miR-181a as a therapeutic target for T-ALL. | 02-25-2010 |
20100048675 | miRNA TRIPLEX FORMATIONS FOR THE DOWNREGULATION OF VIRAL REPLICATION - As discovered herein, using miRNAs having high homology with both HIV- | 02-25-2010 |
20100048676 | Non-androgen dependent roles for androgen receptor in liver cancer - Disclosed are compositions and methods for modulating AR activity, such as non-androgen dependent AR activity. Also disclosed are compositions and methods for diagnosing beast cancer and for inhibiting liver cancer growth. In addition, disclosed are methods for identifying molecules that inhibit AR in non-androgen dependent ways. | 02-25-2010 |
20100048677 | Regulation of Integrin Surface Expression - Disclosed are methods and compositions for preventing and treating conditions associated with platelet aggregation, comprising administering a therapeutically effective amount of a composition that modifies the interaction of DNAJC10 with αIIbβ3 in a megakaryocyte, thereby altering the expression of αIIbβ3 on the surface of the megakaryocyte. | 02-25-2010 |
20100056606 | Combination therapy using budesonide and antisense oligonucleotide targeted to IL4-receptor alpha - Provided herein is a method for reducing the amount of steroid required for the prevention, amelioration and/or treatment of pulmonary inflammation and/or airway hyperresponsiveness, comprising administration of the steroid and an oligonucleotide targeted to IL-4R alpha. Also described is a method for the prevention, amelioration and/or treatment of pulmonary inflammation and/or airway hyperresponsiveness comprising administration of a corticosteroid and an oligonucleotide targeted to IL-4R alpha. Further provided are compositions comprising a corticosteroid and an IL-4R alpha targeted antisense oligonucleotide. | 03-04-2010 |
20100056607 | COMPOSITIONS AND THEIR USES DIRECTED TO HBXIP - Disclosed herein are compounds, compositions and methods for modulating the expression of HBXIP in a cell, tissue or animal. Also provided are methods of target validation. Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and disorders. | 03-04-2010 |
20100056608 | METHODS FOR SCREENING AND TREATMENT INVOLVING THE GENES GYPC, AGPAT3, AGL, PVRL2, HMGB 3, HSDL2 AND/OR LDB2 - The present invention relates to a method for identifying a compound as a candidate drug, comprising the steps a. bringing said compound into contact with a cell expressing the genes CYPC, AGPAT3, AGL, PVRL2, HMGB 3, HSDL2; and b. analyzing if said compound modulates the expression of at least one of said genes. It also relates to a method for identifying a compound as a candidate drug, comprising the steps a. bringing said compound into contact with a cell expressing the gene LDB2; and b. analyzing if said compound modulates the expression of LDB2. The invention further relates to genetically modified cells and animals useful in such methods and to methods for treatment of atherosclerosis, atherosclerosis-related diseases or inflammatory diseases, comprising the use of such identified compounds. | 03-04-2010 |
20100056609 | METHODS AND COMPOSITIONS FOR INHIBITION OF AXONAL DEGENERATION BY MODULATION OF THE DLK/JNK PATHWAY - Methods of reducing Wallerian degeneration are disclosed. These methods comprise inhibiting expression or activity of a mixed lineage kinas such as a dual leucine-zipper-bearing kinase (DLK), inhibiting expression or activity of a molecule acting downstream from DLK, such as a c-Jun N-terminal kinase (JNK), or a combination thereof. Further disclosed are methods of screening candidate compounds for DLK inhibition activity. These methods comprise providing a neuronal culture comprising a plurality of axons; contacting the culture with a candidate compound and with an axon degeneration-triggering agent; and comparing axonal degeneration in the culture to a control culture comprising the axon degeneration-triggering agent but not the candidate compound. | 03-04-2010 |
20100056610 | HEPTbeta AS A TARGET IN TREATMENT OF ANGIOGENISIS MEDIATED DISORDERS - Disclosed herein is the use of HPTPbeta to screen agents useful in the treatment angiogenesis mediated disorders. | 03-04-2010 |
20100063130 | METHOD FOR PROMOTING IMMUNE RESPONSE COMPRISING INHIBITING CD22 FUNCTION IN B CELLS - The purpose of the present invention is to elucidate a relationship between deregulation of signaling by CD22 and a rapid response of B cells by IgG-BCR and the like, and to provide a method capable of inducing a rapid immune response and defending against infection instead of vaccine. The present invention relates to a method for promoting an immune response causing such a strong proliferation of clones and production of a large amount of antibody-producing cells as those seen in the memory immune response even in the naive B cells expressing IgM-BCR and IgD-BCR by inhibiting the CD22 function in B cells; and to a method for screening a substance capable of promoting the immune response based on a change in the CD22 function in B cells. | 03-11-2010 |
20100063131 | PROMPT NUCLEIC ACID DELIVERY CARRIER COMPOSITION - An object of the present invention is to provide a carrier composition for nucleic acid delivery, which can efficiently deliver a nucleic acid into cells when a nucleic acid such as siRNA is administered to animal-derived cells or animals, and also has low toxicity and high safety, and a composition for nucleic acid delivery containing the carrier composition and nucleic acid. | 03-11-2010 |
20100063132 | SMALL INTERFERING RNA AND PHARMACEUTICAL COMPOSITION FOR TREATMENT OF HEPATITIS B COMPRISING THE SAME - The present invention relates to RNA interference mediated inhibition of Hepatitis B virus (HBV) by short interfering RNA (siRNA) molecules. Specially, siRNAs of the present invention which are double-stranded RNAs concern directing the sequence-specific degradation of viral RNA in mammalian cells. Disclosed is a DNA vector encoding the RNA molecules and synthesized siRNA molecules as well as method of therapeutic treatment for inhibition of HBV gene expression and viral replication by the administration of RNA molecules of the present invention. | 03-11-2010 |
20100063133 | ANTISENSE ANTIVIRAL COMPOUND AND METHOD FOR TREATING ARENAVIRUS INFECTION - The invention provides antisense antiviral compounds and methods of their use and production in inhibition of growth of viruses of the Arenaviridae family and in the treatment of a viral infection. The compounds are particularly useful in the treatment of Arenavirus infection in a mammal. The antisense antiviral compounds are substantially uncharged morpholino oligonucleotides have a sequence of 12-40 subunits, including at least 12 subunits having a targeting sequence that is complementary to a region associated with viral RNA sequences within a 19 nucleotide region of the 5′-terminal regions of the viral RNA, viral complementary RNA and/or mRNA identified by SEQ ID NO:1. | 03-11-2010 |
20100063134 | TREATMENT OF NEURODEGENERATIVE DISEASE THROUGH INTRACRANIAL DELIVERY OF SIRNA - The present invention provides devices, small interfering RNA, and methods for treating a neurodegenerative disorder comprising the steps of surgically implanting a catheter so that a discharge portion of the catheter lies adjacent to a predetermined infusion site in a brain, and discharging through the discharge portion of the catheter a predetermined dosage of at least one substance capable of inhibiting production of at least one neurodegenerative protein. The present invention also provides valuable small interfering RNA vectors, and methods for treating neurodegenerative disorders such as Alzheimer's disease, Parkinson's disease, Huntington's disease, Spinocerebellar Ataxia Type 1, Type 2, Type 3, and/or dentatorubral-pallidoluysian atrophy. | 03-11-2010 |
20100069461 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF FACTOR V LEIDEN MUTANT GENE - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the Factor V Leiden mutant gene (Factor V Leiden mutant gene), comprising an antisense strand having a nucleotide sequence which is less that 25 nucleotides in length and which is substantially complementary to at least a part of the Factor V Leiden mutant gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by the expression of the Factor V Leiden mutant gene using the pharmaceutical composition; and methods for inhibiting the expression of the Factor V Leiden mutant gene in a cell. | 03-18-2010 |
20100069462 | MITOCHONDRIAL FUNCTION OF PROHIBITIN 2 (PHB2) - The present invention relates to a PHB2 gene regulator and a therapeutic drug for mitochondrial-function-related disease containing the same, for example. | 03-18-2010 |
20100069463 | METHODS FOR THE DIAGNOSIS AND TREATMENT OF AFFECTIVE DISORDERS AND CUSHING'S SYNDROMES - The present invention relates to a method for identifying a TMEFF2 modulator, comprising (a) contacting a cell which expresses TMEFF2 with a candidate compound to be tested; (b) measuring whether said compound to be tested decreases or increases the level of a constituent of the cAMP signalling pathway, preferably the CRH signalling pathway, in said cell when compared to a corresponding cell which does not express TMEFF2; (b′) optionally determining whether said compound is capable of reduncing the binding between Activin and TMEFF2; and (c) identifying said modulator compound. Furthermore, a method for identifying a TMEFF2 modulator comprising determining whether said TMEFF2 modulator is capable of reducing the binding between Activin and TMEFF2 is contemplated. It also relates to uses and methods applying a TMEFF2 agonist for the treatment of Cushing's Syndromes and a TMEFF2 modulator for the treatment of affective disorders. Furthermore, methods of diagnosing affective disorders or Cushing's Syndromes are provided. | 03-18-2010 |
20100069464 | COMPOSITIONS AND METHODS FOR MODULATING ACTIVITY OF CAPPED SMALL RNAS - Compositions and methods for modulating transcription by RNA polymerases are described. | 03-18-2010 |
20100069465 | METHODS AND COMPOSITIONS FOR THE SPECIFIC INHIBITION OF GENE EXPRESSION BY DOUBLE-STRANDED RNA - The invention is directed to compositions and methods for selectively reducing the expression of a gene product from a desired target gene in a cell, as well as for treating diseases caused by the expression of the gene. More particularly, the invention is directed to compositions that contain double stranded RNA (“dsRNA”), and methods for preparing them, that are capable of reducing the expression of target genes in eukaryotic cells. The dsRNA has a first oligonucleotide sequence that is between 25 and about 30 nucleotides in length and a second oligonucleotide sequence that anneals to the first sequence under biological conditions. In addition, a region of one of the sequences of the dsRNA having a sequence length of at least 19 nucleotides is sufficiently complementary to a nucleotide sequence of the RNA produced from the target gene to trigger the destruction of the target RNA by the RNAi machinery. | 03-18-2010 |
20100069466 | Compositions and Methods for the Systemic Treatment of Arthritis - The present invention includes compositions and methods for treating arthritic joints found in patients with autoinflammation, e.g., systemic onset juvenile idiopathic arthritis, by administering at the site of inflammation a therapeutically effective amount of at least one agent that reduces or blocks the bioavailability of interleukin-1β. | 03-18-2010 |
20100076053 | SEQUENCE OF DSRNA: ATN-RNA, INTERVENTION USING IRNAI, USE OF A SEQUENCE OF DSRNA: ATN-RNA, A METHOD OF TREATING AND INHIBITING A BRAIN TUMOR, A KIT FOR INHIBITING CANCER CELL WHICH EXPRESSES TENASCIN, A METHOD FOR A KIT PREPARATION IN A BRAIN TUMOR THERAPY - The subject matters of this invention are a sequence of double-stranded RNA: ATN-RNA, intervention using interference RNA (iRNAi), use of a sequence of double-stranded RNA: ATN-RNA, a method of treating a brain tumor and a method of inhibiting a brain tumor cells which express tenascin, a kit for inhibiting cancer cell which expresses tenascin and a method for a kit preparation in a brain tumor therapy. Malignant gliomas preferentially express a number of surface markers that may be exploited as therapeutic targets, including tenascin-C, an extracellular matrix glycoprotein that is ubiquitously expressed by malignant gliomas and probably contributes to tumor cell adhesion, invasion, migration and proliferation. For tenascin-C inhibition, RNA interference intervention (iRNAi) approach have been applied. | 03-25-2010 |
20100076054 | SENSIZITATION OF CANCER CELLS TO THERAPY USING SINA TARGETING GENES FROM THE 1P AND 19Q CHROMOSOMAL REGIONS - The invention relates to the identification of genes involved in resistance of cancer cells to therapy, to short nucleic acid molecules which inhibit the expression of these genes by RNA interference and to their use as adjuvant in cancer therapy, to sensitize cancer cells to conventional anticancer agents; the short nucleic acid molecules are double-stranded short interfering nucleic acid molecules including a sense and an antisense region, wherein the sense region includes a nucleotide sequence that is selected from the group consisting of: the sequences SEQ ID NO: 15, 11, 13, 14, 30, 31, 38, 46, 64 and 70 and the sequences having at least 70% identity, preferably at least 80% identity, more preferably at least 90% identity with the sequences, and the antisense region includes a nucleotide sequence that is complementary to the sense region. | 03-25-2010 |
20100076055 | Cationic Lipids and Uses Thereof - Cationic lipids, cationic lipid based drug delivery systems, ways to make them and methods of treating diseases using them are disclosed. | 03-25-2010 |
20100076056 | MODIFIED iRNA AGENTS - The invention relates to iRNA agents, which preferably include a monomer in which the ribose moiety has been replaced by a moiety other than ribose that further includes a tether having one or more linking groups, in which at least one of the linking groups is a cleavable linking group. The tether in turn can be connected to a selected moiety, e.g., a ligand, e.g., a targeting or delivery moiety, or a moiety which alters a physical property. The cleavable linking group is one which is sufficiently stable outside the cell such that it allows targeting of a therapeutically beneficial amount of an iRNA agent (e.g., a single stranded or double stranded iRNA agent), coupled by way of the cleavable linking group to a targeting agent—to targets cells, but which upon entry into a target cell is cleaved to release the iRNA agent from the targeting agent. | 03-25-2010 |
20100076057 | TARGET DNA INTERFERENCE WITH crRNA - The present invention provides methods, systems, and compositions for interfering with the function and/or presence of a target DNA sequence in a eukaryotic cell (e.g., located in vitro or in a subject) using crRNA and CRISPR-associated (cas) proteins or cas encoding nucleic acids. The present invention also relates to a method for interfering with horizontal gene transfer based on the use of clustered, regularly interspaced short palindromic repeat (CRISPR) sequences. | 03-25-2010 |
20100076058 | Methods for identifying analgesic agents - The present invention relates to the discovery that mutations in SCN9A are causative of Congenital Indifference to Pain (CIP) in humans. The invention also relates to methods of utilizing the SCN9A gene and expression products thereof for the screening and identification of therapeutic agents, including small organic compounds, which are selective for SCN9A, and are useful in the treatment of pain and other disorders. The invention also relates to methods of using these compounds to treat or otherwise ameliorate such disorders. | 03-25-2010 |
20100076059 | METHOD OF EVALUATING COMPOUND EFFICACIOUS IN TREATING OBESITY BY USING Slc25a10 - Evaluation of compounds including screening of therapeutic agents for obesity is performed utilizing expression levels of S1c25a10 gene or protein in a test tissue or a test cell, or utilizing the nature of S1c25a10 gene or protein. Examination of obesity is performed based on expression levels of S1c25a10 gene or polymorphisms of the gene. | 03-25-2010 |
20100081703 | TRI-DEMETHYLATION-CAPABLE PROTEIN COMPLEX, METHOD OF ITS PREPARATION AND ITS USE - The invention relates to a multiple-specificity demethylase complex comprising a Jumonji C (JMJC) domain-containing enzyme, a process of its preparation and its use. | 04-01-2010 |
20100081704 | MODULATOR COMPOUNDS OF THE DRUG RESISTANCE IN EPITHELIAL TUMOUR CELLS - The use of compounds is described which are capable of functionally blocking at least one of the genes chosen from the group composed of EphA1, EphA2, EphA8, EphB2, CSF1R, VEGFR2, RAMP2, RAMP3, CLRN1, MAPK4, PIK3C2A, PIK3CG, GSK3alpha, GSK3beta, IRAK3, DAPK1, JAK1, PIM1, TRB3, BTG1, LATS1, LIMK2, MYLK, PAK1, PAK2, CDC2, BTK, PNRC2, NCOA4, NR2C1, TPR, RBBP8, TRPC7, FXYD1, ERN1, PRSS16, RPS3, CCL23 and SERPINE1, for the manufacture of a medicament destined to diminish the resistance to chemotherapeutic drugs in the therapeutic treatment of epithelial tumour pathologies. Also described is a method for the determination of the drug resistance in tumour cells, as well as a method for the identification of tumour stem cells. | 04-01-2010 |
20100081705 | METHODS FOR SLOWING FAMILIAL ALS DISEASE PROGRESSION - Methods for slowing disease progression in an individual suffering from familial ALS are provided. Also provided are methods of increasing the survival time of an individual suffering from familial ALS. These methods employ antisense oligonucleotides targeted to SOD1, for use in inhibiting the expression of SOD1 in the central nervous system of an individual suffering from familial ALS. | 04-01-2010 |
20100087507 | USE OF RPN2 GENE EXPRESSION INHIBITOR - The present invention uses an RPN2 gene expression inhibitor as a cancer cell growth inhibitor, which further includes a drug showing an anti-cancer action if desired, and is administered in combination with atelocollagen if desired. In addition, the present invention is an anti-cancer agent including such cancer cell growth inhibitor. | 04-08-2010 |
20100087508 | Compositions and Methods for Inhibiting Expression of Eg5 and VEGF Genes - This invention relates to compositions containing double-stranded ribonucleic acid (dsRNA) in a SNALP formulation, and methods of using the compositions to inhibit the expression of the Eg5 and Vascular Endothelial Growth Factor (VEGF), and methods of using the compositions to treat pathological processes mediated by Eg5 and VEGF expression, such as cancer. | 04-08-2010 |
20100087509 | Methods, Agents, and Compound Screening Assays for Inducing Differentiation of Undifferentiated Mammalian Cells into Osteoblasts - The present invention relates to methods, agents and compound screening assays for inducing differentiation of undifferentiated mammalian cells into osteoblasts. The invention thus provides a method, comprising contacting a compound with a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID No: 194-309; and measuring a compound-polypeptide property related to the differentiation of said cells. The invention further relates to a bone formation enhancing pharmaceutical composition, and the use thereof in treating and/or preventing a disease involving a systemic or local decrease in mean bone density in a subject. Furthermore, the invention relates to a method for the in vitro production of bone tissue. | 04-08-2010 |
20100093829 | METHODS FOR PREVENTING, POSTPONING OR IMPROVING THE OUTCOME OF SPINAL DEVICE AND FUSION PROCEDURES - Methods for identifying subjects who could benefit therapeutically from administration of a high specificity cytokine inhibitor are provided. Subjects that are identified include those that are eligible, based on pre-determined criteria, for a spinal device or fusion procedure, such as the implantation of a nucleus replacement device, an annular repair device, or a fusion device. Methods of preventing such procedures or improving the outcome of such procedures are also provided, and include administering a TAT to the subject by any route or regimen of administration, including the regimens described herein. | 04-15-2010 |
20100093830 | Modulation of MLCK-L Expression and Uses Thereof - In various aspects and embodiments the invention provides methods and reagents for controlling gene expression, and for treating disorders and diseases. Embodiments provide methods and reagents specifically for the regulation of MLCK expression and for the use thereof in treating disorders and diseases. Various embodiments provide methods and reagents for specifically down regulating the expression of MLCK-L more efficiently than that of MLCK-S, and for the use thereof in treating disorders and diseases. Embodiments provide siNA for the same, particularly siRNAs. Various of the embodiments are useful for the treatment of inflammatory disorders and diseases, including, for one example in this regard, Asthma. | 04-15-2010 |
20100093831 | NUCLEIC ACID COMPOUNDS FOR INHIBITING ANGIOGENESIS AND TUMOR GROWTH - In certain embodiments, this present disclosure provides nucleic acid compounds, compositions, and methods for inhibiting Ephrin B2 or EphB4 expression. In certain embodiments, the present disclosure provides methods and compositions for treating cancer or for treating angiogenesis-associated diseases. | 04-15-2010 |
20100093832 | MODULATION OF INSULIN LIKE GROWTH FACTOR I RECEPTOR EXPRESSION IN CANCER - Provided herein are methods, compounds, and compositions for reducing expression of an IGF-IR mRNA and protein in an animal. Also provided herein are methods, compounds, and compositions that inhibit expression of IGF-IR in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate the tumor or cancer, or a symptom thereof. | 04-15-2010 |
20100093833 | Methods for Inducing Differentiation of Undifferentiated Mammalian Cells Into Osteoblasts - The present invention relates to in vivo and in vitro methods, agents and compound screening assays for inducing differentiation of undifferentiated mammalian cells into osteoblasts, including bone formation enhancing pharmaceutical compositions, and the use thereof in treating and/or preventing a disease involving a systemic or local decrease in mean bone density in a subject. | 04-15-2010 |
20100093834 | MANIPULATION OF NEURONAL ION CHANNELS - The present invention provides compositions and methods for the manipulation of ion channels. For example, the present invention relates to Parkinson's and other neurological diseases and conditions, and treatments thereof. In particular, the present invention provides methods of decreasing pathophysiological high frequency neuronal bursts of Parkinson's and other neurological diseases and conditions. Methods of the present invention comprise decreasing Kv3 ion channel activity in fast-spiking neurons, including by decreasing activity of a Kv3.4 protein and by specifically targeting a Kv3.4 protein with an inhibitor. | 04-15-2010 |
20100093835 | RNA INTERFERENCE MEDIATED INHIBITION OF MYC AND/OR MYB GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating Myc and/or Myb gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of Myc and/or Myb gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of Myc and/or Myb (e.g., c-Myc, N-Myc, L-Myc, c-Myb, a-Myb, b-Myb, and v-Myb) genes. The small nucleic acid molecules are useful in the treatment of cancer and other diseases and disorders. | 04-15-2010 |
20100099737 | COMPOSITIONS AND METHODS FOR TREATING MYELOSUPPRESSION - The invention provides, in part, compositions and methods for protecting a hemopoietic cell, or for treating myelosuppression, in a subject in need thereof, by administering an effective amount of an inhibitor of a SH2-containing inositol-5′-phosphatase. | 04-22-2010 |
20100099738 | POLYETHYLENE GLYCOL LIPID CONJUGATES AND USES THEREOF - Polyethylene glycol (PEG)-lipid conjugates, polyethylene glycol (PEG)-lipid conjugate based drug delivery systems, ways to make them and methods of treating diseases using them are disclosed. | 04-22-2010 |
20100099739 | Compositions and Methods for Gene Silencing - Compositions and methods for modulating the expression of a protein of interest are provided. | 04-22-2010 |
20100099740 | METHODS AND COMPOSITIONS FOR RNAI MEDIATED INHIBITION OF GENE EXPRESSION IN MAMMALS - Methods and compositions are provided for modulating, e.g., reducing, expression of a target sequence in mammals and mammalian cells in vivo. In the subject methods, an effective amount of an RNAi agent, e.g., an interfering ribonucleic acid (such as an siRNA or shRNA) is introduced into a target cell, e.g., by being administered to a mammal that includes the target cell, e.g., via intravascular injection. Also provided are RNAi agent pharmaceutical preparations for use in the subject methods. The subject methods and compositions find use in a variety of different applications, including academic and therapeutic applications. | 04-22-2010 |
20100099741 | Molecular Targets for Treatment of Learning and Memory Dysfunction - Described herein are methods for identification of alternative safe molecular targets and novel regulators in complex molecular networks using a novel fault diagnosis engineering approach. For example, in this invention we claim new molecular targets that could be effectively targeted for changing the activity of CREB, and therefore for treatment of learning and memory related disorders. Learning and memory dysfunction is a major clinical manifestation of a number of human disorders, such as Alzheimer Disease (AD), schizophrenia, dementias, autism, etc. More specifically, we claim that composition and compounds that can target the activity of L AND/OR P/Q-, N-type calcium channels, Gαi, Gβγ, PP2A and CaMKII and IV are effective therapeutics for the treatment of disorders manifested by learning and memory dysfunction. | 04-22-2010 |
20100099742 | Sensitizing Cells for Apoptosis by Selectively Blocking Cytokines - The invention refers to the use of a cytokine antagonist which modulates the expression and/or the function of a cytokine, particularly a Th2 helper cell cytokine, in a cell and causes the down-regulation of anti-apoptotic proteins in said cell through the cytokine modulation for sensitizing cells for apoptosis. In particular, the cells that can be treated with the cytokine antagonists are drug-resistant cancer cells which fail to undergo apoptosis. | 04-22-2010 |
20100099743 | RNA INTERFERENCE MEDIATED INHIBITION OF CHECKPOINT KINASE-1 (CHK-1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating checkpoint kinase (e.g., checkpoint kinase-1 or CHK-1) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of checkpoint kinase gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of checkpoint kinase genes. | 04-22-2010 |
20100099744 | RNA INTERFERENCE MEDIATED INHIBITION OF MATRIX METALLOPROTEINASE 13 (MMP13) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating matrix metalloproteinase (e.g., MMP13) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of MMP13 gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of MMP13 genes. | 04-22-2010 |
20100105758 | USE OF AN ADENOSINE ANTAGONIST - Uses for a selective adenosine A3 receptor antagonist, or RNAi directed against said receptor, to treat myocardial infarction and heart conditions including heart failure, are provided. Optionally, an adenosine A2a receptor agonist may also be used with the adenosine A3 receptor antagonist. Methods of treating heart failure are also provided. | 04-29-2010 |
20100105759 | H19 SILENCING NUCLEIC ACID AGENTS FOR TREATING RHEUMATOID ARTHRITIS - The invention relates to the treatment of rheumatoid arthritis, particularly to the use of nucleic acid agents capable of silencing H19 for the treatment of rheumatoid arthritis. The invention provides methods for ameliorating rheumatoid arthritis and symptoms associated therewith, utilizing gene silencing oligonucleotides such as small interfering RNA (siRNA) agents directed to H19. | 04-29-2010 |
20100105760 | Treatment of Apolipoprotein-A1 Related Diseases by Inhibition of Natural Antisense Transcript to Apolipoprotein-A1 - Oligonucleotide compounds modulate expression and/or function of an apolipoprotein (ApoA1) polynucleotides and encoded products thereof. Methods for treating diseases associated with apolipoprotein-A1 (ApoA1) comprise administering one or more Oligonucleotide compounds designed to inhibit the Apo-A1 natural antisense transcript to patients. | 04-29-2010 |
20100113557 | METHOD FOR PREVENTION OF TUMOR - The present invention provides a method for inhibiting a tumor, which comprises suppressing the expression of HERC2. In one embodiment of the present invention, the suppression of HERC2 is induced by the expression of BRCA1. | 05-06-2010 |
20100113558 | COMPOUNDS AND METHODS - A small nucleic acid molecule that down-regulates expression of Wrap53 gene via RNA interference (RNAi), wherein at least one strand of said small nucleic acid molecule is about 15 to about 30 nucleotides in length; and wherein at least one strand of said small nucleic acid molecule comprises a nucleotide sequence having sufficient complementarity to an RNA of said Wrap53 gene for the small nucleic acid molecule to direct cleavage of said RNA via RNA interference, for use as a medicament. | 05-06-2010 |
20100113559 | Chitosan Based Polymer Conjugate and a Method for Producing the Same - The present invention relates to a conjugate of chitosan and polyamine polymer that is useful for transferring a desired gene medicine into cells, and a method for preparing the same. In particular, the present invention relates to a double conjugate that is prepared by 1 in king poly-L-arginine to low molecular weight chitosan or triple conjugate that is prepared by additionally linking polyethylene glycol (PEG) to the double conjugate, and a method for preparing the same. The chitosan based cationic polymer conjugate of the present invention forms a complex with negatively charged gene medicine such as plasmid DNA and small interfering RNA to efficiently transfer the desired gene medicine into cells with low cytotoxicity. Accordingly, the conjugate can be used as an effective delivery system for in vivo administration of gene medicine. | 05-06-2010 |
20100113560 | COMPOSITIONS AND METHODS FOR TREATING HEMATOPOIETIC MALIGNANCIES - Described herein are compositions and methods for the prevention and treatment of hematopoietic malignancies. The compositions are miRNAs and associated nucleic acids. | 05-06-2010 |
20100113561 | MICRORNA MOLECULES | 05-06-2010 |
20100113562 | THERAPEUTIC TARGETS AND MOLECULES - The invention provides methods and compositions for treating or preventing inflammation or an inflammatory condition in a subject, comprising administering to the subject an effective amount of at least one antagonist of one or more miRNA upregulated in inflammatory disease conditions and response to allergen challenge. The invention also provides methods for diagnosing inflammatory conditions based on miRNA expression profile signatures. | 05-06-2010 |
20100113563 | Method for Treating Pain with a Calmodulin Inhibitor - The present invention relates to the use of Ca | 05-06-2010 |
20100113564 | RNA Interference Mediated Inhibition of Interleukin and Interleukin Receptor Gene Expression Using Short Interfering Nucleic Acid (siNA) - This invention relates to compounds, compositions, and methods useful for modulating interleukin and/or interleukin receptor gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of interleukin and/or interleukin receptor gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of interleukin and/or interleukin receptor genes. | 05-06-2010 |
20100120891 | USE OF A GALECTIN-1-TARGETED RNAI-BASED APPROACH FOR THE TREATMENT OF CANCER - The present invention relates to an RNAi molecule suitable for reducing the expression of galectin-1 containing any of the sequences of SEQ ID NOs: 1-33, and preferably the sequences of SEQ ID NO: 2, 3, or 4, and to the use thereof as a medicament, or for the manufacture of a medicament for treating and/or for delaying the progression of cancer, preferably glioma, pancreatic cancer, head and neck cancer, melanoma, non-small-cell lung cancer and non-Hodgkin's lymphoma. The present invention also relates to compositions and methods for treating and for delaying the progression of cancer, preferably glioma, pancreatic cancer, head and neck cancer, melanoma, non-small-cell lung cancer and non-Hodgkin's lymphoma, for reducing the migration of tumor cells, preferably cells of glioma, pancreatic cancer, head and neck cancer, melanoma, non-small-cell lung cancer and non-Hodgkin's lymphoma, and/or for enhancing the efficacy of cancer therapies for the treatment of cancer, preferably glioma, pancreatic cancer, head and neck cancer, melanoma, non-small-cell lung cancer and non-Hodgkin's lymphoma, selected from the group comprising chemotherapy, radiation therapy, immunotherapy, and/or gene therapy. | 05-13-2010 |
20100120892 | METHODS AND COMPOSITIONS FOR THE INHIBITION OF STAT5 IN PROSTATE CANCER CELLS - The present invention relates to compositions and methods for the treatment of prostate cancer. In certain embodiments, the invention relates to compositions and methods for the inhibition of prostate cancer cell growth, comprising inhibiting the activity of Stat5 in prostate cancer cells. | 05-13-2010 |
20100120893 | Compositions and Methods for Inhibiting Expression of Transthyretin - The invention relates to a double-stranded ribonucleic acid (dsRNA) targeting a transthyretin (TTR) gene, and methods of using the dsRNA to inhibit expression of TTR. | 05-13-2010 |
20100120894 | Intracellular DNA receptor - Provided herein are methods of identifying and using compounds that modulate an AIM2 polypeptide-mediated immune response. Further provided herein are methods of treating disease comprising administering to a patient a compound that decreases expression of an AIM2 polypeptide. Further provided herein are methods of providing gene therapy to a patient comprising administering to the patient a gene therapy agent and a compound that decreases expression of an AIM2 polypeptide. In certain embodiments, a compound that decreases expression of an AIM2 polypeptide comprises an siRNA or an shRNA. | 05-13-2010 |
20100120895 | RNA Interference Mediated Inhibition of Cyclic Nucleotide Type 4 Phosphodiesterase (PDE4B) Gene Expression Using Short Interfering Nucleic Acid (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of cyclic nucleotide type 4 phosphodiesterase (PDE4B) gene expression and/or activity, including PDE4B1, PDE4B2, and PDE4B3 gene expression and/or activity. The present invention is also directed to compounds, compositions, and methods relating to traits, diseases and conditions that respond to the modulation of expression and/or activity of genes involved in cyclic nucleotide type 4 phosphodiesterase (PDE4B) gene expression pathways or other cellular processes that mediate the maintenance or development of such traits, diseases and conditions, including but not limited to IL-6, IL-7, IL-8, IL-15, TNF-alpha and matrix metalloproteinases (MMPs), such as MMP-I, MMP-2, MMP-3, MMP-9 and MMP-12. Specifically, the invention relates to double stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA), and multifunctional siNA molecules capable of mediating RNA interference (RNAi) against cyclic nucleotide type 4 phosphodiesterase (PDE4B) gene expression, including cocktails of such small nucleic acid molecules and lipid nanoparticle (LNP) formulations of such small nucleic acid molecules. The present invention also relates to small nucleic acid molecules, such as siNA, siRNA, antisense and others that can inhibit the function of endogenous RNA molecules or RNAi pathway components (RNAi inhibitors), such as endogenous micro-RNA (miRNA) (e.g, miRNA inhibitors) or endogenous short interfering RNA (siRNA), (e.g., siRNA inhibitors) or that can inhibit the function of RISC (e.g., RISC inhibitors), to modulate PDE4B gene expression by interfering with the regulatory function of such endogenous RNAs or proteins associated with such endogenous RNAs (e.g., RISC) including cocktails of such small nucleic acid molecules and lipid nanoparticle (LNP) formulations of such small nucleic acid molecules. Such small nucleic acid molecules are useful, for example, in providing compositions to prevent, inhibit, or reduce inflammatory, respiratory, and autoimmune diseases, traits, and conditions, and/or other disease states associated with PDE4B gene expression or activity in a subject or organism. | 05-13-2010 |
20100125099 | THERAPEUTIC INTERVENTION IN A GENETIC DISEASE IN AN INDIVIDUAL BY MODIFYING EXPRESSION OF AN ABERRANTLY OR ABNORMALLY EXPRESSED GENE - The present invention provides means and methods for alleviating genetic disease. A genetic defect that has a phenotype in differentiated cells can lead to defects in precursor cells thereof. These so-called secondary defects contribute to the overall disease of the individual. In the present invention, genetic intervention with the aim to alleviate symptoms of genetic disease is directed toward the primary genetic defect in the differentiated cell and the secondary defect in the precursor cell. | 05-20-2010 |
20100125100 | GOLD NANOROD-siRNA COMPLEXES AND METHODS OF USING SAME - Provided are methods and compositions for inhibiting expression of one or more target genes. The compositions contain RNA polynucleotides that can inhibit expression of a target gene via RNA interference (RNAi) electrostatically complexed with surface functionalized gold nanorods (GNRs). The RNA polynucleotides are not covalently bound to the surface functionalized GNRs. The method involves inhibiting expression of a target gene in an individual. The method is performed by administering to the individual an effective amount of a composition containing surface functionalized GNRs electrostatically complexed with RNA polynucleotides, such as siRNA, that can inhibit expression of the target gene via RNAi. The siRNA is not covalently bound to the surface functionalized GNRs. | 05-20-2010 |
20100130585 | METHODS AND COMPOSITIONS FOR INVESTIGATION AND TREATMENT OF CANCER USING A G-PROTEIN COUPLED EICOSANOID RECEPTOR - In some embodiments, without limitation, the present invention comprises compositions and methods for the investigation and treatment of cancers by directly or indirectly blocking or interfering with the delivery of survival signals in cancer cells via a G protein-coupled receptor, in some embodiments, a 5-oxoETE or 5-HETE receptor. Some embodiments comprise the receptor itself and methods to manipulate, block, or interfere with expression of or activity by or through binding with the receptor, including without limitation, by interference with, inhibition, or prevention of action by metabolites of arachidonate 5-lipoxygenase, such as 5-HETE and its derivative, 5-oxoETE. | 05-27-2010 |
20100130586 | DIAGNOSIS AND TREATMENT OF T-CELL ACUTE LYMPHOBLASTIC LEUKEMIA - The present invention relates to the field of biotechnological means to diagnose or treat T-cell acute lymphoblastic leukaemia. More particularly, the invention relates to methods to diagnose T-cell acute lymphoblastic leukaemia via determining the presence of a duplication of the MYB gene in cells taken from patients. The invention further relates to inhibitors capable of neutralizing the biological activity of MYB alone, or in combination with inhibitors capable of neutralizing the biological activity of NOTCH1, which can be used to treat T-cell acute lymphoblastic leukaemia. | 05-27-2010 |
20100130587 | METHODS OF TREATING CANCER USING siRNA MOLECULES DIRECTED AGAINST CD24 - A method of treating a CD24-related medical condition is disclosed. The method comprises administering to a subject in need thereof at least one siRNA molecule selected from the group consisting of SEQ ID NO: 1 to 4. Pharmaceutical compositions comprising same are also disclosed. | 05-27-2010 |
20100130588 | NOVEL LIPID FORMULATIONS FOR NUCLEIC ACID DELIVERY - The present invention provides novel, stable lipid particles comprising one or more active agents or therapeutic agents, methods of making the lipid particles, and methods of delivering and/or administering the lipid particles. More particularly, the present invention provides stable nucleic acid-lipid particles (SNALP) comprising a nucleic acid (such as one or more interfering RNA), methods of making the SNALP, and methods of delivering and/or administering the SNALP. | 05-27-2010 |
20100130589 | MODULATION OF eIF4E EXPRESSION - Oligomeric compounds, compositions and methods are provided for modulating the expression of eIF4E. The antisense compounds may be single- or double-stranded and are targeted to nucleic acid encoding eIF4E. Methods of using these compounds for modulation of eIF4E expression and for diagnosis and treatment of diseases and conditions associated with expression of eIF4E are provided. | 05-27-2010 |
20100130590 | DELETION BEARING BARD1 ISOFORMS AND USE THEREOF - The present invention relates to new protein isoforms, use thereof, methods of preparation thereof, methods of detection thereof, antibodies thereof, combination of antibodies thereof, use of these antibodies and combinations thereof and use of antagonists of those isoforms for the treatment of gynaecological cancers. | 05-27-2010 |
20100130591 | MULTIPLE EXON SKIPPING COMPOSITIONS FOR DMD - Provided are antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon skipping, and methods of use thereof to treat muscular dystrophy. | 05-27-2010 |
20100130592 | RNA Interference Mediated Inhibition of GRB2 Associated Binding Protein (GAB2) Gene Expression Using Short Interfering Nucleic Acid (siNA) - This invention relates to compounds, compositions, and methods useful for modulating GRB2 associated binding protein (GAB2) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of GRB2 associated binding protein (GAB2) gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of GAB2 genes. The small nucleic acid molecules are useful in the treatment of cancer, malignant blood disease (leukemia), inflammatory diseases or conditions, allergic diseases or conditions, or proliferative diseases or conditions. | 05-27-2010 |
20100137404 | Compositions and Methods for Altering Gene Expression - Compositions and methods for regulating gene expression in a growing animal are disclosed. | 06-03-2010 |
20100137405 | RNA Interference Mediated Inhibition of Cyclic Nucleotide Type 4 Phosphodiesterase (PDE4B) Gene Expression Using Short Interfering Nucleic Acid (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of cyclic nucleotide type 4 phosphodiesterase (PDE4B) gene expression and/or activity, including PDE4B1, PDE4B2, and PDE4B3 gene expression and/or activity. The present invention is also directed to compounds, compositions, and methods relating to traits, diseases and conditions that respond to the modulation of expression and/or activity of genes involved in cyclic nucleotide type 4 phosphodiesterase (PDE4B) gene expression pathways or other cellular processes that mediate the maintenance or development of such traits, diseases and conditions, including but not limited to IL-6, IL-I, IL-8, IL-15, TNF-alpha and matrix metalloproteinases (MMPs), such as MMP-I, MMP-2, MMP-3, MMP-9 and MMP-12. Specifically, the invention relates to double stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA), and multifunctional siNA molecules capable of mediating RNA interference (RNAi) against cyclic nucleotide type 4 phosphodiesterase (PDE4B) gene expression, including cocktails of such small nucleic acid molecules and lipid nanoparticle (LNP) formulations of such small nucleic acid molecules. The present invention also relates to small nucleic acid molecules, such as siNA, siRNA, antisense and others that can inhibit the function of endogenous RNA molecules or RNAi pathway components (RNAi inhibitors), such as endogenous micro-RNA (miRNA) (e.g, miRNA inhibitors) or endogenous short interfering RNA (siRNA), (e.g., siRNA inhibitors) or that can inhibit the function of RISC (e.g., RISC inhibitors), to modulate PDE4B gene expression by interfering with the regulatory function of such endogenous RNAs or proteins associated with such endogenous RNAs (e.g., RISC) including cocktails of such small nucleic acid molecules and lipid nanoparticle (LNP) formulations of such small nucleic acid molecules. Such small nucleic acid molecules are useful, for example, in providing compositions to prevent, inhibit, or reduce inflammatory, respiratory, and autoimmune diseases, traits, and conditions, and/or other disease states associated with PDE4B gene expression or activity in a subject or organism. | 06-03-2010 |
20100137406 | RNA Interference Mediated Inhibition of Cyclic Nucleotide Type 4 Phosphodiesterase (PDE4B) Gene Expression Using Short Interfering Nucleic Acid (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of cyclic nucleotide type 4 phosphodiesterase (PDE4B) gene expression and/or activity, including PDE4B1, PDE4B2, and PDE4B3 gene expression and/or activity. The present invention is also directed to compounds, compositions, and methods relating to traits, diseases and conditions that respond to the modulation of expression and/or activity of genes involved in cyclic nucleotide type 4 phosphodiesterase (PDE4B) gene expression pathways or other cellular processes that mediate the maintenance or development of such traits, diseases and conditions, including but not limited to IL-6, IL-I, IL-8, IL-15, TNF-alpha and matrix metalloproteinases (MMPs), such as MMP-1, MMP-2, MMP-3, MMP-9 and MMP-12. Specifically, the invention relates to double stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA), and multifunctional siNA molecules capable of mediating RNA interference (RNAi) against cyclic nucleotide type 4 phosphodiesterase (PDE4B) gene expression, including cocktails of such small nucleic acid molecules and lipid nanoparticle (LNP) formulations of such small nucleic acid molecules. The present invention also relates to small nucleic acid molecules, such as siNA, siRNA, antisense and others that can inhibit the function of endogenous RNA molecules or RNAi pathway components (RNAi inhibitors), such as endogenous micro-RNA (miRNA) (e.g., miRNA inhibitors) or endogenous short interfering RNA (siRNA), (e.g., siRNA inhibitors) or that can inhibit the function of RISC (e.g., RISC inhibitors), to modulate PDE4B gene expression by interfering with the regulatory function of such endogenous RNAs or proteins associated with such endogenous RNAs (e.g., RISC) including cocktails of such small nucleic acid molecules and lipid nanoparticle (LNP) formulations of such small nucleic acid molecules. Such small nucleic acid molecules are useful, for example, in providing compositions to prevent, inhibit, or reduce inflammatory, respiratory, and autoimmune diseases, traits, and conditions, and/or other disease states associated with PDE4B gene expression or activity in a subject or organism. | 06-03-2010 |
20100137407 | SINGLE-CHAIN CIRCULAR RNA AND METHOD OF PRODUCING THE SAME - The present invention relates to a single-chain circular RNA having a sustained or slow-releasing RNA interference effect, characterized in that the single-chain circular RNA comprises a sense strand sequence, an antisense strand sequence complementary to the sense strand sequence, identical or different two loop sequences between the sense strand and the antisense strand, connecting both strands, wherein the sense strand and the antisense strand are paired to form a stem. | 06-03-2010 |
20100137408 | ANTISENSE ANTIBACTERIAL METHOD AND COMPOUND - A method and antisense compound for inhibiting the growth of pathogenic bacterial cells are disclosed. The compound contains no more than 12 nucleotide bases and has a targeting nucleic acid sequence of no fewer than 10 bases in length that is complementary to a target sequence containing or within 10 bases, in a downstream direction, of the translational start codon of a bacterial mRNA that encodes a bacterial protein essential for bacterial replication. The compound binds to a target mRNA with a T | 06-03-2010 |
20100137409 | Compositions and Methods for the Treatment of Diseases Associated with Aberrant Cilia Assembly and Regulation - Compositions and methods are provided for identifying agents which have efficacy for the treatment of disorders related to aberrant cilial structure and function, including polycystic kidney disease. | 06-03-2010 |
20100137410 | Oncogenic ALL-1 Fusion Proteins for Targeting Drosha-Mediated MicroRNA Processing - Disclosed are compositions and methods for reducing the proliferation of ALL cancer cells through targeted interactions with ALL1 fusion proteins. | 06-03-2010 |
20100137411 | RAS-MEDIATED EPIGENETIC SILENCING EFFECTORS AND USES THEREOF - The invention relates to methods for inhibiting gene silencing, methods for inhibiting cell proliferation, methods for inhibiting Ras mediated tumor growth, methods for screening for regulators of FAS expression, and methods for identifying inhibitors of Ras mediated tumor growth. | 06-03-2010 |
20100144830 | CANCER CELL IDENTIFICATION MARKER AND CANCER CELL PROLIFERATION INHIBITOR - Disclosed is an identification marker which can be utilized for detection of various human cancer cells and whose expression closely relates to malignant alteration of cells, and compositions for human cancer treatment which are based on suppression of cancer cell proliferation through inhibition of expression of the identification marker. The marker is human heterochromatin protein 1γ (HP1γ), and the compositions for cancer treatment comprises one or more agents which suppresses the expression of human HP1γ gene, such as siRNAs to human HP1γ. | 06-10-2010 |
20100144831 | BLOCKING OF GENE EXPRESSION IN EUKARYOTIC CELLS - The present invention provides methods for designing a sequence for efficient short interference RNA molecules. In particular, the present invention defines a universal target for siRNA derived from a poly A sequence, optionally in conjunction with unique sequences for gene silencing and inhibition of viral replication in a eukaryotic host cell. The present invention further provides methods for the treatment and prevention of diseases and disorders by silencing a gene of a virus, an oncogene, genes encoding transcription factors and many other diseases related genes. The present invention describes antisense nucleic acids compositions comprising sequences complementary to a target nucleic acid. The antisense sequences are designed to hybridize to complementary nucleic acid target regions in a target RNA, and inhibit translation, processing, transport, or binding by proteins or riboproteins. Target regions include, and are limited to a poly-A tail, and exclude, AUG, 5′ non-translated sequences, translation initiation factor binding sites, ribosome subunit binding sites, Shine Dalgarno sequence, 3′ nontranslated sequences, poly-addition site, 3′ cleavage site, coding region, intron, intron branch site, intron/exon junction, and splice sequence. | 06-10-2010 |
20100144832 | Prostate Cancer-Specific Alternations in ERG Gene Expression and Detection and Treatment Methods Based on Those Alterations - The disclosure describes alterations in ERG gene expression. ERG isoforms and promoter sequence of the ERG gene that are involved in, or associated with, prostate cancer are provided. The disclosure further provides therapeutic compositions and methods of detecting, diagnosing, prognosing, and treating prostate cancer, including biomarkers for detecting the expression of two or more of the following genes: PSA/KLK3, PMEPA1, NKX3.1, ODC1, AMD1, and ERG. | 06-10-2010 |
20100144833 | RNAi Modulation Of RSV, PIV And Other Respiratory Viruses And Uses Thereof - The present invention is based on the in vivo demonstration that RSV and PIV can be inhibited through intranasal administration of RNAi agents as well as by parenteral administration of such agents. Further, it is shown that effective viral reduction can be achieved with more than one virus being treated concurrently. Based on these findings, the present invention provides general and specific compositions and methods that are useful in reducing RSV or PIV mRNA levels, RSV or PIV protein levels and viral titers in a subject, e.g., a mammal, such as a human. These findings can be applied to other respiratory viruses. | 06-10-2010 |
20100144834 | METHODS FOR TREATING HYPERCHOLESTEROLEMIA - Disclosed herein are antisense compounds and methods for decreasing LDL-C in an individual having elevated LDL-C. Additionally disclosed are antisense compounds and methods for treating hypercholesterolemia, or alternatively for treating or preventing atherosclerosis. Further disclosed are antisense compounds and methods for decreasing coronary heart disease risk. Such methods include administering to an individual in need of treatment an antisense compound targeted to a PCSK9 nucleic acid. The antisense compounds administered include gapmer antisense oligonucleotides. | 06-10-2010 |
20100144835 | INHIBITION OF GPR4 - The present invention relates to the use of a GPR4 inhibitor for the manufacture of a medicament for the inhibition of angiogenesis, for instance for the inhibition of tumour growth in the treatment of cancer. In a preferred embodiment, said inhibitor is a siRNA, preferably double-stranded. | 06-10-2010 |
20100144836 | Methods for Detecting Epigenetic Modifications - A method of detecting a predisposition to, or the incidence of, cancer in a sample comprises detecting an epigenetic change in at least one gene selected from an NDRG4/NDRG2 subfamily gene, GATA4, OSMR, GATA5, SFRP1, ADAM23, JPH3, SFRP2, APC, MGMT, 11112, BNIP3, FOXE1, SYNE1, S0X17, PHACTR3 and JAM3, wherein detection of the epigenetic change is indicative of a predisposition to, or the incidence of, cancer. Also described are pharmacogenetic methods for determining suitable treatment regimens for cancer and methods for treating cancer patients, based around selection of the patients according to the methods of the invention. The present invention is also concerned with improved methods of collecting, processing and analyzing samples, in particular body fluid samples. These methods may be useful in diagnosing, staging or otherwise characterizing various diseases. The invention also relates to methods for identifying, diagnosing, staging or otherwise characterizing cancers, in particular gastrointestinal cancers such as colorectal cancers, gastric cancers and oesophageal cancers. The methods of the invention relate, inter alia, to isolating and analyzing the human DNA component from faecal samples and blood-based samples. | 06-10-2010 |
20100144837 | DIAGNOSIS AND TREATMENT OF MALIGNANT NEOPLASMS - The invention features a method for diagnosing a malignant neoplasm in a mammal by contacting a bodily fluid from the mammal with an antibody which binds to an human aspartyl (asparaginyl) beta-hydroxylase (HAAH) polypeptide and methods of treating malignant neoplasms by inhibiting HAAH. | 06-10-2010 |
20100144838 | Methods for Identifying Modulators of Pyrimidine Tract Binding Protein - Provided herein are methods and materials for identifying compounds that modulate polypyrimidine tract binding protein (PTB), a protein that functions as a negative regulator of pre-mRNA splicing by blocking the inclusion of numerous alternative exons into mRNA. | 06-10-2010 |
20100144839 | ANTI-CANCER OLIGODEOXYNUCLEOTIDES - It is disclosed herein that suppressive ODNs are of use for preventing or delaying the formation of a tumor, reducing the risk of developing a tumor, treating a tumor, preventing conversion of a benign to a malignant lesion, or preventing metastasis. In some embodiments, methods are disclosed herein for treating, preventing or reducing the risk of developing a tumor, such as esophageal, gastrointestinal, liver, lung, skin and colon tumors or a mesothelioma. Generally, the methods disclosed herein include selecting a subject for treatment and administering to the subject a therapeutically effective amount of one or more suppressive ODN. In some examples, additional agents can also be administered to the subject of interest. | 06-10-2010 |
20100144840 | Methods for Modulating the Efficacy of Nucleic Acid Based Therapies - Covalently reactive antigen analogs are disclosed herein. The antigens of the invention may be used to stimulate production of catalytic antibodies specific for predetermined antigens associated with particular medical disorders. The antigen analogs may also be used to permanently inactivate endogenously produced catalytic antibodies produced in certain autoimmune diseases as well as in certain lymphoproliferative disorders. Also provided are methods for modulating the efficacy of nucleic acid based therapeutics. | 06-10-2010 |
20100144841 | CONTROL OF NK CELL FUNCTION AND SURVIVAL BY MODULATION OF SHIP ACTIVITY - Inhibition of dendritic cell function in solid organ grafts or allogeneic bone marrow transplants prior to or during engraftment by blocking SH2-containing inositol phosphatase (SHIP) expression or function is taught as a method of abrogating immune rejection and thereby increasing the efficacy of engraftment of an allogeneic bone marrow transplant or solid organ allograft or xenograft. Also disclosed is a transgenic mouse having the genotype SHIP | 06-10-2010 |
20100144842 | RNA Interference Mediated Inhibition of NOGO and NOGO Receptor Gene Expression Using Short Interfering Nucleic Acid (siNA) - This invention relates to compounds, compositions, and methods useful for modulating NOGO and/or NOGO receptor gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of NOGO and/or NOGO receptor gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of NOGO and/or NOGO receptor genes, such as NOGO-A, NOGO-B, NOGO-C, NOGO-66 receptor, NI-35, NI-220, NI-250, myelin-associated glycoprotein, tenascin-R, and NG-2 | 06-10-2010 |
20100144843 | RNAI THERAPEUTIC FOR RESPIRATORY VIRUS INFECTION - Double stranded siRNA molecules for combatting a respiratory virus, wherein the strands of an siRNA molecule may be from about 15 to about 60 nucleotides, and uses thereof. One strand of an siRNA molecule can be a nucleic acid sequence identical to a conserved site, or a variant thereof, within the nucleic acid sequence of the respiratory virus. | 06-10-2010 |
20100144844 | RNAi-MEDIATED INHIBITION OF H1F1A FOR TREATMENT OF OCULAR ANGIOGENESIS - RNA interference is provided for inhibition of HIF1A mRNA expression for treating patients with ocular angiogenesis, particularly for treating retinal edema, diabetic retinopathy, sequela associated with retinal ischemia, posterior segment neovascularization (PSNV), and neovascular glaucoma, and for treating patients at risk of developing such conditions. | 06-10-2010 |
20100152278 | RNA Interference Mediated Inhibition of Cyclic Nucleotide Type 4 Phosphodiesterase (PDE4B) Gene Expression Using Short Interfering Nucleic Acid (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of cyclic nucleotide type 4 phosphodiesterase (PDE4B) gene expression and/or activity, including PDE4B1, PDE4B2, and PDE4B3 gene expression and/or activity. The present invention is also directed to compounds, compositions, and methods relating to traits, diseases and conditions that respond to the modulation of expression and/or activity of genes involved in cyclic nucleotide type 4 phosphodiesterase (PDE4B) gene expression pathways or other cellular processes that mediate the maintenance or development of such traits, diseases and conditions, including but not limited to IL-6, IL-1, IL-8, IL-15, TNF-alpha and matrix metalloproteinases (MMPs), such as MMP-1, MMP -2, MMP-3, MMP-9 and MMP-12. Specifically, the invention relates to double stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA), and multifunctional siNA molecules capable of mediating RNA interference (RNAi) against cyclic nucleotide type 4 phosphodiesterase (PDE4B) gene expression, including cocktails of such small nucleic acid molecules and lipid nanoparticle (LNP) formulations of such small nucleic acid molecules. The present invention also relates to small nucleic acid molecules, such as siNA, siRNA, antisense and others that can inhibit the function of endogenous RNA molecules or RNAi pathway components (RNAi inhibitors), such as endogenous micro-RNA (miRNA) (e.g., miRNA inhibitors) or endogenous short interfering RNA (siRNA), (e.g., siRNA inhibitors) or that can inhibit the function of RISC (e.g., RISC inhibitors), to modulate PDE4B gene expression by interfering with the regulatory function of such endogenous RNAs or proteins associated with such endogenous RNAs (e.g., RISC) including cocktails of such small nucleic acid molecules and lipid nanoparticle (LNP) formulations of such small nucleic acid molecules. Such small nucleic acid molecules are useful, for example, in providing compositions to prevent, inhibit, or reduce inflammatory, respiratory, and autoimmune diseases, traits, and conditions, and/or other disease states associated with PDE4B gene expression or activity in a subject or organism. | 06-17-2010 |
20100152279 | RNAi Inhibition of Serum Amyloid A For Treatment of Glaucoma - RNA interference is provided for inhibition of serum amyloid A mRNA expression in glaucomas involving SAA expression. | 06-17-2010 |
20100160412 | METHODS OF MODULATING METABOLIC MEMORY - Described are methods of identifying modulators of metabolic memory, for the treatment of microvascular complications of diabetes, as well as methods of use thereof. Also described are methods of treating microvascular complications of diabetes by decreasing expression and/or activity of SHP-1. | 06-24-2010 |
20100160413 | Double-stranded ribonucleic acids with rugged physico-chemical structure and highly specific biologic activity - The invention relates to our discovery of a novel double-stranded ribonucleic acid (dsRNA) having specific biological activities, which includes acting as a selective agonist for activation of the Toll-like receptor 3. Its “rugged” molecular structure as measured by physico-chemical techniques is resistant to molecular unfolding (i.e., denaturation). This structure appears to be responsible for increased efficacy of dsRNA in therapeutic applications and improved biological activity (e.g., used as an immunoregulatory agent). Medicaments, processes for their manufacture, and methods for their use are provided herein. | 06-24-2010 |
20100160414 | Treating Picornavirus Infection by Targeting MicroRNA miR-141 - Treatment of picornavirus infection by inhibiting miR-141 activity. Also disclosed herein are a method for identify miR-141 inhibitory compounds and a method for identifying a target viral infection to be treated by anti-miR-141 therapy. | 06-24-2010 |
20100168202 | RAD 9 AS A DIAGNOSTIC,PROGNOSTIC,AND THERAPEUTIC TOOL FOR PROSTATE CANCER - This disclosure provides a method of treating a human subject having a cancer which comprises administering to the subject a nucleic acid so as to inhibit expression of human RAD9 protein in a cell of the cancer so as to thereby treat the human subject. This disclosure also provides methods of assessing gains in prostate cancer therapy and detecting prostate cancer. | 07-01-2010 |
20100168203 | ADENYLYL CYCLASES AS NOVEL TARGETS FOR ANTIBACTRIAL INTERVENTIONS - The present invention relates to a method of preventing or treating a disease caused by bacterial infection by administering an effective amount of a modulator of bacterial adenylyl cyclase. The invention also provides pharmaceutical compositions useful for preventing or treating a disease, with the compositions containing a therapeutically effective amount of a modulator of bacterial adenylyl cyclase. The invention also provides screening methods for identifying selective modulators of bacterial adenylyl cyclase that do not substantially modulate adenylyl cyclase of the subject. The invention also provides methods for culturing bacterial pathogens and methods for inducing the pathogenic state in vitro. | 07-01-2010 |
20100168204 | Therapeutic uses of inhibitors of RTP801L - The present invention provides novel molecules, compositions, methods and uses for treating microvascular disorders, eye diseases respiratory conditions and hearing disorders based upon inhibition of the RTP801L gene and/or protein. | 07-01-2010 |
20100168205 | Methods and Compositions for Prevention or Treatment of RSV Infection Using Modified Duplex RNA Molecules - Methods and compositions are provided for the prevention or treatment of RSV infection in a human. The methods include administering one or more doses of a composition comprising an siRNA. The dose can be formulated for topical or parenteral administration. Topical administration includes administration as a nasal spray, or by inhalation of respirable particles or droplets. The siRNA preferably comprises a sense strand and antisense strand with modified nucleotides. | 07-01-2010 |
20100168206 | GNAQ Targeted dsRNA Compositions And Methods For Inhibiting Expression - The invention relates to a double-stranded ribonucleic acid (dsRNA) targeting a G-alpha q subunit (GNAQ) of a heterotrimeric G gene, and methods of using the dsRNA to inhibit expression of GNAQ. | 07-01-2010 |
20100168207 | COMPOSITIONS AND METHODS FOR SIRNA INHIBITION OF ANGIOGENESIS - RNA interference using small interfering RNAs which are specific for the vascular endothelial growth factor (VEGF) gene and the VEGF receptor genes Flt-1 and Flk-1/KDR inhibit expression of these genes. Diseases which involve angiogenesis stimulated by overexpression of VEGF, such as diabetic retinopathy, age related macular degeneration and many types of cancer, can be treated by administering the small interfering RNAs. | 07-01-2010 |
20100168208 | RNA INTERFERENCE MEDIATED TREATMENT OF ALZHEIMER'S DISEASE USING SHORT INTERFERING NUCLEIC ACID (siNA) - The present invention concerns methods and reagents useful in modulating BACE gene expression in a variety of applications, including use in therapeutic, diagnostic, target validation, and genomic discovery applications. Specifically, the invention relates to small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against beta-secretase (BACE), amyloid precursor protein (APP), pin-1, presenillin 1 (PS-1) and/or presenillin 2 (PS-2) gene expression and/or activity. The small nucleic acid molecules are useful in the treatment of Alzheimer's disease and any other condition that responds to modulation of BACE, APP, pin-1, PS-1 and/or PS-2 expression or activity. | 07-01-2010 |
20100168209 | APOPTOSIS INDUCER FOR CANCER CELL - The present invention revealed that by suppressing the expression of the WRN gene, the BLM gene, or the RecQ1 gene, which belong to the RecQ helicase family, apoptosis is induced in various cancer cells and their proliferation is suppressed. Compounds that suppress the expression of RecQ helicase family genes or the functions of RecQ helicase proteins are thought to have the activity of inducing apoptosis. | 07-01-2010 |
20100168210 | T-Cell Cytokine-Inducing Surface Molecules and Methods of Use - The invention provides cytokine modulators and methods for using the same to modulate cytokine production in monocyte lineage-derived cells. In particular, cytokine modulators of the invention selectively bind to a T-cell cytokine-inducing surface molecule (TCISM)-ligand of T lymphocytes or the corresponding TCISM-receptor of monocyte lineage-derived cells, thereby modulating cytokine production in monocyte lineage-derived cells. | 07-01-2010 |
20100173971 | Genetic changes in ATM and ATR/CHEK1 as prognostic indicators in cancer - The present invention relates to the discovery that, in human cancer, an 11 | 07-08-2010 |
20100173972 | METHODS AND USES RELATED TO RHBDL4 - The invention relates to a method of identifying a modulator of RHBDL4, said method comprising (i) providing a first and second sample of cells; (ii) contacting said first sample of cells with a candidate modulator of RHBDL4; (iii) measuring epidermal growth factor receptor (EGFR) transactivation in said first and second samples of cells, wherein a difference between the transactivation measured in said first and second samples of cells identifies said candidate modulator of RHBDL4 as a modulator of RHBDL4. The invention also relates to RHBDL4 protease assays and to uses of RHBDL4 protease and methods of cleavage of RHBDL4 substrates. | 07-08-2010 |
20100173973 | EXTENDED DICER SUBSTRATE AGENTS AND METHODS FOR THE SPECIFIC INHIBITION OF GENE EXPRESSION - The invention provides compositions and methods for reducing expression of a target gene in a cell, involving contacting a cell with an isolated double stranded nucleic acid (dsNA) in an amount effective to reduce expression of a target gene in a cell. The dsNAs of the invention possess a pattern of deoxyribonucleotides (in most embodiments, the pattern comprises at least one deoxyribonucleotide-deoxyribonucleotide base pair) designed to direct the site of Dicer enzyme cleavage within the dsNA molecule. Deoxyribonucleotides of the dsNA molecules of the invention are located within a region of the dsNA that can be excised via Dicer cleavage to generate an active siRNA agent that no longer contains the deoxyribonucleotide pattern (e.g., deoxyribonucleotide-deoxyribonucleotide base pairs). Such DNA-extended Dicer-substrate siRNAs (DsiRNAs) were demonstrated to be more effective RNA inhibitory agents than corresponding double stranded RNA-extended DsiRNAs. DsiRNA agents were also found to tolerate guide strand mismatches. | 07-08-2010 |
20100173974 | EXTENDED DICER SUBSTRATE AGENTS AND METHODS FOR THE SPECIFIC INHIBITION OF GENE EXPRESSION - The invention provides compositions and methods for reducing expression of a target gene in a cell, involving contacting a cell with an isolated double stranded nucleic acid (dsNA) in an amount effective to reduce expression of a target gene in a cell. The dsNAs of the invention possess a pattern of deoxyribonucleotides (in most embodiments, the pattern comprises at least one deoxyribonucleotide-deoxyribonucleotide base pair) designed to direct the site of Dicer enzyme cleavage within the dsNA molecule. Deoxyribonucleotides of the dsNA molecules of the invention are located within a region of the dsNA that can be excised via Dicer cleavage to generate an active siRNA agent that no longer contains the deoxyribonucleotide pattern (e.g., deoxyribonucleotide-deoxyribonucleotide base pairs). Such DNA-extended Dicer-substrate siRNAs (DsiRNAs) were demonstrated to be more effective RNA inhibitory agents than corresponding double stranded RNA-extended DsiRNAs. DsiRNA agents were also found to tolerate guide strand mismatches. | 07-08-2010 |
20100173975 | Expressed Pseudogene Regulates Gene Expression - Selective expression of a pseudogene of myosin light chain kinase is found in cancer cells and tissues but not in normal cells and tissues. The pseudogene is expressed, and when expressed it inhibits expression of the ancestral myosin light chain kinase. This widespread expression among cancer cell types and the selective expression in cancer cells versus normal cells opens the door to many diagnostic and therapeutic applications. | 07-08-2010 |
20100173976 | RNA INTERFERENCE MEDIATED INHIBITION OF STROMAL CELL-DERIVED FACTOR-1 (SDF-1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of stromal cell-derived factor-1 (SDF-1) gene expression and/or activity. The present invention is also directed to compounds, compositions, and methods relating to traits, diseases and conditions that respond to the modulation of expression and/or activity of genes involved in SDF-1 gene expression pathways or other cellular processes that mediate the maintenance or development of such traits, diseases and conditions. Specifically, the invention relates to small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating or that mediate RNA interference (RNAi) against SDF-1 gene expression. Such small nucleic acid molecules are useful, for example, in providing compositions for treatment of traits, diseases and conditions that can respond to modulation of SDF-1 expression in a subject, such as ocular disease, cancer and proliferative diseases and any other disease, condition, trait or indication that can respond to the level of SDF-1 in a cell or tissue. | 07-08-2010 |
20100179212 | Pharmaceutical composition which improves in vivo gene transfer - A pharmaceutical composition which combines a tetrafunctional copolymer with a nucleic acid, said copolymer having formula I (namely a poloxamine), and preferably taking the form of one of the cationic mineral or organic salts thereof. The composition can be used to improve in vivo gene transfer. | 07-15-2010 |
20100184820 | COMBINATIONS COMPRISING STAUROSPORINES - The present invention relates to a method of treating myelodysplastic syndromes, lymphomas and leukemias, and also solid tumors with a pharmaceutical combination of a FLT-3 kinase inhibitor and an antisense oligonucleotide or a mcl-1-specific RNAi construct. It also relates to the use of a pharmaceutical combination of a histone deacetylase inhibitor and a FLT-3 kinase inhibitor for the treatment of the diseases or malignancies mentioned above and the use of such a pharmaceutical composition for the manufacture of a medicament for the treatment of these diseases or malignancies. | 07-22-2010 |
20100184821 | Compositions and Methods for Modulating Angiogenesis - The invention generally features compositions and methods that are useful for modulating angiogenesis. | 07-22-2010 |
20100184822 | Method of modulating the activity of a nucleic acid molecule - The present invention relates, in general, to agents that modulate the pharmacological activity of nucleic acid molecules and, in particular, to agents that bind therapeutic or diagnostic nucleic acid molecules in a sequence independent manner and modulate (e.g., inhibit or reverse) their activity. The invention also relates to compositions comprising such agents and to methods of using same. | 07-22-2010 |
20100184823 | dsRNA For Treating Viral Infection - The invention relates to double-stranded ribonucleic acids (dsRNAs) targeting gene expression of phosphatidylinositol 4-kinase (PI4K), in particular human phosphatidylinositol 4-kinase, catalytic, beta polypeptide (PIK4CB) or human phosphatidylinositol 4-kinase, catalytic, alpha polypeptide (PIK4CA), and their use for treating infection by positive stranded RNA viruses such as hepatitis C virus (HCV). Each dsRNA comprises an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of the PIK4CB or PIK4CA target mRNA. A plurality of such dsRNA may be employed to provide therapeutic benefit. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier, and including a delivery modality such as fully encapsulated liposomes or lipid complexes. The invention further includes methods for treating diseases caused by positive stranded RNA virus infection using the pharmaceutical compositions; and methods for inhibiting the propagation of positive stranded RNA viruses in and between cells. | 07-22-2010 |
20100184824 | RNA Interference Mediated Inhibition of Interleukin and Interleukin Receptor Gene Expression Using Short Interfering Nucleic Acid (siNA) - This invention relates to compounds, compositions, and methods useful for modulating interleukin and/or interleukin receptor gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of interleukin and/or interleukin receptor gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of interleukin and/or interleukin receptor genes. | 07-22-2010 |
20100184825 | RNA Interference Mediated Inhibition of Protein Tyrosine Phosphatase-1B (PTP-1B) Gene Expression Using Short Interfering Nucleic Acid (siNA) - This invention relates to compounds, compositions, and methods useful for modulating protein tyrosine phosphatase-1B (PTP-1B) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of PTP-1B gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of PTP-1B genes. Such small nucleic acid molecules are useful, for example, for treating, preventing, inhibiting, or reducing obesity, insulin resistance, diabetes (eg. type II and type I diabetes) in a subject or organism, and for any other disease, trait, or condition that is related to or will respond to the levels of PTP-1B in a cell or tissue, alone or in combination with other treatments or therapies. | 07-22-2010 |
20100184826 | METHODS AND COMPOSITIONS FOR ENHANCING THE EFFICACY AND SPECIFICITY OF RNA SILENCING - The present invention provides methods of enhancing the efficacy and specificity of RNA silencing. The invention also provides compositions for mediating RNA silencing. In particular, the invention provides siRNAs, siRNA-like molecules, shRNAs, vectors and transgenes having improved specificity and efficacy in mediating silencing of a target gene. Therapeutic methods are also featured. | 07-22-2010 |
20100184827 | METHODS AND COMPOSITIONS FOR ENHANCING THE EFFICACY AND SPECIFICITY OF RNA SILENCING - The present invention provides methods of enhancing the efficacy and specificity of RNA silencing. The invention also provides compositions for mediating RNA silencing. In particular, the invention provides siRNAs, siRNA-like molecules, shRNAs, vectors and transgenes having improved specificity and efficacy in mediating silencing of a target gene. Therapeutic methods are also featured. | 07-22-2010 |
20100184828 | METHODS AND COMPOSITIONS FOR ENHANCING THE EFFICACY AND SPECIFICITY OF RNA SILENCING - The present invention provides methods of enhancing the efficacy and specificity of RNA silencing. The invention also provides compositions for mediating RNA silencing. In particular, the invention provides siRNAs, siRNA-like molecules, shRNAs, vectors and transgenes having improved specificity and efficacy in mediating silencing of a target gene. Therapeutic methods are also featured. | 07-22-2010 |
20100184829 | RNAI MODULATION OF SCAP AND THERAPEUTIC USES THEREOF - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a SCAP gene (Human SCAP gene), comprising an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of a SCAP gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by Human SCAP expression and the expression of a SCAP gene using the pharmaceutical composition; and methods for inhibiting the expression of a SCAP gene in a cell. | 07-22-2010 |
20100190837 | 5'-Substituted-2-F' Modified Nucleosides and Oligomeric Compounds Prepared Therefrom - The present invention provides 5′-substituted-2′-F nucleoside analogs and oligomeric compounds comprising these nucleoside analogs. In one preferred embodiment the nucleoside analogs have either (R) or (5)-chirality at the 5′-position. These nucleoside analogs are expected to be useful for enhancing properties of oligomeric compounds including nuclease resistance. | 07-29-2010 |
20100190838 | Connective Tissue Growth Factor Fragments and Methods and Uses Thereof - The present invention is directed to CTGF fragments comprising at least exon 2 or exon 3 of CTGF and having the ability to induce extracellular matrix synthesis, in particular, collagen synthesis and myofibroblast differentiation. The present invention is further directed to methods using said CTGF fragments to identify compositions which modulate the activity of said CTGF fragments and to the compositions so identified. The invention also relates to methods of treating CTGF-associated disorders and diseases associated with the overproduction of the extracellular matrix. | 07-29-2010 |
20100197762 | ANTISENSE COMPOUNDS - Provided herein are gapmer oligomeric compounds for reduction of target RNA in vivo comprising different nucleotide modifications within one or both wing regions. Also provided are methods of using such oligomeric compounds, including use in animals. In certain embodiments, such compound have desirable potency and toxicity characteristics. | 08-05-2010 |
20100197763 | RNA Interference Mediated Inhibition of Cyclic Nucleotide Type 4 Phosphodiesterase (PDE4B) Gene Expression Using Short Interfering Nucleic Acid (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of cyclic nucleotide type 4 phosphodiesterase (PDE4B) gene expression and/or activity, including PDE4B1, PDE4B2, and PDE4B3 gene expression and/or activity. The present invention is also directed to compounds, compositions, and methods relating to traits, diseases and conditions that respond to the modulation of expression and/or activity of genes involved in cyclic nucleotide type 4 phosphodiesterase (PDE4B) gene expression pathways or other cellular processes that mediate the maintenance or development of such traits, diseases and conditions, including but not limited to IL-6, IL-7, IL-8, IL-15, TNF-alpha and matrix metalloproteinases (MMPs), such as MMP-I, MMP-2, MMP-3, MMP-9 and MMP-12. Specifically, the invention relates to double stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA), and multifunctional siNA molecules capable of mediating RNA interference (RNAi) against cyclic nucleotide type 4 phosphodiesterase (PDE4B) gene expression, including cocktails of such small nucleic acid molecules and lipid nanoparticle (LNP) formulations of such small nucleic acid molecules. The present invention also relates to small nucleic acid molecules, such as siNA, siRNA, antisense and others that can inhibit the function of endogenous RNA molecules or RNAi pathway components (RNAi inhibitors), such as endogenous micro-RNA (miRNA) (e.g, miRNA inhibitors) or endogenous short interfering RNA (siRNA), (e.g., siRNA inhibitors) or that can inhibit the function of RISC (e.g., RISC inhibitors), to modulate PDE4B gene expression by interfering with the regulatory function of such endogenous RNAs or proteins associated with such endogenous RNAs (e.g., RISC) including cocktails of such small nucleic acid molecules and lipid nanoparticle (LNP) formulations of such small nucleic acid molecules. Such small nucleic acid molecules are useful, for example, in providing compositions to prevent, inhibit, or reduce inflammatory, respiratory, and autoimmune diseases, traits, and conditions, and/or other disease states associated with PDE4B gene expression or activity in a subject or organism. | 08-05-2010 |
20100197764 | ANTISENSE MODULATION OF ACYL COA CHOLESTEROL ACYLTRANSFERASE-2 EXPRESSION - Antisense compounds, compositions and methods are provided for modulating the expression of acyl CoA cholesterol acyltransferase-2. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding acyl CoA cholesterol acyltransferase-2. Methods of using these compounds for modulation of acyl CoA cholesterol acyltransferase-2 expression and for treatment of diseases associated with expression of acyl CoA cholesterol acyltransferase-2 are provided. | 08-05-2010 |
20100197765 | METHOD FOR PROMOTING THE EXPRESSION OF P53, AND P53 EXPRESSION PROMOTER FOR USE IN THE METHOD - A method for promoting expression of p53 mRNA and an expression promoting agent for use in the method are provided. The expression of the p53 gene can be promoted by inhibiting the binding between RNA transcribed from exon 1 of the vegf-A gene and mRNA transcribed from the p53 gene. The inhibition of the binding can be achieved by, for example, degrading the RNA transcribed from the exon 1 of the vegf-A gene, inhibiting transcription of RNA from the exon 1 of the vegf-A gene, or binding a nucleic acid that is different from the mRNA transcribed from the p53 gene to the RNA transcribed from the exon 1 of the vegf-A gene. | 08-05-2010 |
20100197766 | Antisense Oligonucleotides Directed to Ribonucleotide Reductase R2 and Uses Thereof in the Treatment of Cancer - The present invention provides antisense oligonucleotides directed to a mammalian ribonucleotide reductase R2 gene and combinations of the antisense oligonucleotides with one or more chemotherapeutic agents for use in the treatment of cancer. | 08-05-2010 |
20100204297 | INFLUENZA THERAPEUTIC - The present invention provides compositions comprising an RNAi-inducing entity targeted to an influenza virus transcript and any of a variety of delivery agents. The invention further includes methods of use of the compositions for inhibiting a biological activity of an influenza virus and/or for treatment or prevention of influenza. The invention provides target portion sequences that are favorably conserved for RNAi across a plurality of influenza virus A strains isolated from human hosts and/or avian hosts and RNAi-inducing entities, e.g., siRNAs and shRNAs, targeted to such favorably conserved target portions. The invention provides a variety of nucleic acids comprising sequences identical or complementary to at least a portion of one or more of these favorably conserved target portion sequences. The invention further provides methods and compositions for delivering RNAi-inducing agents to an organ or tissue of a mammalian subject, e.g., to the lung. Methods of diagnosing influenza and determining the susceptibility of an influenza virus to inhibition by an RNAi-inducing agent are also provided. Transgenic animals that express an RNAi-inducing agent targeted to an influenza gene are another aspect of the invention. | 08-12-2010 |
20100204298 | Use of Antisense Oligonucleotides Against CPLA2 in the Treatment of Cancer - Inhibitors of cPLA | 08-12-2010 |
20100204299 | C-CBL AND ANTAGONISTS THEREOF FOR THE TREATMENT AND DIAGNOSIS OF CANCER - The present invention relates to the treatment of cancer. More specifically, the present invention relates to the use of c-cbl as a marker for the diagnosis and/or prognosis of cancer, and to the use of a c-cbl antagonist for the treatment of a cancer associated with resistance to apoptosis. | 08-12-2010 |
20100204300 | ANTI-VIRAL METHODS AND COMPOSITIONS - The instant disclosure relates to methods and compositions for silencing poxvirus gene expression and replication using RNA interference. In certain embodiments, the disclosure relates to methods of treating a subject with a poxvirus infection. | 08-12-2010 |
20100204301 | Reducible polymers for nonviral gene delivery - Provided herein are biodegradable copolymers and nanoplex delivery systems comprising the same and a cargo molecule, such as a nucleic acid, a polynucleotide or other biomolecule. The biodegradable copolymers may comprise a reducible polymer linearly modified with lysine, such as a linear lysine-modified N,N′-cystamine bisacrylamide. The biodegradable copolymers also may be conjugated to a sequestering moiety, such as dietheylamine. The biodegradable copolymers also may comprise one or both of a targeting moiety and one or more moieties to facilitate endosomal escape. Also provided are methods for treating a pathophysiological condition and for increasing biocompatibility of a polymeric delivery system upon delivery to a subject using the biodegradable copolymers and nanoplexes. | 08-12-2010 |
20100204302 | SIDNA AGAINST HEPATITIS C VIRUS (HCV) - Silencing of HCV RNA can be achieved by siDNA. These are oligodeoxynucleotides consisting of an antisense strand homologous to the viral RNA and a second strand, partially complementary to the antisense-strand. The two strands are preferentially linked by a linker (eg 4 thymidines). Triple-helix formation is a preferred effect. The siDNA is superior to siRNA because the formation of RNA-DNA hybrids is preferred over double-stranded DNA or double-stranded RNA, which forms as tertiary structures in RNA genomes. Also the induction of interferon is less likely. siDNA is easier to synthesize and it is more stable. It can be combined with siRNA. | 08-12-2010 |
20100204303 | Pharmaceutical Compositions for Administering Oligonucleotides - The invention relates to pharmaceutical compositions useful for administering an oligonucleotide to an animal in need thereof. The pharmaceutical compositions include nano-particles or micro-particles of (i) a protonated oligonucleotide and (ii) a pharmaceutically acceptable organic base or include nano-particles or micro-particles of (i) an oligonucleotide and (ii) a divalent metal ion. | 08-12-2010 |
20100204304 | NOGO Receptor Binding Protein - The invention provides Sp35 polypeptides and fusion proteins thereof, Sp35 antibodies and antigen-binding fragments thereof and nucleic acids encoding the same. The invention also provides compositions comprising, and methods for making and using, such Sp35 antibodies, antigen-binding fragments thereof, Sp35 polypeptides and fusion proteins thereof. | 08-12-2010 |
20100204305 | SMALL INTERFERING RNA MOLECULES AGAINST RIBONUCLEOTIDE REDUCTASE AND USES THEREOF - Small interfering RNA (siRNA) molecules that target a mammalian ribonucleotide reductase gene, and which are capable of inhibiting the expression of their target gene are provided. The siRNA molecules of the invention are capable of attenuating neoplastic cell growth and/or proliferation in vitro and in vivo and, therefore, can be used to attenuate the growth and/or metastasis of various types of mammalian cancers. | 08-12-2010 |
20100204306 | Method of Treating Neurodegenerative Disease - Aspects featured in the invention relate to compositions and methods for inhibiting alpha-synuclein (SNCA) gene expression, such as for the treatment of neurodegenerative disorders. An anti-SNCA agent featured herein that targets the SNCA gene can have been modified to alter distribution in favor of neural cells. | 08-12-2010 |
20100204307 | Compositions And Methods For Inhibiting Expression Of The HAMP Gene - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the HAMP gene (HAMP gene), comprising an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of the HAMP gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by HAMP gene expression and the expression of the HAMP gene using the pharmaceutical composition. | 08-12-2010 |
20100210707 | Small Activating RNA Molecules and Methods of Use - The present invention provides compositions, pharmaceutical preparations, kits and methods for increasing expression of a gene product in a cell by contacting the cell with a small activating RNA (saRNA) molecule comprising a ribonucleic strand that is complementary to a non-coding nucleic acid sequence of the gene. | 08-19-2010 |
20100210708 | COMPOUND PROFILING METHOD - The present invention provides a method for deriving an upstream or downstream component of a component necessary for phenotypic alteration of a living organism, the method comprising the steps of: specifying a pathway of interest related to the phenotypic alteration and a reference pathway different from the pathway of interest, and specifying a stimulant of interest and a reference stimulant which respectively stimulate the pathway of interest and the reference pathway; giving the stimulant of interest to the living organism to identify a collection of components of interest necessary for the phenotypic alteration; giving the reference stimulant to the living organism to identify a collection of reference components necessary for the phenotypic alteration; calculating an intersection between the collections of the components of interest and the reference components; and calculating a differential collection by subtracting the intersection from the collection of components of interest. | 08-19-2010 |
20100210710 | THERAPEUTIC siRNA MOLECULES FOR REDUCING VEGFR1 EXPRESSION IN VITRO AND IN VIVO - The invention relates to nucleic acid molecule compositions for use in modulating the expression and activity of VEGF pathway genes and decreasing unwanted neovascularization, including tumor angiogenesis, by RNA interference and methods and compositions comprising the nucleic acid molecules. | 08-19-2010 |
20100210711 | Methods and Compositions for the Treatment of Sterile Inflammation - Described are methods and compositions that inhibit IL-1 signalling for the treatment of acute inflammatory response to cell necrosis, and the attendant collateral tissue damage. | 08-19-2010 |
20100216863 | Susceptibility Gene for Myocardial Infarction, Stroke, and PAOD; Methods of Treatment - Polymorphisms in the FLAP and LTA4H gene are shown by genetic association analysis to be susceptibility markers for myocardial infarction (MI) and ACS, as well as stroke and PAOD. Pathway targeting for treatment and diagnostic applications in identifying those who are at risk of developing MI, ACS, stroke or PAOD, in particular are described. The invention also provides methods of prophylaxis therapy for MI in human subjects having a race including black African ancestry by administering to the subject a composition comprising a therapeutically effective amount of MI therapeutic agent that inhibits leukotriene synthesis in vivo. The invention also provides for compositions comprising a leukotriene synthesis inhibitor and a statin and methods of using these compositions to reduce C-reactive protein in a human subject at risk of MI, ACS, stroke and/or PAOD. | 08-26-2010 |
20100216864 | RNA Antagonist Compounds for the Modulation of PCSK9 - The present invention provides compounds, compositions and methods for modulating the expression of PCSK9. In particular, this invention relates to oligomeric compounds, such as oligonucleotide compounds, which are hybridisable with target nucleic acids encoding PCSK9, and methods for the preparation of such oligomeric compounds. The oligonucleotide compounds have been shown to modulate the expression of PCSK9, and pharmaceutical preparations thereof and their use as treatment of hypercholesterolemia and related disorders are disclosed. | 08-26-2010 |
20100216865 | MicroRNA COMPOSITIONS IN THE TREATMENT OF VEGF-MEDIATED DISORDERS - The invention provides methods of treating diseases caused by the over-production of a VEGF polypeptide by administering miRNA or miRNA inhibitor compositions to decrease at least one activity of a VEGF polypeptide. | 08-26-2010 |
20100216866 | RNAi Modulation of APOB and Uses Thereof - The invention relates to compositions and methods for modulating the expression of apolipoprotein B, and more particularly to the downregulation of apolipoprotein B by chemically modified oligonucleotides. | 08-26-2010 |
20100216867 | Methods of treatment of a bcl-2 disorder using bcl-2 antisense oligomers - The present invention is directed to the use of bcl-2 antisense oligomers to treat and prevent bcl-2 related disorders. These disorders include cancers, tumors, carcinomas and cell-proliferative related disorders. In one embodiment of the invention, a bcl-2 antisense oligomer is administered at high doses. The present invention is also directed to a method of preventing or treating a bcl-2 related disorder, in particular cancer, comprising administering a bcl-2 antisense oligomer for short periods of time. The present invention is further drawn to the use of bcl-2 antisense oligomers to increase the sensitivity of a subject to cancer therapeutics. The present invention also relates to pharmaceutical compositions comprising one or more bcl-2 antisense oligomers, which may comprise one or more cancer therapeutic agents. | 08-26-2010 |
20100222407 | TRIBLOCK COPOLYMERS FOR CYTOPLASMIC DELIVERY OF GENE-BASED DRUGS - The invention features a triblock copolymer including a hydrophilic block; a hydrophobic block; and a positively charged block capable of reversibly complexing a negatively charged molecule, e.g., a nucleic acid, wherein the hydrophobic block is disposed between the hydrophilic block and the positively charged block. Desirably, the triblock copolymer is capable of self-assembling into a supramolecular structure, such as a micelle or vesicle. The invention further features methods of delivering negatively charged molecules and methods of treating a disease or condition using the polymers of the invention. | 09-02-2010 |
20100222408 | Methods and Compositions for Treatment of Cystic Fibrosis - The present invention relates to compounds and methods of inhibiting p97/valosin-containing protein and compounds and methods of inhibiting gp78, the compounds and methods being useful for the treatment of a disorder comprising a IκB/NFκB mediated chronic inflammatory response component, for example cystic fibrosis. | 09-02-2010 |
20100222409 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF PRO-APOPTOTIC GENES - The invention relates to one or more inhibitors, in particular siRNA compounds, which down-regulate the expression of a pro-apoptotic gene selected from the group consisting of TP53; HTRA2; KEAP1; SHC1-SHC, ZNHIT1, LGALS3 and HI95. The invention also relates to a pharmaceutical composition comprising the compound, and a pharmaceutically acceptable carrier. The present invention further provides methods of treating a subject afflicted with a disease or a condition associated with those genes, comprising administering to the subject a pharmaceutical composition in a therapeutically effective dose so as to thereby treat the subject. | 09-02-2010 |
20100222410 | Nuclease compositions and methods - The present invention generally relates to various nucleases and uses thereof, and in some cases, to the UPF0054 protein superfamily. Members of the UPF0054 protein superfamily, such as the | 09-02-2010 |
20100222411 | VHZ FOR DIAGNOSIS AND TREATMENT OF CANCER - We provide VHZ for use in a method of treatment, prophylaxis or alleviation of a cancer, such as breast cancer, in an individual. We provide an anti-VHZ agent for the treatment, prophylaxis or alleviation of cancer. We further provide a kit for detecting breast cancer in an individual or susceptibility of the individual to breast cancer comprising means for detection of VHZ expression in the individual or a sample taken from him or her as well as a method of detecting a cancer cell, the method comprising detecting modulation of expression, amount or activity of VHZ in the cell. | 09-02-2010 |
20100222412 | MODULATION OF GLUCOCORTICOID RECEPTOR EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of glucocorticoid receptor. The compositions comprise antisense compounds, particularly antisense oligonucleotides which have particular in vivo properties, targeted to nucleic acids encoding glucocorticoid receptor. Methods of using these compounds for modulation of glucocorticoid receptor expression and for treatment of diseases are provided. | 09-02-2010 |
20100222413 | Chemically Modified Oligonucleotides for Use in Modulating Micro RNA and Uses Thereof - This invention relates generally to chemically modified oligonuceotides useful for modulating expression of microRNAs and pre-microRNAs. More particularly, the invention relates to single stranded chemically modified oligonuceotides for inhibiting microRNA and pre-microRNA expression and to methods of making and using the modified oligonucleotides. Also included in the invention are compositions and methods for silencing microRNAs in the central nervous system. | 09-02-2010 |
20100222414 | SiRNA Sequence-Independent Modification Formats for Reducing Off-Target Phenotypic Effects in RNAi, and Stabilized Forms Thereof - Modification formats having modified nucleotides are provided for siRNA. Short interfering RNA having modification formats and modified nucleotides provided herein reduce off-target effects in RNA interference of endogenous genes. Further modification formatted siRNAs are demonstrated to be stabilized to nuclease-rich environments. Unexpectedly, increasing or maintaining strand bias, while necessary to maintain potency for endogenous RNA interference, is not sufficient for reducing off-target effects in cell biology assays. | 09-02-2010 |
20100227908 | DIAGNOSTIC, PROGNOSTIC AND TREATMENT METHODS - The present invention relates generally to diagnostic and prognostic protocols for schizophrenia and its manifestations including sub-threshold phenotypes and states thereof. Profiling and stratifying individuals for schizophrenia and its various manifestations also form part of the present invention as well as monitoring and predicting efficacy of therapeutic, psychiatric, social or environmental intervention. The present invention further contemplates methods of treatment of schizophrenia and symptoms thereof. | 09-09-2010 |
20100227909 | COMPOSITIONS COMPRISING MIR34 THERAPEUTIC AGENTS FOR TREATING CANCER - In one aspect, the invention generally relates to compositions comprising miR-34 and siRNAs functionally and structurally related to miR-34 for the treatment of cancer. | 09-09-2010 |
20100227910 | GENE FUSION TARGETED THERAPY - The present invention relates to compositions and methods for cancer therapy, including but not limited to, targeted inhibition of cancer markers. In particular, the present invention relates to recurrent gene fusions as clinical targets for prostate cancer. | 09-09-2010 |
20100227911 | RNA INTERFERENCE MEDIATED INHIBITION OF CHROMOSOME TRANSLOCATION GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating chromosomal translocation gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of chromosomal translocation gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of BCR-ABL, ERG, EWS-ERG, TEL-AML1, EWS-FLI1, TLS-FUS, PAX3-FKHR, and/or AML1-ETO fusion genes. | 09-09-2010 |
20100227912 | RNA INTERFERENCE MEDIATED INHIBITION OF MYOSTATIN GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating myostatin (GDF8) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of myostatin gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of myostatin genes. | 09-09-2010 |
20100234444 | HINDERED ESTER-BASED BIODEGRADABLE LINKERS FOR OLIGONUCLEOTIDE DELIVERY - The invention provides hindered ester-based biodegradable linkers for the delivery of oligonucleotides in vivo, as well as method of making and using the same. | 09-16-2010 |
20100234445 | Patterns of known and novel small RNAS in human cervical cancer - Small RNA sequences that are differentially expressed in SCCC cells are provided. The sequences find use in diagnosis of cancer, and classification of cancer cells according to expression profiles. The methods are useful for detecting cervical cancer cells, facilitating diagnosis of cervical cancer and the severity of the cancer (e.g., tumor grade, tumor burden, and the like) in a subject, facilitating a determination of the prognosis of a subject, and assessing the responsiveness of the subject to therapy. | 09-16-2010 |
20100234446 | RNAi Modulation of the BCR-ABL Fusion Gene and Uses Thereof - The invention relates to compositions and methods for modulating the expression of Bcr-Abl, and more particularly to the down-regulation of Bcr-Abl mRNA and Bcr-Abl protein levels by oligonucleotides via RNA interference, e.g., chemically modified oligonucleotides. | 09-16-2010 |
20100234447 | MODULATION OF GLUCAGON RECEPTOR EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of glucagon receptor. The compositions comprise oligonucleotides, targeted to nucleic acid encoding glucagon receptor. Methods of using these compounds for modulation of glucagon receptor expression and for diagnosis and treatment of disease associated with expression of glucagon receptor are provided. | 09-16-2010 |
20100234448 | IN VIVO PRODUCTION OF SMALL INTERFERING RNAS THAT MEDIATE GENE SILENCING - The invention provides engineered RNA precursors that when expressed in a cell are processed by the cell to produce targeted small interfering RNAs (siRNAs) that selectively silence targeted genes (by cleaving specific mRNAs) using the cell's own RNA interference (RNAi) pathway. By introducing nucleic acid molecules that encode these engineered RNA precursors into cells in vivo with appropriate regulatory sequences, expression of the engineered RNA precursors can be selectively controlled both temporally and spatially, i.e., at particular times and/or in particular tissues, organs, or cells. | 09-16-2010 |
20100240730 | RNA Interference Mediated Inhibition of Gene Expression Using Chemically Modified Short Interfering Nucleic Acid (siNA) - The present invention concerns methods and reagents useful in modulating gene expression in a variety of applications, including use in therapeutic, cosmetic, cosmeceutical, prophylactic, diagnostic, target validation, and genomic discovery applications. Specifically, the invention relates to synthetic chemically modified small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against target nucleic acid sequences. The small nucleic acid molecules are useful in the treatment of disease (e.g., cancer, proliferative, inflammatory, metabolic, autoimmune, neurologic, ocular diseases), condition, trait (e.g., hair growth and removal), genotype and phenotype that responds to modulation of gene expression or activity in a cell, tissue, or organism. Such small nucleic acid molecules can be administered systemically, locally, or topically. | 09-23-2010 |
20100240731 | LIPOPEPTIDES FOR DELIVERY OF NUCLEIC ACIDS - Lipopeptide compounds comprising a peptide having 2 to 100 amino acid residues, and having a lipophilic group attached to at least one terminus of the peptide or to at least one amino acid residue of the peptide, and salts and uses thereof. The lipophilic group may be attached to the N-terminus, C-terminus or both termini of the peptide. The lipophilic group may be attached to at least one interal amino acid residue (i.e., an amino acid residue that is not the N-terminus or the C-terminus amino acid residue of the peptide). The lipophilic group may be attached to either termini or both and at least one internal amino acid residue. | 09-23-2010 |
20100240732 | APTAMER-TARGETED SIRNA TO PREVENT ATTENUATION OR SUPPRESSION OF A T CELL FUNCTION - Compositions for countering immune attenuating/suppressive pathways comprise targeting agents or aptamer targeted RNAi-mediated gene silencing (siRNA/shRNA). These compositions have broad applicability in the treatment of many diseases. | 09-23-2010 |
20100240733 | Histone Demethylation Mediated by the Nuclear Amine Oxidase Homolog LSD1 - LSD1, a homolog of nuclear amine oxidases, functions as a histone demethylase and transcriptional co-repressor. LSD1 specifically demethylates histone H3 lysine 4, which is linked to active transcription. Lysine demethylation occurs via an oxidation reaction that generates formaldehyde. Importantly, RNAi inhibition of LSD1 causes an increase in H3 lysine 4 methylation and concomitant de-repression of target genes, suggesting that LSD1 represses transcription via histone demethylation. The results thus identify a histone demethylase conserved from | 09-23-2010 |
20100240734 | METHODS AND COMPOSITIONS FOR THE SPECIFIC INHIBITION OF GENE EXPRESSION BY DOUBLE-STRANDED RNA - The invention is directed to compositions and methods for selectively reducing the expression of a gene product from a desired target gene in a cell, as well as for treating diseases caused by the expression of the gene. More particularly, the invention is directed to compositions that contain double stranded RNA (“dsRNA”), and methods for preparing them, that are capable of reducing the expression of target genes in eukaryotic cells. The dsRNA has a first oligonucleotide sequence that is between 25 and about 30 nucleotides in length and a second oligonucleotide sequence that anneals to the first sequence under biological conditions. In addition, a region of one of the sequences of the dsRNA having a sequence length of at least 19 nucleotides is sufficiently complementary to a nucleotide sequence of the RNA produced from the target gene to trigger the destruction of the target RNA by the RNAi machinery. | 09-23-2010 |
20100249208 | Novel Methods and Models for Rapid, Widespread Delivery of Genetic Material to the CNS Using Non-Viral, Cationic Lipid-Mediated Vectors - Provided are safe, non-invasive, non-viral delivery methods for providing a nucleic acid into the neuronal and non-neuronal cells of the central nervous system (CNS) of a subject to protect neuronal and non-neuronal cells from ischemic or traumatic injury, wherein the nucleic acid encodes a therapeutic proteins, specifically providing rapid transient expression and widespread distribution for in vitro or in vivo applications. Further provided are methods for the intrathecal delivery to the cerebrospinal fluid (CSF) of a neuroprotective gene sequence, e.g., a heat shock protein (HSP), complexed with cationic lipid compositions to achieve such delivery, and the complexes used therein. | 09-30-2010 |
20100249209 | GENE INVOLVED IN IMMORTALIZATION OF HUMAN CANCER CELL AND USE THEREOF - The present invention provides a gene related to cancer cell immortalization (an immortalization determining gene) and a process that is useful for selective cancer treatment targeting a cancer cell having the gene. The present invention determines an immortalized cancer cell using a polynucleotide having a base sequence of at least 15 bases that specifically hybridizes with a continuous base sequence of at least 15 bases within any one of abase sequences represented by SEQ ID Nos. 1 to 13. In the foregoing process, the polynucleotide is used as a primer or probe for detecting an immortalization determining gene that exhibits high expression specifically in an immortalized cancer cell. | 09-30-2010 |
20100249210 | METHODS AND COMPOSITIONS RELATED TO DLK-1 AND THE P38 MAPK PATHWAY IN NERVE REGENERATION - Disclosed are compositions and methods for treating neurodegenerative disease. | 09-30-2010 |
20100249211 | N-Substituted-Aminomethylene Bridged Bicyclic Nucleic Acid Analogs - Provided herein are bicyeMc nucleosides comprising a substituted amino group in the bridge, oligomeric compounds having at least one of these bicyclic nucleosides and methods of using the oligomeric compounds. The bicyclic nucleosides comprising a substituted amino group in the bridge are useful for enhancing properties of oligomeric compounds including nuclease resistance, in certain embodiments, the oligomeric compounds hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA. | 09-30-2010 |
20100249212 | Gene Silencing Using mRNA-cDNA Hybrids - The present invention provides novel compositions and methods for suppressing the expression of a targeted gene using mRNA-cDNA duplexes. The invention further provides novel methods and compositions for generating amplified mRNA-cDNA hybrids, whose quantity is high enough to be used for the invention's gene silencing transfection. This improved RNA-polymerase chain reaction method uses thermocycling steps of promoter-linked double-stranded cDNA or RNA synthesis, in vitro transcription and then reverse transcription to amplify the amount of mRNA-cDNA hybrids up to two thousand folds within one round of the above procedure. | 09-30-2010 |
20100249213 | MicroRNA Signatures in Human Ovarian Cancer - The present invention provides novel methods and compositions for the diagnosis, prognosis and treatment of ovarian cancer. The invention also provides methods of identifying anti-cancer agents. | 09-30-2010 |
20100249214 | MULTIPLEX DICER SUBSTRATE RNA INTERFERENCE MOLECULES HAVING JOINING SEQUENCES - The present invention is based, at least in part, upon the insight that compound DsiRNA agents can be generated using site-specific RNase H-cleavable double stranded nucleic acid double stranded nucleic acid regions to attach, e.g., one DsiRNA moiety to another DsiRNA moiety and/or one DsiRNA moiety to a functional group and/or payload. Because such double stranded nucleic acid joining sequences are site-specifically RNase H-cleavable, the bifunctional molecule is cleaved into DsiRNAs which bear terminal ends that orient dicer cleavage. The detrimental impact of administering a single double stranded nucleic acid RNAi agent of longer than 30-35 nucleotides in length (e.g., provocation of interferon response) can be minimized, as once administered or delivered to a subject or RNase H-containing cell, RNase H cleavage produces a shortened, active DsiRNA agent(s). The invention also provides bifunctional DsiRNA agents that are joined by double stranded DNA extension joining sequences—such bifunctional DsiRNA agents joined by dsDNA sequences do not provoke RNase H cleavage. | 09-30-2010 |
20100249215 | Oligomeric Compounds And Compositions For Use In Modulation Of Pri-miRNAs - Compounds, compositions and methods are provided for modulating the levels expression, processing and function of pri-miRNAs. In particular, methods and compounds are provided for the modulation of the levels, expression, processing or function of polycistronic pri-miRNAs. The compositions comprise oligomeric compounds targeted to small non-coding RNAs and pri-miRNAs. Further provided are methods for selectively modulating pri-miRNA levels in a cell. Also provided are methods for identifying oligomeric compounds that result in increase pri-miRNA levels when contacted with a cell. | 09-30-2010 |
20100261776 | BRUTON'S TYROSINE KINASE AS ANTI-CANCER DRUG TARGET - Receptor protein tyrosine kinases (RPTKs) transmit extracellular signals across the plasma membrane to cytosolic proteins, stimulating the formation of complexes that regulate key cellular functions. Over half of the 90 tyrosine kinases have been implicated in human cancers and are for this reason considered highly promising drug targets. To gain insight into the tyrosine kinases that contribute to breast cancer related cellular mechanisms, we carried out a large-scale loss-of-function analysis of the tyrosine kinases, using RNA interference, in the clinically relevant Erb-B2 positive, BT474 breast cancer cell line. The cytosolic, non-receptor tyrosine kinase Bruton's tyrosine kinase (BTK), which has been extensively studied for its role in B cell development, was among those tyrosine kinase genes required for BT474 breast cancer cell survival. The BTK protein identified was an alternative form containing an amino-terminal extension. This alternative form of the Btk message is also present in tumorigenic breast cells at significantly higher levels than in normal breast cells. | 10-14-2010 |
20100267801 | CYCLOHEXYL SULPHONES FOR TREATMENT OF CANCER - Sulphones of formula (I) are disclosed for use in treatment of cancer. | 10-21-2010 |
20100267802 | DELIVERY METHOD - The present invention relates, in general, to RNA silencing and, in particular, to a method of effecting targeted delivery of an RNA silencing moiety using a targeting moiety that binds to a cell surface receptor and mediates internalization of the RNA silencing moiety to be accessible to Dicer. Also provided is a chimeric nucleic acid molecule comprised of a targeting moiety and an RNA silencing moiety, wherein the targeting moiety is an aptamer and the RNA silencing moiety comprises a Dicer substrate. | 10-21-2010 |
20100267803 | Regulators Of Fat Metabolism As Anti-Cancer Targets - Embodiments of the invention provide methods of identifying agents that reduce or prevent the proliferation of breast cancer cells, or kill them, in particular by interfering with the expression of the transcription factors NR1D1 and PPARγ or the expression of genes whose transcription they activate or the activity of the proteins translated from those transcripts. | 10-21-2010 |
20100267804 | DIFFERENTIAL EXPRESSION OF MICRORNAS IN NONFAILING VERSUS FAILING HUMAN HEARTS - The present invention discloses specific miRNAs as novel biomarkers and therapeutic targets in the treatment of heart failure. Methods of treating or preventing heart failure in a subject by administering mimics or inhibitors of these particular miRNAs are disclosed. A method of diagnosing or prognosing heart failure in a subject by determining the level of expression of one or more miRNAs is also described. | 10-21-2010 |
20100267805 | TARGETING OPPOSITE STRAND REPLICATION INTERMEDIATES OF SINGLE-STRANDED VIRUSES BY RNAI - The invention relates to methods and compositions for modulating viral replication through double-stranded RNA-mediated gene silencing (RNAi), wherein the antiviral methods and compositions preferentially target opposite strand replication intermediates of single-stranded RNA viruses. | 10-21-2010 |
20100267806 | LIPID FORMULATED COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF Eg5 AND VEGF GENES - This invention relates to compositions containing double-stranded ribonucleic acid (dsRNA) in a lipid formulation, and methods of using the compositions to inhibit the expression of the Human kinesin family member 11 (Eg5) and Vascular Endothelial Growth Factor (VEGF), and methods of using the compositions to treat pathological processes mediated by Eg5 and VEGF expression, such as cancer. | 10-21-2010 |
20100267807 | ALLEVIATING NEUROPATHIC PAIN WITH EETS AND SEH INHIBITORS - The invention discloses methods of using cis-epoxyeicosantrienoic acids (“EETs”), inhibitors of soluble epoxide hydrolase (“sEH”), or a combination of an EET and an inhibitor of sEH, to alleviate neuropathic pain in subjects suffering from such pain. | 10-21-2010 |
20100267808 | Bispecific Antisense Oligonucleotides that Inhibit IGFBP-2 and IGFBP-5 and Methods of Using Same - Bispecific antisense oligonucleotides which consist essentially of a sequence of bases that is complementary to portions of both the gene encoding human IGFBP-2 and the gene encoding human IGFBP-5 are useful in as antisense therapeutics in the treatment of endocrine-regulated cancers. | 10-21-2010 |
20100267809 | DOUBLE STRANDED NUCLEIC ACID TARGETING LOW COPY PROMOTER-SPECIFIC RNA - The present invention relates to transcriptional gene silencing (TGS) in mammalian, including human, cells that is mediated by small interfering RNA (siRNA) molecules. The present invention also relates to a double stranded nucleic acid that directs methylation of histones associated with target genes that produce low copy promoter-specific RNA. It has been found that siRNAs can be used to direct methylation of histones in mammalian, including human, cells. | 10-21-2010 |
20100267810 | METHODS AND COMPOSITIONS FOR TREATING NEUROLOGICAL DISEASE - This invention relates to methods and compositions for treating neurological disease, and more particularly to methods of delivering iRNA agents to neural cells for the treatment of neurological diseases. | 10-21-2010 |
20100267811 | RNAi-RELATED INHIBITION OF TNFa SIGNALING PATHWAY FOR TREATMENT OF OCULAR ANGIOGENESIS - RNA interference is provided for inhibition of tumor necrosis factor α (TNFα) by silencing TNFα cell surface receptor TNF receptor-1 (TNFR1) mRNA expression, or by silencing TNFα converting enzyme (TACE/ADAM17) mRNA expression. Silencing such TNFα targets, in particular, is useful for treating patients having a TNFα-related condition or at risk of developing a TNFα-related condition, such as ocular angiogenesis, retinal ischemia, and diabetic retinopathy. | 10-21-2010 |
20100273854 | COMPOSITIONS AND METHODS FOR INHIBITING NADPH OXIDASE EXPRESSION - One or more inhibitors, in particular siRNAs, which down-regulate the expression of a NOX gene selected from the group consisting of NOX4, NOXI, NOX2 (gp91phox, CYBB), NOX5, DUOX2, NOXOI, NOXAI and NOXA2 (p67phox) is disclosed. Also provided is a vector capable of expressing the compound A method is provided for treating or preventing the incidence or seventy of various diseases or conditions associated with NOX gene compπsing administering to the patient the inhibitor in a pharmaceutical composition | 10-28-2010 |
20100273855 | COMPOSITIONS AND METHODS OF TREATING CANCER - The invention features a method for treating cancer by administering a double-stranded nucleic acid molecule against a CX gene selected from the group consisting of C14orf78, MYBL2, UBE2S and UBE2T. The invention also features products, including the double-stranded nucleic acid molecules and vectors encoding them, as well as compositions comprising the molecules or vectors, useful in the provided methods. The methods of the invention are suited for the treatment of cancers including lung cancer, breast cancer, bladder cancer, esophagus cancer, prostate cancer, cholangiocellular carcinoma and testicular seminoma. | 10-28-2010 |
20100273856 | SCREENING OF MICRO-RNA CLUSTER INHIBITOR POOLS - The disclosure provides methods for inhibiting the activity of a miRNA cluster in a cell, and also for screening a cell for a phenotype(s) of interest resulting from inhibition of a miRNA cluster. The methods use a cluster pool which comprises at least one miRNA inhibitor specific for each miRNA in the miRNA cluster. MiRNA inhibitors are described that induce apoptosis in breast cancer cells and hence are useful in the treatment of breast cancer. The disclosure also provides pharmaceutical compositions which are useful for the treatment of breast cancer; methods for inducing the nuclear translocation of NF-κB in a breast cancer cell; methods for inducing the nuclear translocation of c-Jun in a breast cancer cell; method for inhibiting the nuclear translocation of NF-κB in a breast cancer cell; and methods for providing prognostic medical information relating to breast cancer progression. | 10-28-2010 |
20100273857 | SUPPRESSION OF SCN9A GENE EXPRESSION AND/OR FUNCTION FOR THE TREATMENT OF PAIN - Disclosed herein are methods, sequences and nucleic acid molecules used to treat pain. Specifically, the methods and sequences include locally administering molecules that suppress the expression of amino acid sequences that encode for Na | 10-28-2010 |
20100273858 | COMPOSITIONS COMPRISING STAT5 SIRNA AND METHODS OF USE THEREOF - The present invention provides nucleic acid molecules that inhibit STAT5 expression. Methods of using the nucleic acid molecules are also provided. | 10-28-2010 |
20100273859 | TREATMENT AND PREVENTION OF HIV INFECTION - Disclosed herein are methods for treating and/or preventing HIV infection in a cell. The methods involve downmodulating one or more of the HIV-dependency factors (HDFs) disclosed herein to thereby treat and/or prevent HIV infection in the cell. Downmodulating the HDFs can be by contacting the cell with an agent that downmodulates the HDF. Also disclosed herein are methods for treating and/or preventing HIV infection in a subject comprising downmodulating one or more of the HIV-dependency factors (HDFs), disclosed herein, to thereby treat and/or prevent HIV infection in the subject. The method may further comprise selecting a subject diagnosed with or at risk for HIV infection, prior to downmodulating. Downmodulating the HDFs may comprise administering an agent that downmodulates the HDF to the subject such that the agent contacts HIV host cells of the subject. The agent may inhibit HDF gene expression, protein synthesis, HDF function or HDF activity, or combinations thereof. | 10-28-2010 |
20100273860 | MODULATION OF APOLIPOPROTEIN (a) EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of apolipoprotein(a). The compositions comprise oligonucleotides, targeted to nucleic acid encoding apolipoprotein(a). Methods of using these compounds for modulation of apolipoprotein(a) expression and for diagnosis and treatment of disease associated with expression of apolipoprotein(a) are provided. | 10-28-2010 |
20100273861 | MYCOBACTERIAL PEPTIDE DEFORMYLASE - The present invention relates to the design of the Antisense-oligonucleotide complementary to the specific region of peptide deformylase gene from | 10-28-2010 |
20100280094 | COMPOSITIONS AND METHODS TO TREAT MUSCULAR & CARDIOVASCULAR DISORDERS - The present invention relates to a novel microRNA, mir-208-2, implicated in muscular and cardiovascular disorders. The present invention also relates to oligonucleotide therapeutic agents (antisense oligonucleotides and/or double stranded oligonucleotides such as dsRNA) and their use in the treatment of muscular and cardiovascular disorders resulting from dysregulation of mir-208-2. | 11-04-2010 |
20100280095 | THERAPEUTIC AGENT FOR WOUNDS AND SCREENING METHOD FOR THE SAME - The present invention provides an agent for treating wound, containing a substance that suppresses the expression or function of PDLIM2. The substance that suppresses the expression or function of PDLIM2 is preferably an siRNA or antisense nucleic acid capable of specifically suppressing the expression of PDLIM2, or an expression vector capable of expressing said polynucleotide. In addition, the present invention provides a method of screening for a substance capable of treating wounds, including determining whether or not a test substance is capable of suppressing the expression or function of PDLIM2. | 11-04-2010 |
20100280096 | TREATMENT OF INFLUENZA - The present invention provides a double-stranded RNA which inhibits replication of influenza B viruses by RNA interference, in which the double-stranded RNA comprises an RNA having 19 to 25 nucleotides homologous with a part of an mRNA transcribed from a genomic RNA of the influenza B viruses and an antisense RNA thereof. | 11-04-2010 |
20100280097 | COMPOSITIONS COMPRISING HIF-1 ALPHA SIRNA AND METHODS OF USE THEREOF - The present invention provides nucleic acid molecules that inhibit HIF-1α expression. Methods of using the nucleic acid molecules are also provided. | 11-04-2010 |
20100280098 | RECEPTOR TARGETED OLIGONUCLEOTIDES - Disclosed herein are oligonucleotide conjugates that include ligands that target cell receptors that mediate endocytosis. The ligands can include peptides and small molecules. The conjugates can include carrier macromolecules to which the ligands and oligonucleotides are attached, or conjugates where an oligonucleotide is attached to a ligand in the absence of a carrier macromolecule. The oligonucleotides can include therapeutic oligonucleotides, such as siRNA, antisense RNA and miRNA. The ligand can be an RGD peptide. Also disclosed herein are methods of delivering the conjugates to cells in subjects. | 11-04-2010 |
20100280099 | Combination Treatment For The Treatment of Hepatitis C Virus Infection - The present invention relate to the use of a combination of an inhibitor of miR-122 and an inhibitor of VLDL assembly, for the treatment of HCV, hyperlipidemia and hypercholesterolemia. | 11-04-2010 |
20100280100 | TREATMENT OF HEMOGLOBIN (HBF/HBG) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO HBF/HBG - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Hemoglobin (HBF/HBG), in particular, by targeting natural antisense polynucleotides of Hemoglobin (HBF/HBG). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of HBF/HBG. | 11-04-2010 |
20100280101 | METHOD OF INHIBITING CANCER CELL PROLIFERATION, PROLIFERATION INHIBITOR AND SCREENING METHOD - The present invention provides a method of inhibiting cancer cell proliferation by suppressing a function of ZNF143, a cancer cell proliferation inhibitor containing as an active ingredient a substance capable of inhibiting a function of ZNF143, like a ZNF143-specific siRNA, a prophylactic and/or therapeutic drug for cancer, a method of detecting cancer cells, a diagnostic reagent for cancer, a vector and transformant cell incorporating the vector, and a screening method for a substance possessing cancer cell proliferation inhibitory activity with the amount of inhibition of the binding of ZNF143 protein as an index. | 11-04-2010 |
20100280102 | DOUBLE-STRANDED RIBONUCLEIC ACID WITH INCREASED EFFECTIVENESS IN AN ORGANISM - The present invention relates to a method for the targeted selection of a double-stranded ribonucleic acid (dsRNA) consisting of two single strands that exhibits increased effectiveness in inhibiting the expression of a target gene by means of RNA interference, wherein at least end of the dsRNA comprises a nucleotide overhang of 1 to 4 unpaired nucleotides in length; wherein the unpaired nucleotide adjacent to the terminal nucleotide pair comprises a purine base; and wherein the terminal nucleotide pair on both ends of the dsRNA is a G-C pair, or at least two of the last four consecutive terminal nucleotide pairs are G-C pairs. | 11-04-2010 |
20100280103 | Methods and compositions for acid phosphatase-1 gene inhibition - The ACP1 *A allele provides a means for diagnosing susceptibility of a human subject to hyperlipidemia, especially hyperlipidemia associated with metabolic syndrome, a means for treating, or preventing the onset of, hyperlipidemia and metabolic syndrome, and a means for screening and identifying drugs suitable for use in treating or preventing hyperlipidemia, especially hyperlipidemia associated with metabolic syndrome. Diagnostic kits are also provided. | 11-04-2010 |
20100286228 | Method of inhibiting intimal hyperplasia - The present invention relates, in general, to intimal hyperplasia, and, in particular, to a method of inhibiting intimal hyperplasia using siRNA to E2F. The invention further relates to compounds and compositions suitable for use in such a method. | 11-11-2010 |
20100286229 | Modulation of Androgen Receptor for Treatment of Prostate Cancer - The present invention provides methods for the reduction of endotoxins in a plasmid preparation using a carbohydrate non-ionic detergent with silica chromatography. | 11-11-2010 |
20100286230 | MODULATION OF TRPV EXPRESSION LEVELS - The present invention relates to methods and compositions for the treatment and/or the prevention of conditions related to high levels of expression and/or activity of the transient receptor potential vanilloid-1 (TRPV1). Amongst others, the conditions to be treated are eye conditions such as discomfort and altered sensitivity of the cornea following refractive surgery, use of contact lenses, dry eyes and diabetic retinopathy. | 11-11-2010 |
20100286231 | METHOD FOR IDENTIFYING A RENAL FIBROSIS PROCESS USE OF SNAIL- ACTIVITY-INHIBITING COMPOUNDS IN THE PRODUCTION OF PHARMACEUTICAL COMPOSITIONS, METHOD FOR IDENTIFYING SAID INHIBITING COMPOUNDS, SAID PHARMACEUTICAL COMPOSITIONS AND APPLICATIONS THEREOF - The present invention relates to Snail, which is a protein that is directly involved in the etiopathogeny of renal fibrosis, in addition to being a marker of this disease. Therefore, the identification thereof may be used as a diagnosis for renal fibrosis. On the other hand, the Snail protein may be of great utility in identifying new drugs for the treatment of renal fibrosis, and its gene inhibition may be of use as a form of treatment in accordance with the present invention. | 11-11-2010 |
20100286232 | MICRORNA EXPRESSION PROFILE ASSOCIATED WITH PANCREATIC CANCER - Methods are provided for diagnosing whether a subject has, or is at risk of developing, pancreatic cancer. The methods include measuring the level of at least one miR gene product in a biological sample derived from the subject's pancreas. An alteration in the level of the miR gene product in the biological sample as compared to the level of a corresponding miR gene product in a control sample, is indicative of the subject either having, or being at risk for developing, pancreatic cancer. | 11-11-2010 |
20100286233 | PERIPHERAL AND NEURAL INFLAMMATORY CROSSTALK - Disclosed are compositions and methods for the study and treatment of inflammatory disease, neurological disorders, bone disease, pain, and methods of making and using thereof. | 11-11-2010 |
20100286234 | Pharmaceutical Composition Comprising Anti-Mirna Antisense Oligonucleotides - The invention provides pharmaceutical compositions comprising short single stranded oligonucleotides, of length of between 8 and 26 nucleobases which are complementary to human microRNAs selected from the group consisting of miR19b, miR21, miR122a, miR155 and miR375. The short oligonucleotides are particularly effective at alleviating miRNA repression in vivo. It is found that the incorporation of high affinity nucleotide analogues into the oligonucleotides results in highly effective anti-microRNA molecules which appear to function via the formation of almost irreversible duplexes with the miRNA target, rather than RNA cleavage based mechanisms, such as mechanisms associated with RNaseH or RISC. | 11-11-2010 |
20100286235 | METHODS FOR INCREASING IN VIVO EFFICACY OF OLIGONUCLEOTIDES AND INHIBITING INFLAMMATION IN MAMMALS - The invention relates to the use of nucleotide substitutes for increasing the in vivo efficacy of nucleic acid molecules and also for inhibiting inflammation in mammals. More particularly, the present invention relates to the use of 2′6′ diaminopurine (DAP) and analogs thereof per se in anti-inflammatory compositions, and also for preparing nucleic acid molecules having an increased in vivo physiological efficiency and a reduced toxicity as compared to conventional oligos. The invention is particularly useful for the preparation of antisense oligonucleotides for treating pulmonary/respiratory diseases such as cystic fibrosis, asthma, chronic bronchitis, chronic obstructive lung disease, eosinophilic bronchitis, allergies, allergic rhinitis, pulmonary fibrosis, adult respiratory distress syndrome, sinusitis, respiratory syncytial virus or other viral respiratory tract infection and cancer. | 11-11-2010 |
20100286236 | Dosage of oligonucleotides suitable for the treatment of tumors - A method for preventing and/or treating a tumor, the method comprising: intravenously administering an antisense oligonucleotide in an amount of between about 400 to about 800 mg/m | 11-11-2010 |
20100286237 | PRO-ANGIOGENIC GENES IN OVARIAN TUMOR ENDOTHELIAL CELL ISOLATES - A gene profiling signature for ovarian tumor endothelial cells is disclosed herein. The gene signature can be used to diagnosis or prognosis an ovarian tumor, identify agents to treat an ovarian tumor, to predict the metastatic potential of an ovarian tumor and to determine the effectiveness of ovarian tumor treatments. Thus, methods are provided for identifying agents that can be used to treat ovarian cancer, for determining the effectiveness of an ovarian tumor treatment, or to diagnose or prognose an ovarian tumor. Methods of treatment are also disclosed which include administering a composition that includes a specific binding agent that specifically binds to one of the disclosed ovarian endothelial cell tumor-associated molecules and inhibits ovarian tumor in the subject. | 11-11-2010 |
20100286238 | SUPPRESSION OF VIRUSES INVOLVED IN RESPIRATORY INFECTION OR DISEASE - The present invention concerns methods and reagents useful in decreasing the level of or severity of respiratory infection or disease due to paramyxoviruses, such as RSV or HPIV, or coronavirus infection. Particularly, the invention relates to modulating gene expression using a multitargeting interfering RNA molecules that target multiple target sites on one or more pre-selected RNA molecules. | 11-11-2010 |
20100286239 | ANTISENSE OLIGONUCLEOTIDES FOR TREATING ATOPIC DISEASES AND NEOPLASTIC CELL PROLIFERATION - The present invention relates to the use of antisense oligonucleotides directed against specific nucleic acid sequences coding for receptors, alone or in combination, in order to inhibit the inflammatory reaction that is present in asthma, atopy or hypereosinophilia and to inhibit neoplastic cell proliferation. The antisense oligonucleotides of the present invention are used for treating and/or preventing asthma, allergy, hypereosinophilia, general inflammation or cancer. The oligonucleotides of the present invention are more specifically directed against nucleic acid sequences coding for a CCR3 receptor, a common sub-unit of IL-4 and IL-13 receptors, or a common sub-unit of IL-3, IL-5 and GM-CSF receptors. | 11-11-2010 |
20100286240 | MicroRNAs FOR INHIBITING VIRAL REPLICATION - The present invention relates to reducing accumulation of viral genomes in a target cell. In particular the present invention provides compositions and methods for combating viral infection through RNA interference. Specifically the present invention provides cellular microRNA mimics for treating virus-infected subjects. | 11-11-2010 |
20100286241 | COMPOSITIONS COMPRISING K-RAS SIRNA AND METHODS OF USE - The present invention provides nucleic acid molecules that inhibit K-ras expression. Methods of using the nucleic acid molecules are also provided. | 11-11-2010 |
20100286242 | siRNA-Mediated Gene Silencing of Synuclein - The present invention is directed to small interfering RNAs that down regulate expression of a synuclein gene and methods of using the small interfering RNAs. | 11-11-2010 |
20100286243 | MIG-7 AS A SPECIFIC ANTICANCER TARGET - Aspects of the present invention provide novel Mig-7 encoding nucleic acids and Mig-7 polypeptides, RNAi (such as siRNA), recombinant DNA expression systems and host cells containing same, as well as methods of inhibiting expression of the subject nucleic acid molecules, inhibiting production of the encoded proteins or polypeptides, inhibiting metastasis of a carcinoma cell in a subject (including in humans), inhibiting migration/invasion of and mimicking of normal cells by carcinoma cells in a subject, detecting the presence of a cancer cell (e.g., a migrating/invading cancer cell or carcinoma cell mimic, tumor neovas-cularization, and/or vascular mimicry) in a sample of a subject's tissue or body fluids, and inhibiting the migration/invasion of an endothelial cell mimicking by a placental cell into the blood stream or vessels of a female mammal. Particular aspects relate to novel anti-Mig-7 antibodies, diagnostic and/or prognostic methods, and therapeutic methods comprising use of the inventive nucleic acids, polypeptides and antibodies or derivatives thereof. | 11-11-2010 |
20100286244 | RNAi MEDIATED KNOCKDOWN OF NUMA FOR CANCER THERAPY - This invention relates to the use of short interfering nucleic acid molecules (siRNA) to inhibit Nuclear Mitotic Apparatus Protein (NuMA) gene expression and their use in treatment of disease, including cancer. | 11-11-2010 |
20100286245 | IDENTIFICATION OF NOVEL GENES CODING FOR SMALL TEMPORAL RNAS | 11-11-2010 |
20100286246 | IDENTIFICATION OF NOVEL GENES CODING FOR SMALL TEMPORAL RNAS | 11-11-2010 |
20100292297 | Micrornas That Regulate Muscle Cell Proliferation and Differentiation - The presently disclosed subject matter provides methods and compositions for modulating gene expression in myocytes. Also provided are cells comprising the compositions of the presently disclosed subject matter. | 11-18-2010 |
20100292298 | METHOD AND REAGENTS FOR TREATING HEPATIC FIBROSIS AND INFLAMMATION - The invention relates to methods for identifying an anti-fibrotic or anti-inflammatory agent comprising determining cathepsin S expression in activated hepatic stellate cells which have been exposed to a test compound and comparing expression to non-exposed hepatic stellate cells. The invention also relates to methods for treating a disorder characterised or caused by hepatic fibrosis or inflammation, comprising administering a cathepsin S inhibitor to a subject. | 11-18-2010 |
20100292299 | Nucleotide Motifs Providing Localization Elements and Methods of Use - The instant invention describes nucleotide motifs comprising a localization element and small RNA molecules comprising the localization motifs, and methods of use in gene silencing. The nucleotide motifs have use in preventing and treating diseases or disorders. | 11-18-2010 |
20100292300 | COMPOSITIONS AND METHODS FOR INHIBITING OR REVERSING FIBROTIC DISORDERS - The present invention provides compositions and methods for inhibiting or reversing fibrotic disorders by administering a Hic-5 antagonist to a mammal in need thereof. The invention also includes methods for screening compounds to identify Hic-5 antagonists useful in inhibiting or reversing fibrotic disorders. | 11-18-2010 |
20100292301 | NOVEL SIRNA STRUCTURES - The present invention provides novel compounds, compositions, methods and uses for treating microvascular disorders, eye diseases and respiratory conditions based upon inhibition of a target gene. More specifically, the present invention relates to positional motifs of modified ribonucleotides useful in the design of siRNA compounds. In particular, the ribonucleotides include modified internucleotide linkages and/or modified sugar moieties. These novel siRNA compounds may be used therapeutically to treat a variety of diseases and indications. | 11-18-2010 |
20100292302 | INDUCTION OF APOPTOSIS AND INHIBITION OF CELL PROLIFERATION THROUGH MODULATION OF CARNITINE PALMITOYLTRANSFERASE 1C ACTIVITY - This invention relates to compositions and methods for cancer therapeutics. In particular, the present invention provides compositions and methods for treating tumors by inhibiting the activity of CPT1C. The methods and compositions can additionally include inhibition of glycolysis. | 11-18-2010 |
20100292303 | GENE EXPRESSION PROFILE FOR PREDICTING OVARIAN CANCER PATIENT SURVIVAL - A gene profiling signature for predicting ovarian cancer patient survival is disclosed herein. The gene signature can be used to diagnosis or prognosis ovarian cancer, identify agents to treat an ovarian tumor, to predict the metastatic potential of an ovarian tumor and to determine the effectiveness of ovarian tumor treatments. Thus, methods are provided for diagnosing and prognosing an ovarian tumor, such as ovarian cancer, in a subject. Methods are also provided for identifying agents that can be used to treat an ovarian tumor, for determining the effectiveness of an ovarian tumor treatment, or to predict the metastatic potential of an ovarian tumor. Methods of treatment are also disclosed which include administering a composition that includes a specific binding agent that specifically binds to one of the disclosed ovarian survival factor-associated molecules and ovarian tumor in the subject. | 11-18-2010 |
20100292304 | COMPOUNDS AND METHODS FOR IMPROVING CELLULAR UPTAKE OF OLIGOMERIC COMPOUNDS - The present invention provides method of optimizing the efficacy and potency of antisense drugs. In certain embodiments, the invention provides assays useful for determining favorable oligonucleotide characteristics and excipeints for improved cellular uptake. | 11-18-2010 |
20100292305 | RNAi MODULATION OF HIF-1 AND THERAPUTIC USES THEREOF - The features of the present invention relate to compounds, compositions and methods useful for modulating the expression of HIF-1α, such as by the mechanism of RNA interference (RNAi). The compounds and compositions include iRNA agents that can be unmodified or chemically-modified. | 11-18-2010 |
20100292306 | Compositions And Methods For The Treatment Of Muscular Dystrophy - Compositions and methods for treatment of individuals diagnosed with a dystrophin deficiency are disclosed. In particular, inhibitors of NFκB transactivation and/or inhibitors that suppress p65 expression are used to prevent and/or reverse muscle damage in animals or humans lacking dystrophin. Such compositions and methods are useful in the treatment of individuals with muscular dystrophy. | 11-18-2010 |
20100298403 | MODIFIED POLY(PROPYLENE-IMINE) DENDRIMERS AND THEIR USE AS TRANSFECTION AGENTS FOR AMIONIC BIOACTIVE FACTORS ( as amended - The present invention is concerned with modified poly-(propylene imine) dendrimers, comprising cationic internal ammonium groups and external non-toxic endgroups, pharmaceutical compositions comprising said dendrimers, methods for the production of said dendrimers and their use as transfections agents for anionic bioactive therapeutic factors, for use in gene therapy, in particular for the treatment of cancer. The modified poly-(propylene imine) dendrimer of generation 1, 2, 3, 4 or 5, also comprising incomplete dendrimers and mixtures thereof, comprising external end groups and internal amine functions are characterized in that:
| 11-25-2010 |
20100298404 | Translocation and mutant ROS kinase in human non-small cell lung carcinoma - In accordance with the invention, a novel gene translocation, (4p15, 6q22), in human non-small cell lung carcinoma (NSCLC) that results in a fusion proteins combining part of Sodium-dependent Phosphate Transporter Isoform NaPi-3h protein (SLC34A2) with Proto-oncogene Tyrosine Protein Kinase ROS Precursor (ROS) kinase has now been identified. The SLC34A2-ROS fusion protein is anticipated to drive the proliferation and survival of a subgroup of NSCLC tumors. The invention therefore provides, in part, isolated polynucleotides and vectors encoding the disclosed mutant ROS kinase polypeptides, probes for detecting it, isolated mutant polypeptides, recombinant polypeptides, and reagents for detecting the fusion and truncated polypeptides. The disclosed identification of the new fusion protein enables new methods for determining the presence of these mutant ROS kinase polypeptides in a biological sample, methods for screening for compounds that inhibit the proteins, and methods for inhibiting the progression of a cancer characterized by the mutant polynucleotides or polypeptides, which are also provided by the invention. | 11-25-2010 |
20100298405 | Compositions And Methods For Inhibiting Expression Of Huntingtin Gene - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the Huntingtin gene (HD gene), comprising an antisense strand having a nucleotide sequence which is less than 25 nucleotides in length and which is substantially complementary to at least a part of the HD gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by the expression of the HD gene, or a mutant form thereof, using the pharmaceutical composition; and methods for inhibiting the expression of the huntingtin gene in a cell. | 11-25-2010 |
20100298406 | Method of suppressing tumour growth - A method of suppressing undesirable cell proliferation, such as tumour growth, is provided comprising the step of increasing the level of PCL2 in target cells. | 11-25-2010 |
20100298407 | COMPOSITIONS AND METHODS FEATURING MICRONAS FOR TREATING NEOPLASIA - The invention provides compositions and methods for the treatment of a neoplasia. The methods of the invention involve expressing a microRNA usually repressed by Myc in a cell of a subject diagnosed as having a neoplasia. | 11-25-2010 |
20100298408 | Oligonucleotide Compositions with Enhanced Efficiency - The oligonucleotide compositions of the present invention make use of combinations of oligonucleotides. In one aspect, the invention features an oligonucleotide composition including at least 2 different oligonucleotides targeted to a target gene. This invention also provides methods of inhibiting protein synthesis in a cell and methods of identifying oligonucleotide compositions that inhibit synthesis of a protein in a cell. | 11-25-2010 |
20100298409 | COMPOSITIONS COMPRISING STAT3 SIRNA AND METHODS OF USE THEREOF - The present invention provides nucleic acid molecules that inhibit STAT3 expression. Methods of using the nucleic acid molecules are also provided. | 11-25-2010 |
20100298410 | MICROMIRs - The present invention relates to very short heavily modified oligonucleotides which target and inhibit microRNAs in vivo, and their use in medicaments and pharmaceutical compositions. | 11-25-2010 |
20100298411 | LIPID-MODIFIED DOUBLE-STRANDED RNA HAVING POTENT RNA INTERFERENCE EFFECT - An object of the present invention is to provide a novel double-stranded RNA that has high nuclease resistance and high cellular uptake efficiency, and that is capable of producing an excellent RNA interference effect. The present invention provides a lipid-modified double-stranded RNA comprising a sense strand having a nucleotide sequence complementary to a target sequence, and an antisense strand having a nucleotide sequence complementary to the sense strand, the double-stranded RNA being capable of inhibiting the expression of the target gene, the sense strand having a lipid linked to at least one of the first to sixth nucleotides from the 5′ end side directly or via a linker. | 11-25-2010 |
20100298412 | Disulfide Chemotherapeutic Agents and Methods of Use Thereof - Compositions and methods for the treatment of cancer are provided. | 11-25-2010 |
20100305186 | METHODS FOR MEDIATING GENE SUPPRESSION - The present invention is concerned with methods for enhancing gene suppression in cells and in particular it is concerned with improved methods for enhancing RNAi-mediated gene silencing by manipulation of factors associated with RNAi. The present invention is also concerned with methods for identifying factors which down-regulate as well as those which up-regulate RNAi. It is also concerned with genetic constructs useful for enhancing or modulating gene silencing and cells harbouring such constructs. | 12-02-2010 |
20100305187 | METHODS AND COMPOUNDS FOR TREATING DISEASES CAUSED BY REACTIVE OXYGEN SPECIES - Provided is a method of treating a patient having an inflammatory disease by using a compound which inhibits the complex I-mediated ROS production, a medicament containing such compound and methods for screening for such compounds. | 12-02-2010 |
20100305188 | NUCLEIC ACID CAPABLE OF REGULATING THE PROLIFERATION OF CELL - Provided are an agent for suppressing or promoting cell proliferation, a diagnostic reagent or therapeutic drug for a disease resulting from a cell proliferation abnormality, an agent for inducing apoptosis, an agent for suppressing or promoting the expression of a target gene for a nucleic acid such as a microRNA, and a method of suppressing or promoting cell proliferation. | 12-02-2010 |
20100305189 | PHARMACEUTICAL COMPOSITION FOR PREVENTING, STABILISING AND/OR INHIBITING BLOOD AND LYMPH VASCULARIZATION - A pharmaceutical composition including as active agent, an antisens oligonucleotide having the sequence SEQ ID NO: 1 in a concentration from about 0.40 mg/ml to about 2 mg/ml and the use thereof for preventing, stabilizing and/or inhibiting blood and lymph vascularization. | 12-02-2010 |
20100305190 | NUCLEIC ACID COMPLEX AND NUCLEIC ACID DELIVERY COMPOSITION - The present invention provides a nucleic acid complex with low toxicity and high safety that can persistently maintain a nucleic acid, such as siRNA or the like, in a cell; and a nucleic acid delivery composition that can efficiently deliver the nucleic acid complex into a cell. A nucleic acid complex with low toxicity and high safety that can persistently maintain a nucleic acid in a cell can be obtained by forming a complex using a nucleic acid to be introduced into a cell, and a highly branched cyclic dextrin. Moreover, when a carrier comprising (A) a diacylphosphatidylcholine, (B) cholesterol and/or a derivative thereof, and (C) an aliphatic primary amine is used as a nucleic acid delivery carrier to introduce the nucleic acid complex into a cell, the safety, the efficiency of intracellular delivery, and the persistence of the nucleic acid in the cell can be further improved. | 12-02-2010 |
20100305191 | RNA INTERFERENCE MEDIATED INHIBITION OF ADENOSINE A1 RECEPTOR (ADORA1) GENE EXPRESSION USING SHORT INTERFERING RNA - The present invention concerns methods and reagents useful in modulating adenosine A1 receptor (ADORA1) gene expression in a variety of applications, including use in therapeutic, diagnostic, target validation, and genomic discovery applications. Specifically, the invention relates to small interfering RNA (siRNA) molecules capable of mediating RNA interference (RNAi) against ADORA1 and related receptors. | 12-02-2010 |
20100305192 | COMPOSITIONS AND METHODS FOR SHORT INTERFERING NUCLEIC ACID INHIBITION OF NAV1.8 - The invention provides short interfering nucleic acids, either single-stranded or double-stranded, that cause RNAi-induced degradation of mRNA from the Na | 12-02-2010 |
20100305193 | RNAI-MEDIATED INHIBITION OF GREMLIN FOR TREATMENT OF IOP-RELATED CONDITIONS - RNA interference is provided for inhibition of gremlin in intraocular pressure-related conditions, including ocular hypertension and glaucoma such as normal tension glaucoma and open angle glaucoma. | 12-02-2010 |
20100311807 | METHODS FOR IDENTIFYING DIABETES AND OBESITY THERAPEUTICS - The invention relates to inhibition of Par-1b kinase activity for treating disorders including diabetes and obesity. The invention also relates to screening for compounds or compositions that inhibit the kinase activity of Par-1b protein, which compounds and compositions are useful in the treatment of diabetes and obesity, as well as preparing compounds for treatment of diabetes and obesity. | 12-09-2010 |
20100311808 | METHODS, COMPOSITIONS AND DRUG DELIVERY SYSTEMS FOR INTRAOCULAR DELIVERY OF siRNA MOLECULES - Biocompatible intraocular drug delivery systems in the form of an implant for intraocular administration of siRNA molecules. The drug delivery systems may be placed in an eye to treat or reduce the occurrence of one or more ocular conditions, such as retinal damage, including glaucoma and proliferative vitreoretinopathy among others. | 12-09-2010 |
20100311811 | RNA-MEDIATED EPIGENETIC REGULATION OF GENE TRANSCRIPTION - The invention provides a method of regulating transcription of a gene that is a target for an epigenetic regulator; a method of characterizing the transcriptional activity of such a gene; a method of screening for a chromosomal element (CE) for an epigenetic regulator of a target gene; an isolated complex including an epigenetic regulator for a target gene, wherein the epigenetic regulator is specifically bound to a non-coding polynucleotide; and a method of screening for a modulator of transcription of a gene that is a target for an epigenetic regulator. | 12-09-2010 |
20100311812 | RNA INTERFERENCE MEDIATED INHIBITION OF INTERCELLULAR ADHESION MOLECULE (ICAM) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating intercellular adhesion molecule (ICAM) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of ICAM gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of ICAM genes. | 12-09-2010 |
20100317713 | MICRO-RNAS OF THE MIR-15 FAMILY MODULATE CARDIOMYOCYTE SURVIVAL AND CARDIAC REPAIR - A family of microRNAs, called the miR-15 family, which includes miR-195, are shown to be up-regulated during pathological cardiac remodeling and repress the expression of mRNAs required for cell proliferation and survival, with consequent loss of cardiomyocytes. Strategies to block expression of the miR-15 family in the heart as a treatment for diverse cardiac disease are provided. | 12-16-2010 |
20100317714 | COMPLEX MOLECULE INTERFERING THE EXPRESSION OF TARGET GENES AND ITS PREPARING METHODS - The present invention provides a complex molecule interfering the expression of target genes and the methods for preparing the complex molecule, wherein the complex molecule contains two siRNA strands X | 12-16-2010 |
20100317715 | METHODS FOR TREATING NEUROPSYCHIATRIC CONDITIONS - Provided herein are compositions and methods for treating a subject suffering from Fragile X syndrome, autism, Down's syndrome, mental retardation, or a neuropsychiatric condition (e.g., schizophrenia). The methods include systemic administration of a a therapeutically effective amount of a PAK inhibitor in combination with a Group I mGluR antagonist (e.g., an mGluR5 antagonist). The PAK inhibitor and mGluR antagonist can be administered together, e.g., in one pharmacological composition, or they can be administered separately. | 12-16-2010 |
20100317716 | RNA INTERFERENCE MEDIATED INHIBITION OF TNF AND TNF RECEPTOR GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating tumor necrosis factor and/or tumor necrosis factor receptor gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of tumor necrosis factor and/or tumor necrosis factor receptor gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of tumor necrosis factor and/or tumor necrosis factor receptor genes, (TNF and/or TNF receptor). | 12-16-2010 |
20100317717 | RNA INTERFERENCE MEDIATED INHIBITION OF PLATELET DERIVED GROWTH FACTOR (PDGF) AND PLATELET DERIVED GROWTH FACTOR RECEPTOR (PDGFR) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating platelet derived growth factor (PDGF) and/or platelet derived growth factor receptor (PDGFr) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of platelet derived growth factor (PDGF) and/or platelet derived growth factor receptor (PDGFr) gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of platelet derived growth factor (PDGF) and/or platelet derived growth factor receptor (PDGFr) genes, such as PDGF and/or PDGFr. | 12-16-2010 |
20100317718 | MODULATION OF HIF1 BETA EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of HIF1-beta. The compositions comprise oligonucleotides, targeted to nucleic acid encoding HIF1-beta. Methods of using these compounds for modulation of HIF1-beta expression and for diagnosis and treatment of diseases and conditions associated with expression of HIF1-beta are provided. | 12-16-2010 |
20100317719 | Antisense Oligonucleotides (ODN) Against SMAD7 and Uses Thereof in Medical Field - The invention relates to antisense oligonucleotidic sequences (ODN) against Smad7 suitably modified, and their uses in medical field as therapeutic biological agents, in particular in the treatment of chronic inflammatory bowel disease, such as Crohn's disease and ulcerative colitis. | 12-16-2010 |
20100317720 | Methods and Compositions for the Treatment of Intestinal Conditions - Methods and compositions for the treatment of intestinal disorders, such as IBD and Crohn's disease, are disclosed. Preferred compositions include siNA. Also disclosed is a method of specifically targeting siNA to treat intestinal disorders by intrarectal administration of siNA compounds. | 12-16-2010 |
20100324112 | Genetic changes in ATM and ATR/CHEK1 as prognostic indicators in cancer - The present invention relates to the discovery that, in human cancer, an 11q deletion of ATM together with an increase in ATR and CHEK1 expression correlates with resistance to ionizing radiation which could be overcome by inhibition of the ATR/CHEK1 pathway. It provides for methods of identifying patients unlikely to exhibit an adequate response to radiation therapy and/or chemotherapy who may benefit from ATR/CHEK1 pathway inhibition, as well as methods of treating said patients. | 12-23-2010 |
20100324113 | Delivery Method - The present invention relates, in general, to siRNA and, in particular, to a method of effecting targeted delivery of siRNAs and to compounds suitable for use in such a method. | 12-23-2010 |
20100324114 | Methods and kits to detect hereditary angioedema type III - The present invention relates to a method of diagnosing hereditary angioedema type III (HAE III) or a predisposition thereto in a subject being suspected of having developed or of having a predisposition to develop a hereditary angioedema type III or in a subject being suspected of being a carrier for hereditary angioedema type III, the method comprising determining in vitro from a biological sample of said subject the presence or absence of a disease-associated mutation in a nucleic acid molecule regulating the expression of or encoding coagulation factor XII; wherein the presence of such a mutation is indicative of a hereditary angioedema type III or a predisposition thereto. The present invention also relates to a method of diagnosing hereditary angioedema type III (HAE III) or a predisposition thereto in a subject being suspected of having developed or of having a predisposition to develop a hereditary angioedema type III or in a subject being suspected of being a carrier for hereditary angioedema type III, the method comprising assessing the presence, amount and/or activity of coagulation factor XII in said subject and including the steps of: (a) determining from a biological sample of said subject in vitro, the presence, amount and for activity of: (i) a (poly)peptide encoded by the coagulation factor XII gene; (ii) a substrate of the (poly)peptide of (i); or (iii) a (poly)peptide processed by the substrate mentioned in (ii); (b) comparing said presence, amount and/or activity with that determined from a reference sample; and (c) diagnosing, based on the difference between the samples compared in step (b), the pathological condition of a hereditary angioedema type III or a predisposition thereto. The present invention also relates to a method of identifying a compound modulating coagulation factor XII activity which is suitable as a medicament or a lead compound for a medicament for the treatment and/or prevention of hereditary angioedema type III, the method comprising the steps of: (a) in vitro contacting a coagulation factor XII (poly)peptide or a functionally related (poly)peptide with the potential modulator; and (b) testing for modulation of coagulation factor XII activity, wherein modulation of coagulation factor XII activity is indicative of a compound's suitability as a medicament for the treatment and/or prevention of hereditary angioedema type III. Furthermore, the present invention relates to gene therapy methods and to a kit for diagnosing hereditary angioedema type III. | 12-23-2010 |
20100324115 | Treatment of Squamous Cell Carcinoma with HSP27 Antisense Oligonucleotides and Radiotherapy - Squamous cell carcinomas, such as squamous head and neck cancer, are treated with a combination of radio-therapy and a therapeutic agent that reduces the amount of hsp27 in the squamous cancer cells. In specific embodiments, the therapeutic agent that reduces the amount of hsp27 is an antisense oligonucleotide therapeutic agent. | 12-23-2010 |
20100324116 | FAS/FASL OR OTHER DEATH RECEPTOR TARGETED METHODS AND COMPOSITIONS FOR KILLING TUMOR CELLS - Provided herein are methods and compositions for killing tumor cells. In certain embodiments, compositions can promote apoptosis by down-regulating FAPP2 and PATZ1 products. | 12-23-2010 |
20100324117 | HEPATITIS C DSRNA EFFECTOR MOLECULES, EXPRESSION CONSTRUCTS, COMPOSITIONS, AND METHODS OF USE - The present invention provides agents, compositions, constructs and methods for silencing HCV polynucleotides, as well as methods and compositions for treating or preventing HCV infection in a mammalian cell. In one aspect, the present invention provides an agent or composition comprising at least one double-stranded RNA effector molecule or complex. The double-stranded RNA effector molecule or complex comprises: (1) a sequence of at least 19 nucleotides having at least 90% identity with a nucleotide sequence within HCV Conserved Region 1 (SEQ ID NO: 2), HCV Conserved Region 2 (SEQ ID NO: 3), HCV Conserved Region 5 (SEQ ID NO: 4), (ATR)-1 (SEQ ID NO: 86), ATR-2 (SEQ ID NO: 87), ATR-3 (SEQ ID NO: 88), ATR-4 (SEQ ID NO: 89); and (2) its complementary sequence. In another aspect, the present invention provides a construct suitable for replication in a host cell, and/or suitable for expression of an RNA molecule or complex of the invention in vitro or in vivo. In a third aspect, the present invention provides a method for silencing HCV RNA in a mammalian cell, which comprises administering to the mammalian cell an agent, composition, or construct of the invention in a manner and amount effective to silence HCV RNA in the cell. In a related aspect, the invention provides a method for treating or preventing HCV infection in a patient, comprising administering to the patient an effective amount of an agent, composition, or construct of the invention as described herein. | 12-23-2010 |
20100324118 | Method for the Promotion of Angiogenesis, Vascularization, or Vascular Repair or for the Inhibition of Tumor Angiogenesis - The invention relates to a method for influencing the miR-92 expression in a cell, comprising the following steps: (a) providing a cell; and (b1) reducing the miR-92 expression in the cell in order to promote the vascularization or vessel repair by introducing an antisense molecule against miR-92 into the cell, or (b2) increasing the miR-92 expression in the cell for an inhibition of the tumor angiogenesis by introducing a construct into the cell, wherein said construct includes an expressible miR-92 sequence. Furthermore, the invention relates to a pharmaceutical composition, comprising an agent for reducing the miR-92 activity or expression in a cell in the form of an antisense molecule against miR-92, or an agent for increasing the miR-92 expression in a cell in the form of a construct for expressing miR-92. | 12-23-2010 |
20100324119 | REDUCING IRF4, DUSP22, OR FLJ43663 POLYPEPTIDE EXPRESSION - This document relates to the activity of interferon regulatory factor 4 (IRF4) in T-cell lymphomas. For example, methods and materials involved in reducing the expression of an IRF4 polypeptide in T-cell lymphoma cells and identifying agents having the ability to reduce expression of an IRF4 polypeptide in T-cell lymphoma cells are provided. This document also relates to reducing DUSP22 or FLJ43663 polypeptide activity in T-cell lymphomas. For example, methods and materials involved in reducing the expression of DUSP22 polypeptides and/or FLJ43663 polypeptides in T-cell lymphoma cells and identifying agents having the ability to reduce expression of DUSP22 polypeptides and/or FLJ43663 polypeptides in T-cell lymphoma cells are provided. | 12-23-2010 |
20100324120 | LIPID FORMULATION - The invention features a cationic lipid of formula I, | 12-23-2010 |
20100324121 | METHODS AND COMPOSITIONS FOR THE SPECIFIC INHIBITION OF GENE EXPRESSION BY DOUBLE-STRANDED RNA - The invention provides compositions and methods for selectively reducing the expression of a gene product from a desired target gene, as well as treating diseases caused by expression of the gene. The method involves introducing into the environment of a cell an amount of a double-stranded RNA (dsRNA) such that a sufficient portion of the dsRNA can enter the cytoplasm of the cell to cause a reduction in the expression of the target gene. The dsRNA has a first oligonucleotide sequence that is between 26 and about 30 nucleotides in length and a second oligonucleotide sequence that anneals to the first sequence under biological conditions. In addition, a region of one of the sequences of the dsRNA having a sequence length of from about 19 to about 23 nucleotides is complementary to a nucleotide sequence of the RNA produced from the target gene. | 12-23-2010 |
20100331389 | Compositions and methods for the specific inhibition of gene expression by dsRNA containing modified nucleotides - The invention features compositions and methods that are useful for reducing the expression or activity of a specified gene in a eukaryotic cell. | 12-30-2010 |
20100331390 | EFFECTS OF APOLIPOPROTEIN B INHIBITION ON GENE EXPRESSION PROFILES IN ANIMALS - Methods are provided for modulating the expression of genes involved in lipid metabolism, useful in the treatment of conditions associated with cardiovascular risk. Antisense oligonucleotides targeted to apolipoprotein B reduce the level of apolipoprotein B mRNA, lower serum cholesterol and shift liver gene expression profiles from those of an obese animal towards those of a lean animal. Further provided are methods for improving the cardiovascular risk of a subject through antisense inhibition of apolipoprotein B. Also provided are methods for employing antisense oligonucleotides targeted to apolipoprotein B to modulate a cellular pathway or metabolic process. | 12-30-2010 |
20100331391 | ZAP-70 AS PREDICTOR AND MODULATOR OF EFFECTOR FUNCTION OF T CELLS - In this application is described a novel, multiparameter analysis of TCR-coupled signaling and function in resting and activated naive and memory CD4 T cells, revealing a biochemical basis for immunological recall. Results reveal a novel biochemical signature imparted to memory CD4 T cells enabling efficacious responses through increased ZAP-70 expression and reduced accumulation of downstream signaling events. | 12-30-2010 |
20100331392 | ANTIDOTES TO ANTISENSE COMPOUNDS - The present invention relates to antisense antidote compounds and uses thereof. Such antidote compounds reduce the magnitude and/or duration of the antisense activity of an antisense compound. | 12-30-2010 |
20100331393 | COMPOSITIONS AND METHODS OF SPHINGOSINE KINASE INHIBITORS IN RADIATION THERAPY OF VARIOUS CANCERS - The present invention relates to Sphingosine kinase inhibitors that are useful for treating various cancers. The invention further relates to compositions and methods of SPK inhibitors, including siRNAs, which specifically block gene expression of SPK and potentiates the effect of radiation in the treatment of various cancers. | 12-30-2010 |
20100331394 | Methods and Compositions for the Treatment of Eye Disorders with Increased Intraocular Pressure - The present invention relates to methods and compositions that decrease intraocular pressure (IOP) of the eye. The compositions of the invention comprise short interfering nucleic acid molecules (siNA) including, but not limited to, siRNA that decrease expression of genes associated with production or drainage of intraocular fluid. The compositions of the invention can be used in the preparation of a medicament for the treatment of an eye conditions displaying increased IOP such as glaucoma, infection, inflammation, uveitis, and diabetic retinopathy. The methods of the invention comprise the administration to a patient in need thereof an effective amount of one or more siNAs of the invention. | 12-30-2010 |
20110003879 | Antisense oligonucleotides targeted to the coding region of thymidylate synthase and uses thereof - Antisense oligonucleotides directed to the coding region of a mammalian thymidylate synthase mRNA that are capable of inhibiting the proliferation of cancer cells without decreasing the level of thymidylate synthase mRNA in the cells are provided. The antisense oligonucleotides are also capable of inducing apoptosis in the cancer cells. The antisense oligonucleotides can be used to inhibit the proliferation of cancer cells and to induce apoptosis in cancer cells. Methods of treating cancer, and in particular breast cancer, with the antisense oligonucleotides, alone or in combination with other therapeutics, are also provided. | 01-06-2011 |
20110003880 | Compositions and methods for inhibiting optic nerve damage - Provided herein is a method of inhibiting optic nerve damage in an individual in need thereof, comprising administering to the individual an agent that inhibits peptidyl arginine deiminase 2 (PAD2). In a particular embodiment, the present invention is directed to a method of inhibiting glaucomatous optic nerve damage in an individual in need thereof, comprising administering to the individual an agent that inhibits peptidyl arginine deiminase 2 (PAD2). The present invention is also directed to a method of treating glaucoma (e.g., primary open angle glaucoma) in an individual in need thereof, comprising administering to the individual an agent that inhibits (e.g., specifically inhibits) peptidyl arginine deiminase 2 (PAD2). | 01-06-2011 |
20110003881 | SINGLE STRANDED EXTENDED DICER SUBSTRATE AGENTS AND METHODS FOR THE SPECIFIC INHIBITION OF GENE EXPRESSION - The invention provides compositions and methods for reducing expression of a target gene in a cell, involving contacting a cell with an isolated double stranded nucleic acid (dsNA) in an amount effective to reduce expression of a target gene in a cell. The dsNAs of the invention possess a single stranded extension (in most embodiments, the single stranded extension comprises at least one modified nucleotide and/or phosphate back bone modification). Such single stranded extended Dicer-substrate siRNAs (DsiRNAs) were demonstrated to be effective RNA inhibitory agents compared to corresponding double stranded DsiRNAs. | 01-06-2011 |
20110003882 | RNAi Modulation of AHA and Therapeutic Uses Thereof - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of an Aha gene (Aha1 gene), comprising an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of an Aha gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by Aha1 expression and the expression of an Aha gene using the pharmaceutical composition; and methods for inhibiting the expression of an Aha gene in a cell. | 01-06-2011 |
20110009466 | METHODS OF INCREASING GENE EXPRESSION THROUGH RNA PROTECTION - This invention relates to the use of one or more RNA target protectors to inhibit the binding of an RNA, e.g., small RNA, to a target RNA (e.g., a target mRNA), thus increasing the stability of the target RNA and its function (e.g., increasing the gene expression of the gene corresponding to a target mRNA). An RNA target protector may be, for example, an oligonucleotide, e.g., a morpholino, or a small molecule. The invention further relates to the treatment of a human patient in need thereof with one or more RNA target protectors. | 01-13-2011 |
20110009467 | Methods to Increase or Decrease Bone Density - The SOST gene gives rise to sclerostin, a protein that leads to apoptosis of bone progenitor cells. The invention provides antagonists to the sclerostin protein, and methods for identifying new sclerostin antagonists. The invention also provides molecules that can depress expression of the SOST gene, as well as methods for identifying such molecules. Such molecules and antagonists are useful for increasing bone mineralization in mammals, for example, in the treatment of osteoporosis. | 01-13-2011 |
20110009468 | MIRNA, SIRNA AND USE THEREOF IN THERAPY - The present invention relates to a mixture of molecules comprising at least one miRNA and at least one siRNA, or at least two miRNAs, or at least two siRNAs for inducing hematopoietic differentiation or for treating leukemia wherein the miRNA is able to modulate hematopoietic differentiation and/or to act as oncosuppressor, and the siRNA is able to modulate hematopoietic differentiation or to inhibit the expression of a fusion product deriving from a chromosomic translocation associated to leukemia. | 01-13-2011 |
20110009469 | COMPOSITIONS AND METHODS OF TREATING NEOPLASIA - The present invention provides compositions and methods featuring microRNA polynucleotides for the diagnosis, treatment or prevention of neoplasia. | 01-13-2011 |
20110009470 | Nucleic acid external skin formulation - The present invention provides a nucleic acid external skin formulation having a high skin permeability and which is prepared from a polymeric nucleic acid having a high molecular weight and sodium alginate. The nucleic acid external skin formulation is highly skin permeable and delivers its active ingredient nucleic acid to the affected area efficiently. The nucleic acid used may be smaller in amount, and thus, the formulation is also superior in safety and cost. The working mechanism thereof is different from that of the low-molecular weight compounds currently used as an active ingredient for skin anti-inflammatory agents, and thus, the formulation may be applicable to cases where such low-molecular weight medicines are less effective. | 01-13-2011 |
20110009471 | Oligonucleotide analogues and methods utilizing the same - A method for the prevention or treatment in a mammal of a disease preventable or treatable by the pharmacologically useful antisense or antigene activity of an oligonucleotide analogue or a pharmacologically acceptable salt thereof in the body of said mammal, which method comprises administering to said mammal in need of such prevention or treatment a pharmaceutically effective amount of an oligonucleotide analogue comprising two or more nucleoside units, wherein at least one of said nucleoside units is a structure of the formula (2): | 01-13-2011 |
20110009472 | RNAi Probes Targeting Cancer-Related Proteins - RNAi sequences that are useful as therapeutics in the treatment of cancers of various types, including prostate cancer, sarcomas such as osteosarcoma, renal cell carcinoma, breast cancer, bladder cancer, lung cancer, colon cancer, ovarian cancer, anaplastic large cell lymphoma and melanoma; and Alzheimer's disease. These sequences target clusterin, IGFBP-5, IGFBP-2, both IGFBP-2 and -5 simultaneously, Mitf, and B-raf. The invention further provides for the use of these RNAi sequences in the treatment of cancers of various types, including prostate cancer, sarcomas such as osteosarcoma, renal cell carcinoma, breast cancer, bladder cancer, lung cancer, colon cancer, ovarian cancer, anaplastic large cell lymphoma and melanoma; and Alzheimer's disease, and a method of treating such conditions through the administration of the RNA molecules with RNAi activity to an individual, including a human individual in need of such treatment. | 01-13-2011 |
20110009473 | PTTG1 AS A BIOMARKER FOR CANCER TREATMENT - The present invention relates to the use of pituitary tumor transforming gene 1 (PTTG1) as a biomarker for diagnosing cancer as well as for determining cancer treatment responsiveness. In one embodiment, the present invention provides a method of treating cancer by inhibiting the expression of PTTG1, and administering a therapeutically effective amount of Aurora kinase inhibitor, HDAC inhibitor and/or ROS-generating agent. | 01-13-2011 |
20110015249 | METHODS AND COMPOSITIONS FOR TREATMENT OF CANCER AND OTHER ANGIOGENESIS-RELATED DISEASES - The present invention provides nucleic acid molecules that modulate the expression of molecules in the angiopoietin/Tie2 signaling pathway. Methods of using the nucleic acid molecules are also provided. | 01-20-2011 |
20110015250 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF Eg5 GENE - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the Eg5 gene (Eg5 gene), comprising an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of the Eg5 gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by Eg5 expression and the expression of the Eg5 gene using the pharmaceutical composition; and methods for inhibiting the expression of the Eg5 gene in a cell. | 01-20-2011 |
20110015251 | RNA INTERFERENCE MEDIATED INHIBITION OF HUMAN IMMUNODEFICIENCY VIRUS (HIV) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - This invention relates to compounds, compositions, and methods useful for modulating human immunodeficiency virus (HIV) gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of human immunodeficiency virus (HIV) gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of HIV genes. The small nucleic acid molecules are useful in the treatment of HIV infection, AIDS, and/or disease and conditions related to HIV infection and/or AIDS in a subject or organism. | 01-20-2011 |
20110015252 | LIPID FORMULATED DSRNA TARGETING THE PCSK9 GENE - This invention relates to composition and methods using lipid formulated siRNA targeted to a PCSK9 gene. | 01-20-2011 |
20110015253 | ANTISENSE OLIGONUCLEOTIDES FOR INDUCING EXON SKIPPING AND METHODS OF USE THEREOF - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202. | 01-20-2011 |
20110015254 | PTPH1 Inhibitors for the Treatment of Alzheimer's Disease - The present invention relates to the use of PTPH1 inhibitors in the prevention or treatment of Alzheimer's Disease, or a symptom thereof. The present invention also relates to a method of identifying compounds useful in the prevention or treatment of Alzheimer's Disease, or a symptom thereof. | 01-20-2011 |
20110021599 | METHODS AND COMPOSITIONS FOR INHIBITING OR REDUCING HAIR LOSS, ACNE, ROSACEA, PROSTATE CANCER, AND BPH - This invention provides methods of treating androgenetic alopecia (AGA), acne, rosacea, prostate cancer, and benign prostatic hypertrophy (BPH), comprising the step of contacting a subject with a compound or composition capable of decreasing prostaglandin D2 (PGD2) level or activity, a downstream signaling or receptor pathway thereof, or prostaglandin D2 synthase level or activity; methods of stimulating hair growth, comprising the step of contacting a subject with a compound or composition capable of increasing or decreasing the activity or level of a target gene of the present invention, or with a protein product of the target gene or an analogue or mimetic thereof; and methods of testing for AGA and evaluating therapeutic methods thereof, comprising measuring PGD2 levels. | 01-27-2011 |
20110021600 | NOVEL NUCLEIC ACID - According to the present invention, it possible to provide a novel nucleic acid, a vector that expresses the nucleic acid, a screening method for a substance that controls the nucleic acid, a method of detecting the expression and a mutation of the nucleic acid, and a diagnostic method or therapeutic method for a disease caused by an abnormality of mesenchymal stem cells, mast cells or the like, or a disease caused by a cell proliferation abnormality, such as cancer. | 01-27-2011 |
20110021601 | COMPOSITION CONTAINING MICRORNA-21 INHIBITOR FOR ENHANCING RADIATION SENSITIVITY - Disclosed is a radiation sensitivity-enhancing composition in which a microRNA-21 inhibitor acts as an active ingredient. The microRNA-21 inhibitor is an antisense nucleic acid molecule binding complementarily to microRNA-21. The composition can be administered to a patient in conjunction with irradiation. The inhibitor can act as a radiosensitizer, enhancing the therapeutic effect of such irradiation on cancer high in microRNA-21 expression level, particularly, glioma. | 01-27-2011 |
20110021602 | GRAFT POLYMERS FOR ENHANCED INTRACELLULAR DELIVERY OF ANTISENSE MOLECULES - Innovative graft polymers designed for the efficient delivery of antisense molecules into biological cells and for maintaining the biological activity of these molecules while in serum and other aqueous environments are provided. Such polymers may comprise an anionic graft polymer comprising an anionic polymer backbone with pendant carboxylic acid groups and pendant chains comprising amphipathic or hydrophilic polymers covalently bonded to a portion of said pendant carboxylic acid groups. Antisense molecule delivery vectors comprising such polymers in combination with cationic agents for delivery of antisense molecules are also disclosed. | 01-27-2011 |
20110021603 | TRPM-2 Antisense Therapy - It has now been determined that antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. In particular, such antisense therapy can be applied in treatment of prostate cancer and renal cell cancer. Addition of antisense TRPM-2 ODN to prostatic tumor cells in vivo is effective for delaying the onset of androgen independence. Thus, prostate cancer can be treated in an individual suffering from prostate cancer by initiating androgen-withdrawal to induce apoptotic cell death of prostatic tumor cells in the individual, and administering to the individual a composition effective to inhibit expression of TRPM-2 by the tumor cells, thereby delaying the progression of prostatic tumor cells to an androgen-independent state in an individual Combined use of antisense TRPM-2 and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer. In addition, it has also been found that antisense TRPM-2 has beneficial effect for other cancer types. Specifically, antisense TRPM-2 ODN enhances chemosensitivity in human Renal cell cancer, a normally chemoresistant disease with no active chemotherapeutic agent having an objective response rate higher than 10%. Radiation sensitivity is also enhanced when cells expressing TRPM-2 are treated with antisense TRPM-2 ODN. Thus, the antisense TRPM-2 ODNs can be used to enhance hormone sensitivity, chemosensitivity and radiation sensitivity of a variety of cancer types in which expression of TRPM-2 has been observed. | 01-27-2011 |
20110021604 | METHODS AND COMPOSITIONS FOR THE SPECIFIC INHIBITION OF KRAS BY ASYMMETRIC DOUBLE-STRANDED RNA - This invention relates to compounds, compositions, and methods useful for reducing KRAS target RNA and protein levels via use of Dicer substrate siRNA (DsiRNA) agents possessing asymmetric end structures. | 01-27-2011 |
20110021605 | MEANS AND METHODS FOR THE SPECIFIC INHIBITION OF GENES IN CELLS AND TISSUE OF THE CNS AND/OR EYE - Described is a method for the specific modulation of the expression of target genes in cells and/or tissues of the CNS and/or eye, wherein a composition comprising one or more doubled stranded oligoribonucleotides (dsRNA) is introduced into the cell, tissue or organism outside the blood-brain or blood-retina barriers. Furthermore, a method for the identification and validation of the function of a gene is provided, wherein the method provides a test cell, test tissue or test organism, which allow information to be gained on the function of the target gene. In addition, compositions and kits are described useful for those methods. In particular, components and methods for the diagnostic use and/or therapy of disorders related to the CNS and/or eye are provided which are based on RNA interference. | 01-27-2011 |
20110021606 | RNAi Modulation of RSV, PIV and Other Respiratory Viruses and Uses Thereof - The present invention is based on the in vivo demonstration that RSV and PIV can be inhibited through intranasal administration of RNAi agents as well as by parenteral administration of such agents. Further, it is shown that effective viral reduction can be achieved with more than one virus being treated concurrently. Based on these findings, the present invention provides general and specific compositions and methods that are useful in reducing RSV or PIV mRNA levels, RSV or PIV protein levels and viral titers in a subject, e.g., a mammal, such as a human. These findings can be applied to other respiratory viruses. | 01-27-2011 |
20110021607 | Methods and Compositions Relating to Carcinoma Stem Cells - MicroRNA markers of breast cancer stem cells (BCSC) are provided herein. The markers are polynucleotides that are differentially expressed in BCSC as compared to normal counterpart cells. Uses of the markers include use as targets for therapeutic intervention; as targets for drug development, and for diagnostic or prognostic methods relating to breast cancer and BCSC cell populations. BCSCs have the phenotype of having lower expression of certain miRNAs compared to normal breast epithelial cells, or to cancer cells that are not cancer stem cells. | 01-27-2011 |
20110021608 | METHODS FOR NUCLEIC ACID TRANSFER INTO CELLS - The present invention provides methods for increasing the transfer of nucleic acids into cells. In particular, the present invention provides for the use of inhibitors of HDAC6, a cytoplasmic histone deacetylase present in mammalian cells by, for example, small molecules or siRNA treatment, in increasing gene transfer and/or expression in cells in vitro and in vivo for research and gene therapy applications. | 01-27-2011 |
20110021609 | MicroRNA Signatures Associated with Cytogenetics and Prognosis in Acute Myeloid Leukemia (AML) and Uses Thereof - Methods and compositions utilizing an miRNA signature for the diagnosis, prognosis and/or treatment of leukemia associated diseases, particularly acute myeloid leukemia, are disclosed. | 01-27-2011 |
20110021610 | AROMATIC PRENYLTRANSFERASE FROM HOP - Nucleic acid molecules from hop ( | 01-27-2011 |
20110028531 | NOVEL SIRNA COMPOUNDS FOR INHIBITING RTP801 - The present invention provides chemically modified siRNA compounds that target RTP801 and pharmaceutical compositions comprising same useful for treating microvascular disorders, eye diseases, hearing impairment, neurodegenerative diseases and disorders, spinal cord injury and respiratory conditions. | 02-03-2011 |
20110028532 | Methods of treating eye diseases in diabetic patients - The present invention provides novel molecules, compositions, methods and uses for treating microvascular disorders, eye diseases and respiratory conditions based upon inhibition of the RTP801 gene and/or protein. | 02-03-2011 |
20110028533 | NOVEL FER -LIKE PROTEIN, PHARMACEUTICAL COMPOSITIONS CONTAINING IT AND METHOD FOR ITS USE - Provided is a novel Fer-like protein, referred to as “FerC” (Fer colorectal cancer). FerC is a 47kDa protein having a unique N-terminal sequence and was found to be present in six colon cancer cell-lines and in five hepatocarcinoma (liver cancer) cell-lines, but not in CCD33 normal colon epithelial cells or normal human and mouse fibroblasts. Depletion of FerC impairs cell-cycle progression and induces apoptotic death in treated colon cancer (CC) cells. Also provided are nucleotide sequences that are antisense to at least a portion of the N-terminal sequence, short interfering nucleotides including such an antisense sequence, as well as pharmaceutical compositions containing an antisense sequence. The present pharmaceutical composition may be used in the treatment of cancer, in particular, colorectal cancer and liver cancer. | 02-03-2011 |
20110028534 | RNAi INHIBITION OF CTGF FOR TREATMENT OF OCULAR DISORDERS - RNA interference is provided for inhibition of connective tissue growth factor mRNA expression in ocular disorders involving CTGF expression. Ocular disorders involving aberrant CTGF expression include glaucoma, macular degeneration, diabetic retinopathy, choroidal neovascularization, proliferative vitreoretinopathy and wound healing. Such disorders are treated by administering interfering RNAs of the present invention. | 02-03-2011 |
20110028535 | OLIGONUCLEOTIDES-TRANSFERRING PREPARATIONS - Preparations for transferring efficiently oligonucleotides necessary in antisense therapy or the like into animal cells so as to be useful in treatment for various diseases, which comprises a collagen as an essential component are provided. | 02-03-2011 |
20110034532 | Modulation of T Cell Signaling Threshold and T Cell Sensitivity to Antigens - MicroRNAs (miRNAs) are a diverse and abundant class of ˜22-nucleotide (nt) endogenous regulatory RNAs that play a variety of roles in animal cells by controlling gene expression at the posttranscriptional level. Increased miR-181a expression in mature T cells is shown to cause a marked increase in T cell activation and augments T cell sensitivity to peptide antigens. Moreover, T cell blasts with higher miR-181a expression become reactive to antagonists. The effects of miR-181a on antigen discrimination are in part achieved by dampening the expression of multiple negative regulators in the T cell receptor (TCR) signaling pathway, including PTPN22 and the dual specificity phosphatases DUSP5 and DUSP6. This results in a reduction in the TCR signaling threshold, thus quantitatively and qualitatively enhancing T cell sensitivity to antigens. | 02-10-2011 |
20110034533 | COMPOSITIONS AND METHODS MODULATING MG29 FOR THE TREATMENT OF DIABETES - Disclosed herein are compositions and methods for treatment of muscle dysfunction, including diabetes. In addition, the invention relates to therapeutic compositions comprising nucleotides and/or polypeptides of the invention in combination with a pharmaceutically acceptable carrier, wherein the composition facilitates the treatment of skeletal muscle disorders. Moreover, the invention relates to the treatment and/or prevention of pathological conditions associated with altered intracellular Ca2+ regulation and disrupted membrane structure that occurs when the expression levels of MG29 are reduced. | 02-10-2011 |
20110034534 | siRNA compounds and methods of use thereof - The present invention relates to compounds, pharmaceutical compositions comprising same and methods of use thereof for the inhibition of certain genes, including SOX9, ASPP1, CTSD, CAPNS1, FAS and FAS ligand. The compounds and compositions are useful in the treatment of subjects suffering from diseases or conditions and or symptoms associated with diseases or conditions in which gene expression has adverse consequences. | 02-10-2011 |
20110034535 | POSITIVE CONTROLS FOR EXPRESSION MODULATING EXPERIMENTS - The invention pertains to the use of an apoptosis inducing combination of at least a. a first expression modulating compound silencing the expression of at least a first target gene involved in apoptosis and b. a second expression modulating compound silencing the expression of at least a second target gene involved in apoptosis as a positive control in expression modulating assays. Also provided are suitable methods, kits and compositions. | 02-10-2011 |
20110034536 | CONTROLLING THE POTENTIAL OF PRIMATE NEURAL STEM CELLS BY REGULATING PAX6 - A transcription factor both necessary and sufficient for human neuroectoderm specification, Pax6, as well as applications thereof, is disclosed. | 02-10-2011 |
20110034537 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF CD45 GENE - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the CD45 gene. | 02-10-2011 |
20110034538 | MicroRNA-Based Methods and Compositions for the Diagnosis, Prognosis and Treatment of Gastric Cancer - Methods and compositions for the diagnosis, prognosis and/or treatment of gastric cancer associated diseases are disclosed. | 02-10-2011 |
20110039909 | METHODS AND MATERIALS FOR REDUCING GLI2 EXPRESSION - Methods and materials for reducing expression of GLI2 are disclosed including nucleic acid molecules such as short hairpin RNAs that direct cleavage of GLI2 encoding transcripts and the use of such molecules for reducing prostate cancer cell growth. | 02-17-2011 |
20110039910 | MODULATION OF APOLIPOPROTEIN (A) EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of apolipoprotein(a). The compositions comprise oligonucleotides, targeted to nucleic acid encoding apolipoprotein(a). Methods of using these compounds for modulation of apolipoprotein(a) expression and for diagnosis and treatment of disease associated with expression of apolipoprotein(a) are provided. | 02-17-2011 |
20110039911 | METHOD OF INHIBITING NONSENSE-MEDIATED mRNA DECAY - Provided are methods for treating a NAD comprising administering to a patient suffering from a NAD a composition comprising an eIF5A inhibitor compound in an amount effective to prevent intracellular hypusination of eIF5A, whereby gene expression of NMD-susceptible mRNA is increased. | 02-17-2011 |
20110039912 | Therapeutic Agent for Neuroblastoma Targeting ARID3b - It is intended to provide a therapeutic agent for neuroblastoma. More particularly, it is intended to provide the therapeutic agent for neuroblastoma containing an ARID3b inhibitor. | 02-17-2011 |
20110039913 | ANTISENSE MODULATION OF HYDROXYSTEROID 11-BETA DEHYDROGENASE 1 EXPRESSION - Antisense compounds, compositions and methods are provided for modulating the expression of hydroxysteroid 11-beta dehydrogenase 1. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding hydroxysteroid 11-beta dehydrogenase 1. Methods of using these compounds for modulation of hydroxysteroid 11-beta dehydrogenase 1 expression and for treatment of diseases associated with expression of hydroxysteroid 11-beta dehydrogenase 1 are provided. | 02-17-2011 |
20110039914 | MODIFIED RNAI POLYNUCLEOTIDES AND USES THEREOF - The invention relates to improved RNAi constructs and uses thereof. The construct has a double stranded region of 19-49 nucleotides, preferably 25, 26, or 27 nucleotides, and preferably blunt-ended. The construct has selective minimal modifications to confer an optimal balance of biological activity, toxicity, stability, and target gene specificity. For example, the sense strand may be modified (e.g., one or both ends of the sense strand is/are modified by four 2′-O-methyl groups), such that the construct is not cleaved by Dicer or other RNAse III, and the entire length of the antisense strand is loaded into RISC. In addition, the antisense strand may also be modified by 2′-O-methyl group at the 2nd 5′-end nucleotide to greatly reduce off-target silencing. The constructs of the invention largely avoids the interferon response and sequence-independent apoptosis in mammalian cells, exhibits better serum stability, and enhanced target specificity. | 02-17-2011 |
20110039915 | IMMUNOSTIMULATORY siRNA MOLECULES - The present invention relates to a double-stranded siRNA molecule that is capable of silencing gene expression as well as inducing an immune response. The molecule comprises a sense strand and an antisense strand, wherein the antisense strand comprises a first nucleotide sequence that is specifically complementary to mRNA transcribed from a target gene, and the sense strand comprises a second nucleotide sequence that is substantially or perfectly complementary to the antisense strand with the exception that the second nucleotide sequence comprises at least one immunostimulatory motif comprising two or more non-complementary nucleotides. Such a molecule may be utilized in a method of treating or preventing a disease or condition (such as a viral infection, a bacterial infection, or cancer) in a subject. | 02-17-2011 |
20110046200 | Use of antisense oligonucleotides to effect translation modulation - The present invention provides methods for modulating translation of an mRNA using antisense oligonucleotides. The methods result in the stimulation or inhibition of a change in reading frame or stop codon readthrough during translation. | 02-24-2011 |
20110046201 | METHODS AND COMPOSITIONS FOR SEAMLESS CLONING OF NUCLEIC ACID MOLECULES - The present invention is in the fields of biotechnology and molecular biology. More particularly, the present invention relates to cloning or subcloning one or more nucleic acid molecules comprising one or more type IIs restriction enzyme recognition sites. The present invention also embodies cloning such nucleic acid molecules using recombinational cloning methods such as those employing recombination sites and recombination proteins. The present invention also relates to nucleic acid molecules (including RNA and iRNA), as well as proteins, expressed from host cells produced using the methods of the present invention. | 02-24-2011 |
20110046202 | METHOD FOR TESTING A SUBJECT THOUGHT TO HAVE OR TO BE PREDISPOSED TO ASTHMA - The present invention concerns a method of testing a subject thought to have or be predisposed to having asthma, allergy, atopic disease or atopic sensitization, which comprises the step of analyzing a biological sample from said subject for (i) detecting the presence of a mutation associated with the over-expression of the ORMDL3 gene, and/or (ii) analyzing the expression of the ORMDL3 gene; a use, for treating and/or preventing asthma, allergy, atopic disease or atopic sensitization in a subject, of a compound which specifically inhibits the expression of the ORMDL3 gene; and an in vitro method of selecting a compound, which can be useful for treating asthma, allergy, atopic disease or atopic sensitization, characterized in that said method comprises the steps of: (a) obtaining a cell expressing the ORMDL3 gene, (b) contacting said cell with at least one compound, (c) comparing the expression of the ORMDL3 gene in the cell between the steps a) and b), and (d) selecting the compound, which induces a lower level of expression of the ORMDL3 gene in the cell contacted to that compound. | 02-24-2011 |
20110046203 | ANTISENSE OLIGONUCLEOTIDES FOR INDUCING EXON SKIPPING AND METHODS OF USE THEREOF - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202. | 02-24-2011 |
20110054003 | ANTISENSE OLIGONUCLEOTIDE MODULATION OF STAT3 EXPRESSION - Compounds, compositions and methods are provided for inhibiting the expression of human STAT3. The compositions comprise antisense oligonucleotides targeted to nucleic acids encoding STAT3. Methods of using these oligonucleotides for inhibition of STAT3 expression and for promotion of apoptosis are provided. Methods for treatment of diseases, particularly inflammatory diseases and cancers, associated with overexpression or constitutive activation of STAT3 or insufficient apoptosis are also provided. | 03-03-2011 |
20110054004 | METHOD FOR REDUCING SCARRING DURING WOUND HEALING USING ANTISENSE COMPOUNDS DIRECTED TO CTGF - This invention provides a method for reducing hypertropic scarring resulting from dermal wound healing in a subject in need which comprises administering to the subject an antisense oligonucleotide which inhibits expression of connective tissue growth factor (CTGF) in an amount effective to inhibit expression of CTGF and thereby reduce hypertrophic scarring. | 03-03-2011 |
20110054005 | Polynucleotides for causing RNA interference and method for inhibiting gene expression using the same - The present invention provides a polynucleotide that not only has a high RNA interference effect on its target gene, but also has a very small risk of causing RNA interference against a gene unrelated to the target gene. A sequence segment conforming to the following rules (a) to (d) is searched from the base sequences of a target gene for RNA interference and, based on the search results, a polynucleotide capable of causing RNAi is designed, synthesized, etc.:
| 03-03-2011 |
20110054006 | REGULATION OF ONCOGENES BY MICRORNAS - Naturally occurring miRNAs that regulate human oncogenes and methods of use thereof are described. Suitable nucleic acids for use in the methods and compositions described herein include, but are not limited to, pri-miRNA, pre-miRNA, mature miRNA or fragments of variants thereof that retain the biological activity of the mature miRNA and DNA encoding a pri-miRNA, pre-miRNA, mature miRNA, fragments or variants thereof, or regulatory elements of the miRNA. The compositions are administered to a subject prior to administration of a cytotoxic therapy in an amount effective to sensitize cells or tissues to be treated to the effects of the cytotoxic therapy. | 03-03-2011 |
20110054007 | COMPOSITIONS AND METHODS TO CONTROL INSECT PESTS - Methods and compositions are provided which employ a silencing element that, when ingested by a pest, such as a Coleopteran plant pest or a | 03-03-2011 |
20110054008 | RNAi Inhibition of Serum Amyloid A For Treatment of Glaucoma - RNA interference is provided for inhibition of serum amyloid A mRNA expression in glaucomas involving SAA expression. | 03-03-2011 |
20110054009 | MicroRNA-Based Methods and Compositions for the Diagnosis, Prognosis and Treatment of Prostate Related Disorders - Methods and compositions for the diagnosis, prognosis and/or treatment of prostate associated disorders are disclosed. | 03-03-2011 |
20110060027 | Aptamer Therapeutics Useful in the Treatment of Complement-Related Disorders - The invention provides nucleic acid therapeutics and methods for using these nucleic acid therapeutics in the treatment of complement-related disorders. | 03-10-2011 |
20110060028 | COMBINATION THERAPY - This disclosure relates to a SIRT1 polypeptide and a treatment regime that inhibits the activity of SIRT1 and including a method of diagnosis. | 03-10-2011 |
20110060029 | METHOD OF TREATING CANCER BY MODULATING EPAC - Methods of treating cancer by preventing, mitigating, and/or inhibiting cancer metastasis in tumors expressing Epac by inhibiting the activity of exchange proteins directly activated by cyclic AMP (Epac) or one or more proteins within the Epac-induced carcinoma migration pathway. | 03-10-2011 |
20110060030 | MODULATION OF APOLIPOPROTEIN C-III EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of apolipoprotein C-III. The compositions comprise oligonucleotides, targeted to nucleic acid encoding apolipoprotein C-III. Methods of using these compounds for modulation of apolipoprotein C-III expression and for diagnosis and treatment of disease associated with expression of apolipoprotein C-III are provided | 03-10-2011 |
20110060031 | Compositions And Methods For Inhibiting Expression Of A Gene From The Ebola Virus - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a gene from the Ebola virus. | 03-10-2011 |
20110060032 | LIPID ENCAPSULATING INTERFERING RNA - The present invention provides lipid-based formulations for delivering, e.g., introducing, nucleic acid-lipid particles comprising an interference RNA molecule to a cell, and assays for optimizing the delivery efficiency of such lipid-based formulations. | 03-10-2011 |
20110060033 | FERTILITY RESTORER GENE AND FERTILITY RESTORATION METHOD FOR CW-TYPE MALE STERILE CYTOPLASM OF RICE - Mainly provided is a technique for directly identifying the genotype at locus Rf17 based on the specific base sequence data thereof. Also provided is a technique for artificially constructing a fertility-restored line. A method of restoring the fertility of CW-type cytoplasmic male sterile rice by inhibiting or reducing the expression of a gene comprising the base sequence represented by SEQ ID NO:2 in the above-described rice, and a method for determining the presence or absence of gene Rf17, which is a fertility restorer gene for CW-type cytoplasmic male sterility, comprising identifying a single nucleotide polymorphism (SNP) in the base at the 1812 position of the base sequence represented by SEQ ID NO:1 in the rice to be examined. | 03-10-2011 |
20110065770 | Formulations comprising antisense nucleotides to connexins - A therapeutic and/or cosmetic formulation comprising at least one anti-sense polynucleotide to a connexin protein together with a pharmaceutically acceptable carrier or vehicle is useful in site specific down regulation of connexin protein expression, particularly in reduction of neuronal cells death, wound healing, reduction of inflammation, decrease of scar formation and skin rejuvenation and thickening. | 03-17-2011 |
20110065771 | INFLAMMATORY BOWEL DISEASE THERAPIES - The invention relates to methods of treating inflammatory bowel disease in a subject. Methods of promoting intestinal barrier function as well as related compositions are also provided. | 03-17-2011 |
20110065772 | TREATMENT OF RHEUMATOID ARTHRITIS - The present invention provides a method for treating or inhibiting rheumatoid arthritis in a subject, the method comprising administering to the subject a therapeutically effective amount of a nucleic acid which decreases the level of c-Jun mRNA, c-Jun mRNA translation or nuclear accumulation or activity of c-Jun protein. | 03-17-2011 |
20110065773 | RNA INTERFERENCE MEDIATING SMALL RNA MOLECULES - Double-stranded RNA (dsRNA) induces sequence-specific post-transcriptional gene silencing in many organisms by a process known as RNA interference (RNAi). Using a | 03-17-2011 |
20110065774 | CHEMICALLY MODIFIED OLIGONUCLEOTIDES AND USES THEREOF - This invention relates generally to chemically oligonucleotides (e.g., modified oligonucleotides) useful for augmenting activity of a target gene. | 03-17-2011 |
20110065775 | COMPOUNDS AND METHODS FOR MODULATING EXPRESSION OF SGLT2 - The present disclosure describes short antisense compounds, including such compounds comprising chemically-modified high-affinity monomers 8-16 monomers in length. Certain such short antisense compound are useful for the reduction of target nucleic acids and/or proteins in cells, tissues, and animals with increased potency and improved therapeutic index. Thus, provided herein are short antisense compounds comprising high-affinity nucleotide modifications useful for reducing a target RNA in vivo. Such short antisense compounds are effective at lower doses than previously described antisense compounds, allowing for a reduction in toxicity and cost of treatment. In addition, the described short antisense compounds have greater potential for oral dosing. | 03-17-2011 |
20110065776 | Method for Treating Hepatitis C Infection - The present invention relates to a method for treating hepatitis C virus (HCV) infection, comprising administrating a subject in need thereof with a therapeutically effective amount of an inhibitor against a serine/threonine kinase (AKT) and an activator thereof. A method for screening a candidate agent for treating hepatitis C infection determined by the presence of an inhibition of AKT function is also provided. | 03-17-2011 |
20110065777 | DOUBLE-STRANDED RNA (dsRNA) AND METHOD OF USE FOR INHIBITING EXPRESSION OF A FUSION GENE - Specific inhibition of expression of a fusion gene in mammals occurs using a short, double-stranded ribonucleic acid molecule (dsRNA). The dsRNA comprises two separate non-linked RNA strands, an 51 strand and a complementary strand. The strands are 20 to 23 nucleotides in length, and the 51 strand is complementary to the fusion junction of the AML-1/MTG-8 fusion gene. The dsRNA also comprises at least 3 nucleotides on each side of the fusion junction. The dsRNA can be introduced into and maintained in a mammalian cell under conditions and for a time sufficient to obtain degradation of mRNA of the fusion gene to inhibit expression of the fusion gene. The dsRNAs and methods described are useful for treating diseases caused by chromosomal aberrations, particularly malignant diseases such as lymphoma and leukemia. | 03-17-2011 |
20110065778 | RNA Interference Mediated Inhibition of Muscarinic Colinergic Receptor Gene Expression Using Short Interfering Nucleic Acid (siNA) - The present invention relates to compounds, compositions, and methods useful for modulating the expression of genes associated with respiratory and pulmonary disease, such as cholinergic muscarinic receptor genes, using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of cholinergic muscarinic receptor genes, or other genes involved in pathways of cholinergic muscarinic receptor gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of M3 muscarinic acetylcholine receptor or cholinergic receptor muscarinic 3 (CHRM3). | 03-17-2011 |
20110071208 | LIPID ENCAPSULATED DICER-SUBSTRATE INTERFERING RNA - The present invention provides novel, stable nucleic acid-lipid particles comprising one or more Dicer-substrate dsRNAs and/or small hairpin RNAs (shRNAs), methods of making the particles, and methods of delivering and/or administering the particles (e.g., for the treatment of a disease or disorder). In some embodiments, the nucleic acid-lipid particles of the invention comprise Dicer-substrate dsRNAs and/or shRNAs. In other embodiments, the nucleic acid-lipid particles of the invention comprise Dicer-substrate dsRNAs and/or shRNAs in combination with one or more additional interfering RNAs (e.g., siRNA, aiRNA, and/or miRNA). In further embodiments, the Dicer-substrate dsRNAs and/or shRNAs present in the nucleic acid-lipid particles of the invention are chemically synthesized. | 03-24-2011 |
20110071209 | RNAi Modulation of the RHO-A Gene and Uses Thereof - The invention relates to compositions and methods for modulating the expression of the RhoA gene, and more particularly to the downregulation of RhoA by chemically modified oligonucleotides. | 03-24-2011 |
20110071210 | METHODS AND COMPOSITIONS FOR THE TREATMENT OF CANCER OR OTHER DISEASES - The present invention relates to methods and compositions for the treatment of diseases, including cancer, infectious diseases and autoimmune diseases. The present invention also relates to methods and compositions for improving immune function. More particularly, the present invention relates to multifunctional molecules that are capable of being delivered to cells of interest for the treatment of diseases and for the improvement in immune function. | 03-24-2011 |
20110071211 | MicroRNA (miRNA) And Downstream Targets For Diagnostic And Therapeutic Purposes - The present invention relates to a promoter region of a microRNA, the use of a microRNA, in particular miR-21, and related elements for the diagnosis and for the manufacture of a medicament for the treatment and/or prevention of fibrosis and/or fibrosis related diseases. Additionally, the invention concerns antisense oligonucleotides against targets of miR-21. A cell deficient for miR-21, the promoter region and targets of miR-21 and a knock-out organism thereof are also encompassed. Finally, the invention is directed to a method for diagnosing fibrosis and/or fibrosis related diseases and to a method for screening a pharmaceutically active compound for the treatment of fibrosis and/or fibrosis related diseases. The present invention further relates to compositions for use in the treatment, amelioration, and/or prevention of fibrosis. In certain embodiments, the compositions modulate the activity of a miRNA for the treatment, amelioration, and/or prevention of fibrosis. In certain embodiments, the compositions inhibit the activity of miR-21 for the treatment, amelioration, and/or prevention of fibrosis. | 03-24-2011 |
20110077283 | MOLECULAR TARGETS AND COMPOUNDS, AND METHODS TO IDENTIFY THE SAME, USEFUL IN THE TREATMENT OF NEURODEGENERATIVE DISEASES - The present invention relates to methods and assays for identifying agents capable of inhibiting the mutant huntingtin protein, inhibiting or reducing polyglutamine-induced protein aggregation, and/or altering huntingtin protein conformation, which inhibition is useful in the prevention, amelioration and/or treatment of neurodegenerative diseases, and protein aggregation diseases more generally. In particular, the present invention provides methods and assays for identifying agents for use in the prevention and/or treatment of Huntington's disease. The invention provides polypeptide and nucleic acid TARGETs and siRNA sequences based on these | 03-31-2011 |
20110077284 | DRY POWDER COMPOSITIONS FOR RNA INFLUENZA THERAPEUTICS - A dry powder formulation for delivery to a mammal by inhalation, the formulation comprising particles comprising a lipid, a carrier, and one or more double-stranded siRNA molecules or dicer-active precursors targeted to influenza virus A method for treating or preventing influenza in a mammal comprising administering a therapeutically-effective amount of a dry powder formulation. | 03-31-2011 |
20110077285 | RNA ANTAGONIST COMPOUNDS FOR THE MODULATION OF PIK3CA EXPRESSION - The invention relates to oligomeric compounds (oligomers), which target PIK3CA mRNA in a cell, leading to reduced expression of PIK3CA. Reduction of PIK3CA expression is beneficial for the treatment of certain medical disorders, such as hyperproliferative diseases (e.g., cancer). The invention provides therapeutic compositions that include the oligomers and methods for modulating the expression of PIK3CA using the oligomers, including methods of treatment. | 03-31-2011 |
20110077286 | OLIGONUCLEOTIDE DUPLEXES COMPRISING DNA-LIKE AND RNA-LIKE NUCLEOTIDES AND USES THEREOF - Novel oligonucleotide pairs which can form a duplex comprising one or more DNA-like nucleotides (e.g., 2′-substituted arabinonucleotides (ANA)); in combination with one or more RNA-like nucleotides (e.g., 2′-substituted ribonucleotides (RNA) and/or locked nucleic acid nucleotides (LNA)), are disclosed. The use of such oligonucleotide duplexes, such as for silencing the expression of a nucleic acid or gene of interest using small interfering RNA (siRNA) technologies, is also disclosed. | 03-31-2011 |
20110082185 | CANCER-TESTIS GENE SILENCING AGENTS AND USES THEREOF - The invention relates to methods, formulations and kits useful for inhibiting cancer cell viability, invasion, or migration. | 04-07-2011 |
20110082186 | COMPOSITIONS FOR INHIBITING GENE EXPRESSION AND USES THEREOF - The inventors have examined the means for providing more efficacious gene expression blocking compounds. The inventors have discovered new structural features that surprisingly improve the efficacy of gene expression blocking molecules. These features include the presence of multiple 3′ ends and a linker at the 5′ ends. Surprisingly, these features improve the efficacy of the gene expression blocking compounds in a manner that decreases the compound's biologic instability. Even more surprisingly, this effect has been found to be applicable to both DNA and RNA oligonucleotide-based compounds and to have application in traditional antisense and RNAi technologies. | 04-07-2011 |
20110082187 | MARKERS AND METHODS RELATING TO THE ASSESSMENT OF ALZHEIMER'S DISEASE - Use of clusterin as a biomarker of Alzheimer's disease (AD), particularly methods and compositions for detection of clusterin in a biological sample and assessment of in vivo pathology, disease severity and rate of clinical progression in a subject having or suspected of having AD. | 04-07-2011 |
20110082188 | GENE EXPRESSION PROFILING OF INFLAMMATORY BOWEL DISEASE - The present invention relates to methods for identifying and/or classifying patients with inflammatory bowel diseases (IBD), particularly patients with Crohn's disease or ulcerative colitis. Gene expression profiling shows broad and fundamental differences in the pathogenic mechanism of UC and CD. The subject method is based on the findings that certain genes are differentially expressed in intestinal tissue of IBD patients compared with related normal cells, such as normal colon cells. That change can be used to identify or classify IBD cells by the upregulation and/or downregulation of expression of particular genes, alterations in protein levels or modification, or changes at the genomic level (such as mutation, methylation, etc), e.g., an event which is implicated in the pathology of inflammatory bowel diseases. | 04-07-2011 |
20110086901 | OLIGONUCLEOTIDES AFFECTING EXPRESSION OF PHOSPHODIESTERASES - The invention relates to therapeutic antisense oligonucleotides directed against genes encoding phosphodiesterases (PDE) and the use of these antisense oligonucleotides in combination. These antisense oligonucleotides may be used as analytical tools and/or as therapeutic agents in the treatment of disease associated with reduced cellular cAMP in a patient, such as inflammatory diseases of the respiratory tract including, for example, asthma, chronic obstructive pulmonary disease (COPD), acute respiratory distress syndrome, bronchitis, chronic bronchitis, silicosis, pulmonary fibrosis, lung allograft rejection, allergic rhinitis and chronic sinusitis as well as other conditions in which an increase in cyclic AMP or a decrease in PDE levels is beneficial. | 04-14-2011 |
20110086902 | COMPOUNDS FOR THE MODULATION OF BETA-CATENIN EXPRESSION - The invention relates to oligomer compounds (oligomers), which target beta-catenin mRNA in a cell, leading to reduced expression of beta-catenin. Reduction of beta-catenin expression is beneficial for a range of medical disorders, such as hyperproliferative disorders, such as cancer. The invention provides therapeutic compositions comprising oligomers and methods for modulating the expression of beta-catenin using said oligomers, including methods of treatment. | 04-14-2011 |
20110086903 | EMERGENCE OF A R-TYPE CA2+ CHANNEL (CAV 2.3) CONTRIBUTES TO CEREBRAL ARTERY CONSTRICTION FOLLOWING SUBARACHNOID HEMORRHAGE - The invention relates to methods and products for treatment of a neurological defect such as a subarachnoid hemorrhage or cerebral vasospasm. Specifically, R-type voltage-gated calcium channel inhibitors and related compositions and kits are described. | 04-14-2011 |
20110092565 | METHOD OF TREATING NEURODEGENERATIVE DISEASE - Aspects featured in the invention relate to compositions and methods for inhibiting alpha-synuclein (SNCA) gene expression, such as for the treatment of neurodegenerative disorders. An anti-SNCA agent featured herein that targets the SNCA gene can have been modified to alter distribution in favor of neural cells. | 04-21-2011 |
20110092566 | Treatment of cancer with aldose reductase inhibitors - Provided herein are methods of treating a pathophysiological state or symptoms thereof resulting from aldose reductase-mediated signaling in a cytotoxic pathway in a subject using an inhibitor of aldose reductase. Particularly, specific inhibitors may be small molecules such as fidarestat or siRNA. Also, methods of treating breast and prostate cancers or suppressing metastasis of colon cancer thereof using the siRNAs and aldose reductase inhibitors are provided. | 04-21-2011 |
20110092567 | Cannabinoid 2 (Cb2) Receptor Gene Promoter and Unique RNA Transcripts in B Cells and Methods of Use - Cannabinoid receptor 2 (CB | 04-21-2011 |
20110092568 | MODULATION OF MLCK-L EXPRESSION AND USES THEREOF - In various aspects and embodiments the invention provides methods and reagents for controlling gene expression, and for treating disorders and diseases. Embodiments provide methods and reagents specifically for the regulation of MLCK expression and for the use thereof in treating disorders and diseases. Various embodiments provide methods and reagents for specifically down regulating the expression of MLCK-L more efficiently than that of MLCK-S, and for the use thereof in treating disorders and diseases. Embodiments provide siNA for the same, particularly siRNAs. Various of the embodiments are useful for the treatment of inflammatory disorders and diseases, including, for one example in the regard, Asthma. | 04-21-2011 |
20110092569 | Administration of Exogenous mi/siRNA - Certain genes controlled by endogenous miRNA are actually upregulated upon the transfection of exogenous mi/siRNA. Based on this, methods of determining whether administration of mi/siRNA will have a deleterious effect by upregulating certain genes are provided. Comparison of sequences of exogenous mi/siRNA allows selection of exogenous miRNA to be administered to cell to enhance or limit this affect, and therefore to control unwanted disregulation, or to upregulate an endogenous miRNA-regulated gene of interest. | 04-21-2011 |
20110092570 | OLIGOMERIC COMPOUNDS COMPRISING TRICYCLIC NUCELOSIDES AND METHODS FOR THEIR USE - The present disclosure provides tricyclic nucleosides, oligomeric compounds comprising at least one of the tricyclic nucleosides and methods of using the oligomeric compounds. The methods provided herein include contacting a cell or administering to an animal at least one of the oligomeric compounds. In certain embodiments, the oligomeric compounds hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA. | 04-21-2011 |
20110092571 | COMPOSITIONS AND METHODS FOR SIRNA INHIBITION OF ICAM-1 - RNA interference using small interfering RNAs which are specific for the ICAM-1 gene inhibits expression of this gene. Diseases which involve ICAM-1-mediated cell adhesion, such as inflammatory and autoimmune diseases, diabetic retinopathy and other complications arising from type I diabetes, age related macular degeneration and many types of cancer, can be treated by administering the small interfering RNAs. | 04-21-2011 |
20110092572 | MODULATION OF GROWTH HORMONE RECEPTOR EXPRESSION AND INSULIN-LIKE GROWTH FACTOR EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of growth hormone receptor and/or insulin like growth factor-I (IGF-I). The compositions comprise oligonucleotides, targeted to nucleic acid encoding growth hormone receptor. Methods of using these compounds for modulation of growth hormone receptor expression and for diagnosis and treatment of disease associated with expression of growth hormone receptor and/or insulin-like growth factor-I are provided. Diagnostic methods and kits are also provided. | 04-21-2011 |
20110092573 | MODIFICATION OF MYD88 SPLICING USING MODIFIED OLIGONUCLEOTIDES - Antisense compounds, compositions and methods are provided for modulating the expression of MyD88. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding MyD88. Methods of using these compounds for modulation of MyD88 expression and for treatment of diseases associated with expression of MyD88 are provided. | 04-21-2011 |
20110092574 | mRNA Cap Analogs - Dinucleotide cap analogs are disclosed, modified at different phosphate positions with a boranophosphate group or a phosphoroselenoate group. The analogs are useful as reagents in the preparation of capped mRNAs and have increased stability both in vitro and in vivo. They may be used as inhibitors of cap-dependent translation. Optionally, the boranophosphate or phosphoroselenoate group has a 2′-O or 3′-O-alkyl group, preferably a methyl group, producing analogs called BH | 04-21-2011 |
20110098337 | Inhibitors of RTP801 and their use in disease treatment - The present invention provides novel molecules, compositions, methods and uses for treating microvascular disorders, eye diseases respiratory conditions and hearing disorders based upon inhibition of the RTP801 gene and/or protein. | 04-28-2011 |
20110098338 | RNA Interference for the Treatment of Heart Failure - The present invention relates to targeted RNAi for the treatment of heart failure by modulating defective cardiac Ca | 04-28-2011 |
20110098339 | C2ORF18 AS TARGET GENE FOR CANCER THERAPY AND DIAGNOSIS - Described herein are objective methods for detecting or diagnosing a predisposition to developing cancer, particularly pancreatic cancer. In one embodiment, the diagnostic method involves the step of determining an expression level of C2orf18 using anti-C2orf18 antibody. The present invention further provides methods of screening for therapeutic agents useful in the treatment of a C2orf18-associated disease, such as a cancer, e.g. pancreatic cancer, methods of inhibiting the cell growth and treating or alleviating their symptom. The invention also features products, such as polynucleotides, polypeptides, and vectors double-stranded molecules, antibodies, vectors and compositions composed thereof. | 04-28-2011 |
20110098340 | ANTISENSE MODULATION OF BCL2-ASSOCIATED X PROTEIN EXPRESSION - Antisense compounds, compositions and methods are provided for modulating the expression of BCL2-associated X protein. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding BCL2-associated X protein. Methods of using these compounds for modulation of BCL2-associated X protein expression and for treatment of diseases associated with expression of BCL2-associated X protein are provided. | 04-28-2011 |
20110098341 | USE OF ID4 FOR DIAGNOSIS AND TREATMENT OF CANCER - The invention relates to a method of determining whether a human subject is suffering from or at risk for developing pancreatic cancer by determining the methylation level of an ID4 gene promoter or the expression level of an ID4 gene in a biological sample from a human subject. Also disclosed are a method of analyzing the methylation level of an ID4 gene promoter or the expression level of an ID4 gene in a pancreatic cancer cell, and a method of inhibiting the methylation of an ID4 gene promoter or enhancing the expression of an ID4 gene by contacting a pancreatic cancer cell with a compound that decreases the methylation level of an ID4 gene promoter or increases the expression level of an ID4 gene in the cell. | 04-28-2011 |
20110098342 | METHODS OF DETECTING LONG RANGE CHROMOSOMAL INTERACTIONS - The present invention relates to a method of monitoring epigenetic changes comprising monitoring changes in conditional long range chromosomal interactions at at least one chromosomal locus where the spectrum of long range interaction is associated with a specific physiological condition, the method comprising the steps of: —(i) in vitro crosslinking of said long range chromosomal interactions present at the at least one chromosomal locus; (ii) isolating the cross linked DNA from said chromosomal locus; (iii) subjecting said cross linked DNA to restriction digestion with an enzyme that cuts at least once within the at least one chromosomal locus; (iv) ligating said cross linked cleaved DNA ends to form DNA loops; (v) identifying the presence of said DNA loops; wherein the presence of DNA loops indicates the presence of a specific long range chromosomal interaction. | 04-28-2011 |
20110098343 | Antisense Formulation - A room temperature stable and minimal aggregate liquid formulation comprises an oligonucleotide comprising Seq ID No. 1: or comprising a variant oligonucleotide in which no more than 3 non-sequential bases are different from Seq. ID NO. 1 and an aqueous carrier comprising a aggregation-preventing compound selected from the group consisting of mono and disaccharides and/or sugar alcohols. | 04-28-2011 |
20110098344 | DRUG CARRIER - A drug carrier characterized by mainly containing a polyethylene-glycol-modified phospholipid and a cationic lipid and containing the polyethylene-glycol-modified phospholipid in a concentration within a specific range. The drug carrier, which is of the in-blood residence type, is characterized by comprising a polyethylene-glycol-modified phospholipid represented by the following general formula (I) or a pharmaceutically acceptable salt thereof: | 04-28-2011 |
20110105582 | Composition for inhibiting function of human flt3 - To provide a means of controlling the function of Flt3. A composition for inhibiting the function of human Flt3, a method of inducing apoptosis by using the composition, and a kit for the method. | 05-05-2011 |
20110105583 | METHODS OF USING MIR34 AS A BIOMARKER FOR TP53 FUNCTIONAL STATUS - In one aspect, the invention generally relates to use of miR-34 as a biomarker to estimate TP53 function in a cell. In another aspect, the invention generally relates to multiple uses of miR-34 and siRNAs functionally and structurally related to miR-34 for the treatment of cancer. | 05-05-2011 |
20110105584 | RTP80IL SIRNA COMPOUNDS AND METHODS OF USE THEREOF - The invention provides chemically modified siRNA oligonucleotides that target RTP801L, compositions comprising same and to the use of such molecules to treat, inter alia, respiratory diseases including acute and chronic pulmonary disorders, eye diseases including glaucoma and ION, microvascular disorders, angiogenesis- and apoptosis-related conditions, and hearing impairments. | 05-05-2011 |
20110105585 | METHODS FOR DIAGNOSING AND TREATING SQUAMOUS CELL CARCINOMA UTILIZING miRNA-205 AND INHIBITORS THEREOF - Disclosed are diagnostic and therapeutic methods related to squamous cell carcinoma. In particular, the diagnostic methods relate to detecting miRNA-205, thereby diagnosing an aggressive form of squamous cell carcinoma. The therapeutic methods relate to inhibiting the function of miRNA-205, thereby treating an aggressive form of squamous cell carcinoma. | 05-05-2011 |
20110105586 | COMPOSITIONS AND THEIR USES DIRECTED TO GEMIN GENES - Disclosed herein are compounds, compositions and methods for modulating the expression of a Gemin Gene. Also provided are methods of target validation. Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and disorders. | 05-05-2011 |
20110105587 | TARGET SEQUENCES AND METHODS TO IDENTIFY THE SAME, USEFUL IN TREATMENT OF NEURODEGENERATIVE DISEASES - The present invention relates to methods and assays for identifying agents capable of inhibiting the mutant huntingtin protein, inhibiting or reducing cell death, in particular cell death associated with polyglutamine-induced protein aggregation, which inhibition is useful in the prevention, amelioration and/or treatment of neurodegenerative diseases, and Huntington's disease more generally. In particular, the present invention provides methods and assays for identifying agents for use in the prevention and/or treatment of Huntingtons disease. The invention provides polypeptide and nucleic acid TARGETs and siRNA sequences based on these TARGETS. | 05-05-2011 |
20110105588 | COMPOSITIONS COMPRISING NOTCH1 SIRNA AND METHODS OF USE THEREOF - The present invention provides siRNA nucleic acid molecules that inhibit Notch1 expression. Methods of using the nucleic acid molecules are also provided. | 05-05-2011 |
20110105589 | APOPTOSIS INDUCER - This invention relates to an agent, a composition and a product comprising at least one apoptosis-inducing substance, and at least one substance which inhibits expression and/or activity of an apoptosis-inhibiting substance; a method for inducing apoptosis or for treating a proliferative disease using one or more of them; a nucleic acid construct comprising a nucleic acid molecule encoding a protein to be expressed and a nucleic acid molecule which inhibits expression of an undesired protein; and a method for expressing a desired protein in a cell while inhibiting the expression of an undesired protein. | 05-05-2011 |
20110105590 | Compositions And Methods For Inhibiting Expression Of Anti-Apoptotic Genes - The present invention relates to an isolated double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of bcl-2, where the antisense strand comprises a sequence that comprises a region of complementarity which is substantially complementary to at least a part of an mRNA encoding bcl-2. The dsRNA, upon contact with a cell expressing the bcl-2, inhibits expression of the bcl-2 gene by at least 20%. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier. The invention further relates to a vector for inhibiting expression of bcl-2 in a cell, where the vector comprises a regulatory sequence operably linked to a nucleotide sequence that encodes at least one strand of the dsRNA. | 05-05-2011 |
20110105591 | siRNA COMPOUNDS FOR INHIBITING NRF2 - The present invention provides chemically modified siRNA compounds that target the Nrf2 gene and pharmaceutical compositions comprising same useful for treating or preventing the incidence or severity of a cancerous disease, particularly various lung cancers. | 05-05-2011 |
20110105592 | ANTI-SENSE MICRORNA EXPRESSION VECTORS - The present invention relates to an alternative strategy for expressing the antisense sequence of a miRNA. This system allows for continuous production of the antisense sequence and subsequently complete knockdown of the targeted miRNA. | 05-05-2011 |
20110112167 | THERAPEUTIC AGENTS AND TARGETS - The present invention relates to diagnostic and therapeutic methods in relation to diabetic complications, such as blindness, nephropathy and cardiovascular disease, and inflammatory conditions, such as angina, arthritis, empyema pharyngitis and urinary tract infection. Diagnostic methods involve screening for up regulated expression of decor (Den) or thioredoxin-like protein 19 (TLP 19). Therapeutic methods involve modulation of expression or activity o Den or TLP 19. The invention also relates to screening methods for identifying functional signal sequences to screen for secreted, membrane-bound and exported proteins and cell surface receptors. | 05-12-2011 |
20110112168 | NOVEL SIRNA STRUCTURES - The invention relates to siRNA compounds possessing novel sequences and structural motifs which down-regulate the expression of specific human genes. The invention also relates to pharmaceutical compositions comprising such compounds and a pharmaceutically acceptable carrier. The present invention also provides a method of treating and/or preventing the incidence or severity of various diseases or conditions associated with the genes and/or symptoms associated with such diseases or conditions comprising administering to a subject in need of treatment for such disease or condition and/or symptom the compound or the pharmaceutical composition in a therapeutically effective dose so as to thereby treat the subject. | 05-12-2011 |
20110112169 | RNAi-BASED THERAPEUTICS FOR ALLERGIC RHINITIS AND ASTHMA - The present invention provides compositions comprising one or more RNAi agents (e.g., siRNAs, shRNAs, or RNAi vectors) for the treatment of conditions and diseases mediated by (e.g., featuring IgE-mediated hypersensitivity), as well as systems for identifying RNAi agents effective for this purpose. The compositions are suitable for the treatment of allergic rhinitis and/or asthma. In certain embodiments of the invention the RNAi agent is targeted to a transcript that encodes a protein selected from the group consisting of the FCεRIα chain, the FCεRIβ chain, c-Kit, Lyn, Syk, ICOS, OX40L, CD40, CD80, CD86, Re1A, Re1B, 4-1BB ligand, TLR1, TLR2, TLR3, TLR4, TLR5, TLR6, TLR7, TLR8, TLR9, CD83, SLAM, common γ chain, and COX-2. In addition, the invention provides RNAi agent/delivery agent compositions and methods of use. In certain embodiments of the invention compositions comprising an RNAi agent are delivered by the respiratory route. | 05-12-2011 |
20110112170 | OLIGOMERIC COMPOUNDS COMPRISING BICYCLIC NUCLEOSIDES AND HAVING REDUCED TOXICITY - In certain embodiments, the present invention provides oligomeric compounds having favorable toxicity profiles and therapeutic indexes. Compounds of the present invention comprise bicyclic nucleosides. Certain such bicyclic nucleosides are pyrimidines that do not include a methyl group at the 5-carbon. Oligomeric compounds comprising such nucleosides are less toxic than compounds comprising bicyclic nucleosides that do include a methyl group at the 5-carbon. In certain embodiments, the present invention provides methods of preparing and using such compounds. | 05-12-2011 |
20110112171 | COMPOSITIONS AND THEIR USES DIRECTED TO PTPRU - Disclosed herein are compounds, compositions and methods for modulating the expression of PTPRU in a cell, tissue or animal. Also provided are methods of active target segment validation. Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and disorders. Also provided are methods for the prevention, amelioration and/or treatment of diabetes, obesity, insulin resistance, insulin deficiency, hypercholesterolemia, hyperglycemia, hyperlipidemia, hypertriglyceridemia, hyperfattyacidemia, liver steatosis, steatohepatitis, non-alcoholic steatohepatitis, metabolic syndrome, cardiovascular disease and coronary heart diseaseby administration of antisense compounds targeted to PTPRU. | 05-12-2011 |
20110118331 | CATIONIC SIRNAS, SYNTHESIS AND USE FOR RNA INTERFERENCE - The invention relates to cationic siRNAs, characterized in that they are double-stranded RNA fragments, grafted to the ends of which are oligocations, the number of cationic charges grafted being comparable to or greater than that of the anionic charges carried by the internucleoside phosphates of the RNA strands. | 05-19-2011 |
20110118332 | VIRAL MICRORNA - The present invention relates, in general, to micro RN As and. in particular, to viral microRNAs expressed by Herpes Simplex Vims 1 (HSV-1) or Herpes Simplex Virus 2 (HSV-2), to agents that inhibit such microRNAs and to methods of treatment based on the use of such agents. | 05-19-2011 |
20110118333 | Use on Minicircle vectors for cardiac gene therapy - Compositions and methods are provided for the treatment of an ischemic cardiovascular condition by providing a patient with a novel non-viral minicircle DNA vector comprising polynucleotide sequences that potentiate HIF-1 activity, including RNAi or antisense agents selective for proteins involved in HIF1 inactivation. | 05-19-2011 |
20110118334 | ANTISENSE ANTIVIRAL COMPOUND AND METHOD FOR TREATING INFLUENZA VIRAL INFECTION - The present invention relates to antisense antiviral compounds and methods of their use and production in inhibition of growth of viruses of the Orthomyxoviridae family and in the treatment of a viral infection. The compounds are particularly useful in the treatment of influenza virus infection in a mammal. Exemplary antisense antiviral compounds are substantially uncharged, or partially positively charged, morpholino oligonucleotides having 1) a nuclease resistant backbone, 2) 12-40 nucleotide bases, and 3) a targeting sequence of at least 12 bases in length that hybridizes to a target region selected from the following: a) the 5′ or 3′ terminal 25 bases of the negative sense viral RNA segment of Influenzavirus A, Influenzavirus B and Influenzavirus C; b) the terminal 30 bases of the 5′ or 3′ terminus of the positive sense vcRNA; c) the 45 bases surrounding the AUG start codon of an influenza viral mRNA and; d) 50 bases surrounding the splice donor or acceptor sites of influenza mRNAs subject to alternative splicing. | 05-19-2011 |
20110118335 | RNA Interference Mediated Inhibition Of Gene Expression Using Multifunctional Short Interfering Nucleic Acid (Multifunctional siNA) - The present invention concerns methods and nucleic acid based reagents useful in modulating gene expression in a variety of applications, including use in therapeutic, veterinary, agricultural, diagnostic, target validation, and genomic discovery applications. Specifically, the invention relates to multifunctional short interfering nucleic acid (multifunctional siNA) molecules that modulate the expression of one or more genes in a biologic system, such as a cell, tissue, or organism via RNA interference (RNAi). The bifunctional short interfering nucleic acid (multifunctional siNA) molecules of the invention can target more than one regions of nucleic acid sequence in a single target nucleic acid molecule or can target regions of nucleic acid sequence in differing target nucleic acid molecules. The self multifunctional siNA molecules are useful in the treatment of any disease or condition that responds to modulation of gene expression or activity in a cell, tissue, or organism. | 05-19-2011 |
20110118336 | Microrna-21 antagonists and its target PDCD4 for use in the treatment of a glioma - The present invention embraces microRNA-21 antagonists and activators of Programmed Cell Death 4 for use in decreasing glial tumor cell proliferation and treating glioma. | 05-19-2011 |
20110118337 | Method of Using Compositions Comprising MIR-192 and/or MIR-215 for the Treatment of Cancer - The invention provides methods and compositions for inhibiting the proliferation of mammalian cells. In some embodiments, the methods comprise contacting mammalian cells with an effective amount of at least one small interfering nucleic acid (siNA) agent that inhibits the level of expression of at least two miR 192 family responsive genes selected from the group consisting of SEPT 10, LMNB2, HRH1, HOXA10, ERCC3, MIS12, MPHOSPHI1, CDC7, SMARCB1, MAD2L1, DTL, RAC-GAP1, MCM10, PIM1, DLG5, BCL2, CUL5, and PRPF38A. | 05-19-2011 |
20110118338 | METHODS, COMPOSITIONS AND COMPOUND ASSAYS FOR INHIBITING AMYLOID-BETA PROTEIN PRODUCTION - A method for identifying compounds that inhibit amyloid-beta precursor protein processing in cells, comprising contacting a test compound with a GPCR polypeptide, or fragment thereof, and measuring a compound-GPCR property related to the production of amyloid-beta peptide. Cellular assays of the method measure indicators including second messenger and/or amyloid beta peptide levels. Therapeutic methods, and pharmaceutical compositions including effective amyloid-beta precursor processing-inhibiting amounts of GPCR expression inhibitors, are useful for treating conditions involving cognitive impairment such as Alzheimers Disease. | 05-19-2011 |
20110124706 | SOCS3 Inhibition Promotes CNS Neuron Regeneration - Regeneration of injured CNS neurons in a mammal in need thereof is promoted by delivering directly to the body of the injured CNS neurons, such as with an intracerebral or intraretinal cannula, an effective amount of a specific inhibitor of SOCS3. | 05-26-2011 |
20110124707 | Methods And Compositions For Reducing Viral Genome Amounts In A Target Cell - Methods and compositions for reducing viral genome amounts in a target cell are provided. In the subject methods, the activity of a miRNA is inhibited in a manner sufficient to reduce the amount of viral genome in the target cell, e.g., by introducing a miRNA inhibitory agent in the target cell. Also provided are pharmaceutical compositions, kits and systems for use in practicing the subject methods. The subject invention finds use in a variety of applications, including the treatment of subjects suffering from a viral mediated disease condition, e.g., an HCV mediated disease condition. | 05-26-2011 |
20110124708 | RNAI-MEDIATED INHIBITION OF OCULAR HYPERTENSION TARGETS - RNA interference is provided for inhibition of ocular hypertension target mRNA expression for lowering elevated intraocular pressure in patients with open-angle glaucoma or ocular hypertension. Ocular hypertension targets include carbonic anhydrase II, IV, and XII; β1- and β2 adrenergic receptors; acetylcholinesterase; Na | 05-26-2011 |
20110124709 | RNA ANTAGONISTS TARGETING GLI2 - The present invention relates to oligomer compounds (oligomers), which target GLI2 mRNA in a cell, leading to reduced expression of GLI2. Reduction of GLI2 expression is beneficial for the treatment of certain medical disorders, such as hyperproliferative disorders, such as cancer. | 05-26-2011 |
20110124710 | COMPOSITION AND METHODS OF RNAI THERAPEUTICS FOR TREATMENT OF CANCER AND OTHER NEOVASCULARIZATION DISEASES - Compositions and methods are provided for treatment of diseases involving unwanted neovascularization (NV). The invention provides treatments that control NV through selective inhibition of pro-angiogenic biochemical pathways, including inhibition of the VEGF pathway gene expression and inhibition localized at pathological NV tissues. Tissue targeted nanoparticle compositions comprising polymer conjugates and nucleic acid molecules that induce RNA interference (RNAi) are provided. The nanoparticle compositions of the invention can be used alone or in combination with other therapeutic agents such as VEGF pathway antagonists. The compositions and methods can be used for the treatment of NV diseases such as cancer, ocular disease, arthritis, and inflammatory diseases. | 05-26-2011 |
20110124711 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF Nav1.8 GENE - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the Nav1.8 gene (Nav1.8 gene), comprising an antisense strand having a nucleotide sequence which is less that 25 nucleotides in length and which is substantially complementary to at least a part of the Nav1.8 gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by the expression of the Nav1.8 gene using the pharmaceutical composition; and methods for inhibiting the expression of the Nav1.8 gene in a cell. | 05-26-2011 |
20110130440 | NON-NATURAL RIBONUCLEOTIDES, AND METHODS OF USE THEREOF - One aspect of the present invention relates to modified nucleosides and oligonucleotides comprising such modified nucleosides. Another aspect of the invention relates to a method of inhibiting the expression of a gene in call, the method comprising (a) contacting an oligonucleotide of the invention with the cell; and (b) maintaining the cell from step (a) for a time sufficient to obtain degradation of the mRNA of the target gene. | 06-02-2011 |
20110130441 | OLIGOMERIC COMPOUNDS HAVING AT LEAST ONE NEUTRALLY LINKED TERMINAL BICYCLIC NUCLEOSIDES - The present disclosure describes oligomeric compounds having at least one bicyclic nucleoside attached to the 3′ or 5′ termini by a neutral internucleoside linkage and methods of using the oligomeric compounds. In some embodiments, the oligomeric compounds provided herein hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA. | 06-02-2011 |
20110130442 | NUCLEIC ACID CAPABLE OF CONTROLLING DEGRANULATION OF MAST CELL - Provided are a mast cell degranulation control agent, a diagnostic agent or therapeutic agent for a disease resulting from mast cell degranulation control, a method of controlling mast cell degranulation, and a screening method for a mast cell degranulation control agent, all of which involve the use of a nucleic acid and the like. These are useful in the diagnosis or treatment of a disease resulting from mast cell degranulation control. | 06-02-2011 |
20110130443 | Compositions And Methods For Inhibiting Expression Of Factor V Leiden Mutant Gene - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the Factor V Leiden mutant gene (Factor V Leiden mutant gene), comprising an antisense strand having a nucleotide sequence which is less that 25 nucleotides in length and which is substantially complementary to at least a part of the Factor V Leiden mutant gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by the expression of the Factor V Leiden mutant gene using the pharmaceutical composition; and methods for inhibiting the expression of the Factor V Leiden mutant gene in a cell. | 06-02-2011 |
20110136889 | COMPOSITIONS AND THEIR USES DIRECTED TO ACEYTL-COA CARBOXYLASES - Disclosed herein are compounds, compositions and methods for modulating the expression of ACC1 or ACC2 or both in a cell, tissue or animal. Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and disorders. | 06-09-2011 |
20110136890 | TREATMENT OF FIBROTIC CONDITIONS - Treatment of fibrosis and fibrotic diseases, disorders, and conditions, and associated methods, compositions, formulations and articles. | 06-09-2011 |
20110136891 | Nucleic acid molecules and collections thereof, their application and Identification - Provided is a method for characterising a sample comprising nucleic acid derived from a cell. The method comprises determining whether a sample comprises at least a minimal sequence of at least one new microRNA (miRNA) as disclosed herein or a mammalian ortholog thereof and characterizing the sample on the basis of the presence or absence of the miRNA. The invention further provides new nucleic acid molecules and collections thereof and their use in therapeutic and diagnostic applications. The invention furthermore provides a method for identifying a miRNA molecule or a precursor molecule thereof. | 06-09-2011 |
20110136892 | Targeting TGF-beta as a Therapy for Alzheimer's Disease - The invention includes compositions and methods for enhancing peripheral macrophage Aβ phagocytosis activity. The invention includes inhibiting a component of TGF-β signaling pathway in peripheral macrophages to promote central nervous system infiltration and beneficial cerebral Aβ clearance. Inhibition of TGF-β signaling in peripheral macrophages represents an advantageous anti-amyloid therapeutic approach for Alzheimer's disease. | 06-09-2011 |
20110144182 | TREATMENT OF SURGICAL ADHESIONS - Connexin modulation for the treatment of surgical adhesions, and associated methods, compositions, and articles. | 06-16-2011 |
20110144183 | OLIGONUCLEOTIDES FOR TREATING INFLAMMATION AND NEOPLASTIC CELL PROLIFERATION - There is provided oligonucleotides directed against the CCR3 receptor and the common beta sub-unit of IL-3, IL-5 and GM-CSF receptors. The oligonucleotides are useful to inhibit general inflammation, including inflammation associated with asthma, COPD, allergy, Cystic fibrosis (CF), hypereosinophilia and neoplastic cell proliferation such as cancer. | 06-16-2011 |
20110144184 | PREVENTING OR TREATING VIRAL INFECTION USING AN INHIBITOR OF THE LSD1 PROTEIN, A MAO INHIBITOR OR AN INHIBITOR OF LSD1 AND A MAO INHIBITOR - An embodiment of the invention provides preventing or treating a viral infection of a host, comprising administering to the host an effective amount of an inhibitor of the protein LSD1 and/or a monoamine oxidase inhibitor. Another embodiment of the invention provides preventing or treating reactivation of a virus after latency in a host, comprising administering to the host an effective amount of an inhibitor of the protein LSD1 and/or a monoamine oxidase inhibitor. Another embodiment of the invention provides preventing or treating a viral infection in a mammal that has undergone, is undergoing, or will undergo an organ or tissue transplant, comprising administering to the mammal an effective amount of an inhibitor of the protein LSD1 and/or a monoamine oxidase inhibitor before, during, and/or after the organ or tissue transplant. The viral infection may be due to a herpesvirus, such as herpes simplex virus type 1 (HSV-1) or type 2 (HSV-2), varicella zoster virus (VZV), or cytomegalovirus (CMV). The viral infection may also be due to an adenovirus, including types 1-5. | 06-16-2011 |
20110152344 | Inhibition of filovirus entry into cells and uses thereof - The present invention discloses method to treat infections caused by filovirus. Such a method comprises blocking the PI3 kinase pathway or the calcium-associated pathway at the gene or protein level. Also disclosed herein are the compounds useful in the treatment of filoviral infection. | 06-23-2011 |
20110152345 | EBI3, DLX5, NPTX1 AND CDKN3 FOR TARGET GENES OF LUNG CANCER THERAPY AND DIAGNOSIS - The present invention relates to methods for treating or preventing lung cancer by administering a double-stranded molecule against one or more of EBI3, DLX5, NPTX1, CDKN3 or EF-I delta genes or compositions, vectors or cells containing such a double-stranded molecule. The present invention also features methods for diagnosing lung cancer, especially NSCLC or SCLC, using one or more over-expressed genes selected from among EBI3, DLX5, NPTX1, CDKN3 and/or EF-I delta. Also disclosed are methods of identifying compounds for treating and preventing lung cancer, using as an index their effect on the over-expression of one or more of EBI3, DLX5, CDKN3 and/or EF-I delta in the lung cancer, the cell proliferation function of one or more of EBI3, DLX5, NPTX1, CDKN3 and/or EF-I delta or the interaction between CDKN3 and VRS, EF-I beta, EF-I gamma and/or EF-I delta. | 06-23-2011 |
20110152346 | Use of Oligonucleotides with Modified Bases in Hybridization of Nucleic Acids - The invention is concerned with the use of oligonucleotide analogs that contain specifically modified DNA bases to be used in hybridization of nucleic acids, polymerase chain reaction (PCR) and siRNA-mediated gene silencing (RNAi). | 06-23-2011 |
20110152347 | Methods and compositions for controlling efficacy of RNA silencing - Based at least in part on an understanding of the mechanisms by which small RNAs (e.g., naturally-occurring miRNAs) mediate RNA silencing in plants, rules have been established for determining, for example, the degree of complementarity required between an RNAi-mediating agent and its target, i.e., whether mismatches are tolerated, the number of mismatches tolerated, the effect of the position of the mismatches, etc. Such rules are useful, in particular, in the design of improved RNAi-mediating agents which allow for more exact control of the efficacy of RNA silencing. | 06-23-2011 |
20110152348 | METHODS FOR TREATING ANDROGEN RECEPTOR DEPENDENT DISORDERS INCLUDING CANCERS - The invention provides the combination use of antisense oligomers targeting androgen receptor mRNA and androgen receptor binding inhibitors that reduce androgen receptor activity for the treatment of androgen receptor related medical disorders, such as cancers, particularly prostate cancers and breast cancers. | 06-23-2011 |
20110152349 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF IL-18 GENES - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a IL-18 gene. The invention also relates to a pharmaceutical composition comprising the dsRNA or nucleic acid molecules or vectors encoding the same together with a pharmaceutically acceptable carrier; methods for treating diseases caused by the expression of a IL-18 gene using said pharmaceutical composition; and methods for inhibiting the expression of IL-18 in a cell. | 06-23-2011 |
20110152350 | Compositions and Methods for Inhibiting Expression of XBP-1 Gene - The invention relates to a double-stranded ribonucleic acid (dsRNA) targeting X-Box Protein 1 (XBP-1), and methods of using the dsRNA to inhibit expression of XBP-1. | 06-23-2011 |
20110152351 | MODULATION OF SMRT EXPRESSION - Disclosed herein are compounds and methods for decreasing SMRT and treating metabolic and/or cardiovascular diseases in an individual in need thereof. Examples of disease conditions that can be ameliorated with the administration of antisense compounds targeted to SMRT include obesity, diabetes, dyslipidemia, and hypothyroidism. | 06-23-2011 |
20110152352 | SMAD PROTEINS CONTROL DROSHA-MEDIATED MIRNA MATURATION - The invention, in some aspects, relates to compositions and methods useful for modulating expression of miRNAs that are regulated by the TGF-β/BMP signaling pathway. In some aspects, the invention relates, to oligonucleotides comprising a CAGRN-motif that modulate expression of miRNAs that are regulated by TGF-β/BMP signaling pathway. The invention, in some aspects, relates to composition and methods useful for inhibiting microRNA processing. In some aspects, the invention relates to composition and methods for treating TGF-Beta/BMP mediated disorders. | 06-23-2011 |
20110152353 | DOUBLE-STRANDED POLYNUCLEOTIDE - It is intended to provide a double-stranded polynucleotide that is resistant to RNase and has RNA interference effect, etc. The present invention provides a double-stranded polynucleotide comprising sense and antisense strands comprising polynucleotides comprising a nucleotide unit of DNAs and 2′-O-methyl RNAs alternately combined. | 06-23-2011 |
20110152354 | Bispecific Oligonucleotide for the Treatment of CNS Malignancies - CNS malignancy is treated in a subject suffering from a CNS malignancy by administering to the subject an antisense oligonucleotide having a sequence of bases that is complementary to portions of both the gene encoding IGFBP-2 and the gene encoding IGFBP-5, and which is of sufficient length to act as an inhibitor of the effective amount of IGFBP-2 and IGFBP-5, in an amount effective to reduce effective levels of IGFBP-2 and IGFBP-5 in cells of the CNS malignancy. | 06-23-2011 |
20110152355 | METHOD FOR PREDICTING AND DETECTING TUMOR METASTASIS - The invention provides a method of determining the prognosis of cancer in a subject. The method comprises (a) obtaining a sample from the subject, (b) analyzing the sample for the expression level of a carboxypeptidase E (CPE) splice variant, and (c) correlating the expression level in the sample with the prognosis of cancer in the subject. The invention further provides a method of diagnosing cancer, methods of treatment, kits for detecting mRNA expression of a CPE-ΔN, and inhibitors of CPE-ΔN and compositions thereof. | 06-23-2011 |
20110152356 | NOVEL RNAi THERAPEUTIC FOR TREATMENT OF HEPATITIS C INFECTION - Small interfering RNAs (siRNAs) or small hairpin RNA (shRNAs) and compositions comprising same are provided that specifically target human cyclophilin A (CyPA) to effectively inhibit Hepatitis C(HCV) infection in a cell. Such siRNA and shRNAs may have a length of from about 19 to about 29 contiguous nucleotides corresponding to a specific region of human cyclophilin A (CyPA) cDNA of from about nucleotide 155 to about nucleotide 183 having particular potency against CyPA and HCV. Such siRNA and shRNAs may be formulated as naked compositions or as pharmaceutical compositions. DNA polynucleotides, plasmids, and viral or non-viral vectors are also provided that encode siRNA or shRNA molecules, which may be delivered directly to cells or in combination with known delivery agents, such as lipids, polymers, encapsulated lipid particles, such as liposomes. Methods for treating, managing inhibiting, preventing, etc., HCV infection using such siRNA and shRNAs and compositions comprising same are also provided. | 06-23-2011 |
20110152357 | Micro-RNA-Based Compositions and Methods for the Diagnosis, Prognosis and Treatment of Multiple Myeloma - Methods for assessing a pathological condition in a subject includes measuring an expression profile of one or more markers where a difference is indicative of multiple myeloma (MM) or a predisposition to MM. The present invention provides novel methods and compositions for the diagnosis, prognosis and treatment of MM. The invention also provides methods of identifying anti-MM cancer agents. | 06-23-2011 |
20110152358 | Compositions and Methods for Diagnosis and Treatment of Pancreatic Ductal Cancer - The present invention includes compositions and methods for diagnosing and treating pancreatic cancer. These compositions and methods are based on the finding that 14-3-3σ protein is secreted from pancreatic cancer cells and is therefore a specific biomarker protein. | 06-23-2011 |
20110160277 | MODULATION OF 11 BETA-HYDROXYSTERIOD DEHYDROGENASE 1 EXPRESSION FOR THE TREATMENT OF OCULAR DISEASES - The invention relates to siNA compositions and methods for the treatment of eye conditions wherein the siNA compound capable of inhibiting the expression of 11 beta-hydroxysteroid dehydrogenase (11 beta-HSD1). | 06-30-2011 |
20110160278 | Methods For Selectively Modulating Survivin Apoptosis Pathways - The present invention, based on the discovery of a new biological phenomena, provides methods and compositions for use in identifying agents that modulate the phosphorylation of survivin, the interaction between survivin and p34 | 06-30-2011 |
20110160279 | METHODS FOR TREATMENT AND PREVENTION OF OTOTOXICITY BY siRNA - The present invention relates to methods for reducing and/or preventing ototoxicity caused by an ototoxic agent, noise or head and/or neck radiation. It is also directed to a method for preventing or reducing generation of reactive oxygen species in the inner ear of a patient. The methods of the present invention include administering at least one siRNA directed against TRPV1 mRNA, NOX3 mRNA or a combination thereof. | 06-30-2011 |
20110160280 | CANCER-RELATED GENES, CDCA5, EPHA7, STK31 AND WDHD1 - The invention features methods for detecting cancers, especially lung cancer and/or esophageal cancer, using over-expressed gene; CDCA5, EPHA7, STK31 or WDHD1 compared the normal organs. Also disclosed are methods of identifying compounds for treating and preventing cancers, based on the over-expression or the biological activity of CDCA5, EPHA7, STK31 or WDHD1 in the cancers, especially the interaction between EPHA7 and EGFR. Also, features are a method for treating cancers by administering a double-stranded molecule against CDCA5, EPHA7, STK31 or WDHD1 gene. The invention also features products, including the double-stranded molecules and vectors encoding them, as well as compositions comprising the molecules or vectors, useful in the provided methods. | 06-30-2011 |
20110160281 | RNA Interference Mediated Inhibition of Vascular Cell Adhesion Molecule (VCAM) Gene Expression Using Short Interfering Nucleic Acid (siNA) - This invention relates to compounds, compositions, and methods useful for modulating vascular cell adhesion molecule gene expression using short interfering nucleic acid (siNA) molecules. This invention also relates to compounds, compositions, and methods useful for modulating the expression and activity of other genes involved in pathways of vascular cell adhesion molecule gene expression and/or activity by RNA interference (RNAi) using small nucleic acid molecules. In particular, the instant invention features small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules and methods used to modulate the expression of vascular cell adhesion molecule genes, such as vascular cell adhesion molecule-1 (VCAM-1). | 06-30-2011 |
20110160282 | NUCLEIC-ACID PHARMACEUTICAL COMPOSITION FOR CANCER THERAPY - The present invention provides at least one siRNA (small interfering RNA) which inhibits the expression of Mcl-1 within the cell, and which is selected from siRNA having SEQ. ID. NO. 1 sense sequence and SEQ. ID. NO. 2 antisense sequence, siRNA having SEQ. ID. NO. 3 sense sequence and SEQ. ID. NO. 4 antisense sequence, and siRNA having SEQ. ID. NO. 5 sense sequence and SEQ. ID. NO. 6 antisense sequence. The invention also provides a nucleic-acid pharmaceutical composition for cancer therapy comprising the same. The siRNA of the present invention kills cancer cells by inhibiting the expression of Mcl-1 which is commonly expressed in cancer cells by means of RNA-mediated interference (RNAi), and the composition of the present invention can be used as an outstanding anti-cancer preparation. | 06-30-2011 |
20110160283 | MODULATION OF CD40 EXPRESSION - Disclosed herein are antisense compounds and methods for decreasing CD40. Examples of disease conditions that can be ameliorated with the administration of antisense compounds targeted to CD40 include hyperproliferative disorders, graft versus host disease (GVHD), graft rejection, asthma, airway hyperresponsiveness, chronic obstructive pulmonary disease (COPD), multiple sclerosis (MS), systemic lupus erythematosus (SLE), and certain forms of arthritis. | 06-30-2011 |
20110160284 | SUPERCOILED MINICIRCLE DNA FOR GENE THERAPY APPLICATIONS - The present invention relates to nucleic acid molecule compositions comprising minivectors encoding a nucleic acid sequence and methods of gene therapy using minivectors encoding a nucleic acid sequence. | 06-30-2011 |
20110160285 | IDENTIFICATION OF MIRNA PROFILES THAT ARE DIAGNOSTIC OF HYPERTROPHIC CARDIOMYOPATHY - Disclosed herein are a collection of miRNAs and genes whose expression is altered in hypertrophic cardiomyopathy. Accordingly, these miRNAs and genes, singly or in combination, are useful as molecular markers for diagnosis or prognosis of hypertrophic cardiomyopathy. The miRNAs and genes disclosed can also be therapeutic targets for cardiac hypertrophy. For example, agents such as miRNA mimics, miRNA inhibitors or siRNAs for a given miRNA or gene can be used to modulate the level of these molecules thereby inhibiting or preventing hypertrophic cardiomyopathy. | 06-30-2011 |
20110160286 | ALLELE-SPECIFIC RNA INTERFERENCE - Human diseases caused by dominant, gain-of-function mutations develop in heterozygotes bearing one mutant and one wild-type copy of a gene. Because the wild-type gene often performs important functions, whereas the mutant gene is toxic, any therapeutic strategy must selectively inhibit the mutant while retaining wild-type gene expression. The present invention includes methods of specifically inhibiting the expression of a mutant allele, while preserving the expression of a co-expressed wild-type allele using RNAi, a therapeutic strategy for treating genetic disorders associated with dominant, gain-of-function gene mutations. The invention also includes small interfering RNAs (siRNAs) and small hairpin RNAs (shRNAs) that selectively suppress mutant, but not wild-type, expression of copper zinc superoxide dismutase (SOD1), which causes inherited amyotrophic lateral sclerosis (ALS). The present invention further provides asymmetric siRNAs and shRNAs with enhanced efficacy and specificity and mediating RNAi. | 06-30-2011 |
20110160287 | POTENTIATOR OF ACTIVITY OF ANTI-CANCER AGENT AND USE THEREOF, AND BIOMARKER FOR PREDICTION OF PROGNOSIS IN CANCER PATIENT AND USE THEREOF - Disclosed is a means for improving the clinical outcomes of cancer therapy. Specifically disclosed is an activity potentiator comprising a compound capable of inhibiting the expression of RFP (RET finger protein) gene or the activity of RFP as an active ingredient. The activity of an anti-cancer agent having an oxidative stress inducing ability can be potentiated by using the anti-cancer agent in combination with the activity potentiator. Further specifically disclosed are a biomarker useful for the recognition of prognosis in a cancer patient and use of the biomarker. | 06-30-2011 |
20110160288 | OIP5 AS A TARGET GENE FOR CANCER THERAPY AND DIAGNOSIS - The present invention relates to the roles played by OIP5 genes in lung and/or esophageal cancer carcinogenesis and features a method for treating and/or preventing lung and/or esophageal cancer by administering a double-stranded molecule against the OIP5 genes or a composition, vector or cell containing such a double-stranded molecule and antibody. The present invention also features methods for detecting and/or diagnosing lung and/or esophageal cancer, or assessing/determining the prognosis of and/or monitoring the efficacy of a cancer therapy in a patient with lung and/or esophageal cancer by detecting OIP5. Also, disclosed are methods of identifying compounds for treating and preventing cancer relating to OIP5. | 06-30-2011 |
20110166196 | TREATMENT AND PROPHYLAXIS OF EPILEPSY AND FEBRILE SEIZURES - Provided are methods for treatment and prophylaxis of convulsive disorders and seizures, such as epilepsy and febrile seizures, by modulating TRPV | 07-07-2011 |
20110166197 | Antisense Modulation Of Amyloid Beta Protein Expression - Antisense nucleic acids, compositions and methods are provided for modulating the expression of an amyloid beta protein (AβP) portion of the amyloid precursor protein (APP) coding sequence. The compositions comprise antisense nucleic acids targeted to nucleic acids encoding amyloid precursor protein. Methods of using these nucleic acids for modulation of amyloid precursor protein expression and for treatment of diseases and conditions associated with expression of the amyloid beta protein portion of the amyloid precursor protein are provided. | 07-07-2011 |
20110166198 | RNA COMPOSITIONS FOR MODULATING IMMUNE RESPONSE - This invention features modified iRNA agents that modulate an immune response, methods of making and identifying iRNA agents that modulate an immune response, and methods of using the iRNA agents to modulate an immune response. | 07-07-2011 |
20110166199 | RNAi COMPOUND TARGETED TO THROMBOSPONDIN-1 AND APPLICATIONS THEREOF - The present invention relates to an RNAi compound and an expression plasmid for inhibiting expression of Thrombospondin-1, which comprises a target sequence selected from Thrombospondin-1 gene. The present invention also related to a pharmaceutical composition comprising the RNAi compound and applications thereof. The RNAi compound can reduce the expression of Thrombospondin-1 to activate immune responses. In addition, the present invention also disclosed that an RNAi compound targeted to Thrombospondin-1 gene can delay tumor progression. | 07-07-2011 |
20110166200 | METHODS OF USING MIR210 AS A BIOMARKER FOR HYPOXIA AND AS A THERAPEUTIC AGENT FOR TREATING CANCER - The present invention provides compositions and methods for predicting the hypoxia response in tumor cells, methods for predicting the likelihood of cancer metastasis, and methods for inhibiting tumor cell proliferation using a microRNA comprising miR-210. | 07-07-2011 |
20110166201 | MIRNAS AS THERAPEUTIC TARGETS IN CANCER - MicroRNAs (miRNAs) are a class of non-coding small RNA molecules that regulate gene expression at the post-transcriptional level by interacting with 3′ untranslated regions (UTRs) of their target mRNAs. The invention relates to the application of miR-192 and miR-215. Both of these miRNAs impact cellular proliferation through the p53-miRNA circuit, and interact with dihydrofolate reductase (DHFR) and thymidylate synthase (TS). Particularly, upregulation of these miRNAs reduces cellular proliferation. The invention relates to this discovery. For example, inhibiting miR-192 and/or miR-215 sensitizes a neoplasm or a subject with a neoplasm to chemotherapeutic agents. Furthermore, measuring the levels of miR-192 and/or miR-215 provides one with information regarding whether the neoplasm or subject will respond to chemotherapeutic agents. Accordingly, the invention relates to composition and methods relating to the identification, characterization and modulation of the expression of miR-192 and miR-215. | 07-07-2011 |
20110166202 | FORMOTEROL/STEROID BRONCHODILATING COMPOSITIONS AND METHODS OF USE THEREOF - Bronchodilating compositions and methods are provided. The compositions are intended for administration as a nebulized aerosol. In certain embodiments, the compositions contain formoterol, or a derivative thereof, and a steroidal anti-inflammatory agent. Methods for treatment, prevention, or amelioration of one or more symptoms of bronchoconstrictive disorders using the compositions provided herein are also provided. | 07-07-2011 |
20110166203 | ANTI-HEPATITIS C VIRUS COMPOSITION - The present invention provides an anti-hepatitis C virus composition that includes a substance that suppresses the expression or function of a PA28γ gene, a method for preventing hepatitis C viral infection or suppressing hepatitis C virus growth that includes the step of administering the composition to a subject, and a method for screening an effective component of an anti-hepatitis C virus composition that includes the step of selecting a substance that inhibits the expression or function of a PA28γ gene. | 07-07-2011 |
20110166204 | OLIGONUCLEOTIDES TARGETING HUMAN ENDOGENOUS RETROVIRUS 9 (ERV-9) LONG TERMINAL REPEAT (LTR) AND METHODS OF USE - Described herein are oligonucleotides that target the human endogenous retrovirus-9 (ERV-9) long terminal repeat (LTR). The ERV-9 LTR oligonucleotides specifically hybridize with either the coding strand or non-coding strand of ERV-9 LTR. It is disclosed herein that ERV-9 LTR oligonucleotides inhibit the proliferation of cancer cells, including breast cancer, liver cancer, prostate cancer, fibrosarcoma and myeloid cancer cells. Also described herein are methods of treating a subject diagnosed with cancer comprising administering to the subject an ERV-9 LTR oligonucleotide. In some examples, the methods further comprise administering a second therapeutic agent, such as an antisense compound or a chemotherapeutic agent. | 07-07-2011 |
20110166205 | SUBSTITUTED ALPHA-L-BICYCLIC NUCLEOSIDES - The present disclosure describes substituted α-L-bicyclic nucleoside analogs, oligomeric compounds prepared therefrom and methods of using the oligomeric compounds. More particularly, substituted α-L-bicyclic nucleoside analogs are provided, having one or more chiral substituents, that are useful for enhancing properties of oligomeric compounds including binding affinity. In some embodiments, the oligomeric compounds provided herein hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA. | 07-07-2011 |
20110172286 | CD44 SPLICE VARIANTS IN NEURODEGENERATIVE DISEASES - There is provided a method of treating or preventing a neurodegenerative disease, which includes administration of a composition that includes a reagent capable of modulating expression of ribonucleic acid (RNA) encoded by a nucleic acid, wherein the nucleic acid is selected from a group that includes a contiguous nucleotide sequence being at least 90% homologous to at least 20 nucleotides of: SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, or any combination thereof. There is further provided a method of treating or preventing a neurodegenerative disease, which includes administration of a composition that includes a reagent capable of modulating expression and/or activity of a polypeptide, wherein the sequence of the polypeptide is selected from a group that includes a contiguous amino acid sequence being at least 90% homologous to at least 10 amino acid of: SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 6, SEQ ID NO: 8, or any combination thereof. | 07-14-2011 |
20110172287 | COMPOSITIONS AND METHODS FOR INHIBITING TUMOR GROWTH AND METASTASIS - Disclosed are compositions and methods useful in the reduction of p11 protein activity in cancer cells. P11 protein is demonstrated to affect plasmin production and activity, MMP activity, plasminogen activation, antiangiogenic plasmin fragment production, cell invasion, tumor development and metastasis. Compositions that modulate levels of p11 either up or down are demonstrated to be effective in reducing tumor development. Also disclosed are cancer treatment methods that employ compositions that modulate p11 activity and clonal cell lines and assays useful for the identification of compositions that modulate p11 activity. | 07-14-2011 |
20110172288 | Compositions and Methods for the Identification, Assessment, Prevention and Therapy of Thymic Lymphoma or Hamartomatous Tumours - The subject matter relates to newly discovered nucleic acid molecules and proteins associated with thymic lymphoma and hamartomatous tumors. Compositions and methods for detecting, characterizing, preventing, and treating human thymic lymphoma and hamartomatous tumors are provided. | 07-14-2011 |
20110172289 | MINOR GROOVE BINDER (MGB)-OLIGONUCLEOTIDE MIRNA ANTAGONISTS - Compositions and methods for inhibiting the actions of non-coding RNAs such as miRNAs and piRNAs are provided. The compositions comprise single or double stranded oligonucleotides conjugated with Minor Groove Binders (“MGBs”). The oligonucleotides can vary in length, can contain nucleotides having one or more modifications, and have regions that are substantially complementary to one or more mature miRNAs or piRNAs. | 07-14-2011 |
20110172290 | Isoforms of eIF-5A: Senescence-induced eIF5A; Wounding-induced elF-5A; Growth elF-5A; and DHS - The present invention relates to unique isoforms of eukaryotic initiation Factor 5A (“eIF-5A”): senescence-induced eIF-5A; wounding-induced eIF-5A; and growth eIF-5A, as well as polynucleotides that encode these three factors. The present invention also relates to methods involving modulating the expression of these factors. The present invention also relates to deoxyhypusine synthase (“DHS”), polynucleotides that encode DHS, and methods involving modulating the expression of DHS. | 07-14-2011 |
20110172291 | RNA INTERFERENCE FOR THE TREATMENT OF GAIN-OF-FUNCTION DISORDERS - The present invention relates to the discovery of an effective treatment for a variety of gain-of-function diseases, in particular, Huntington's disease (HD). The present invention utilizes RNA Interference technology (RNAi) against polymorphic regions in the genes encoding various gain-of-function mutant proteins resulting in an effective treatment for the gain-of-function disease. | 07-14-2011 |
20110172292 | ANTIDOTE OLIGOMERS - The present invention relates to antidote oligomeric compounds (oligomers), which target nucleotide based therapeutics in vivo, thereby providing a method of controlling the bioavailability and therefore the therapeutic activity and/or side effects of nucleotide based therapeutic in vivo. | 07-14-2011 |
20110172293 | Methods and Compositions for Modulating Angiogenesis - The present invention provides compositions comprising antisense nucleic acids that reduce miR-126 levels in an endothelial cell. The present invention provides compositions comprising a target protector nucleic acid. The present invention provides methods of modulating angiogenesis in an individual, the methods generally involving administering to the individual an effective amount of an agent that increases or that decreases the level of miR-126 in endothelial cells of the individual. | 07-14-2011 |
20110172294 | CYCLOHEXENYL NUCLEIC ACIDS ANALOGS - The present disclosure describes cyclohexenyl nucleic acid analogs, oligomeric compounds prepared therefrom and methods of using the oligomeric compounds. More particularly, cyclo-hexenyl nucleic acid analogs are provided, having one or more chiral substituents, that are expected to be useful for enhancing properties of oligomeric compounds including nuclease resistance and binding affinity. In some embodiments, the oligomeric compounds provided herein hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA. | 07-14-2011 |
20110178153 | METHODS OF TREATING CHEMORESISTANCE AND RELAPSE IN CANCER CELLS - Methods of treating or preventing chemoresistance or relapse growth of cancer cells are provided. Methods of treating or preventing resistance to tyrosine kinase based chemotherapeutic treatment in hematologic and solid tumors are provided. BCR-ABL drug resistance in chronic myelogenous leukemia (CML) and models for conducting further study on the same are presented. The methods comprise administering a therapeutically effective amount of one or more SIRT1 modulators to the cells or subject in need thereof. The methods may be administered in combination with, prior to or subsequent to chemotherapy or may be administered to counteract the effect of a spontaneous genetic mutation. Methods of using SIRT1 inhibitors to treat or prevent insulin and transferrin-induced resistance are also presented. A novel cell model to study mechanisms of acquired chemoresistance is also provided. | 07-21-2011 |
20110178154 | GENE EXPRESSION PROFILE THAT PREDICTS OVARIAN CANCER SUBJECT RESPONSE TO CHEMOTHERAPY - A gene profiling signature is disclosed herein. The gene signature can predict whether a subject with ovarian cancer will be chemorefractory, chemoresistant or chemosensitive. Thus, methods are disclosed for determining whether a subject with ovarian cancer is sensitive to treatment with a chemotherapeutic agent. Methods are also provided for increasing sensitivity to the chemotherapeutic agent if the presence of differential expression indicates that the ovarian cancer has a decreased sensitivity to chemotherapeutic agent. | 07-21-2011 |
20110178155 | SILENCING OF CSN5 GENE EXPRESSION USING INTERFERING RNA - The present invention provides compositions comprising nucleic acids that target CSN5 gene expression and methods of using such compositions to silence CSN5 gene expression. More particularly, the present invention provides unmodified and chemically modified interfering RNA molecules which silence CSN5 gene expression and methods of use thereof, e.g., for treating cell proliferative disorders such as cancer. The present invention also provides nucleic acid-lipid particles that target CSN5 gene expression comprising an interfering RNA molecule, a cationic lipid, a non-cationic lipid, and optionally a conjugated lipid that inhibits aggregation of particles. | 07-21-2011 |
20110178156 | Method of suppressing pRb deficiency-induced tumor formation - The present invention provides methods of determining a putative agent that inhibits tumorigenesis in retinoblastoma protein deficient cells, the methods comprising determining whether the putative agent decreases phosphorylation of threonine residue 187 of p27, decreases S-phase kinase-associated protein 2 interaction with p27 having a phosphorylated threonine residue 187, or an increase in apoptosis of retinoblastoma protein deficient cells. The present invention also provides the agent, the pharmaceutical composition, and methods of inhibiting, preventing and treating tumorigenesis in retinoblastoma deficient cells, the method comprising administration of the agent that decreases phosphorylation of threonine residue 187 of p27 or the S-phase kinase-associated protein 2 interaction with p27 having a phosphorylated threonine residue 187. | 07-21-2011 |
20110178157 | MODULATION OF HSP47 EXPRESSION - Provided herein are compositions, methods and kits for modulating expression of target genes, particularly heat shock protein 47 (hsp47). The compositions, methods and kits may include nucleic acid molecules (for example, short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA) or short hairpin RNA (shRNA)) that modulate a gene encoding hsp47, for example, the gene encoding human hsp47. The composition and methods disclosed herein may also be used in treating conditions and disorders associated with hsp47 such as liver fibrosis, pulmonary fibrosis, peritoneal fibrosis and kidney fibrosis. | 07-21-2011 |
20110178158 | Set of Antiangiogenic Molecules and Use Thereof - The present invention relates to an antiangiogenic pharmaceutical composition comprising at least one molecule selected from the group comprising an antisense nucleic acid molecule of VEGF 165, an antisense nucleic acid molecule of alpha-9 domain that forms integrin alpha-9/beta-1 and an antisense nucleic acid molecule of VAP-1, a molecule of VEGF 165-specific antibody, a molecule of antibody specific for the alpha-9 domain that forms integrin alpha-9/beta-1 and a molecule of VAP-1-specific antibody and/or combinations thereof and a pharmaceutically acceptable vehicle. The present invention also protects the use of said molecules for the production of a medicament. | 07-21-2011 |
20110178159 | INHIBITORY RNAS THAT REGULATE HEMATOPOIETIC CELLS - Provided are compositions and methods for preventing, treating, ameliorating or diagnosing conditions or diseases involving a myeloid cell proliferation disorder. Such compositions and methods target miRNA function myeloproliferative diseases. More particularly, such compositions and methods target miR-29a function in myeloid cell proliferation disorders. Also provided are methods for diagnosing risk or presence of a myeloid cell proliferation disorder in a subject. | 07-21-2011 |
20110178160 | Inhibition of Interaction of PSD93 and PSDS95 with nNOS and NMDA Receptors - PSD-95/SAP90 antisense-treated animals not only experience a significant decrease in MAC for isoflurane, but also experience an attenuation in the NMDA-induced increase in isoflurane MAC. PSD-95/SAP90 appears to mediate the role of the NMDA receptor in determining the MAC of inhalational anesthetics. Suppression of the expression of PSD-95/SAP90 in the spinal cord significantly attenuates responses to painful stimuli mediated through the N-methyl-D-aspartate receptor activation. In spinal cord neurons PSD-95/SAP90 interacts with the N-methyl-D-aspartate receptor subunits 2A/2B. Activation of the N-methyl-D-aspartate receptor in spinal hyperalgesia results in association of the N-methyl-D-aspartate receptor with PSD-95/SAP90. PSD-95/SAP90 is required for hyperalgesia triggered via the N-methyl-D-aspartate receptor at the spinal cord level. | 07-21-2011 |
20110184041 | PTHrP, ITS ISOFORMS AND ANTAGONIST THERETO IN THE DIAGNOSIS AND TREATMENT OF DISEASE - The present invention is directed to the diagnosis and treatment of diseases, preferably the inhibition of tumor growth and its progression to metastatic sites, through the inhibition of the action or production of PTHrP, its isoforms or PTHrP signalling. An aspect of the present invention is also directed to methods of inhibiting the PTHrP1-173 isoform through antagonists thereof, including monoclonal antibodies and siRNA directed there against. The invention may be applicable to many disease states, including but not limited to several types of cancer (including epithelial cancers such as breast, lung, colon, pancreatic, ovarian, prostate and squamous as well as melanoma) expressing PTHrP and its isoforms, alone or in combination with other therapeutic agents. | 07-28-2011 |
20110184042 | RNA Aptamer Specifically Binding to Carcinoembryonic Antigen and Use thereof - Provided are RNA aptamer specifically binding to cancer metastasis-inducing domain of CEA (Carcinoembryonic antigen), a composition for prevention and/or inhibition and/or diagnosis of cancer metastasis containing the same as an active ingredient, and a method of prevention and/or inhibition and/or diagnosis of cancer metastasis using the same. | 07-28-2011 |
20110184043 | INHIBITION OF ANGIOGENESIS - The present invention relates to the microRNA miR-126 and to inhibitors of miR-126 that regulate angiogenesis. The present invention provides compositions and methods for the inhibition of miR-126 and for the inhibition of angiogenesis in vivo. | 07-28-2011 |
20110184044 | METHODS AND COMPOSITIONS FOR ASSESSMENT OF PULMONARY FUNCTION AND DISORDERS - The present invention provides methods for the assessment of risk of developing chronic obstructive pulmonary disease (COPD), emphysema or both COPD and emphysema in smokers and non-smokers using analysis of genetic polymorphisms. | 07-28-2011 |
20110184045 | SILENCNG AND RIG-I ACTIVATION BY DUAL FUNCTION OLIGONUCLEOTIDES - The invention describes a method of determining whether a double stranded RNA (dsRNA) silences gene expression in a cell in vivo by an RNA interference (RNAi) mechanism by performing 5′-rapid amplification of cDNA ends (5′RACE) to detect the cleavage site of the mRNA in the RNA sample. | 07-28-2011 |
20110184046 | Compositions And Methods For Inhibiting Expression Of GSK-3 Genes - The invention relates to a double-stranded ribonucleic acid (dsRNA) targeting Glycogen Synthase Kinase-3 (GSK-3), and methods of using the dsRNA to inhibit expression of GSK-3. | 07-28-2011 |
20110184047 | RNAI MODULATION OF SCAP AND THERAPEUTIC USES THEREOF - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a SCAP gene (Human SCAP gene), comprising an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of a SCAP gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by Human SCAP expression and the expression of a SCAP gene using the pharmaceutical composition; and methods for inhibiting the expression of a SCAP gene in a cell. | 07-28-2011 |
20110190370 | MODULATION OF HIF1(ALPHA) AND HIF2(ALPHA) EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of HIF1α and/or HIF2α. The compositions comprise oligonucleotides, targeted to nucleic acid encoding HIF1α and HIF2α. Methods of using these compounds for modulation of HIF1α and/or HIF2α expression and for diagnosis and treatment of disease associated with expression of HIF1α and/or HIF2α are provided. | 08-04-2011 |
20110190371 | GENETIC SUPPRESSION AND REPLACEMENT - Methods and agents for suppressing expression of a mutant allele of a gene and providing a replacement nucleic acid are provided. The methods of the invention provide suppression effectors such as, for example, antisense nucleic acids, ribozymes, or RNAi, that bind to the gene or its RNA. The invention further provides for the introduction of a replacement nucleic acid with modified sequences such that the replacement nucleic acid is protected from suppression by the suppression effector. The replacement nucleic acid is modified at degenerate wobble positions in the target region of the suppression effector and thereby is not suppressed by the suppression effector. In addition, by altering wobble positions, the replacement nucleic acid can still encode a wild type gene product. The invention has the advantage that the same suppression strategy could be used to suppress, in principle, many mutations in a gene. Also disclosed is a transgenic mouse that expresses human rhodopsin (modified replacement gene) and a transgenic mouse that expresses a suppression effector targeting rhodopsin. Also disclosed in intraocular administration of siRNA. | 08-04-2011 |
20110190372 | COMPOSITIONS AND METHODS FOR TREATING INFLAMMATORY DISORDERS - Compositions and methods for antagonizing miRNAs that are overexpressed in chronic, non-healing wounds, as compared to healthy tissue, are disclosed. The miRNA antagonists are oligonucleotides that hybridize to selected pre-miRNA or mature miRNAs and prevent the miRNAs from binding to and downregulating their target mRNAs. Methods of using the miRNA antagonists to treat inflammatory disorders, including to promote healing of chronic, non-healing wounds and acute wounds are provided. | 08-04-2011 |
20110190373 | METHODS AND COMPOSITIONS FOR THE TREATMENT OR PREVENTION OF PATHOLOGICAL CARDIAC REMODELING AND HEART FAILURE - The invention relates to methods of treating or preventing pathological cardiac remodeling and/or preventing heart failure. These methods include the administration of a PDE1 inhibitor to a patient under conditions effective to treat or prevent pathological cardiac remodeling, and therefore heart failure that occurs as a result of such remodeling. Pharmaceutical compositions and delivery vehicles that can be used in the methods of the present invention are also disclosed herein. | 08-04-2011 |
20110190374 | METHODS OF TREATING A MEIOTIC KINESIN ASSOCIATED DISEASE - The invention provides methods of treating a meiotic kinase-associated disease, preferably the meiotic kinase HSET, by administering an inhibitor of the meiotic kinase. Preferably, the disease is associated with the presence of supernumerary centrosomes, such as cancer. Methods of inhibiting the growth of a tumor cell by contacting the cell with an inhibitor of a meiotic kinase, preferably HSET, are also provided. Screening methods for identifying inhibitors of the meiotic kinase HSET are also provided. Methods of selecting subjects for treatment with an inhibitor of a meiotic kinase, such as HSET, are also provided. | 08-04-2011 |
20110190375 | COMPOSITIONS COMPRISING CMYC SIRNA AND METHODS OF USE THEREOF - The present invention provides nucleic acid molecules that inhibit c-Myc expression. Methods of using the nucleic acid molecules are also provided. | 08-04-2011 |
20110190376 | RNAi-RELATED INHIBITION OF TNFa SIGNALING PATHWAY FOR TREATMENT OF MACULAR EDEMA - RNA interference is provided for inhibition of tumor necrosis factor α (TNFα) by silencing TNFα cell surface receptor TNF receptor-1 (TNFR1) mRNA expression, or by silencing TNFα converting enzyme (TACE/ADAM17) mRNA expression. Silencing such TNFα targets, in particular, is useful for treating patients having or at risk of developing macular edema. | 08-04-2011 |
20110190377 | METHOD FOR PRODUCING A CELL AND/OR TISSUE AND/OR DISEASE PHASE SPECIFIC MEDICAMENT - A DNAzyme is disclosed, which comprises:
| 08-04-2011 |
20110190378 | MIR 204, MIR 211, THEIR ANTI-MIRS, AND THERAPEUTIC USES OF SAME - Embodiments of the invention provide methods of preventing or treating detrimental epithelial cell proliferation, loss of epithelial cell differentiation, age-related macular degeneration and/or proliferative vitreal retinopathy in an individual comprising administering to an individual in need thereof an effective amount of miR 204, an effective amount of miR 211, or an effective amount of a mixture of miR 204 and miR 211. A further embodiment of the invention provides a method of facilitating the transport of a substance across an epithelium in an individual comprising administrating to an individual an effective amount of anti-miR 204, an effective amount of anti-miR 211, or an effective amount of a mixture of anti-miR 204 and anti-miR 211. Additional embodiments of the invention include pharmaceutical compositions of miR 204 and/or miR 211 and pharmaceutical compositions of anti-miR 204 and/or anti-miR 211. | 08-04-2011 |
20110190379 | PLANT PATHOGEN RESISTANCE - The present invention relates to a method for protecting a plant from infection by a pathogen by decreasing the presence of a plant hormone or reducing the responsiveness of a plant to a plant hormone. In particular, the invention related to infection by a necrotrophic pathogen, such as | 08-04-2011 |
20110190380 | METHODS FOR DELIVERY OF SIRNA TO BONE MARROW CELLS AND USES THEREOF - The present invention relates to a method for the delivery of therapeutic oligonucleotides to bone marrow, and in particular delivery of siRNA to a subset of bone marrow cells. The method comprises systemically administering siRNA to a subject in need thereof, to reduce or inhibit expression of a gene associated with a disease or disorder or to symptoms associated with a disease or disorder associated with the cells. The invention further relates to chemically modified siRNA compounds, to pharmaceutical compositions comprising such compounds and to methods of using such compounds and compositions in the treatment of disease. | 08-04-2011 |
20110190381 | RNAI-MEDIATED INHIBITION OF FRIZZLED RELATED PROTEIN-1 FOR TREATMENT OF GLAUCOMA - RNA interference is provided for inhibition of Frizzled Related Protein-1 mRNA expression, in particular, for treating patients having glaucoma or at risk of developing glaucoma. | 08-04-2011 |
20110190382 | Treatment of Cancer by Inhibition of IGFBPs and Clusterin - Agents that reduce the amount of IGFBP-2 and/or IGFBP-5 and that are known to be useful in the treatment of cancer result in increased expression of the protein clusterin. Since clusterin can provide protection against apoptosis, this secondary effect detracts from the efficacy of the therapeutic agent. In overcoming this, the present invention provides a combination of therapeutic agents that is useful in the treatment of cancer. The combination includes an agent that reduces the amount of IGFBP-2 and/or IGFBP-5 and that stimulates expression of clusterin as a secondary effect, and an oligonucleotide that is effective to reduce the amount of clusterin in cancer cells. In some embodiments of the invention, the agent that reduces IGFBP-2 and/or IGFBP-5 is a bispecific antisense species. The oligonucleotide may be an antisense oligonucleotide or an RNAi oligonucleotide. | 08-04-2011 |
20110190383 | Diagnostic, Prognostic and Therapeutic Uses of MIRs in Adaptive Pathways and/or Disease Pathways - Described herein are methods and compositions for the diagnosis, prognosis and treatment of various adaptive and/or of disease pathways by examining samples containing one or more miRs therein, and by formulating therapeutic agents therefrom. | 08-04-2011 |
20110196016 | Compositions and Methods for Inhibiting Expression of IKK2 Genes - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of an IKK2 gene. The invention also relates to a pharmaceutical composition comprising the dsRNA or nucleic acid molecules or vectors encoding the same together with a pharmaceutically acceptable carrier; methods for treating diseases caused by the expression of an IKK2 gene using said pharmaceutical composition; and methods for inhibiting the expression of IKK2 in a cell. | 08-11-2011 |
20110196017 | MICRO-RNA THAT PROMOTES VASCULAR INTEGRITY AND USES THEREOF - The present invention relates to the identification of a microRNA, designated miR-126, that is a regulator of vascular integrity in endothelial cells. This endothelial cell-restricted microRNA mediates developmental angiogenesis in vivo, and targeted deletion of miR-126 in mice causes leaky vessels, hemorrhaging, and partial embryonic lethality, due to a loss of vascular integrity and defects in endothelial cell proliferation, migration, and angiogenesis. These vascular abnormalities resemble the consequences of diminished signaling by angiogenic growth factors, such as VEGF and FGF. These findings have important therapeutic implications for a variety of disorders involving abnormal angiogenesis and vascular leakage. Methods of treating disease states characterized by ischemia, vascular damage, and pathologic neovascularization by modulating miR-126 function are disclosed. | 08-11-2011 |
20110196018 | Nuclease resistant external guide sequences for treating inflammatory and viral related respiratory diseases - External Guide Sequence (EGS) are described that target proteins required for generation and modification of the immunoglobulin and T-cell repertoire that are useful for treatment or prevention of inflammatory or related diseases. Formulations suitable for administration of an EGS for treatment of inflammatory or related disease are described. The formulations may be administered via inhalation, injection, or orally. The formulations may be in the form of an ointment, lotion, cream, gel, drop, suppository, spray, liquid, powder, granule, solution, suspension, capsule, or tablet. Methods of treating inflammatory or related diseases by administering an effective amount of an EGS in a pharmaceutically acceptable carrier are also described. In preferred embodiments, the disease is asthma, allergic rhinitis, food allergies, atopic skin disease such as eczema, IL-4 and/or IL-13 dependent malignancies, IL-4 and/or IL-13 dependent autoimmune diseases, atopic diseases, the flu, and diseases caused by IL-4 dependent replication of viruses. | 08-11-2011 |
20110196019 | Treatment of Cancer by Inhibition of IGFBPs and Clusterin - Agents that reduce the amount of IGFBP-2 and/or IGFBP-5 and that are known to be useful in the treatment of cancer result in increased expression of the protein clusterin. Since clusterin can provide protection against apoptosis, this secondary effect detracts from the efficacy of the therapeutic agent. In overcoming this, the present invention provides a combination of therapeutic agents that is useful in the treatment of cancer. The combination includes an agent that reduces the amount of IGFBP-2 and/or IGFBP-5 and that stimulates expression of clusterin as a secondary effect, and an oligonucleotide that is effective to reduce the amount of clusterin in cancer cells. In some embodiments of the invention, the agent that reduces IGFBP-2 and/or IGFBP-5 is a bispecific antisense species. The oligonucleotide may be an antisense oligonucleotide or an RNAi oligonucleotide. | 08-11-2011 |
20110201667 | COMPOSITIONS AND METHODS FOR SILENCING EBOLA VIRUS GENE EXPRESSION - The present invention provides compositions comprising therapeutic nucleic acids (e.g., interfering RNA such as siRNA) that target Ebola virus (EBOV) gene expression and methods of using such compositions to silence EBOV gene expression. More particularly, the invention provides unmodified and chemically modified interfering RNA which silence EBOV gene expression and methods of use thereof, e.g., for preventing or treating EBOV infections caused by one or more EBOV species such as Zaire EBOV. The invention also provides serum-stable nucleic acid-lipid particles comprising one or more interfering RNA molecules, a cationic lipid, and a non-cationic lipid, which can further comprise a conjugated lipid that inhibits aggregation of particles. Methods of silencing EBOV gene expression by administering one or more interfering RNA molecules to a mammalian subject are also provided. | 08-18-2011 |
20110201668 | REGULATION OF NEUROTRANSMITTER RELEASE THROUGH ANION CHANNELS - A novel use of anion channels, preferably Ca2+-activated anion channels (CAACs), in regulating release of neurotransmitters from neurons and/or astrocytes is provided. More specifically, CAAC activity regulators, agents for regulating neurotransmitter release comprising such CAAC activity regulators, and methods of screening agents for regulating neurotransmitter release using CAAC as a target. | 08-18-2011 |
20110201669 | METHODS AND COMPOSITIONS FOR THE DIAGNOSIS AND TREATMENT OF CANCER - The present invention relates to the diagnosis and treatment of cancer, and in particular breast cancer. Specifically, in some embodiments the invention relates to methods of diagnosing cancer, and in particular breast cancer, using an antibody specific for a gene product that localizes selectively to the endoplasmic reticulum of the cancer cell(s). In some embodiments, the invention relates to methods of treating cancer, and in particular breast cancer, by administering a composition comprising an RNA interference sequence (e.g., shRNA, RNAi and/or siRNA molecule) characterized by an ability to inhibit an mRNA molecule, which mRNA molecule is encoded by the C43 gene (SEQ ID NO: 1). The invention additionally relates to methods for detecting cancer cells by detecting reduced methylation of the C43 promoter, and methods for reducing cancer metastasis by using demethylation inhibitors that result in increased methylation of the C43 promoter. The invention additionally relates to an in vitro 3-dimensional assay for detecting migrating cells, identifying test agents and/or nucleotide sequences that alter cell migration. | 08-18-2011 |
20110201670 | OLIGORIBONUCLEOTIDES AND METHODS OF USE THEREOF FOR TREATMENT OF FIBROTIC CONDITIONS AND OTHER DISEASES - The invention relates to a double-stranded compound, preferably an oligoribonucleotide (siRNA), which down-regulates the expression of a human TGaseII gene at the post-transcriptional level. The invention also relates to a pharmaceutical composition comprising the compound, or a vector capable of expressing the oligoribonucleotide compound, and a pharmaceutically acceptable carrier. The present invention also contemplates a method of treating a patient suffering from a fibrotic disease such as pulmonary, kidney and liver fibrosis or ocular, scarring comprising administering to the patient the pharmaceutical composition in a therapeutically effective dose so as to thereby treat the patient. The invention also relates to treatment of fibrotic and other diseases by use of antibodies to TGaseII polypeptide. | 08-18-2011 |
20110201671 | Compositions And Methods For Inhibiting Expression Of A Gene From The Ebola Virus - The invention relates to a double-stranded ribonucleic acid (dsRNA) FOR INHIBITING THE expression of a gene from the Ebola virus. | 08-18-2011 |
20110207795 | SMAD7 INHIBITOR COMPOSITIONS AND USES THEREOF - The present invention relates to the use of a specific inhibitor of Smad7 expression or function for the preparation of a pharmaceutical composition for the prevention, amelioration or treatment of a disease of the central nervous system and/or diseases related and/or caused by said disease of the central nervous system. Furthermore, methods for preventing, ameliorating and/or treating such diseases are disclosed. | 08-25-2011 |
20110207796 | ALPHA-SYNUCLEIN KINASE - Agents and methods for treatment of diseases associated with Lewy body diseases (LBDs) in the brain of a patient are provided. Preferred agents include inhibitors of PLK2 kinase. | 08-25-2011 |
20110207797 | ENHANCED ANTISENSE OLIGONUCLEOTIDES - Described herein are gap-widened antisense oligonucleotides having improved therapeutic index as compared to 5-10-5 MOE gapmer antisense oligonucleotides of the same sequence. Also described are methods of reducing a target RNA in an animal using the gap-widened antisense oligonucleotides of the present invention. Further, are methods for selecting a gap-widened antisense oligonucleotides. | 08-25-2011 |
20110207798 | METHOD FOR TREATING BREAST CANCER USING ADENINE NUCLEOTIDE TRANSLOCATOR 2 (ANT2) SIRNA OR ANT2 SHRNA - The present invention relates to adenine nucleotide translocator 2 (ANT2) siRNA (small interfering RNA) or ANT2 shRNA (short hairpin RNA) suppressing the expression of ANT2 gene expression and anticancer agent containing the same. Furthermore, the present invention relates to methods for treating breast cancers or stem cells of a breast cancer by treating the same with ANT2 siRNA or ANT2 shRNA. In addition, the invention provides a method for inhibiting metastasis of breast cancer cells with ANT2 siRNA or ANT2 shRNA. | 08-25-2011 |
20110207799 | Compositions for Targeted Delivery of siRNA - The present invention is directed compositions for targeted delivery of RNA interference (RNAi) polynucleotides to hepatocytes in vivo. Targeted RNAi polynucleotides are administered together with co-targeted delivery polymers. Delivery polymers provide membrane penetration function for movement of the RNAi polynucleotides from outside the cell to inside the cell. Reversible modification provides physiological responsiveness to the delivery polymers. | 08-25-2011 |
20110213006 | Compositions and Methods for Treatment of Uncontrolled Cell Growth - Compositions and methods are provided for the treatment of cancer and other diseases of uncontrolled cell growth. Inhibitors of t-RNA and 28s rRNA are provided as are non-functional amino acid residues for charging of t-RNA molecules. Therapeutic application of the above inhibitors is also provided for the treatment of cancer. | 09-01-2011 |
20110213007 | MicroRNAs and uses thereof - Described herein are novel polynucleotides associated with prostate and lung cancer. The polynucleotides are miRNAs and miRNA precursors. Related methods and compositions that can be used for diagnosis, prognosis, and treatment of those medical conditions are disclosed. Also described herein are methods that can be used to identify modulators of prostate and lung cancer. | 09-01-2011 |
20110213008 | PHARMACEUTICAL CONTAINING HIF-1 ALPHA AND HIF-2 ALPHA EXPRESSION INHIBITOR - Provided is a pharmaceutical product exhibiting a high therapeutic effect in the treatment of retinal diseases associated with angiogenesis such as age-related macular degeneration, diabetic retinopathy and the like. A therapeutic agent for a retinal disease, containing a substance specifically inhibiting HIF-1α expression and a substance specifically inhibiting HIF-2α expression. The aforementioned inhibitory substances, which are active ingredients in the therapeutic agent of the present invention, are nucleic acids capable of inducing RNAi, antisense nucleic acids or ribozymes for HIF-1α and HIF-2α, or expression vectors thereof. | 09-01-2011 |
20110213009 | ADFP MODULATORS IN THE TREATMENT OF ACNE, OF SEBORRHOEIC DERMATITIS OR OF HYPERSEBORRHOEA - An in vitro or in vivo method for screening for candidate compounds for the preventive or curative treatment of acne, of seborrhoeic dermatitis or of skin disorders associated with hyperseborrhoea, includes determining the ability of a compound to modulate the expression or the activity of the adipose differentiation-related protein (ADFP), and also utilizes modulators of the expression or of the activity of this protein, for the treatment of acne, of seborrhoeic dermatitis or of skin disorders associated with hyperseborrhoea; methods for the in vitro diagnosis of or in vitro prognosis for these pathologies are also featured. | 09-01-2011 |
20110213010 | METHODS AND COMPOSITIONS FOR THE TREATMENT OF HUNTINGTON'S DISEASE - Methods and compositions for reducing expression of a mutant huntingtin (mHTT) protein in a cell are provided. Such methods include contacting the cell with an effective amount of a nucleic acid silencing agent targeting a differentiating polymorphism in RNA encoding the mHTT. | 09-01-2011 |
20110213011 | MODULATION OF SMAD3 EXPRESSION - Provided are compounds capable of inhibiting SMAD3 and compositions containing same as well as methods using such compounds for treating fibrosis and scarring. | 09-01-2011 |
20110213012 | Treatment of Cancers Characterized by Chromosomal Rearrangement of the NUT Gene - The present invention is directed, inter alia, to methods of treating NUT midline carcinoma (NMC) by administering compounds that promote increased histone acetylation. The invention also includes assay methods for determining the responsiveness of NMC to specific histone deacetylases and other compounds. | 09-01-2011 |
20110213013 | Complexes of Small-Interfering Nucleic Acids - The present invention relates to complexes of small-interfering nucleic acids (siNA). Compositions of siNA suited for administration to a patient are described. Methods for delivering the compositions are also described. | 09-01-2011 |
20110213014 | COMPOSITIONS AND METHODS FOR TOPICAL DELIVERY OF OLIGONUCLEOTIDES - The present invention relates to compositions and methods which enhance the delivery of oligonucleotides and other nucleosidic moieties via topical routes of administration. Preferred compositions include liposomes or penetration enhancers for the delivery of such moieties to dermal and/or epidermal tissue in an animal for investigative, therapeutic or prophylactic purposes. | 09-01-2011 |
20110213015 | OLIGONUCLEOTIDIC SEQUENCES ABLE TO SILENCE THE EXPRESSION OF THE CYCLIN D1-TROP2 CHIMERA AND USES THEREOF IN MEDICAL FIELD - The invention concerns RNA oligonucleotide sequences or sequences that are transcribed into RNA or analogous molecules able to silence the expression of the CYCLIN D1/TROP2 chimeric mRNA and their use in the treatment and the prevention of tumors. | 09-01-2011 |
20110218229 | SIRT1 Modulation of Adipogenesis and Adipose Function - SIRT1 regulates the physiology of cells of the adipocyte lineage. Modulators of SIRT1 activity can be used to ameliorate, treat, or prevent diseases and disorders associated with adipose physiology, e.g., obesity, an obesity-related disease, or a fat-related metabolic disorder. | 09-08-2011 |
20110218230 | NATRIURETIC PEPTIDE RELATED FRAGMENT IN CARDIOVASCULAR DISEASE - This disclosure provides an intracellular fragment of natriuretic peptide receptor A (NPRA), referred to herein as soluble natriuretic peptide receptor-related fragment (sNRF). It is shown herein that sNRF causes NP resistance. Based on these observations, methods of treating a cardiovascular disorder by inhibiting the activity of sNRF are disclosed. Assays are provided that use sNRF to screen agents for their ability to increase the biological activity of an NPR, for example agents that increase the sensitivity of NPR for NPs (such as atrial natriuretic peptide, ANP), or that decrease growth factor deleterious effects, or combinations thereof. Also provided are agents identified using the disclosed assays, and methods of using the agents, for example to treat or diagnose a cardiovascular disorder, such as heart failure. | 09-08-2011 |
20110218231 | Combination of Immuno Gene Therapy and Chemotherapy for Treatment of Cancer and Hyperproliferative Diseases - Pharmaceutical compositions comprising a nucleic acid, a gene delivery polymer, and at least one adjunctive chemotherapeutic drug for the treatment of mammalian cancer or hyperproliferative disorders and methods of using thereof for the treatment of mammalian cancer or hyperproliferative disorders by intratumoral, intraperitoneal or systemic injection. | 09-08-2011 |
20110224277 | Oligomeric Compounds And Compositions For Use In Modulation Of Small Non-Coding RNAs - Compounds, compositions and methods are provided for modulating the expression and function of small non-coding RNAs. The compositions comprise oligomeric compounds, targeted to small non-coding RNAs. Methods of using these compounds for modulation of small non-coding RNAs as well as downstream targets of these RNAs and for diagnosis and treatment of disease associated with small non-coding RNAs are also provided. | 09-15-2011 |
20110224278 | METHODS AND COMPOSITIONS FOR TREATING A SUBJECT FOR CENTRAL NERVOUS SYSTEM (CNS) INJURY - Methods for treating a central nervous system (CNS) injury in a subject are provided. Aspects of the methods include administering to the subject an effective amount of gamma aminobutyric acid (GABA) receptor signaling inhibitor to treat the subject for the CNS injury. Also provided are compositions finding use in embodiments of the methods. Methods and compositions of the invention find use in the treatment of a variety of different CNS injuries, including but not limited to, treating a subject for CNS injury associated with the occurrence of stroke. | 09-15-2011 |
20110224279 | ANTICANCER AGENT - The present invention relates to a nucleic acid molecule and a pharmaceutical or diagnostic composition for the therapeutic and/or prophylactic treatment or diagnosis of cancer and/or metastasis thereof, comprising a nucleic acid molecule, or an amino acid sequence related to Trim71 and/or its mammalian and non mammalian orthologs and/or a nucleic acid sequence of the gene encoding for Trim71 and/or its mammalian and non mammalian orthologs. | 09-15-2011 |
20110224280 | Pharmaceutical Composition Comprising Anti PCSK9 Oligomers - The present invention relates to oligomer compounds (oligomers), which target PCSK9 mRNA in a cell, leading to reduced expression of PCSK9. Reduction of PCSK9 expression is beneficial for the treatment of certain medical disorders, such as HYPERCHOLESTEROLEMIA AND RELATED DISORDERS. | 09-15-2011 |
20110224281 | RNA ANTAGONISTS TARGETING HSP70-2 - The present invention relates to LNA oligomer compounds (oligomers), which target Hsp70 and mRNA in a cell, leading to reduced expression of Hsp70. Reduction of Hsp70 expression is beneficial for the treatment of certain medical disorders, such as hyperproliferative diseases, such as cancer. | 09-15-2011 |
20110224282 | iRNA Agents Targeting VEGF - The features of the present invention relate to compounds, compositions and methods useful for modulating the expression of vascular endothelial growth factor (VEGF), such as by the mechanism of RNA interference (RNAi). The compounds and compositions include iRNA agents that can be unmodified or chemically-modified. | 09-15-2011 |
20110224283 | ANTISENSE MODULATION OF NUCLEAR HORMONE RECEPTORS - Provided are antisense oligonucleotides and other agents that target and modulate nuclear hormone receptors (NHRs) such as the glucocorticoid receptor (GR), compositions that comprise the same, and methods of use thereof. | 09-15-2011 |
20110224284 | PUTATIVE TUMOR SUPPRESSOR MICRORNA-101 MODULATES THE CANCER EPIGENOME BY REPRESSING THE POLYCOMB GROUP PROTEIN EZH2 - The present invention relates in general to microRNA profiling in disease. More specifically, the invention provides for methods and compositions of microRNA to inhibit the growth and formation of tumors. | 09-15-2011 |
20110230542 | Compositions and Methods for Inhibiting Expression of the PCSK9 Gene - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the PCSK9 gene (PCSK9 gene), comprising an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of the PCSK9 gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by PCSK9 gene expression and the expression of the PCSK9 gene using the pharmaceutical composition; and | 09-22-2011 |
20110230543 | OLIGORIBONUCLEOTIDE INHIBITORS OF NRF2 AND METHODS OF USE THEREOF FOR TREATMENT OF CANCER - The invention provides novel double stranded oligoribonucleotides that inhibit the Nrf2 gene. The invention also provides a pharmaceutical composition comprising one or more such oligoribonucleotides, and a vector capable of expressing the oligoribonucleotide. The present invention also relates to methods and compositions for treating or preventing the incidence or severity of a cancerous disease, particularly various lung cancers. | 09-22-2011 |
20110230544 | MODULATION OF C-REACTIVE PROTEIN EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of C-reactive protein. The compositions comprise oligonucleotides, targeted to nucleic acid encoding C-reactive protein. Methods of using these compounds for modulation of C-reactive protein expression and for diagnosis and treatment of disease associated with expression of C-reactive protein are provided. | 09-22-2011 |
20110230545 | EML4-ALK FUSION GENE - The present inventors found that a fusion gene present in some cancer patients is an oncogene. The present invention relates to a polypeptide as a novel fusion protein, a polynucleotide encoding the polypeptide, a vector comprising the polynucleotide, a transformed cell comprising the vector, a method for detecting the fusion protein or polynucleotide, a method for screening a therapeutic agent for cancer, and a method for treating cancer that is shown to be positive for the fusion gene. Further, the present invention relates kit, primer set, and probe useful in the detection of cancer that is shown to be positive for the fusion gene. | 09-22-2011 |
20110230546 | dsRNA COMPOSITIONS AND METHODS FOR TREATING HPV INFECTION - The invention relates to a double-stranded ribonucleic acid (dsRNA) for treating human papilloma virus (HPV) infection. The dsRNA comprises an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of an HPV Target gene selected from among HPV E1, HPV E6 and the human E6AP gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by HPV infection and the expression of the E6AP gene using the pharmaceutical composition; and methods for inhibiting the expression of the HPV Target genes in a cell. | 09-22-2011 |
20110237643 | Identification of a Novel repressor on IFN-lambda promoter and siRNA against ZEB1 and BLIMP-1 to increase IFN-lambda gene activity - The present invention is directed to the identification of a novel repressor located between ˜1.2 kb to ˜1.6 kb from the translation start site of the IFN-λ1 promoter. The present invention provides a method of using siRNAs against ZEB1 (binds to the repressor region) and BLIMP-1 (binds outside the repressor region) and increases the promoter activity of IFN-λ1 (i.e., increases the production of IFN-λ1 protein). siRNAs against ZEB1 mRNA or BLIMP-1 mRNA increase IFN-λ1 gene activity. There is provided a therapeutic application of siRNAs against ZEB1 and BLIMP-1 mRNAs in treating a mammal (including a human) by increasing the production of IFN-λ1 protein that promotes an anti-viral response as well as treats asthma diseases. | 09-29-2011 |
20110237644 | UBIQUITIN SPECIFIC PROTEASES RESPONSIBLE FOR MCL-1 STABILITY AND USES THEREOF - Use of a polypeptide selected from the group consisting of USP13, USP26, USP38, USP42 or USP46 as a screening tool for an agent for treating cancer. | 09-29-2011 |
20110237645 | USE OF RNAi TECHNOLOGY TO INHIBIT ASIC3 - In vitro studies using cells transfected with acid-sensing ion channel 3 (ASIC3) or acid-sensing ion channel 1 (ASIC1) cDNA, demonstrated that the miRNAs against mouse ASIC3 (miR844 and miR847) selectively inhibit mouse ASIC3, but not ASIC1 as detected by protein expression and responses to pH. When the RNAi agents, miR844 or miR847, were used in vivo, delivered into the muscle of mice using a replication-defective herpes simplex viral (HSV-1) vector, primary and secondary hyperalgesia were reduced after carrageenan-induced muscle inflammation. Accordingly, the present invention provides RNAi agents that target ASIC3, methods of preparing such RNAi agents, and methods of using them to modulate in a cell the level of ASIC3 or activity of an ASIC including at least one ASIC3. Modulation of ASIC3 activity or levels can be used for different purposes such as treating pain associated with the expression of ASIC3 and the like. | 09-29-2011 |
20110237646 | MODULATION OF TRANSTHYRETIN EXPRESSION FOR THE TREATMENT OF CNS RELATED DISORDERS - Compounds, compositions and methods are provided for modulating the expression of transthyretin in the brain, specifically the choroid plexus. The compositions comprise oligonucleotides, targeted to nucleic acid encoding transthyretin. Methods of using these compounds for modulation of transthyretin expression and for diagnosis and treatment of diseases and conditions associated with expression of transthyretin are provided. | 09-29-2011 |
20110237647 | INHIBITORY RNA FOR MODULATING THE MOLECULAR FUNCTION OF ZFAT GENE - The inhibitory RNA for inhibiting the expression of ZFAT gene according to this invention is a siRNA comprising a sense RNA having a base sequence of contiguous 20 to 20 bases, preferably 23 to 27 bases, of ZFAT mRNA and an anti-sense RNA having a base sequence complementary to the base sequence of the sense RNA or a shRNA comprising a double-stranded RNA (dsRNA) with the sense RNA connected to the anti-sense RNA via a loop sequence. | 09-29-2011 |
20110237648 | RNA INTERFERENCE IN SKIN INDICATIONS - The present invention relates to RNAi constructs with improved tissue and cellular uptake characteristics and methods of use of these compounds in dermal applications. | 09-29-2011 |
20110237649 | TREATMENT OF SIRTUIN 1 (SIRT1) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO SIRTUIN 1 - Oligonucleotide compounds modulate expression and/or function of Sirtuin 1 (SIRT1) polynucleotides and encoded products thereof. Methods for treating diseases associated with Sirtuin 1 (SIRT1) comprise administering one or more Oligonucleotide compounds designed to inhibit the SIRT1 natural antisense transcript to patients. | 09-29-2011 |
20110237650 | TREATMENT OF VASCULAR ENDOTHELIAL GROWTH FACTOR (VEGF) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO VEGF - Oligonucleotide compounds modulate expression and/or function of Vascular Endothelial Growth Factor (VEGF) polynucleotides and encoded products thereof. Methods for treating diseases associated with Vascular Endothelial Growth Factor (VEGF) comprise administering one or more Oligonucleotide compounds designed to inhibit the VEGF natural antisense transcript to patients. | 09-29-2011 |
20110237651 | TREATMENT OF ERYTHROPOIETIN (EPO) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO EPO - Oligonucleotide compounds modulate expression and/or function of Erythropoietin (EPO) polynucleotides and encoded products thereof. Methods for treating diseases associated with Erythropoietin (EPO) comprise administering one or more oligonucleotide compounds designed to inhibit the EPO natural antisense transcript to patients. | 09-29-2011 |
20110245318 | RNA SEQUENCE-SPECIFIC MEDIATORS OF RNA INTERFERENCE - The present invention relates to a | 10-06-2011 |
20110245319 | RNAi-Mediated Inhibition of RHO Kinase for Treatment of Ocular Disorders - RNA interference is provided for inhibition of Rho kinase mRNA expression for treating patients with ocular disorders, particularly for treating intraocular pressure, ocular hypertension and glaucoma. Rho kinase mRNA targets include mRNA for ROCK1 and ROCK2. | 10-06-2011 |
20110245320 | NUCLEASE RESISTANT DOUBLE-STRANDED RIBONUCLEIC ACID - This invention relates to modified double-stranded oligoribonucleic acid (dsRNA) having improved stability in cells and biological fluids, and methods of making and identifying dsRNA having improved stability, and of using the dsRNA to inhibit the expression or function of a target gene. | 10-06-2011 |
20110245321 | SIDEROPHORE-MEDIATED IRON UPTAKE IN BACTERIAL INFECTION - The present invention relates to methods of inhibiting | 10-06-2011 |
20110245322 | METHODS FOR IDENTIFYING AND COMPOUNDS USEFUL FOR INCREASING THE FUNCTIONAL ACTIVITY AND CELL SURFACE EXPRESSION OF CF-ASSOCIATED MUTANT CYSTIC FIBROSIS TRANSMEMBRANE CONDUCTANCE REGULATOR - The present invention relates to agents, and methods for identifying compounds, which agents and compounds result in the modulation of cellular trafficking of proteins in particular that of CF-associated mutant Cystic Fibrosis Transmembrane Conductance Regulator (CFTR). In addition, the invention relates to compositions and methods for the use thereof in treating conditions that are characterized by an ER-associated protein misfolding and abnormal cellular trafficking of disease-associated proteins, including cystic fibrosis (CF). | 10-06-2011 |
20110245323 | RIG-Like Helicase Innate Immunity Inhibits VEGF-Induced Tissue Responses - The present invention encompasses compositions and compounds as well as methods of their use for the regulation of a VEGF-induced tissue response. A VEGF-induced tissue response may include angiogenesis, inflammation, increased vascular permeability, increased vascular leak, hemorrhage, or mucus metaplasia. As such, the present invention encompasses methods of treating diseases where a VEGF-induced tissue response is part of the disease's clinical presentation. Specifically, the present invention provides compounds and compositions as well as methods for treating acute lung injury (ALI), acute respiratory distress syndrome (ARDS), asthma, chronic obstructive pulmonary disease (COPD), obstructive sleep apnea (OSA), idiopathic pulmonary fibrosis (IPF), tuberculosis, pulmonary hypertension, pleural effusion, and lung cancer. | 10-06-2011 |
20110245324 | ANTIMICROBIAL COMPOUNDS - The present invention relates to compounds that modulate the shikimate pathway and/or a pathway branching from the shikimate pathway in members of the Amoebida Order. In particular these compounds may be useful in the treatment or prevention of diseases caused or contributed to by members of the Amoebida Order. | 10-06-2011 |
20110245325 | PHARMACEUTICAL COMPOSITION FOR TREATMENT OF CANCER AND ASTHMA - Provided is a pharmaceutical composition for treating cancer and asthma. | 10-06-2011 |
20110251255 | Methods and Compositions for Inhibiting the Proliferation of Cancer Cells - A method of decreasing the expression of LIM kinase 1 in a cancer cell comprising; providing an oligonucleotide consisting of the sequence of SEQ ID NO: 1; providing a cancer cell comprising an mRNA encoding LIM kinase 1; and introducing the oligonucleotide into the cancer cell, wherein the oligonucleotide decreases the expression of LIM kinase 1 in the cancer cell. The method also provides compositions of an antisense RNA LIM kinase 1 that can be administered to an individual for the purpose of inhibiting a protein kinase pathway and which further comprises methods for treating and monitoring the proliferation and metastasis of cancer cells. A kit may be used in the detection and treatment of cancer. | 10-13-2011 |
20110251256 | USE OF TRIM72 AS A TARGET FOR MUSCLE AND HEART ENHANCER - The present invention relates to a new use of TRIM72 as a target for muscle enhancer and heart enhancer, more particularly to a composition for enhancing muscle or heart comprising an expression or action inhibitor of TRIM72 protein. The present invention further relates to a new TRIM mutant protein inducing muscle differentiation and hypertrophy and its gene. The inventors of the present invention have identified that TRIM72 overexpression inhibits myogenesis whereas TRIM72 knockdown enhances myogenesis, and first elucidated that TRIM72 is a negative regulator of skeletal muscle differentiation. Accordingly, the inhibition of TRIM72 acts exclusively on skeletal muscle and heart muscle, but does not affect IGF-I signaling pathway in other tissues. Therefore, a drug or gene therapy using TRIM72 as a target may be helpful in treating obesity and type 2 diabetes by promoting skeletal muscle differentiation, hypertrophy and energy consumption in adipose tissue and inducing strong muscle by promoting physiological hypertrophy of heart muscle, without cancer or other side effects. | 10-13-2011 |
20110251257 | METHODS AND COMPOSITIONS FOR TREATING NEUROLOGICAL DISEASE - This invention relates to methods and compositions for treating neurological disease, and more particularly to methods of delivering iRNA agents to neural cells for the treatment of neurological diseases. | 10-13-2011 |
20110251258 | RNAI CONSTRUCTS AND USES THEREOF - The invention relates to improved double-stranded RNAi constructs (sometimes referred to as “solo-rxRNA”) and uses thereof. The construct comprises a structure formed in some aspects of the invention by two identical single-stranded polynucleotides, with the structure having two double-stranded stem regions (each having less than 21 base pairs) and a loop or bulge having about 4 to 11 nucleotides on each strand. The construct is resistant to cleavage by Dicer or other Dicer-like RNase III enzymes and is capable of being loaded into a RISC complex to effect RNA interference. In addition, the nucleotides of the present hairpin constructs may be modified to greatly enhance functionality, such as stability and specificity. | 10-13-2011 |
20110251259 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF CD274/PD-L1 GENE - The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the CD274/PD-L1 gene, and methods of using such dsRNA compositions to inhibit expression of CD274/PD-L1. | 10-13-2011 |
20110251260 | NOVEL siRNAS AND METHODS OF USE THEREOF - The invention relates to compounds, in particular siRNAs, which inhibit the expression of specific human genes. The invention also relates to pharmaceutical compositions comprising such compounds and a pharmaceutically acceptable carrier. The present invention also provides a method of treating and/or preventing the incidence or severity of various diseases or conditions associated with the genes and/or symptoms associated with such diseases or conditions comprising administering to a subject in need of treatment for such disease or condition and/or symptom the compound or the pharmaceutical composition in a therapeutically effective dose so as to thereby treat the subject. The invention also provides antibodies which inhibit specified human polypeptides and pharmaceutical compositions comprising one or more such antibodies. | 10-13-2011 |
20110251261 | COMPOSITIONS AND METHODS FOR INHIBITION OF NUCLEIC ACIDS FUNCTION - The invention relates generally to compositions and methods for inhibiting the function of target nucleic acids by sequence specific binding. The compositions and methods can be used for inhibition of micro RNAs and other relatively short non-coding RNAs. | 10-13-2011 |
20110251262 | Compositions And Methods For Inhibiting Expression Of An RNA From West Nile Virus - This invention relates to double-stranded ribonucleic acid (dsRNA), and its use in mediating RNA interference to inhibit the expression of an RNA from the West Nile virus (WNV), and the use of the dsRNA to treat pathological processes mediated by WNV infection, such as viral encephalitis. | 10-13-2011 |
20110251263 | RNAi Modulation of the BCR-ABL Fusion Gene and Uses Thereof - The invention relates to compositions and methods for modulating the expression of Bcr-Abl, and more particularly to the down-regulation of Bcr-Abl mRNA and Bcr-Abl protein levels by oligonucleotides via RNA interference, e.g., chemically modified oligonucleotides. | 10-13-2011 |
20110257244 | CHEMICALLY MODIFIED OLIGONUCLEOTIDES AND SMALL MOLECULES FOR USE IN REDUCING MICRO RNA ACTIVITY LEVELS AND USES THEREOF - This invention relates generally to chemically modified oligonucleotides useful for modulating activity of microRNAs and pre-microRNAs. More particularly, the invention relates to single stranded chemically modified oligonucleotides for inhibiting microRNA and pre-microRNA activity and to methods of making and using the modified oligonucleotides. | 10-20-2011 |
20110257245 | METHODS OF IDENTIFYING REGULATORS OF CELLULAR PROTEOSTASIS - Embodiments of the present invention provide methods for identifying and utilizing regulators of cellular proteostasis as new therapeutic targets against protein misfolding diseases. | 10-20-2011 |
20110257246 | RNAi-MEDIATED INHIBITION OF HIF1A FOR TREATMENT OF OCULAR ANGIOGENESIS - RNA interference is provided for inhibition of HIF1A mRNA expression for treating patients with ocular angiogenesis, particularly for treating retinal edema, diabetic retinopathy, sequela associated with retinal ischemia, posterior segment neovascularization (PSNV), and neovascular glaucoma, and for treating patients at risk of developing such conditions. | 10-20-2011 |
20110257247 | Method of Treating Neurodegenerative Disease - Aspects featured in the invention relate to compositions and methods for inhibiting alpha-synuclein (SNCA) gene expression, such as for the treatment of neurodegenerative disorders. An anti-SNCA agent featured herein that targets the SNCA gene can have been modified to alter distribution in favor of neural cells. | 10-20-2011 |
20110257248 | RNAi-RELATED INHIBITION OF TNFa SIGNALING PATHWAY FOR TREATMENT OF OCULAR ANGIOGENESIS - RNA interference is provided for inhibition of tumor necrosis factor α (TNFα) by silencing TNFα cell surface receptor TNF receptor-1 (TNFR1) mRNA expression, or by silencing TNFα converting enzyme (TACE/ADAM17) mRNA expression. Silencing such TNFα targets, in particular, is useful for treating patients having a TNFα-related condition or at risk of developing a TNFα-related condition, such as ocular angiogenesis, retinal ischemia, and diabetic retinopathy. | 10-20-2011 |
20110257249 | DRUG CARRIERS - Compositions that can include a cationic polymeric carrier, targeting agent, and therapeutic agent are disclosed herein. The therapeutic agent may have a therapeutic activity such as inhibiting fibrosis within a target organ or tissue or inhibiting the growth of a cancer cell. | 10-20-2011 |
20110263675 | METHODS OF MODULATING MESENCHYMAL STEM CELL DIFFERENTIATION - The present disclosure includes compositions and methods for modulating the differentiation of cells having osteogenic differentiation potential (such as mesenchymal stem cells (MSCs)) towards the osteogenic fate, and for obtaining diagnostic and prognostic information relating to diseases and disorders characterized by defects in osteogenic differentiation. The compositions include miRNAs, rm′RNA mimics, miRNA inhibitors, and siRNAs. | 10-27-2011 |
20110263676 | SMALL INTERFERING RNA FOR GENE KNOCKDOWN OF THE SUBCUTANEOUS N-METHYL-D-ASPARTATE RECEPTOR NR1 SUBUNIT, AND IT'S APPLICATION ON PHARMACEUTICS - A small interfering RNA for gene knockdown of the N-methyl-D-aspartate receptor NR1 subunit comprises 21 to 25 ribonucleic acids, which are homologous to the RNA sequence of N-methyl-D-aspartate receptor NR1 subunit. A method of using the small interfering RNA, applying the small interfering RNA on subcutaneous tissues temporary interfere with the genetic expression of the NMDA receptor NR1 subunit in hypoderm. A use of the small interfering RNA on pharmaceutics, applying the small interfering RNA manufacture into new analgesic drugs for moderating the inflammatory pain or intolerable chronic pain, especially on clinical chronic pain and burn pain patients. An analgesic drug for skin inflammatory pain comprising: the small interfering RNA and a siRNA acceptable vehicle. | 10-27-2011 |
20110263677 | GOS2 MODULATORS IN THE TREATMENT OF ACNE, OF SEBORRHOEIC DERMATITIS OR OF HYPERSEBORRHOEA - An in vitro or in vivo method for screening for candidate compounds for the preventive or curative treatment of acne, of seborrhoeic dermatitis or of skin disorders associated with hyperseborrhoea, includes determining the ability of a compound to modulate the expression or the activity of G0/G1 switch protein 2 (GOS2), and also utilizes modulators of the expression or of the activity of this protein, for the treatment of acne, of seborrhoeic dermatitis or of skin disorders associated with hyperseborrhoea; methods for the in vitro diagnosis of or in vitro prognosis for these pathologies are also featured. | 10-27-2011 |
20110263678 | INHIBITORS OF TGF-R SIGNALING FOR TREATMENT OF CNS DISORDERS - The present invention relates to the use of oligonucleotides for the preparation of a pharmaceutical composition for the prevention or treatment of a disease, wherein neurogenesis and/or neuroregeneration has a beneficial effect, in particular a disease like Morbus Alzheimer, Morbus Parkinson, Lewy Body Dementia,—Amyotrophic Lateral Sclerosis, Spinocerebellar Atrophies, Creutzfeldt Jakob Disease, Frontemporal Dementia, Morbus Pick, AIDS Dementia Complex, Vascular Dementia, Progressive Supranuclear Palsy, Corticobasal Degeneration, Multisystem-Atrophy, Hallervorden Spatz Disease, Huntington's disease, Stroke, Traumatic Brain and spinal cord Injury, Retinitis Pigmentosa, Macular Degeneration, Glaucoma, Cochlea Degeneration, Depression, Schizophrenia, Multiple Sclerosis, and developmental neurodegeneration. | 10-27-2011 |
20110263679 | C12ORF48 AS A TARGET GENE FOR CANCER THERAPY AND DIAGNOSIS - Objective methods for diagnosing a predisposition to developing pancreatic cancer and prostate cancer, particularly pancreatic ductal adenocarcinoma (PDAC) and castration-resistant prostate cancer, are described herein. In one embodiment, the diagnostic method involves the step of determining an expression level of C12ORF48 using siRNAs targeting the C12ORF48 gene. The invention also features products such as siRNAs as well as to compositions containing them. The present invention further provides methods of screening for therapeutic agents useful in the treatment of C12ORF48 associated disease, such as a cancer, e.g. pancreatic cancer and prostate cancer, as well as methods of inhibiting the cell growth and treating or alleviating one or more disease symptoms. The invention also features products such as double stranded molecules, as well as vectors and compositions containing them. | 10-27-2011 |
20110263680 | REDUCED SIZE SELF-DELIVERING RNAI COMPOUNDS - The present invention relates to RNAi constructs with minimal double-stranded regions, and their use in gene silencing. RNAi constructs associated with the invention include a double stranded region of 8-14 nucleotides and a variety of chemical modifications, and are highly effective in gene silencing. The RNAi constructs may be, for instance, miRNA constructs that are miRNA modulators. | 10-27-2011 |
20110263681 | Organic Compositions to Treat Beta-ENaC-Related Diseases - The present disclosure relates to RNAi agents useful in methods of treating Beta-ENaC-related diseases such as cystic fibrosis, pseudohypoaldosteronism type 1 (PHA1), Liddle's syndrome, hypertension, alkalosis, hypokalemia, and obesity-associated hypertension, using a therapeutically effective amount of a RNAi agent to Beta-ENaC. | 10-27-2011 |
20110263682 | METHODS AND MEANS FOR EFFICIENT SKIPPING OF AT LEAST ONE OF THE FOLLOWING EXONS OF THE HUMAN DUCHENNE MUSCULAR DYSTROPHY GENE: 43, 46, 50-53 - The invention relates a method wherein a molecule is used for inducing and/or promoting skipping of at least one of exon 43, exon 46, exons 50-53 of the DMD pre-mRNA in a patient, preferably in an isolated cell of a patient, the method comprising providing said cell and/or said patient with a molecule. The invention also relates to said molecule as such. | 10-27-2011 |
20110263683 | RNA Interference Mediated Inhibition of Gene Expression Using Chemically Modified Short Interfering Nucleic Acid (siNA) - The present invention concerns methods and reagents useful in modulating gene expression in a variety of applications, including use in therapeutic, diagnostic, target validation, and genomic discovery applications. Specifically, the invention relates to synthetic chemically modified small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against target nucleic acid sequences. The small nucleic acid molecules are useful in the treatment of any disease or condition that responds to modulation of gene expression or activity in a cell, tissue, or organism. | 10-27-2011 |
20110263684 | Lipid Formulated Compositions and Methods for Inhibiting Expression of Serum Amyloid A Gene - The invention relates to a double-stranded ribonucleic acid (dsRNA) targeting a Serum Amyloid A (SAA) gene, and methods of using the dsRNA to inhibit expression of SAA. | 10-27-2011 |
20110263685 | Method for Identification of Sensitivity of a Patient to Telomerase Inhibition Therapy - The invention provides methods for determining the susceptibility of cancer patients to developing adverse reactions if treated with a telomerase inhibitor drug by measurement of telomere length in appropriate cells of the patient prior to initiation of the telomerase inhibitor treatment. | 10-27-2011 |
20110263686 | ANTISENSE OLIGONUCLEOTIDES FOR INDUCING EXON SKIPPING AND METHODS OF USE THEREOF - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202. | 10-27-2011 |
20110269813 | Gene Silencing by Single-Stranded Polynucleotides - The present invention relates to compositions and methods for concurrently activating antisense and double-stranded RNase (dsRNase) mechanisms for inhibiting expression of a targeted gene, by delivering a single stranded bifunctional chimeric DNA/RNA oligonucleotide optimized for siRNA activity as well as antisense activity, into the nucleus of a target cell. | 11-03-2011 |
20110269814 | 2'-F MODIFIED RNA INTERFERENCE AGENTS - This invention relates to a method of modulating the expression of a target gene in an organism comprising administering an iRNA agent, wherein the iRNA comprises at least one 2′-deoxy-2′-fluoro (2′-F) nucleotide in the antisense strand and at least one modified nucleotide in the sense strand. The invention also relates to compositions comprising a single-stranded oligonucleotide that contains at least one 2′-deoxy-2′-fluoro (2′-F) nucleotide. siRNA molecule containing these oligonucleotides have decreased immunogenicity. | 11-03-2011 |
20110269815 | METHODS OF REDUCING CELLULAR PROLIFERATION BY INHIBITING ACSVL3 - The present invention is directed to methods of reducing cancer cell proliferation and/or treating cancer by administering a therapeutically effective amount of a compound that inhibits the activity of ACSVL3. | 11-03-2011 |
20110269816 | Inhibition of Viral Gene Expression Using Small Interfering RNA - The invention provides methods, compositions, and kits comprising small interfering RNA (shRNA or siRNA) that are useful for inhibition of viral-mediated gene expression. Small interfering RNAs as described herein can be used in methods of treatment of HCV infection. ShRNA and siRNA constructs targetING the internal ribosome entry site (IRES) sequence of HCV are described. | 11-03-2011 |
20110269817 | COMPOSITIONS AND METHODS RELATED TO SIRT1 FUNCTION - The invention relates to modulation of circadian rhythm and underlying biological processes. | 11-03-2011 |
20110269818 | MODULATION OF PRION EXPRESSION - Disclosed herein are compounds and methods for decreasing PrP and preventing, ameliorating, or treating a prion disease or conformational neurodegenerative disorder, in an individual in need thereof. Examples of disease conditions that can be ameliorated with the administration of antisense compounds targeted to PrP include Creutzfeldt-Jakob disease (CJD); variant Creutzfeldt-Jakob Disease (vCJD); Gerstmann-Straussler-Scheinker syndrome; fatal familial insomnia; kuru; Bovine Spongiform Encephalopathy (BSE), e.g. “mad cow disease”; Chronic Wasting Disease (CWD); scrapie; transmissible mink encephalopathy; feline spongiform encephalopathy; ungulate spongiform encephalopathy; Alzheimer's disease; Parkinson's disease; Huntington's disease; and Amyotrophic Lateral Sclerosis (ALS). | 11-03-2011 |
20110269819 | METHODS AND COMPOSITIONS FOR TARGETING SKIP - Provided herein are methods and compositions for modulating apoptosis by targeting SKIP (Ski-interacting protein) activity. Methods of increasing DNA damage-induced cell death in cancer cells, and reducing DNA damage-induced cell death in normal cells are provided. | 11-03-2011 |
20110269820 | SPINAL MUSCULAR ATROPHY TREATMENT VIA TARGETING SMN2 CATALYTIC CORE - The present invention is directed to methods and compositions for blocking the effect of the intronic inhibitory splicing region of intron 7 of the SMN2 gene. The compositions and methods of the instant invention include short oligonucleotide reagents (e.g., oligoribonucleotides) that effectively target sites in the SMN2 pre-mRNA, thereby modulating the splicing of SMN2 pre-mRNA to include exon 7 in the processed transcript. The short target regions are 8-mers and 5-mers and also include the identification of a single nucleotide base that is essential for initiating a long distance stearic inhibitory interactions as well as novel targets distant from intron 7 which block the intronic inhibitory splicing of the same. These short target regions and concomitant inhibitory blocking oligonucleotides are less expensive and easier to manufacture and are small enough to cross the blood brain barrier. | 11-03-2011 |
20110269821 | 5' AND 2' BIS-SUBSTITUTED NUCLEOSIDES AND OLIGOMERIC COMPOUNDS PREPARED THEREFROM - The present invention provides modified nucleosides and oligomeric compounds prepared therefrom. More particularyl, the present invention provides modified nucleosides having at least one 5′-substituent and a 2′-O-substituent, oligomeric compounds comprising at least one of these modified nucleosides and methods of using the oligomeric compounds. In some embodiments, the oligomeric compounds provided herein are expected to hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA. | 11-03-2011 |
20110269822 | RNAi-Mediated Inhibition of Histamine Receptor H1-Related Conditions - RNA interference is provided for inhibition of histamine receptor H1 mRNA expression, in particular, for treating patients having an HRH1-related condition or at risk of developing an HRH1-related condition such as allergic conjunctivitis, ocular inflammation, dermatitis, rhinitis, asthma, or allergy. | 11-03-2011 |
20110269823 | Compositions And Methods For Inhibiting Expression Of The HAMP Gene - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the HAMP gene (HAMP gene), comprising an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of the HAMP gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by HAMP gene expression and the expression of the HAMP gene using the pharmaceutical composition. | 11-03-2011 |
20110275697 | REGULATION OF CYCLIN D - The present invention provides methods for modulating the level or activity of cyclin D by inhibiting EGLN2 expression or activity. The methods are particularly useful for treating or preventing a disorder associated with elevated cyclin D levels or activity, such as cancer. | 11-10-2011 |
20110275698 | "TEST AND TREAT" STRATEGY FOR TREATING TRANSFORMING HPV INFECTION - The invention is concerned with a “test and treat” method of screening and directly treating female subjects having transforming or abnormal human papillomavirus (HPV) infection. | 11-10-2011 |
20110275699 | Treatment For Obesity And Diabetes - The present disclosure relates to strategies aimed at treating/preventing obesity and diabetes. In particular, obesity is a major public health problem, associated with detrimental metabolic consequences such as diabetes, cardiovascular disease, stroke, osteoarthritis and even some types of cancer. Thus, application of DNA-PK inhibitors, that has been connected to the signaling pathway involved in the formation of fat from carbohydrate in the liver, could potentially be a pharmacological target for regulation of obesity and diabetes due to a diet high in carbohydrates. Therefore, the invention finds application in the fields of obesity, diabetes, and lipogenesis research and therapy. | 11-10-2011 |
20110281931 | RNA SEQUENCE-SPECIFIC MEDIATORS OF RNA INTERFERENCE - The present invention relates to a Drosophila in vitro system which was used to demonstrate that dsRNA is processed to RNA segments 21-23 nucleotides (nt) in length. Furthermore, when these 21-23 nt fragments are purified and added back to Drosophila extracts, they mediate RNA interference in the absence of long dsRNA. Thus, these 21-23 nt fragments are the sequence-specific mediators of RNA degradation. A molecular signal, which may be their specific length, must be present in these 21-23 nt fragments to recruit cellular factors involved in RNAi. This present invention encompasses these 21-23 nt fragments and their use for specifically inactivating gene function. The use of these fragments (or chemically synthesized oligonucleotides of the same or similar nature) enables the targeting of specific mRNAs for degradation in mammalian cells, where the use of long dsRNAs to elicit RNAi is usually not practical, presumably because of the deleterious effects of the interferon response. This specific targeting of a particular gene function is useful in functional genomic and therapeutic applications. | 11-17-2011 |
20110281932 | Methods to enhance T-cell mediated immune response - The present invention provides methods for restoring or enhancing T cell mediated immune response in individuals of middle and advanced age. | 11-17-2011 |
20110281933 | METHODS AND COMPOSITIONS FOR THE MANAGEMENT OF CARDIOVASCULAR DISEASE WITH OLIGONUCLEOTIDES - Disclosed are compositions and methods for treating cardiovascular disease and reducing the adverse effects induced by the administration of statins. In particular, disclosed is the use of antisense compounds to augment the expression of mirR-33 and associated genetic elements. In particular methods of the treatment of cardiovascular disease and the modulation of miR-33 levels is disclosed as well as treatment of the secondary effects including cholestasis, induced by the administration of statins is disclosed. Also disclosed is the treatment of Benign Recurrent Intrahepatic Cholestasis and reverse cholesterol transport. The disclosed methods and compositions may be practiced separately or co-administered with satins to reduce or treat statin induced secondary effects. | 11-17-2011 |
20110281934 | MICELLES OF HYDROPHILICALLY SHIELDED MEMBRANE-DESTABILIZING COPOLYMERS - Provided herein are micelles comprising a plurality of copolymers. In certain instances, micelles provided herein are pH sensitive particles. | 11-17-2011 |
20110281935 | Combination Therapy Based on SRC and Aurora Kinase Inhibition for the Treatment of Cancer - Compositions which act synergistically to inhibit the growth of cancer cells and methods of use thereof are disclosed. | 11-17-2011 |
20110281936 | METHODS OF TREATING COGNITIVE DISORDERS BY INHIBITION OF GPR12 - The present invention provides methods for screening a pharmaceutical agent for its ability to modulate long term memory formation, performance of a hippocampal-dependent cognitive task or Gpr12 function. The present invention also provides methods for modulating long term memory formation or performance of a hippocampal-dependent cognitive task by modulating Gpr12-dependent protein expression. The present invention further provides methods for treating a defect in long term memory formation by inhibiting Gpr12 function and methods for treating a defect in performance of a hippocampal-dependent cognitive task by inhibiting Gpr12 function. | 11-17-2011 |
20110288147 | Compositions and methods for the specific inhibition of gene expression by DSRNA containing a tetraloop - The invention features compositions and methods that are useful for reducing the expression or activity of a specified gene in a eukaryotic cell. | 11-24-2011 |
20110288148 | TRIGGERED COVALENT PROBES FOR IMAGING AND SILENCING GENETIC EXPRESSION - The present invention relates to the use of cross-linking probes to covalently bind probes to nucleic acid targets. In some embodiments, the probe comprises an initiator region that is able to bind to a first portion of a target nucleic acid, a probe region linked too the initiator region that is able to bind to a second region of the target nucleic acid and that comprises one or more cross-linkers, and a blocking region hybridized to the probe region. | 11-24-2011 |
20110288149 | Method of protecting against heart failure - The present invention relates, in general, to heart failure, and, in particular to a method of reducing the risk of heart failure, particularly in patents with established cardiomyopathy. | 11-24-2011 |
20110288150 | Oligonucleotides for Suppressing Cancer Cell Invasion and Migration - Provided herein is a method for detection of migratory and invasive cancer cells based on a number of marker nucleic acids differentially expressed in migratory/invasive cancer cells relative to nonmigratory/noninvasive cancer cells. Also disclosed are antisense oligonucleotides of the marker nucleic acids and uses thereof for suppressing cancer cell migration and invasion. | 11-24-2011 |
20110288151 | METHODS OF CHARACTERIZING BREAST CANCER AND IDENTIFYING TREATMENTS FOR SAME - This application describes antibodies to P-Rex 1, and methods of detecting breast cancer, and methods of treatments for the same. | 11-24-2011 |
20110288152 | PSMA BINDING LIGAND-LINKER CONJUGATES AND METHODS FOR USING - Described herein are prostate specific membrane antigen (PSMA) binding conjugates that are useful for targeting prostate cancer cells. Also described herein are compositions containing them and methods of using the conjugates and compositions. Also described are processes for manufacture of the conjugates and the compositions containing them. | 11-24-2011 |
20110288153 | TRANSLATION FACTORS AS ANTI-AGING DRUG TARGETS - In certain embodiments this invention pertains to the discovery that inhibition of the expression and/or activity of eukaryotic initiation factor 4A (eIF4A) inhibits the aging process. Accordingly, in certain embodiments, methods are provided for inhibiting/slowing aging. The methods typically involve administering to a mammal an agent that inhibits the expression and/or activity of eukaryotic initiation factor 4A (eIF4A) in an amount sufficient to inhibit expression or activity of EIF4A, where the agent is not resveratrol. | 11-24-2011 |
20110288154 | RNA Interference Mediated Inhibition of Epithelial Sodium Channel (ENaC) Gene Expression Using Short Interfering Nucleic Acid (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of ENaC gene expression and/or activity, and/or modulate a ENaC gene expression pathway. Specifically, the invention relates to double-stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules that are capable of mediating or that mediate RNA interference (RNAi) against ENaC gene expression. | 11-24-2011 |
20110288155 | SIRNA COMPOUNDS AND METHODS OF USE THEREOF - The present application relates to double stranded oligonucleotide inhibitors of target genes, pharmaceutical compositions comprising same and the use of such molecules to treat, inter alia, neurodegenerative disorders including Alzheimer's disease and Amyotrophic Lateral Sclerosis, eye diseases including glaucoma and ION, acute renal failure, hearing loss, acute respiratory distress syndrome and in preventing or treating ischemia-reperfusion injury in organ transplant patients. | 11-24-2011 |
20110288156 | Nucleic Acids, Polypetides, and Methods for Modulating Apoptosis - The present invention relates to isolated and/or purified rat apoptosis-specific eucaryotic initiation Factor-5A (eIF-5A) and deoxyhypusine synthase (DHS) nucleic acids and polypeptides. The present invention also relates to methods of modulating apoptosis using apoptosis-specific eIF-5A and DHS, and antisense oligonucleotides and expression vectors of apoptosis-specific and DHS useful in such methods. | 11-24-2011 |
20110288157 | RNAi-Mediated Inhibition of Spleen Tyrosine Kinase-Related Inflammatory Conditions - RNA interference is provided for inhibition of spleen tyrosine kinase (Syk) mRNA expression, in particular, for treating patients having a Syk-related inflammatory condition or at risk of developing a Syk-related inflammatory condition such as allergic conjunctivitis, ocular inflammation, dermatitis, rhinitis, asthma, allergy, or mast-cell disease. | 11-24-2011 |
20110288158 | METHODS AND COMPOSITIONS FOR THE SPECIFIC INHIBITION OF GENE EXPRESSION BY DOUBLE-STRANDED RNA - The invention is directed to compositions and methods for selectively reducing the expression of a gene product from a desired target gene in a cell, as well as for treating diseases caused by the expression of the gene. More particularly, the invention is directed to compositions that contain double stranded RNA (“dsRNA”), and methods for preparing them, that are capable of reducing the expression of target genes in eukaryotic cells. The dsRNA has a first oligonucleotide sequence that is between 25 and about 30 nucleotides in length and a second oligonucleotide sequence that anneals to the first sequence under biological conditions. In addition, a region of one of the sequences of the dsRNA having a sequence length of at least 19 nucleotides is sufficiently complementary to a nucleotide sequence of the RNA produced from the target gene to trigger the destruction of the target RNA by the RNAi machinery. | 11-24-2011 |
20110294865 | METHODS OF DETECTING A FRAGMENT OF NEUROSECRETORY PROTEIN VGF FOR DIAGNOSING ALZHEIMER'S DISEASE - The present invention provides a neurosecretory protein VGF peptide useful in qualifying Alzheimer's disease status in a patient. In particular, this peptide and modified forms thereof may be used to classify a subject sample as Alzheimer's disease or non-Alzheimer's disease. The peptide biomarker can be detected by SELDI mass spectrometry. | 12-01-2011 |
20110294866 | PHARMACEUTICAL COMPOSITION FOR TREATING DEMENTIA COMPRISING SHRNA INHIBITING S100A9 EXPRESSION - Disclosed is a composition for treating dementia including shRNA to inhibit expression of S100a9. More particularly, the present disclosure describes a composition for prevention or treatment of dementia which includes shRNA having a nucleotide sequence defined by SEQ. ID No. 1 or 2 or a mixture thereof wherein the nucleotide sequence is complementarily bonded to mRNA of S100a9 in order to inhibit expression of S100a9, as well as a method for prevention or treatment of dementia, including administering the foregoing shRNA into a mammalian cell including a human cell or in vitro established mammalian cell-line, in order to inhibit expression of S100a9 protein. | 12-01-2011 |
20110294867 | SENSIZITATION OF CANCER CELLS TO THERAPY USING SINA TARGETING GENES FROM THE 1P AND 19Q CHROMOSOMAL REGIONS - The invention relates to the identification of genes involved in resistance of cancer cells to therapy, to short nucleic acid molecules which inhibit the expression of these genes by RNA interference and to their use as adjuvant in cancer therapy, to sensitize cancer cells to conventional anticancer agents; the short nucleic acid molecules are double-stranded short interfering nucleic acid molecules including a sense and an antisense region, wherein the sense region includes a nucleotide sequence that is selected from the group consisting of: the sequences SEQ ID NO: 15, 11, 13, 14, 30, 31, 38, 46, 64 and 70 and the sequences having at least 70% identity, preferably at least 80% identity, more preferably at least 90% identity with the sequences, and the antisense region includes a nucleotide sequence that is complementary to the sense region. | 12-01-2011 |
20110294868 | MODULATION OF TRANSTHYRETIN EXPRESSION - Provided herein are methods, compounds, and compositions for reducing expression of transthyretin mRNA and protein in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate transthyretin amyloidosis, or a symptom thereof. | 12-01-2011 |
20110294869 | SELF DELIVERING BIO-LABILE PHOSPHATE PROTECTED PRO-OLIGOS FOR OLIGONUCLEOTIDE BASED THERAPEUTICS AND MEDIATING RNA INTERFERENCE - Disclosed herein are compositions and methods for generating ribo-nucleic neutral (RNN) or deoxyribo-nucleic-neutral (DNN) polynucleotides with reduced anionic charge, for improved intracellular delivery. Also disclosed herein are methods of using RNN and DNN compositions. | 12-01-2011 |
20110294870 | TREATMENT OF TUMOR SUPPRESSOR GENE RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO THE GENE - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Tumor Suppressor genes, in particular, by targeting natural antisense polynucleotides of Tumor Suppressor genes. The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of Tumor Suppressor genes. | 12-01-2011 |
20110294871 | LIPIDS, LIPID COMPLEXES AND USE THEREOF - The present invention is related to a compound according to formula (I), | 12-01-2011 |
20110301218 | MODIFIED snRNAs FOR USE IN THERAPY - The invention relates to a nucleic acid encoding a small nuclear RNA (snRNA), which snRNA is modified so that it contains sequence capable of hybridizing with the 5′ and 3′ splice site junctions and an exonic splicing enhancer of an exon of a pre-mRNA, so that the exon sequence is skipped during the splicing process that converts the pre-mRNA in the mature mRNA. The nucleic acid, the modified snRNA and vectors incorporating the nucleic acid may be used in the therapy, in particular in the treatment of muscular dystrophies. | 12-08-2011 |
20110301219 | RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING CHEMICALLY MODIFIED SHORT INTERFERING NUCLEIC ACID (siNA) - The present invention concerns methods and reagents useful in modulating gene expression in a variety of applications, including use in therapeutic, diagnostic, target validation, and genomic discovery applications. Specifically, the invention relates to synthetic chemically modified small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against target nucleic acid sequences. The small nucleic acid molecules are useful in the treatment of any disease or condition that responds to modulation of gene expression or activity in a cell, tissue, or organism. | 12-08-2011 |
20110301220 | RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING CHEMICALLY MODIFIED SHORT INTERFERING NUCLEIC ACID (siNA) - The present invention concerns methods and reagents useful in modulating gene expression in a variety of applications, including use in therapeutic, diagnostic, target validation, and genomic discovery applications. Specifically, the invention relates to synthetic chemically modified small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against target nucleic acid sequences. The small nucleic acid molecules are useful in the treatment of any disease or condition that responds to modulation of gene expression or activity in a cell, tissue, or organism. | 12-08-2011 |
20110301221 | DIAGNOSIS, PROGNOSIS AND TREATMENT OF GLIOBLASTOMA MULTIFORME - The present invention in one aspect relates generally to the identification, provision and use of a plurality of biomarkers to provide risk assessment of a subject having glioblastoma multiforme, and products and processes related thereto. In one aspect, a novel plurality of biomarkers as described herein is provided to determine a risk of glioblastoma multiforme. In another aspect, a novel plurality of biomarkers as described herein is provided to diagnose a subject having glioblastoma multiforme. In yet another aspect are methods for treating a subject having glioblastoma multiforme by administering one or more therapeutic regimens for glioblastoma multiforme. In yet another aspect are nucleic acid arrays comprising nucleic acid probes that hybridize to one or more glioblastoma multiforme genes. | 12-08-2011 |
20110301222 | COMBINATION THERAPY FOR THE TREATMENT OF CANCER - The present invention provides methods of sensitizing cancer cells to docetaxel and inhibiting the growth of various tumors by employing a modified eIF-4E antisense oligonucleotide and docetaxel in combination. | 12-08-2011 |
20110301223 | COMPOSITIONS AND METHODS FOR INSECTICIDAL CONTROL OF STINKBUGS - Methods and compositions are provided which employ a silencing element that, when ingested by a pest, such as a Pentatomidae plant pest or a | 12-08-2011 |
20110301224 | METHODS AND COMPOSITIONS FOR THE SPECIFIC INHIBITION OF GENE EXPRESSION BY DOUBLE-STRANDED RNA - The invention provides compositions and methods for selectively reducing the expression of a gene product from a desired target gene, as well as treating diseases caused by expression of the gene. The method involves introducing into the environment of a cell an amount of a double-stranded RNA (dsRNA) such that a sufficient portion of the dsRNA can enter the cytoplasm of the cell to cause a reduction in the expression of the target gene. The dsRNA has a first oligonucleotide sequence that is between 26 and about 30 nucleotides in length and a second oligonucleotide sequence that anneals to the first sequence under biological conditions. In addition, a region of one of the sequences of the dsRNA having a sequence length of from about 19 to about 23 nucleotides is complementary to a nucleotide sequence of the RNA produced from the target gene. | 12-08-2011 |
20110306651 | RNA INTERFERENCE MEDIATING SMALL RNA MOLECULES - Double-stranded RNA (dsRNA) induces sequence-specific post-transcriptional gene silencing in many organisms by a process known as RNA interference (RNAi). Using a | 12-15-2011 |
20110306652 | COMPOSITIONS AND THEIR USES DIRECTED TO HUNTINGTIN - Disclosed herein are compounds, compositions and methods for modulating the expression of huntingtin in a cell, tissue or animal. Further provided are methods of slowing or preventing Huntington's Disease (HD) progression using an antisense compound targeted to huntingtin. Additionally provided are methods of delaying or preventing the onset of Huntington's Disease (HD) in an individual susceptible to Huntington's Disease (HD). Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and disorders. | 12-15-2011 |
20110306653 | STABILIZATION METHOD OF FUNCTIONAL NUCLEIC ACID - This invention is intended to enhance and improve the resistance of a single- or double-stranded nucleic acid fragment comprising a base sequence of a functional nucleic acid to degradation by nucleolytic enzymes in a simple and cost-effective manner. The single- or double-stranded nucleic acid fragment comprises, ligated to at least one end thereof, hairpin-shaped DNA comprising: (A) a nucleic acid region comprising 2 to 5 arbitrary nucleotides; (B) a nucleic acid region comprising a “gna” or “gnna” base sequence, wherein each “n” represents “g”, “t”, “a”, or “c”, a base analogue, or a modified base; and (C) a nucleic acid region comprising a base sequence complementary to the nucleic acid region (A), sequentially from the 5′ end toward the 3′ end. | 12-15-2011 |
20110306654 | Methods for identifying analgesic agents - The present invention relates to the discovery that mutations in SCN9A are causative of Congenital Indifference to Pain (CIP) in humans. The invention also relates to methods of utilizing the SCN9A gene and expression products thereof for the screening and identification of therapeutic agents, including small organic compounds, which are selective for SCN9A, and are useful in the treatment of pain and other disorders. The invention also relates to methods of using these compounds to treat or otherwise ameliorate such disorders. | 12-15-2011 |
20110306655 | METHODS FOR IDENTIFYING AND COMPOUNDS USEFUL FOR THE DIAGNOSIS AND TREATMENT OF DISEASES INVOLVING INFLAMMATION - The present invention relates to agents, and methods for identifying compounds, which agents and compounds result in the inhibition of the maturation of dendritic cells. In addition, the invention relates to compositions and methods for the use thereof in treating conditions that are characterized by maturation of dendritic cells including infections, allograft reactions, inflammation, allergic and autoimmune diseases, and cancer. | 12-15-2011 |
20110313016 | Treatment of Intestinal Conditions - Methods and compositions for the treatment of intestinal disorders, such as IBD and Crohn's disease, are disclosed. Preferred compositions include siNA. Also disclosed is a method of specifically targeting siNA to treat intestinal disorders by intrarectal administration of siNA compounds. | 12-22-2011 |
20110313017 | SNALP FORMULATIONS CONTAINING POLYOXAZOLINE-DIALKYLOXYPROPYL CONJUGATES - The present invention provides polyoxaline-dialkyloxypropyl conjugates (POZ-DAA), SNALP compositions comprising POZ-DAA conjugates and methods of using such SNALP compositions to introduce a therapeutic agent, such as a nucleic acid, into a cell (e.g., for the treatment of a disease or disorder). | 12-22-2011 |
20110313018 | CANCER RELATED GENE, LGN/GPSM2 - The present invention provides methods for detecting and diagnosing cancer, which method involves the determination of the expression level of the LGN/GPSM2 gene. Furthermore, the present invention provides methods of screening for therapeutic agents useful in the treatment or prevention of cancer and methods for treating breast cancer. Moreover, the present invention provides siRNAs targeting the LGN/GPSM2 gene, which are useful in the treatment or prevention of cancer. | 12-22-2011 |
20110313019 | OLIGOMERIC COMPOUNDS AND METHODS - The present invention provides oligomeric compounds and uses thereof. In certain embodiments, such oligomeric compounds are useful as antisense compounds. Certain such antisense compounds are useful as RNase H antisense compounds or as RNAi compounds. | 12-22-2011 |
20110313020 | UsiRNA Complexes - This disclosure provides double-stranded RNA complexes having one or more hydroxymethyl substituted nucleomonomer(s) in the passenger strand (or sense strand) of an RNA complex. RNA complexes of the disclosure may be useful for therapeutic applications, diagnostic applications or research applications. RNA complexes include short interfering RNA complexes (siRNA) capable of modulating gene expression comprising an antisense strand and a continuous or a discontinuous passenger strand (“sense strand”). Further, one or more hydroxymethyl substituted nucleomonomer(s) of this disclosure may be positioned at the 3′-end, at the 5′-end, at both the 3′-end and 5′end. | 12-22-2011 |
20110313021 | Method to rapidly identify critical p53 target genes that can be utilized for therapeutic intervention - The majority of human cancers inactivate the p53 tumor suppressor network, and consequently, p53 is one of the most studied proteins in cancer biology. Peering into the intricacies of the p53 network should provide insight into the etiology of cancer, which may lead to the identification of molecular targets for therapeutic intervention. p53 carries out its tumor suppressor functions by inducing potent biological outputs, such as programmed cell death, in cells destined for becoming cancerous. p53 is a transcription factor that can regulate expression of numerous genes. The present invention discloses a novel method of rapidly determining the critical p53 target genes that can be utilized for therapeutic intervention. Additionally, this invention discloses suppression of MCAK as a treatment of human cancers and other diseases where p53 levels are elevated. | 12-22-2011 |
20110313022 | Compositions and Methods for Diminishing Viral Infection and Inflammation Associated with Viral Infection - The invention relates to compositions and methods for preventing and diminishing virus infection. The invention further relates to compositions and methods for diminishing inflammation associated with viral infection. The invention also relates to compositions and methods for interfering with TLR activation, and thereby diminishing inflammation associated with viral infection. | 12-22-2011 |
20110313023 | RNAi MODULATION OF RSV AND THERAPEUTIC USES THEREOF - The present invention is based on the in vivo demonstration that RSV can be inhibited through intranasal administration of iRNA agents as well as by parenteral administration of such agents. Further, it is shown that effective viral reduction can be achieved with more than one virus being treated concurrently. Based on these findings, the present invention provides general and specific compositions and methods that are useful in reducing RSV mRNA levels, RSV protein levels and viral titers in a subject, e.g., a mammal, such as a human. These findings can be applied to other respiratory viruses. | 12-22-2011 |
20110313024 | RNA INTERFERENCE MEDIATED INHIBITION OF PROPROTEIN CONVERTASE SUBTILISIN KEXIN 9 (PCSK9) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of Proprotein Convertase Subtilisin Kexin 9 (PCSK9) gene expression and/or activity. Specifically, the invention relates to double stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against Proprotein Convertase Subtilisin Kexin 9 (PCSK9) gene expression, including cocktails of such small nucleic acid molecules and lipid nanoparticle (LNP) formulations of such small nucleic acid molecules. | 12-22-2011 |
20110313025 | METHODS AND COMPOSITIONS INVOLVING MIRNA AND MIRNA INHIBITOR MOLECULES - The present invention concerns methods and compositions for introducing miRNA activity or function into cells using synthetic nucleic acid molecules. Moreover, the present invention concerns methods and compositions for identifying miRNAs with specific cellular functions that are relevant to therapeutic, diagnostic, and prognostic applications wherein synthetic miRNAs and/or miRNA inhibitors are used in library screening assays. | 12-22-2011 |
20110319469 | SNPs of Apolipoprotein B and Modulation of Their Expression - Compounds, compositions and methods are provided for modulating the expression of apolipoprotein B. The compositions comprise oligonucleotides, targeted to nucleic acid encoding apolipoprotein B. Methods of using these compounds for modulation of apolipoprotein B expression and for diagnosis and treatment of diseases and conditions associated with expression of apolipoprotein B are provided. | 12-29-2011 |
20110319470 | Diagnosis, prognosis and identification of potential therapeutic targets of multiple myeloma based on gene expression profiling - Provided herein is a method for gene expression profiling multiple myeloma patients into distinct subgroups via DNA hybridization and hierarchical clustering analysis of the hybridization data where the results may further be used to identify therapeutic gene targets. Also provided is a method for controlling bone loss in an individual via pharmacological inhibitors of DKK1 protein. In addition provided herein is a method for diagnosing multiple myeloma using a 15-gene model that classifies myeloma into subtypes 1-7. | 12-29-2011 |
20110319471 | LNA ANTAGONISTS TARGETING THE ANDROGEN RECEPTOR - The invention relates to oligonucleotide compounds (oligomers), which target androgen receptor mRNA in a cell, leading to reduced expression of the androgen receptor. Reduction of the androgen receptor expression is beneficial for the treatment of certain disorders, such as a hyperproliferative disorders (e.g., cancer). The invention provides therapeutic compositions comprising oligomers and methods for modulating the expression of androgen receptor using said oligomers, including methods of treatment. | 12-29-2011 |
20110319472 | METHODS OF PROGNOSTICATING AND TREATING EWING SARCOMA/PNET AND OTHER NEOPLASMS - A method of distinguishing between Ewing sarcoma patients having a good prognosis relative to those having a poor prognosis by screening for specific genomic copy number alterations (CNA) isolated and/or measuring denticleless homolog (Drosophila) (DTL) protein levels from the tumors of patients diagnosed with Ewing Sarcoma. | 12-29-2011 |
20110319473 | COMPOSITIONS AND METHODS FOR ENHANCEMENT OF NUCLEIC ACID DELIVERY - Embodiments of the invention include devices and methods for delivery of nucleic acids as active agents. Embodiments of the invention include devices and methods for delivery of nucleic acids as active agents. In an embodiment, an article for delivering an active agent is included. The article can include a dehydrated complex including a nucleic acid, a transfection agent, and a saccharide protectant. The nucleic acid and transfection agent can form a liposome or a lipoplex. The dehydrated complex can be disposed within a polymeric matrix. The dehydrated complex can be disposed within a microparticle. Other embodiments are also included herein. | 12-29-2011 |
20110319474 | siRNA targeting cyclin-dependent kinase 4 (CDK4) - Efficient sequence specific gene silencing for cyclin-dependent kinase 4 is possible through the use of siRNA technology. By selecting particular siRNAs by rational design, one can maximize the generation of an effective gene silencing reagent, as well as methods for silencing genes. Methods, compositions, and kits generated through rational design of siRNAs are disclosed. | 12-29-2011 |
20110319475 | TREATMENT OF BRAIN DERIVED NEUROTROPHIC FACTOR (BDNF) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO BDNF - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Brain derived neurotrophic factor (BDNF), in particular, by targeting natural antisense polynucleotides of Brain derived neurotrophic factor (BDNF). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of BDNF. | 12-29-2011 |
20110319476 | TREATMENT OF GLIAL CELL DERIVED NEUROTROPHIC FACTOR (GDNF) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO GDNF - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Glial cell derived neurotrophic factor (GDNF), in particular, by targeting natural antisense polynucleotides of Glial cell derived neurotrophic factor (GDNF). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of GDNF. | 12-29-2011 |
20110319477 | MUTATIONS OF THE PIK3CA GENE IN HUMAN CANCERS - Phosphatidylinositol 3-kinases (PI3Ks) are known to be important regulators of signaling pathways. To determine whether PI3Ks are genetically altered in cancers, we analyzed the sequences of the PI3K gene family and discovered that one family member, PIK3CA, is frequently mutated in cancers of the colon and other organs. The majority of mutations clustered near two positions within the PI3K helical or kinase domains. PIK3CA represents one of the most highly mutated oncogenes yet identified in human cancers and is useful as a diagnostic and therapeutic target. | 12-29-2011 |
20120004276 | RNA ANTAGONIST COMPOUNDS FOR THE INHIBITION OF EXPRESSION OF MITOCHONDRIAL GLYCEROL-3 PHOSPHATE ACYLTRANSFERASE 1 (MTGPAT1) - The present invention relates to oligomer compounds (oligomers), which target mtGPAT1mRNA in a cell, leading to reduced expression of mtGPAT1. Reduction of mtGPAT1 expression is beneficial for the treatment of certain medical disorders, such as overweight, obesity, fatty liver, hepatosteatosis, non alcoholic fatty liver disease (NAFLD), non alcoholic steatohepatitis (NASH), insulin resistance, and non insulin dependent diabetes mellitus (NIDDM). | 01-05-2012 |
20120004277 | VECTOR(S) CONTAINING AN INDUCIBLE GENE ENCODING A CDK4/CDK6 INHIBITOR USEFUL FOR TREATING NEURODEGENERATIVE DISORDERS OR DISEASES ASSOCIATED WITH AN UNSCHEDULED ACTIVATION OF THE CELL CYCLE - Described are vectors containing (a) a gene encoding (i) a CDK4/CDK6 inhibitor, preferably p16 | 01-05-2012 |
20120004278 | LINC RNAS IN CANCER DIAGNOSIS AND TREATMENT - Long non-coding RNAs (lincRNAs), a relatively recently recognized class of widely transcribed genes, are thought to affect chromatin state and epigenetic regulation, but their mechanisms of action and potential roles in human disease are poorly understood. The present invention shows that long non-coding RNAs in the human HOX loci are systematically dysregulated during breast cancer progression, and that expression levels of the lincRNA termed HOTAIR can predict cancer metastasis. Elevated levels of HOTAIR can lead to altered patterns of Polycomb binding to the genome. These findings indicate that lincRNAs have active roles in modulating the cancer epigenome and may be important targets for cancer diagnosis and therapy. | 01-05-2012 |
20120004279 | COMPOSITIONS AND METHODS FOR MODULATING ACTIVITY OF CAPPED SMALL RNAS - Compositions and methods for modulating transcription by RNA polymerases are described. | 01-05-2012 |
20120004280 | RNA Interference Mediated Inhibition of the High Affinity 1 gE Receptor Alpha Chain (FC Epsilon R1 Alpha) Gene Expression Using Short Interfering Nucleic Acid (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of FCεR1α gene expression and/or or activity, and/or modulate a FCεR1α gene expression pathway. Specifically, the invention relates to doublestranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules that are capable of mediating or that mediate RNA interference (RNAi) against FCεR1α gene expression. | 01-05-2012 |
20120004281 | RNA Interference Mediated Inhibition of the Nerve Growth Factor Beta Chain (NGFB) Gene Expression Using Short Interfering Nucleic Acid (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of NGFβ gene expression and/or activity, and/or modulate a NGFβ gene expression pathway. Specifically, the invention relates to double-stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules that are capable of mediating or that mediate RNA interference (RNAi) against NGFβ gene expression. | 01-05-2012 |
20120004282 | RNA Interference Mediated Inhibition of the Intercellular Adhesion Molecule 1 (ICAM-1) Gene Expression Using Short Interfering Nucleic Acid (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of ICAM-1 gene expression and/or activity, and/or modulate a ICAM-1 gene expression pathway. Specifically, the invention relates to double-stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules that are capable of mediating or that mediate RNA interference (RNAi) against ICAM-1 gene expression. | 01-05-2012 |
20120010266 | TBC1D7 AS TUMOR MARKER AND THERAPEUTIC TARGET FOR CANCER - The present invention relates to the roles played by the TBC1D7 genes in cancer, in particular, lung cancer or esophageal cancer, or carcinogenesis and features a method for treating and/or preventing cancer, in particular, lung cancer or esophageal cancer by administering a double-stranded molecule against one or more of the TBC1D7 genes or a composition, vector or cell containing such a double stranded molecule. The present invention also features methods for diagnosing lung or assessing/determining the prognosis of a patient with lung, especially NSCLC or SCLC, or esophageal cancer, using one or more over-expressed genes selected from among TBC1D7. To that end, TBC1D7 may serve as a novel biomarker for lung cancer or esophageal cancer. Also, disclosed are methods of identifying compounds for treating and preventing lung or esophageal cancer, using as an index for their effect on the over-expression of one or more of TBC1D7 in the lung cancer or esophageal cancer. | 01-12-2012 |
20120010267 | RNAi MODULATION OF MLL-AF4 AND USES THEREOF - The invention relates to compositions and methods for modulating the expression of the MLL-AF4 fusion gene, and more particularly to the downregulation of MLL-AF4 by chemically modified oligonucleotides. | 01-12-2012 |
20120010268 | ISOLATED GENOMIC POLYNUCLEOTIDE FRAGMENTS FROM THE p15 REGION OF CHROMOSOME 11 ENCODING HUMAN ACHAETE-SCUTE HOMOLOG 2 (HASH2) - Provided herein are isolated genomic polynucleotide fragments from the p15 arm of chromosome 11 encoding HASH2 and methods of use. | 01-12-2012 |
20120010269 | ISOLATED GENOMIC POLYNUCLEOTIDE FRAGMENTS FROM THE p15 REGION OF CHROMOSOME 11 ENCODING HUMAN SMS3 - Provided herein are isolated genomic polynucleotide fragments from the from the p15 region of chromosome 11 encoding human SMS3 (SMS3) and methods of use. | 01-12-2012 |
20120010270 | ISOLATED GENOMIC POLYNUCLEOTIDE FRAGMENTS FROM THE p15 REGION OF CHROMOSOME 11 ENCODING HUMAN TUMOR SUPPRESSING SUBTRANSFERABLE CANDIDATE 6 (TSSC6) - Provided herein are isolated genomic polynucleotide fragments from the from the p15 region of chromosome 11 encoding human tumor suppressing subtransferable candidate 6 and methods of use. | 01-12-2012 |
20120010271 | SINGLE-STRANDED NUCLEIC ACID MOLECULE FOR CONTROLLING GENE EXPRESSION - Provided is a novel nucleic acid molecule that can inhibit the expression of a gene and can be produces easily and efficiently. The nucleic acid molecule is a single-stranded nucleic acid molecule including an expression inhibitory sequence that inhibits expression of a target gene. The single-stranded nucleic acid molecule includes, in sequence from the 5′ side to the 3′ side: a 5′ side region (Xc); an inner region (Z); and a 3′ side region (Yc). The inner region (Z) is composed of an inner 5′ side region (X) and an inner 3′ side region (Y) that are linked to each other. The 5′ side region (Xc) is complementary to the inner 5′ side region (X). The 3′ side region (Yc) is complementary to the inner 3′ side region (Y). At least one of the inner region (Z), the 5′ side region (Xc), and the 3′ side region (Yc) includes the expression inhibitory sequence. According to this single-stranded nucleic acid molecule, it is possible to inhibit the expression of the target gene. | 01-12-2012 |
20120010272 | RNA Interference Mediated Inhibition of Apoptosis Signal-Regulating Kinase 1 (ASK1) Gene Expression Using Short Interfering Nucleic Acid (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of ASK1 gene expression and/or activity, and/or modulate a ASK1 gene expression pathway. Specifically, the invention relates to double-stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules that are capable of mediating or that mediate RNA interference (RNAi) against ASK1 gene expression. | 01-12-2012 |
20120016003 | POT1 ALTERNATIVE SPLICING VARIANTS - The present invention provides methods and compositions for diagnosis and treatment of carcinomas with aberrant expression patterns of POT 1. The invention also provides methods of identifying compounds that may modulate the cellular expression of POT 1. The invention further provides methods for treating subjects suffering from or at risk of developing a colorectal carcinoma. | 01-19-2012 |
20120016004 | COMPOSITIONS FOR INHIBITING GENE EXPRESSION AND USES THEREOF - The inventors have examined the means for providing more efficacious gene expression blocking compounds. The inventors have discovered new structural features that surprisingly improve the efficacy of gene expression blocking molecules. These features include the presence of multiple 3′ ends and a linker at the 5′ ends. Surprisingly, these features improve the efficacy of the gene expression blocking compounds in a manner that decreases the compound's biologic instability. Even more surprisingly, this effect has been found to be applicable to both DNA and RNA oligonucleotide-based compounds and to have application in traditional antisense and RNAi technologies. | 01-19-2012 |
20120016005 | PHAGOCYTIC CELL DELIVERY OF RNAI - The present invention provides a particulate delivery system for delivering an RNAi construct to phagocytic cells such as macrophages, comprising various configurations of a complex comprising a phagocytic cell-targeting moiety and an RNAi construct. The invention further provides methods of making the delivery system, and their uses, such as treating phagocytic cell-associated disease conditions. | 01-19-2012 |
20120016006 | Compositions And Methods For Increasing Cellular Uptake Of RNAi Via SID-1 - The invention relates to a double-stranded ribonucleic acid (dsRNA) targeting a Systemic RNA Interference Defective-1 (SID-I) gene, and methods of using the dsRNA to inhibit expression of SID-1. | 01-19-2012 |
20120016007 | SMALL INTERFERENCE RNA COMPLEX WITH INCREASED INTRACELLULAR TRANSMISSION CAPACITY - A multiplex siRNA complex and a multifunctional nucleic acid structure complex, which have enhanced intracellular delivery capacity are provided. The siRNA complex and the multifunctional nucleic acid structure complex have a novel structure which can be chemically synthesized in an easy manner for a conventional shRNA system for inhibiting the expression of a plurality of genes, while they can inhibit the expression of a plurality of genes at the same time at increased efficiency compared to the conventional siRNA. Also, they have high intracellular delivery capacity and can specifically inhibit the expression of target genes without causing a nonspecific antiviral response, and thus are highly useful as siRNA mechanism-mediated therapeutic agents for treating cancer or viral infection. In addition, the multifunctional nucleic acid structure complex can comprise, in addition to siRNAs, functional oligonucleotides, such as miRNA, antagomiR, an antisense oligonucleotide, an aptamer and ribozyme, and thus can perform various functions at the same time. | 01-19-2012 |
20120016008 | ISOLATED GENOMIC POLYNUCLEOTIDE FRAGMENTS FROM THE p15 REGION OF CHROMOSOME 11 ENCODING HUMAN RIBOSOMAL PROTEIN L26 (RIBO26) - Provided herein are isolated genomic polynucleotide fragments from the from the p15 region of chromosome 11 encoding human ribosomal protein L26 (RIBO26) and methods of use. | 01-19-2012 |
20120016009 | Optimized Methods For Delivery Of DSRNA Targeting The PCSK9 Gene - This invention relates to optimized methods for treating diseases caused by PCSK9 gene expression. | 01-19-2012 |
20120016010 | RNA Interference Mediated Inhibition of BTB and CNC Homology 1, Basic Leucine Zipper Transcription Factor 1 (BACH1) Gene Expression Using Short Interfering Nucleic Acid (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of Bach1 gene expression and/or activity, and/or modulate a Bach1 gene expression pathway. Specifically, the invention relates to double-stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules that are capable of mediating or that mediate RNA interference (RNAi) against Bach1 gene expression. | 01-19-2012 |
20120016011 | RNA Interference Mediated Inhibition of Connective Tissue Growth Factor (CTGF) Gene Expression Using Short Interfering Nucleic Acid (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of CTGF gene expression and/or activity, and/or modulate a CTGF gene expression pathway. Specifically, the invention relates to double-stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules that are capable of mediating or that mediate RNA interference (RNAi) against CTGF gene expression. | 01-19-2012 |
20120016012 | RNAi MOLECULE TARGETING THYMIDYLATE SYNTHASE AND APPLICATION THEREOF - This invention provides a novel RNAi molecule that can significantly potentiate antitumor effects of a 5-FU antitumor agent. The RNAi molecule comprises the nucleotide sequence shown in SEQ ID NO: 2. The invention also provides an antitumor agent comprising such RNAi molecule and a 5-FU antitumor agent. | 01-19-2012 |
20120022128 | PKIB and NAALADL2 for Target Genes of Prostate Cancer Therapy and Diagnosis - The invention features methods for detecting prostate cancer, especially hormone-refractory prostate cancer (HRPC) or castration-resistant prostate cancer (CRPC), by detecting over-expression of PKIB or NAALADL2 compared the normal organs. Also disclosed are methods of identifying compounds for treating and preventing prostate cancer including HRPC, based on the over-expression of PKIB or NAALADL2 in the prostate cancer, the cell proliferation function of PKIB or NAALADL2, the intracellular localization of PKIB or NAALADL2 or the interaction between PKIB and PKA-C. Also, provided are a method for treating prostate cancer by administering a double-stranded molecule against the PKIB or NAALADL2 gene. The invention also provides products, including the double-stranded molecules and vectors encoding them, as well as compositions comprising the molecules or vectors, useful in the provided methods. | 01-26-2012 |
20120022129 | Targeting of Histone Deacetylase 2, Protein Kinase CK2, and Nuclear Factor NRF2 For Treatment of Inflammatory Diseases - Methods for the treatment or prevention of diseases which are caused by the degradation of histone deacetylase 2 (HDAC2) in cells are described. The diseases which may be treated by the methods of the invention include chronic obstructive pulmonary disease (COPD) and asthma. The invention provides methods for treating or preventing of diseases caused by the degradation of HDAC2 by providing to the subject in need of treatment or prevention a molecular compound capable of preventing the degradation of HDAC2. Such molecular compounds include protein kinase CK2 inhibitors, ubiquitination inhibitors, ubiquitin-proteosome inhibitors, nuclear factor (erythroid-derived 2)-like 2 (Nrf2) activators and MAPK phosphatase 1 activators. Methods are also provided for the treatment and prevention of diseases caused by the degredation of HDAC2 by interfering with the expression of protein kinase CK2 or by increasing expression of Nrf2. | 01-26-2012 |
20120022130 | METHOD OF REGULATING NFATc2 ACTIVITY IN LYMPHOCYTES - A method of decreasing NFATc2 activity in a lymphocyte includes administering to the lymphocyte an amount of an NFATc2 mRNA antagonist that binds to a binding site on the 3′UTR of NFATc2 mRNA effective to decrease the activity of NFATc2 mRNA in the lymphocyte. | 01-26-2012 |
20120022131 | BREAST CANCER RELATED GENE RQCD1 - The present invention provides methods for detecting and diagnosing cancer, such methods involving the determination of the expression level of the RQCD1, GIGYF1 or GIGYF2 genes. These genes were discovered to discriminate cancer cells from normal cells. Furthermore, the present invention provides methods of screening for therapeutic agents useful in the treatment of cancer and methods for treating cancer. Moreover, the present invention provides siRNAs targeting the RQCD1, GIGYF1 and/or GIGYF2 genes, all of which are suggested to be useful in the treatment of cancer. | 01-26-2012 |
20120022132 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF MUTANT EGFR GENE - The invention relates to a double-stranded ribonucleic acid (dsRNA) targeting a mutant Epidermal Growth Factor Receptor (EGFR), and methods of using the dsRNA to inhibit expression of mutant EGFR. | 01-26-2012 |
20120022133 | ANTISENSE MODULATION OF CHOLESTERYL ESTER TRANSFER PROTEIN EXPRESSION - Antisense compounds, compositions and methods are provided for modulating the expression of cholesteryl ester transfer protein. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding cholesteryl ester transfer protein. Methods of using these compounds for modulation of cholesteryl ester transfer protein expression and for treatment of diseases associated with expression of cholesteryl ester transfer protein are provided. | 01-26-2012 |
20120022134 | METHODS AND MEANS FOR EFFICIENT SKIPPING OF EXON 45 IN DUCHENNE MUSCULAR DYSTROPHY PRE-mRNA - The invention relates to a method for inducing or promoting skipping of exon 45 of DMD pre-mRNA in a Duchenne Muscular Dystrophy patient, preferably in an isolated (muscle) cell, the method comprising providing said cell with a molecule that binds to a continuous stretch of at least 21 nucleotides within said exon. The invention further relates to such molecule used in said method. | 01-26-2012 |
20120022135 | PHD2 INHIBITION FOR BLOOD VESSEL NORMALIZATION, AND USES THEREOF - A key function of blood vessels, to supply oxygen, is impaired in tumors because of abnormalities in their endothelial lining. PHD proteins serve as oxygen sensors and may regulate oxygen delivery. Therefore the role of endothelial PHD2 in vessel shaping by implanting tumors in PHD2 | 01-26-2012 |
20120022136 | Cellular Genes Regulated by HIV-1 Infection and Methods of Use Thereof - This invention provides cellular gene products which have anti-apoptotic activity in HIV-1 infected cells and provides agents for the inhibition of the cellular gene products. | 01-26-2012 |
20120022137 | METHOD OF CONTROLLING INITIAL DRUG RELEASE OF siRNA FROM SUSTAINED-RELEASE IMPLANTS - The present invention provides an intraocular implant comprising siRNA combined with a excipient effective to retard the initial release of the siRNA from an implant, wherein said siRNA and excipient is associated with a biocompatible polymer (e.g., a polymeric matrix), configured to release said siRNA into the eye of a patient at therapeutic levels for a time sufficient to treat an ocular condition or disease. | 01-26-2012 |
20120022138 | MEANS FOR INHIBITING THE EXPRESSION OF ANG2 - The present invention is related to an siRNA comprising an antisense strand and a sense strand, wherein all or a portion of said antisense strand comprises an antisense duplex region, wherein all or a portion of said sense strand comprises a sense duplex region, wherein said antisense duplex region is at least partially complementary to said sense duplex region, wherein said siRNA comprises a duplex region consisting of said antisense duplex region and said sense duplex region, and wherein: a) said antisense strand comprises a nucleotide sequence of SEQ ID NO: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, 26, 28, 30, 32, 34, 36, 38, 40, 42, 44, 46, 48, 50, 52, 54, 56, 58, 60, 62, 64, 68, 74, 76, 78, 80, 82, 84, 86, 88, 90, 92, 94, 96, 98, 100, 102 or 104; or b) said antisense strand comprises an antisense duplex region, all or a portion of which, is complementary to a portion of SEQ ID NO: 1 or 70. | 01-26-2012 |
20120022139 | Short Interfering Ribonucleic Acid (siRNA) for Oral Administration - Short interfering ribonucleic acid (siRNA) for oral administration, said siRNA comprising two separate RNA strands that are complementary to each other over at least 15 nucleotides, wherein each strand is 49 nucleotides or less, and wherein at least one of which strands contains at least one chemical modification. | 01-26-2012 |
20120022140 | Method of treating a cancer with a survivin antisense oligonucleotide and paclitaxel - Provided is a method of treating cancer of the stomach, comprising administering to a patient a therapeutically effective combination of a Survivin antisense oligonucleotide and paclitaxel. | 01-26-2012 |
20120022141 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF A GENE FROM THE JC VIRUS - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a gene from the JC Virus (JC virus genome), comprising an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of a gene from the JC Virus. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by JC virus expression and the expression of a gene from the JC Virus using the pharmaceutical composition; and methods for inhibiting the expression of a gene from the JC Virus in a cell. | 01-26-2012 |
20120022142 | RNA Interference Mediated Inhibition of Signal Transducer and Activator of Transcription 1 (STAT1) Gene Expression Using Short Interfering Nucleic Acid (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of STAT1 gene expression and/or activity, and/or modulate a STAT1 gene expression pathway. Specifically, the invention relates to double-stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules that are capable of mediating or that mediate RNA interference (RNAi) against STAT1 gene expression. | 01-26-2012 |
20120022143 | RNA Interference Mediated Inhibition of the Thymic Stromal Lymphopoietin (TSLP) Gene Expression Using Short Interfering Nucliec Acid (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of TSLP gene expression and/or activity, and/or modulate a TSLP gene expression pathway. Specifically, the invention relates to double-stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules that are capable of mediating or that mediate RNA interference (RNAi) against TSLP gene expression. | 01-26-2012 |
20120022144 | Antisense Oligonucleotides for Inducing Exon Skipping and Methods of Use Thereof - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202. | 01-26-2012 |
20120022145 | Antisense Oligonucleotides for Inducing Exon Skipping and Methods of Use Thereof - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202. | 01-26-2012 |
20120029049 | Antisense Modulation of Superoxide Dismutase 1, Soluble Expression - Antisense compounds, compositions and methods are provided for modulating the expression of superoxide dismutase 1, soluble. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding superoxide dismutase 1, soluble. Methods of using these compounds for modulation of superoxide dismutase 1, soluble expression and for treatment of diseases associated with expression of superoxide dismutase 1, soluble are provided. | 02-02-2012 |
20120029050 | COMPOSITIONS AND THEIR USES DIRECTED TO DIACYLGLYCEROL ACYLTRANSFERASE 1 - Disclosed herein are compounds, compositions and methods for modulating DGAT-1 activity. Preferably, the expression of DGAT-1 from a nucleic acid is inhibited. Methods are provided for treating, ameliorating or treating liver fibrosis, either directly or by treating an underlying etiological factor. Preferably, the treatment, amelioration or prevention comprises administering a DGAT-1 activity modulator. | 02-02-2012 |
20120029051 | siRNA Targeting VEGFA and Methods for Treatment In Vivo - Vascular endothelial growth factor A (VEGFA) is a chemical signal produced by cells that stimulates the growth of new blood vessels, and overexpression of VEGFA can lead to undesirable physiological conditions. Through the identification of new siRNA and modifications that improve the silencing ability of these siRNA in vivo, therapeutic compositions and methods have been invented to address the problems associated with this overexpression. | 02-02-2012 |
20120029052 | Short Interfering Ribonucleic Acid (siRNA) for Oral Administration - Short interfering ribonucleic acid (siRNA) for oral administration, said siRNA comprising two separate RNA strands that are complementary to each other over at least 15 nucleotides, wherein each strand is 49 nucleotides or less, and wherein at least one of which strands contains at least one chemical modification. | 02-02-2012 |
20120029053 | Short Interfering Ribonucleic Acid (siRNA) for Oral Administration - Short interfering ribonucleic acid (siRNA) for oral administration, said siRNA comprising two separate RNA strands that are complementary to each other over at least 15 nucleotides, wherein each strand is 49 nucleotides or less, and wherein at least one of which strands contains at least one chemical modification. | 02-02-2012 |
20120029054 | RNA Interference Mediated Inhibition of GATA Binding Protein 3 (GATA3) Gene Expression Using Short Intefering Nucleic Acid (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of GATA3 gene expression and/or activity, and/or modulate a GATA3 gene expression pathway. Specifically, the invention relates to double-stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsR-NA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules that are capable of mediating or that mediate RNA interference (RNAi) against GATA3 gene expression. | 02-02-2012 |
20120029055 | MODULATORS OF APOPTOSIS AND THE USES THEREOF - Here we demonstrate that miR-125b, a brain-enriched microRNA, is a negative regulator of p53 in animals. miR-125b-mediated downregulation of p53 is dependent on the binding of miR-125b to a microRNA response element in the 39 untranslated region of p53 mRNA. Overexpression of miR-125b represses the endogenous level of p53 protein and suppresses apoptosis in cells. In contrast, knockdown of miR-125b elevates the level of p53 protein and induces apoptosis in cells. This phenotype can be rescued significantly by either an ablation of endogenous p53 function or ectopic expression of miR-125b in zebrafish. Ectopic expression of miR-125b suppresses the increase of p53 and stress-induced apoptosis. Together, our study demonstrates that miR-125b is an important negative regulator of p53 and p53-induced apoptosis during development and during the stress response. | 02-02-2012 |
20120029056 | DIFFERENTIALLY EXPRESSED MICRORNAS AS BIOMARKERS FOR THE DIAGNOSIS AND TREATMENT OF SJOGREN'S SYNDROME - The identification of differentially expressed microRNAs in patients with Sjögren's syndrome is disclosed herein. Provided is a method of diagnosing a subject as having Sjögren's syndrome by measuring the level of at least one differentially expressed miR gene product identified herein. An alteration in the level of the at least one miR gene product in the biological sample of the subject relative to a control indicates the subject has Sjögren's syndrome. Also provided is a method of treating a patient with Sjögren's syndrome by administering to the patient a therapeutically effective amount of an agent that inhibits expression of a miR gene product that is up-regulated in the patient with Sjögren's syndrome relative to a control, or by administering to the patient a therapeutically effective amount of an isolated miR gene product that is down-regulated in the patient with Sjögren's syndrome relative to a control. A method of restoring salivary flow in a patient with Sjögren's syndrome is also provided. | 02-02-2012 |
20120029057 | Antisense Oligonucleotides for Inducing Exon Skipping and Methods of Use Thereof - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202. | 02-02-2012 |
20120029058 | Antisense Oligonucleotides for Inducing Exon Skipping and Methods of Use Thereof - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202. | 02-02-2012 |
20120029059 | Antisense Oligonucleotides for Inducing Exon Skipping and Methods of Use Thereof - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202. | 02-02-2012 |
20120029060 | Antisense Oligonucleotides for Inducing Exon Skipping and Methods of Use Thereof - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202. | 02-02-2012 |
20120035240 | CONSERVED HBV AND HCV SEQUENCES USEFUL FOR GENE SILENCING - Conserved consensus sequences from known hepatitis B virus strains and known hepatitis C virus strains, which are useful in inhibiting the expression of the viruses in mammalian cells, are provided. These sequences are useful to silence the genes of HBV and HCV, thereby providing therapeutic utility against HBV and HCV viral infection in humans. | 02-09-2012 |
20120035241 | USE OF INHIBITORS OF PLAC8 ACTIVITY FOR THE MODULATION OF ADIPOGENESIS - The present invention concerns Plac8, a new target involved in adipogenesis modulation. Using a siRNA approach, the inventors demonstrated that decrease in Plac8 activity in preadipocytes and adipose tissue induces a decrease in adipogenesis. Thus, the present invention relates to modulators of Plac8 activity as well screening test for identification of modulators as of the activity of this target, and their use, especially in pharmaceutical composition, to modulate adipogenesis and thus treat obesity and related disorders. | 02-09-2012 |
20120035242 | PHARMACEUTICAL COMPOSITION FOR TREATING OBESITY OR DIABETES - The invention is intended to provide a pharmaceutical composition for treating or preventing obesity or type II diabetes and a method for treatment for them. A pharmaceutical composition comprising an Acsl-1 inhibitor of this invention as an active ingredient is useful for prevention or treatment of obesity or type II diabetes. | 02-09-2012 |
20120035243 | DUAL TARGETING OF MIR-208 AND MIR-499 IN THE TREATMENT OF CARDIAC DISORDERS - The present invention provides a method of treating or preventing cardiac disorders in a subject in need thereof by inhibiting the expression or function of both miR-499 and miR-208 in the heart cells of the subject. In particular, specific protocols for administering inhibitors of the two miRNAs that achieve efficient, long-term suppression are disclosed. In addition, the invention provides a method for treating or preventing musculoskeletal disorders in a subject in need thereof by increasing the expression or activity of both miR-208 and miR-499 in skeletal muscle cells of the subject. | 02-09-2012 |
20120035244 | PARP1 TARGETED THERAPY - The present invention relates to compositions and methods for cancer therapy, including but not limited to, targeted inhibition of cancer markers. In particular, the present invention relates to PARP1 proteins and nucleic acids as clinical and research targets for cancer. | 02-09-2012 |
20120035245 | METHODS FOR IDENTIFYING AND COMPOUNDS USEFUL FOR THE DIAGNOSIS AND TREATMENT OF DISEASES INVOLVING INFLAMMATION - The present invention relates to agents, and methods for identifying compounds, which agents and compounds result in the stabilization of mast cells, in particular that inhibit mast cell degranulation. In addition, the invention relates to compositions and methods for the use thereof in treating conditions that are characterized by mast cell degranulation and/or inflammation, including allergic rhinitis. | 02-09-2012 |
20120035246 | SINGLE-STRANDED NUCLEIC ACID MOLECULE HAVING NITROGEN-CONTAINING ALICYCLIC SKELETON - Provided is a novel nucleic acid molecule that can be produced easily and efficiently and can inhibit the expression of a gene. The nucleic acid molecule is a single-stranded nucleic acid molecule including an expression inhibitory sequence that inhibits expression of a target gene. The single-stranded nucleic acid molecule includes: a region (X); a linker region (Lx); and a region (Xc). The linker region (Lx) is linked between the regions (Xc) and (Xc). The region (Xc) is complementary to the region (X). At least one of the regions (X) and (Xc) includes the expression inhibitory sequence. The linker region (Lx) has a non-nucleotide structure including at least one of a pyrrolidine skeleton and a piperidine skeleton. According to this single-stranded nucleic acid molecule, it is possible to inhibit the expression of the target gene. | 02-09-2012 |
20120035247 | RNA Interference Mediated Inhibition of Signal Transducer and Activator of Transcription 6 (STAT6) Gene Expression Using Short Interfering Nucleic Acid (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of STAT6 gene expression and/or activity, and/or modulate a STAT6 gene expression pathway. Specifically, the invention relates to double-stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsR-NA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules that are capable of mediating or that mediate RNA interference (RNAi) against STAT6 gene expression. | 02-09-2012 |
20120041047 | Injectable Pharmaceutical Composition for Preventing, Stabilizing and/or Inhibiting Pathological Neovascularization-Related Conditions - This invention relates to a pharmaceutical composition for the treatment and/or prevention of at least one pathological neovascularization-related conditions of the interior of the eye, the composition comprising a therapeutically effective amount of an antisense oligonucleotide having the sequence SEQ ID NO: 1: | 02-16-2012 |
20120041048 | COMPOSITIONS AND METHODS RELATING TO miR-31 - MicroRNA-31 (miR-31), targets of miR-31, the role of miR-31 in inhibiting tumor metastasis, and the role of miR-31 target genes in promoting tumor metastasis are disclosed. | 02-16-2012 |
20120041049 | DESIGN OF SMALL-INTERFERING RNA - The present invention relates to small-interfering RNA molecules displaying an increased thermodynamic stability at the 3′ end of the antisense strand (guide strand) and the 5′ end of the sense strand (passenger strand), respectively, in comparison to the base pairing in the seed region. The siRNAs of the present invention display an increased knock-down activity against targeted genes and show an improved resistance to RNAses, in particular serum RNAses. The present invention also relates to a method for the production of the siRNA molecules, a method of target-specific RNA interference making use of the improved siRNA molecules of the invention and pharmaceutical compositions containing the siRNA molecules. | 02-16-2012 |
20120041050 | ANTISENSE OLIGONUCLEOTIDES FOR INDUCING EXON SKIPPING AND METHODS OF USE THEREOF - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202. | 02-16-2012 |
20120041051 | Compositions And Methods For Inhibiting Expression Of MIG-12 Gene - The invention relates to a double-stranded ribonucleic acid (dsRNA) targeting MIDI interacting G12-like protein (MIG 12) gene, and methods of using the dsRNA to inhibit expression of MIG 12. | 02-16-2012 |
20120041052 | Compositions and Methods to Treat Muscular & Cardiovascular Disorders - The present invention relates to a novel microRNA, mir-208-2, implicated in muscular and cardiovascular disorders. The present invention also relates to oligonucleotide therapeutic agents (antisense oligonucleotides and/or double stranded oligonucleotides such as dsRNA) and their use in the treatment of muscular and cardiovascular disorders resulting from dysregulation of mir-208-2. | 02-16-2012 |
20120041053 | DELIVERY OF dsRNA TO ARTHROPODS - The invention is to methods of gene silencing in arthropods using dsRNA. The method is include contacting the arthropod with, and/or directly feeding the arthropod, the dsRNA to the arthropods to deliver the dsRNA to arthropod tissues. It is envisaged that the methods of the invention will have use in determining the biological function of genes in arthropods. Methods of pest control of arthropods, and of protecting arthropods against parasites and predators are provided. Transgenic arthropods expressing dsRNA molecules are also provided by the present invention. | 02-16-2012 |
20120041054 | COMPOSITIONS AND METHODS FOR THE TREATMENT OF SEPSIS AND OTHER DISORDERS INVOLVING PHOSPHOLIPASE A2 INDUCTION - The present invention provides antisense oligomers to PLA | 02-16-2012 |
20120046339 | Novel chorismate mutase gene from the potato cyst nematode globodera rostochiensis - The nucleotide sequence of a 992 bp region of cDNA and the nucleotide sequence of a 1973 bp (or a 1913 bp) of genomic DNA of the Gr-cm-1 gene were determined for | 02-23-2012 |
20120046340 | Down Regulation of the Gene Expression by Means of Nucleic Acid-Loaded Virus-Like Particles - The present invention relates to compositions of virus-like particles for the introduction of RNA-interference (RNAi-) inducing molecules into eukaryotic cells and methods for the cell type-specific transduction of a plurality of eukaryotic cells with RNAi-inducing molecules. The present invention furthermore relates to methods for a diagnosis, prevention and/or treatment of diseases or disease states associated with an increased expression rate of at least one endogenous gene, and/or with the undesired expression of at least one endogenous gene and/or foreign nucleic acids, in particular viral nucleic acids. | 02-23-2012 |
20120046341 | FUS/TLS-BASED COMPOUNDS AND METHODS FOR DIAGNOSIS, TREATMENT AND PREVENTION OF AMYOTROPHIC LATERAL SCLEROSIS AND RELATED MOTOR NEURON DISEASES - The invention provides novel FUS/TLS nucleic acids and proteins that comprise one or more genetic markers (for example, single nucleotide polymorphisms) and methods of use thereof including methods relating to the diagnosis of ALS or other related motor neuron disease by virtue of the presence of the mutant FUS/TLS sequence(s). | 02-23-2012 |
20120046342 | OLIGONUCLEOTIDE COMPRISING AN INOSINE FOR TREATING DMD - The invention provides an oligonucleotide comprising an inosine, and/or a nucleotide containing a base able to form a wobble base pair or a functional equivalent thereof, wherein the oligonucleotide, or a functional equivalent thereof, comprises a sequence which is complementary to at least part of a dystrophin pre-m RNA exon or at least part of a non-exon region of a dystrophin pre-m RNA said part being a contiguous stretch comprising at least 8 nucleotides. The invention further provides the use of said oligonucleotide for preventing or treating DMD or BMD. | 02-23-2012 |
20120046343 | MULTI-TARGETING SHORT INTERFERING RNAs - The present invention relates to novel short interfering RNA (siRNA) molecules that are multi-targeted. More specifically, the present invention relates to siRNA molecules that target two or more sequences. In one embodiment, multi-targeting siRNA molecules are designed to incorporate features of siRNA molecules and features of micro-RNA (miRNA) molecules. In another embodiment, multi-targeting siRNA molecules are designed so that each strand is directed to separate targets. | 02-23-2012 |
20120046344 | TREATMENT OF LIPID TRANSPORT AND METABOLISM GENE RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO A LIPID TRANSPORT AND METABOLISM GENE - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of a Lipid transport and metabolism gene, in particular, by targeting natural antisense polynucleotides of a Lipid transport and metabolism gene. The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of a Lipid transport and metabolism genes. | 02-23-2012 |
20120046345 | TREATMENT OF DYSTROPHIN FAMILY RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO DMD FAMILY - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Dystrophin family, in particular, by targeting natural antisense polynucleotides of Dystrophin family. The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of DMD family. | 02-23-2012 |
20120059041 | Methods for Extending Lifespan in Subject - Disclosed is a method for extending lifespan in a subject. By screening for mutations that enhance resistance to multiple stresses, the invention identified multiple alleles of alpha-1, 2-mannosidase I (mas1) which, in addition to promoting stress resistance, also extended longevity. Meanwhile, longevity enhancement of a subject is also observed when either the expression of mas1 or its downstream gene Edm1 is reduced. Furthermore, this invention also found that the down-regulating mas1 and Edm1 may extend longevity by modulating DR (Dietary Restriction). Thus, via molecular biology techniques, the expression of the target genes such as mas1 and Edm1 can be regulated, and the lifespan extension for a subject also can be achieved. | 03-08-2012 |
20120059042 | METHOD FOR EFFICIENT EXON (44) SKIPPING IN DUCHENNE MUSCULAR DYSTROPHY AND ASSOCIATED MEANS - The invention relates to a nucleic acid molecule that binds and/or is complementary to the nucleotide molecule having sequence 5′-GUGGCUAACAGAAGCU (SEQ ID NO 1) and to its use in a method for inducing skipping of exon 44 of the DMD gene in a DMD patient. | 03-08-2012 |
20120059043 | THERAPEUTIC AND DIAGNOSTIC STRATEGIES - The present invention encompasses the finding that microRNAs (miRNAs) regulate certain key proteins involved in DNA repair. In some embodiments, a miRNA suppresses levels and/or activity of one or more DNA repair proteins. In some such embodiments, such suppression renders cells hypersensitive to certain DNA damage agents (e.g., γ-irradiation and genotoxic drugs, among others). The present invention provides various reagents and methods associated with these findings including, among other things, strategies for treating cell proliferative disorders, certain diagnostic systems, etc. | 03-08-2012 |
20120059044 | METHODS OF UTILIZING THE ARRESTIN-2/STAM-1 COMPLEX AS A THERAPEUTIC TARGET - Methods of utilizing the arrestin-2/sTAM-1 complex as a therapeutic target. The methods include treating cells of a living organism to mediate an interaction between arrestin-2 and STAM-1 adapter protein molecules, wherein the interaction is characterized by the arrestin-2 adapter protein molecule directly binding to the STAM-2 adapter protein molecule. Pharmacological agents can be identified for therapeutic uses by determining whether the pharmacological agent disrupts the interaction between the arrestin-2 and STAM-1 adapter protein molecules. | 03-08-2012 |
20120059045 | METHODS OF USING OLIGOMERIC COMPOUNDS COMPRISING 2'-SUBSTITUTED NUCLEOSIDES - The present disclosure provides oligomeric compounds comprising at least one 2′-fluoroethoxy modified nucleoside of formula I and methods of using these oligomeric compounds. The methods provided herein include contacting a cell or administering to an animal at least one of the oligomeric compounds. In certain embodiments, the oligomeric compounds hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA. | 03-08-2012 |
20120059046 | INHIBITION OF MAP4K4 THROUGH RNAI - RNAi constructs directed to MAP4K4 that demonstrate unexpectedly high gene silencing activities, and uses thereof are disclosed. The blunt-ended constructs have a double-stranded region of 19-49 nucleotides. The constructs have selective minimal modifications to confer an optimal balance of biological activity, toxicity, stability, and target gene specificity. For example, the strands may be modified (e.g., one or both ends of the sense strand is modified by 2′-O-methyl groups), such that the construct is not cleaved by Dicer or other RNAse III, the antisense strand may also be modified by a 2′-O-methyl group at the penultimate 5′-end nucleotide to greatly reduce off-target silencing. | 03-08-2012 |
20120059047 | DIFFERENTIATION MODULATING AGENTS AND USES THEREFOR - The present invention is directed to methods and agents for modulating the differentiation potential and/or proliferation of preadipocytes. More particularly, the present invention discloses methods and agents for modulating a fibroblast growth factor (FGF) signaling pathway, especially the FGF-1 or FGF-2 signaling pathway, for treating or preventing adiposity-related conditions including, but not limited to, obesity, lipoma, lipomatosis, cachexia or lipodystrophy or the loss of adipose tissue in trauma or atrophic conditions. | 03-08-2012 |
20120059048 | METHODS FOR DIAGNOSING AND TREATING SQUAMOUS CELL CARCINOMA UTILIZING miRNA-205 AND INHIBITORS THEREOF - Disclosed are diagnostic and therapeutic methods related to squamous cell carcinoma. In particular, the diagnostic methods relate to detecting miRNA-205, thereby diagnosing an aggressive form of squamous cell carcinoma. The therapeutic methods relate to inhibiting the function of miRNA-205, thereby treating an aggressive form of squamous cell carcinoma. | 03-08-2012 |
20120065242 | POLYMERIC NANO-PARTICLES FOR siRNA DELIVERY USING CHARGE INTERACTION AND COVALENT BONDING - Disclosed is a polymer-siRNA delivery carrier in which a siRNA is combined with a polymer and the use thereof. More specifically, there is disclosed a stable in vivo polymer-siRNA delivery carrier in which a polymer and a siRNA are combined by using charge interaction and biodegradable covalent bonding at the same time and the use thereof. | 03-15-2012 |
20120065243 | RNA DUPLEXES WITH SINGLE STRANDED PHOSPHOROTHIOATE NUCLEOTIDE REGIONS FOR ADDITIONAL FUNCTIONALITY - The present invention relates to RNAi constructs and their use in gene silencing. RNAi constructs associated with the invention contain a double stranded region connected to a single stranded region of phosphorothioate modified nucleotides. | 03-15-2012 |
20120065244 | OLIGOMERS - Molecules are provided for inducing or facilitating exon skipping in forming spliced mRNA products from pre-mRNA molecules in cells. The molecules may be provided directly as oligonucleotides or expression products of vectors that are administered to a subject. High rates of skipping can be achieved. High rates of skipping reduce the severity of a disease like Duchene Muscular Dystrophy so that the disease is more like Becker Muscular Dystrophy. This is a severe reduction in symptom severity and mortality. | 03-15-2012 |
20120065245 | REGULATION OF HEMATOPOIETIC STEM CELL FUNCTIONS THROUGH MICRORNAS - The present disclosure relates to regulation of functions of hematopoietic stem cells (HSCs) by delivering of miRNAs, including miR-125b, miR-126, and miR-155, to HSCs. For example, in some embodiments, blood output in a mammal can be increased by administering miR-125b, miR-126, and/or miR-155 oligonucleotides. Also disclosed are methods for promoting hematopoietic stem cell engraftment and method for treating a myeloproliferative disorder. | 03-15-2012 |
20120065246 | RNA MOLECULES AND THERAPEUTIC USES THEREOF - The invention relates to double-stranded RNA molecules in which each strand of said molecule possesses: (a) sufficient complementarity to a target mRNA molecule to facilitate cleavage thereof; and (b) sufficient complementarity to the other strand of the double-stranded RNA molecule so as to form a stable duplex; and in which at least one strand of said molecule possesses: (c) a seed region of complementarity to at least one seed site present in a 3′ untranslated region of at least one target mRNA molecule. The invention also relates to an algorithm for the design of a double-stranded RNA molecule in which each strand of said molecule possesses: (a) sufficient complementarity to a target mRNA molecule to facilitate cleavage thereof; and (b) sufficient complementarity to the other strand of the double-stranded RNA molecule so as to form a stable duplex; and in which at least one strand of said molecule possesses: (c) a seed region of complementarity to at least one seed site present in a 3′ untranslated region of at least one target mRNA molecule; wherein said algorithm comprises the steps: (i) input a population of mRNA sequences transcribed from one or more genes of interest; (ii) identify all subsequences of at least 12 nucleotides in length within the population of step (i) which are complementary to another subsequence of at least 12 nucleotides in length in the population; (iii) determine a list of candidate bi-functional double-stranded RNA molecules, said list comprising the double-strand RNA duplexes comprising the two complementary subsequences of step (ii); and (iv) sort the list of candidate double-stranded RNA molecules of step (iii) based on their potential to cause translational suppression. | 03-15-2012 |
20120065247 | MODULATING IRES-MEDIATED TRANSLATION - Provided herein are compounds and methods for use in preventing or treating a viral infection mediated by a virus comprising an IRES-containing RNA molecule or cancer related to an increase or decrease in IRES-mediated translation of an RNA molecule. Also provided are methods of inhibiting or promoting IRES-mediated translation. Also provided are methods of screening for an agent that inhibits IRES-mediated translation. | 03-15-2012 |
20120065248 | METHODS AND COMPOSITIONS INVOLVING MIRNA AND MIRNA INHIBITOR MOLECULES - The present invention concerns methods and compositions for introducing miRNA activity or function into cells using synthetic nucleic acid molecules. Moreover, the present invention concerns methods and compositions for identifying miRNAs with specific cellular functions that are relevant to therapeutic, diagnostic, and prognostic applications wherein synthetic miRNAs and/or miRNA inhibitors are used in library screening assays. | 03-15-2012 |
20120065249 | ANTISENSE OLIGONUCLEOTIDES FOR TREATING ALLERGY AND NEOPLASTIC CELL PROLIFERATION - Antisense oligonucleotides for treating and/or preventing at least one of asthma, allergy, hypereosinophilia, general inflammation and cancer are provided. The oligonucleotides are directed against nucleic acid sequences coding for a receptor selected from the group consisting of a CCR3 receptor and a common sub-unit of IL-3, IL-5 and GM-CSF receptors. | 03-15-2012 |
20120065250 | siRNA Targeting Apolipoprotein B (APOB) - Efficient sequence specific gene silencing is possible through the use of siRNA technology. By selecting particular siRNAs by rational design, one can maximize the generation of an effective gene silencing reagent, as well as methods for silencing genes. Methods, compositions, and kits generated through rational design of siRNAs are disclosed including those directed to nucleotide sequences for APOB. | 03-15-2012 |
20120071539 | COMPOUNDS AND METHODS FOR MODULATING THE SILENCING OF A POLYNUCLEOTIDE OF INTEREST - Methods and compositions comprising chemical compounds that modulate the silencing of a polynucleotide of interest in a cell are provided. Such chemical compounds when used in combination with an appropriate silencing element can be used to modulate (increase or decrease) the level of the polynucleotide targeted by the silencing element. Methods of using such compositions both in therapies involving RNAi-mediated suppression of gene expression, as well as, in vitro methods that allow for the targeted modulation of expression of a polynucleotide of interest are provided. Pharmaceutical or cosmetic compositions comprising such compounds and silencing elements also are disclosed. Methods for screening a compound of interest for the ability to modulate the activity of a heterologous silencing element also are provided. | 03-22-2012 |
20120071540 | Compositions and Methods Using siRNA Molecules and siRNA Cocktails for the Treatment of Breast Cancer - The present invention provides small interfering RNA (siRNA) molecules, compositions containing the molecules, and methods of using the molecules and compositions to treat breast cancer. In one aspect, a multi-targeted siRNAi cocktail is disclosed. The siRNA molecules may be encapsulated in nanoparticles to further enhance their anti-cancer activity. The compositions may also be used in combination with other anti-cancer agents, such as bevacizumab. | 03-22-2012 |
20120071541 | Micro-RNA Associated With Rheumatoid Arthritis - An object of the present invention is to provide a novel marker for rheumatoid arthritis (RA), and more specifically, to provide a marker whose expression may be specifically increased or decreased in RA. Another object of the present invention is to confirm whether or not miRNA serving as the marker is involved as the etiology of RA, and to provide an inspection method for RA and a therapeutic agent for RA each using the miRNA involved. The marker includes miRNA (for example, miR124 | 03-22-2012 |
20120077860 | Adeno-Associated Viral Vector for Exon Skipping in a Gene Encoding a Dispensable Domain Protein - The invention concerns an adeno-associated viral vector comprising:
| 03-29-2012 |
20120077861 | Bispecific Antisense Oligonucleotides that Inhibit IGFBP-2 and IGFBP-5 and Methods of Using Same - Bispecific antisense oligonucleotides which consist essentially of a sequence of bases that is complementary to portions of both the gene encoding human IGFBP-2 and the gene encoding human IGFBP-5 are useful in as antisense therapeutics in the treatment of endocrine-regulated cancers. | 03-29-2012 |
20120077862 | ANTISENSE MODULATION OF PTP1B EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of PTP1B. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding PTP1B. Methods of using these compounds for modulation of PTP1B expression and for treatment of diseases associated with expression of PTP1B are provided. | 03-29-2012 |
20120077863 | GUANIDINO-SUBSTITUTED BI-AND POLYPHENYLS AS SMALL MOLECULE CARRIERS - A compound of formula I, or a pharmaceutically acceptable salt thereof, wherein —X | 03-29-2012 |
20120077864 | RNAI-MEDIATED INHIBITION OF GREMLIN FOR TREATMENT OF IOP-RELATED CONDITIONS - RNA interference is provided for inhibition of gremlin in intraocular pressure-related conditions, including ocular hypertension and glaucoma such as normal tension glaucoma and open angle glaucoma. | 03-29-2012 |
20120077865 | METHODS FOR TREATING HYPERCHOLESTEROLEMIA - Disclosed herein are antisense compounds and methods for decreasing LDL-C in an individual having elevated LDL-C. Additionally disclosed are antisense compounds and methods for treating, preventing, or ameliorating hypercholesterolemia and/or atherosclerosis. Further disclosed are antisense compounds and methods for decreasing coronary heart disease risk. Such methods include administering to an individual in need of treatment an antisense compound targeted to a PCSK9 nucleic acid. The antisense compounds administered include gapmer antisense oligonucleotides. | 03-29-2012 |
20120077866 | ANTISENSE MODULATION OF C-REACTIVE PROTEIN EXPRESSION - Antisense compounds, compositions and methods are provided for modulating the expression of C-reactive protein. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding C-reactive protein. Methods of using these compounds for modulation of C-reactive protein expression and for treatment of diseases associated with expression of C-reactive protein are provided. | 03-29-2012 |
20120077867 | Compositions And Methods For Treating Pancreatic Cancer - The present invention provides a method of treating pancreatic cancer by inhibiting the activity cyclin D1 activity in tumor cells. The invention is based on the finding that cyclin D1 shRNA molecules are capable of attenuating tumor growth and interfering with tumor angiogenesis. | 03-29-2012 |
20120083518 | Cancer Treatment Targeting BRCA1-IRIS - Patients identified as candidates at risk of developing aggressive cancer, including metastatic cancer, are determined based on the expression of BRCA1-IRIS. In one advantageous form, the expression of BRCA1-IRIS is quantified based on BRCA1-IRIS present in tumor cells of patients. The amount of BRCA1-IRIS expression can be quantified in any conventionally known manner, including quantifying the amount of protein present in tumor cells or BRCA1-IRIS mRNA present in tumor cells of patients. | 04-05-2012 |
20120083519 | Methods For Diagnosing And Treating A Renal Disease In An Individual - A method for diagnosing a renal disease in an individual, comprising: a) measuring the level of expression of c-mip in a renal sample of the individual; b) comparing the level of expression of c-mip to a predetermined value; and c) determining therefrom whether the individual is afflicted with a renal disease. Furthermore, a method for treating a renal disease, comprising administration of a c-mip inhibitor. | 04-05-2012 |
20120088811 | METHOD FOR THE TREATMENT OF ACUTE MYELOID LEUKEMIA - The invention is in the field of molecular medicine and provides methods for the treatment of acute myeloid leukemia. These methods are based on the observation that microRNA-9 and microRNA-9* are involved in the pathogenesis of the disease in that the overexpression of microRNA-9/9* block myeloid differentiation in vitro. More in particular, microRNA-9/9* were found to play a role in leukemic transformation in acute myeloid leukemia. | 04-12-2012 |
20120088812 | COMPOSITIONS FOR PROMOTING EPIGENETIC DNA DEMETHYLATION AND METHODS OF USE THEREFORE - The invention features compositions and methods for modulating the expression of Gadd45 and the use of such compositions and methods as neuroprotectants, to enhance neurogenesis, and for the treatment of mood disorders. | 04-12-2012 |
20120088813 | ANTI VIRAL THERAPY - The present invention provides a method of identifying host cell molecules which may be modulated to inhibit viral replication and method of testing antiviral compounds. In addition, the invention provides compositions, methods and medicaments for treating viral infections and/or diseases or conditions caused or contributed to by viruses. | 04-12-2012 |
20120088814 | METHODS OF MODULATING AN IMMUNE RESPONSE TO A VIRAL INFECTION - Disclosed herein are methods for treating respiratory disorders via administration of antisense compounds targeting IL-4Rα. Provided herein, for example, are compositions and methods of modulating immune responses to a viral infection in a subject. Also provided, for example, are compositions and methods for managing, treating, ameliorating, preventing and/or delaying the onset of pulmonary inflammation, airway hyperreactivity and/or loss of lung function, or a symptom thereof in a subject during the course of or resulting from a viral infection. Further provided, for example, are compositions and methods of inducing or augmenting hypo-responsiveness, non-responsiveness or tolerance to a virus in a subject. Also provided, for example, are compositions and methods of enhancing the efficacy of a viral vaccine in a subject. In certain embodiments, the compositions and methods provided herein utilize an antisense compound 12 to 35 nucleobases in length targeted to a nucleic acid molecule encoding human IL-4 receptor alpha IL-4Rα, wherein said antisense compound inhibits expression of human IL-4Rα protein and/or expression of functional IL-4 and IL-13 receptors. | 04-12-2012 |
20120088815 | Modified Oligonucleotide and Its Preparation and Application - The present invention relates to a modified oligonucleotide, its preparation and application. The invention enables stabilizing the oligonucleotide by introducing a relatively small amount of modified nucleotide at specific UA/UA and/or CA/UG and/or UG/CA site of the oligonucleotide, therefore to decrease the modification-related cytotoxicity and compromising effects on the biological activity. | 04-12-2012 |
20120088816 | Head-And-Neck Tumor Proliferation Inhibitor - It is to provide a novel head-and-neck tumor proliferation inhibitor, head-and-neck tumor metastasis inhibitor and pharmaceutical composition for treating a head-and-neck tumor. The present invention is characterized by using an inhibitory substance of a microRNA whose expression increases in a head-and-neck tumor and/or a promoting substance of a microRNA whose expression decreases in a head-and-neck tumor. Preferred examples of the microRNA whose expression increases in a head-and-neck tumor include miR-455-3p, miR-455-5p, miR-130b, miR-130b*, miR-801, miR-196a, miR-21 and miR-31. Preferred examples of the microRNA whose expression decreases in a head-and-neck tumor include miR-133b, miR-145 and miR-375. | 04-12-2012 |
20120088817 | TREATMENT OF ANTIVIRAL GENE RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO AN ANTIVIRAL GENE - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of an Antiviral gene, in particular, by targeting natural antisense polynucleotides of an Antiviral gene. The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of Antiviral genes. | 04-12-2012 |
20120095074 | Genetic Alterations on Chromosome 12 and Methods of Use Thereof for the Diagnosis and Treatment of Type 1 Diabetes - Compositions and methods for the detection and treatment of T1D are provided. | 04-19-2012 |
20120095075 | NOVEL LIPIDS AND COMPOSITIONS FOR THE DELIVERY OF THERAPEUTICS - The present invention provides lipids that are advantageously used in lipid particles for the in vivo delivery of therapeutic agents to cells. In particular, the invention provides lipids having the following structure: | 04-19-2012 |
20120095076 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF HUNTINGTIN GENE - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the Huntingtin gene (HD gene), comprising an antisense strand having a nucleotide sequence which is less than 25 nucleotides in length and which is substantially complementary to at least a part of the HD gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by the expression of the HD gene, or a mutant form thereof, using the pharmaceutical composition; and methods for inhibiting the expression of the huntingtin gene in a cell. | 04-19-2012 |
20120095077 | METHODS AND COMPOSITIONS RELATED TO MODIFIED GUANINE BASES FOR CONTROLLING OFF-TARGET EFFECTS IN RNA INTERFERENCE - Disclosed are compositions and methods related to modified nucleobases. Also disclosed are compositions and methods related to modified interfering RNAs. Also disclosed are compositions and methods related to modified guanine bases for controlling off-target effects in RNA interference. | 04-19-2012 |
20120095078 | METHODS OF DIAGNOSIS AND TREATMENT OF MELANOMA - Methods for the diagnosis or prognosis of melanoma by detecting expression of ATF2 and MITF in melanocytes are provided herein. Also provided are methods of treating a melanocyte proliferative disorder with agents that modulate the transcriptional activity of ATF2 and/or MITF activity. | 04-19-2012 |
20120095079 | TREATMENT OF TRANSCRIPTION FACTOR E3 (TFE3) AND INSULIN RECEPTOR SUBSTRATE 2 (IRS2) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO TFE3 - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Transcription factor E3 (TFE3) and/or Insulin Receptor Substrate 2 (IRS2) polynucleotides, in particular, by targeting natural antisense polynucleotides of Transcription factor E3 (TFE3) and/or Insulin Receptor Substrate 2 (IRS2). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of TFE3 and/or IRK. | 04-19-2012 |
20120095080 | METHODS FOR PRODUCING INTERFERING RNA MOLECULES IN MAMMALIAN CELLS AND THERAPEUTIC USES FOR SUCH MOLECULES - Methods for producing interfering RNA molecules in mammalian cells are provided. Therapeutic uses for the expressed molecules, including inhibiting expression of HIV, are also provided. | 04-19-2012 |
20120095081 | TREATMENT OF PARAOXONASE 1 (PON1) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO PON1 - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Paraoxonase 1 (PON1), in particular, by targeting natural antisense polynucleotides of Paraoxonase 1 (PON1). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of PON1. | 04-19-2012 |
20120095082 | USE OF INTERFERING RNA FOR TREATING AN HIV INFECTION - The present invention relates to interfering RNAs, in particular miRNAs, capable of specifically blocking the replication of a strain of the HIV virus that is resistant to an antiretroviral compound, and use thereof for treating infections by this type of virus. | 04-19-2012 |
20120101147 | INHIBITION OF HDAC2 TO PROMOTE MEMORY - The invention relates to methods and products for enhancing and improving recovery of lost memories. In particular the methods are accomplished by inhibiting HDAC2 and or selectively inhibiting HDAC1/2 or HDAC1/2/3. | 04-26-2012 |
20120101148 | LIPID FORMULATION - The invention features an improved lipid formulation comprising a cationic lipid of formula (A), a neutral lipid, a sterol and a PEG or PEG-modified lipid, where R | 04-26-2012 |
20120108646 | RNAi Modulation Of TGF-BETA And Therapeutic Uses Thereof - The present invention concerns methods of treatment using transforming growth factor beta (TGF-beta) modulators. More specifically, the invention concerns methods of treating disorders associated with undesirable TGF-beta signaling, by administering short interfering RNA which down-regulate the expression of TGF-beta, and agents useful therein. | 05-03-2012 |
20120108647 | THERAPEUTIC USES OF INHIBITORS OF RTP801L - The present invention provides novel molecules, compositions, methods and uses for treating microvascular disorders, eye diseases respiratory conditions and hearing disorders based upon inhibition of the RTP801L gene and/or protein. | 05-03-2012 |
20120108648 | MITOCHONDRIAL FUNCTION-IMPROVING AGENT - It is an object of the present invention to provide a novel mitochondrial function-improving agent and a novel PGC-1α expression inducing agent. The present invention provides a mitochondrial function-improving agent and a PGC-1α expression inducing agent each of which comprises a lysine-specific demethylase-1 (LSD-1) inhibitor. | 05-03-2012 |
20120108649 | METHODS AND COMPOSITIONS TO PROTECT AQUATIC INVERTEBRATES FROM DISEASE - Compositions and methods of protecting aquatic invertebrates from disease is shown. In one embodiment, dsRNA or antisense RNA to a nucleic acid molecule of the disease-causing microorganism is prepared and delivered to the animal. In another embodiment, a nucleic acid molecule of the disease-causing microorganism is delivered to the animal. In another embodiment, the RNA or nucleic acid molecule is delivered to the animal by replicon particle. In a further embodiment, the protective molecule is delivered to the digestive tract of the animal. Protection from disease is obtained. | 05-03-2012 |
20120108650 | MICRO RNA MARKERS AND METHODS RELATED THERETO - The present invention provides methods of diagnosis of Alzheimer's disease including assessing the levels of certain microRNAs in a subject and comparing these to levels in subjects not exhibiting the disease. The identified measurements provide input for improved diagnoses of Alzheimer's disease as compared to certain other forms of dementias, which allows more effective treatment regimens. | 05-03-2012 |
20120108651 | GENETIC POLYMORPHISMS ASSOCIATED WITH VENOUS THROMBOSIS AND STATIN RESPONSE, METHODS OF DETECTION AND USES THEREOF - The present invention provides compositions and methods based on genetic polymorphisms that are associated with response to statin treatment (particularly for reducing the risk of venous thrombosis). For example, the present invention relates to nucleic acid molecules containing the polymorphisms, variant proteins encoded by these nucleic acid molecules, reagents for detecting the polymorphic nucleic acid molecules and variant proteins, and methods of using the nucleic acid molecules and proteins as well as methods of using reagents for their detection. | 05-03-2012 |
20120108652 | OLIGOMERS - Molecules are provided for inducing or facilitating exon skipping in forming spliced mRNA products from pre-mRNA molecules in cells. The molecules may be provided directly as oligonucleotides or expression products of vectors that are administered to a subject. High rates of skipping can be achieved. High rates of skipping reduce the severity of a disease like Duchene Muscular Dystrophy so that the disease is more like Becker Muscular Dystrophy. This is a severe reduction in symptom severity and mortality. | 05-03-2012 |
20120108653 | OLIGOMERS - Molecules are provided for inducing or facilitating exon skipping in forming spliced mRNA products from pre-mRNA molecules in cells. The molecules may be provided directly as oligonucleotides or expression products of vectors that are administered to a subject. High rates of skipping can be achieved. High rates of skipping reduce the severity of a disease like Duchene Muscular Dystrophy so that the disease is more like Becker Muscular Dystrophy. This is a severe reduction in symptom severity and mortality. | 05-03-2012 |
20120115923 | Sirna Compositions Promoting Scar-Free Wound Healing of Skin and Methods for Wound Treatment - This invention describes compositions and methods using siRNA to target various genes expressed in cells of injured tissue during scar formation to promote scar-free wound healing. | 05-10-2012 |
20120115924 | Micro-RNA Mediated Modulation of Colony Stimulating Factors - The present invention relates to the modulation of immunoregulatory proteins, including cytokines, such as colony stimulatory factors (CSF) via the use of microRNA-155 modulators. | 05-10-2012 |
20120115925 | Allelic Variants Associated with Advanced Age-Related Macular Degeneration - The invention relates to allelic variants and haplotypes of the Complement Factor H (CFH) gene, the Complement Component 3 (C3) gene, and the Complement Factor D (CFD) gene, associated with either an elevated or a reduced risk that an individual will develop age-related macular degeneration (AMD), methods of diagnosing such risk in an individual based on the presence or absence of such variants, and methods and reagents for diagnosis and treatment of AMD. | 05-10-2012 |
20120115926 | ANTISENSE MODULATION OF APOLIPOPROTEIN B EXPRESSION - Methods for the rapid and long-term lowering of lipid levels in human subjects and for the treatment of conditions associated with elevated LDL-cholesterol and elevated apolipoprotein B are provided. | 05-10-2012 |
20120115927 | PHARMACEUTICAL AGENT FOR PREVENTING CELL DEATH - Disclosed is a pharmaceutical agent for preventing cell death. The occurrence of cell death can be prevented by inhibiting the function of Int6 protein in an affected area. Then, a pharmaceutical agent comprising a substance capable of inhibiting the function of Int6 protein is prepared. The pharmaceutical agent can be used for preventing cell death. | 05-10-2012 |
20120115928 | MIRNA AND ITS TARGETS RESPECTIVELY THE PROTEINS MADE BASED ON THE TARGETS AS A PROGNOSTIC, DIAGNOSTIC BIOMARKER AND THERAPEUTIC AGENT FOR CANCER - A compound miRNA (miRNA661) (Nr MI0003669 or ENSG00000207574) the sequence of the mature miRNA-661 being 51-ugccugggucucuggccugcgcgu-74 for use as a medicament in the in the treatment and/or the diagnosis of cancer, neuronal disease and infection. | 05-10-2012 |
20120115929 | Means And Methods For Counteracting, Preventing And/Or Determining Heart Failure, Or A Risk Of Heart Failure - The present invention relates to a method for diagnosing and/or prognosing heart failure in a subject the method comprising the step of determining the level of at least one genetic marker in a body fluid sample obtained from said subject, wherein said at least one genetic marker is an mi RNA. The invention further relates to a method for treating or preventing heart failure in a subject the method comprising the step of decreasing within said subject the expression, amount, and/or activity of at least one mi RNA, or decreasing within said subject the interaction of at least one mi RNA with its m RNA target or increasing within said subject the expression, amount, and/or activity of the m RNA target of at least one mi RNA. | 05-10-2012 |
20120115930 | COMPOSITIONS AND THEIR USES DIRECTED TO HEPCIDIN - Disclosed herein are compounds, compositions and methods for modulating the expression of hepcidin in a cell, tissue or animal or preventing, ameliorating or treating anemia. Also provided are methods for prevention, amelioration or treatment of anemia, and for increasing red blood cell count in an animal. Also provided are methods for the prevention, amelioration and/or treatment of low serum iron levels, low red blood cell count and other clinical endpoints of anemia in an animal. These methods may be achieved by administration of compounds or compositions including antisense compounds targeted to a nucleic acid that expresses hepcidin polypeptide combined with an erythropoiesis stimulating agent. | 05-10-2012 |
20120115931 | SELECTIVE INHIBITORS OF CB2 RECEPTOR EXPRESSION AND/OR ACTIVITY FOR THE TREATMENT OF OBESITY AND OBESITY-RELATED DISORDERS - The invention relates to a method for treating and/or preventing obesity and/or obesity-related disorders by administering to a subject in need thereof a selective inhibitor of cannabinoid type 2 (CB2) receptor expression. | 05-10-2012 |
20120115932 | MODULATION OF STAT 6 EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of STAT 6. The compositions comprise oligonucleotides, targeted to nucleic acid encoding STAT 6. Methods of using these compounds for modulation of STAT 6 expression and for diagnosis and treatment of disease associated with expression of STAT 6 are provided. | 05-10-2012 |
20120115933 | Organic Compositions to Treat Beta-ENaC-Related Diseases - The present disclosure relates to RNAi agents useful in methods of treating Beta-ENaC-related diseases such as cystic fibrosis, pseudohypoaldosteronism type 1 (PHA1), Liddle's syndrome, hypertension, alkalosis, hypokalemia, and obesity-associated hypertension, using a therapeutically effective amount of a RNAi agent to Beta-ENaC. | 05-10-2012 |
20120115934 | Organic Compositions to Treat Beta-ENaC-Related Diseases - The present disclosure relates to RNAi agents useful in methods of treating Beta-ENaC-related diseases such as cystic fibrosis, pseudohypoaldosteronism type 1 (PHA1), Liddle's syndrome, hypertension, alkalosis, hypokalemia, and obesity-associated hypertension, using a therapeutically effective amount of a RNAi agent to Beta-ENaC. | 05-10-2012 |
20120115935 | ANTI-CANCER AGENT, METHOD FOR INDUCING APOPTOSIS OF CANCER CELLS, AND METHOD FOR SCREENING FOR ANTI-CANCER AGENT - Disclosed is an anti-cancer agent which can inhibit the progression of cell cycle in the M phase, unlike taxane anti-cancer agents. The anti-cancer agent comprises a compound capable of inhibiting specifically the expression and/or functions of RBM8A depicted in SEQ ID NO: 1, Magoh depicted in SEQ ID NO: 3 or an isoform thereof. The anti-cancer agent can inhibit the expression and/or functions of RBM8A or Magoh in cancer cells to terminate the cell cycle in the M phase, thereby inhibiting the proliferation of the cells. Therefore, the anti-cancer agent can inhibit the proliferation of cancer cells and induce the apoptosis of cancer cells, leading to the cure of cancer. | 05-10-2012 |
20120122953 | METHODS FOR ENHANCING UTROPHIN PRODUCTION VIA INHIBITION OF MICRORNA - This invention provides a method for enhancing utrophin protein production in a cell by inhibiting an utrophin microRNA molecule. Moreover, the invention provides that methods for enhancing utrophin protein production in a muscle cell are used for treating a muscular dystrophy and/or other myopathies. | 05-17-2012 |
20120122954 | Antisense Oligomers Targeting PCSK9 - The present invention relates to oligomer compounds (oligomers), which target PCSK9 mRNA in a cell, leading to reduced expression of PCSK9. Reduction of PCSK9 expression is beneficial for the treatment of certain medical disorders, such as hypercholesterolemia and related disorders. | 05-17-2012 |
20120122955 | USE OF LNA APOB ANTISENSE OLIGOMERS FOR THE TREATMENT OF ACUTE CORONARY SYNDROMES - The present invention relates to the use of LNA antisense apoB oligonucleotides for the treatment of acute coronary syndrome. | 05-17-2012 |
20120122956 | METHODS FOR INHIBITING ANGIOGENESIS WITH MULTI-ARM POLYMERIC CONJUGATES OF 7-ETHYL-10-HYDROXYCAMPTOTHECIN - The present invention relates to methods of inhibiting angiogenesis in mammals. The present invention includes administering polymeric prodrugs of 7-ethyl-10-hydroxycamptothecin to the mammals in need thereof. The present invention also relates to methods of treating a disease associated with angiogenesis in mammals by administering polymeric prodrugs of 7-ethyl-10-hydroxycamptothecin to the mammals in need thereof. | 05-17-2012 |
20120122957 | REGULATION OF AGING BY MODULATION OF MITOCHONDRIAL FUNCTION - The invention relates to the field of longevity enhancement. More particularly, the invention provides compositions and methods relating to modulation of mitochondrial function. In certain embodiments, the invention provides methods and related compositions for the enhancement of longevity in an animal, comprising inhibition of one or more electron transport chain components, such as cco-1 and homologs thereof, in a tissue-specific manner in the animal. | 05-17-2012 |
20120122958 | TRANSCRIPTIONAL REPRESSION LEADING TO PARKINSON'S DISEASE - Parkinson's disease is caused by the preferential loss of substantia nigra dopamine neurons. A Parkin Interacting Substrate, PARIS (ZNF746) is identified. The levels of PARIS are regulated by the ubiquitin proteasome system via binding to and ubiquitination by the E3 ubiquitin ligase, parkin. PARIS is a KRAB and zinc finger protein that accumulates in models of parkin inactivation and in human brain Parkinson's disease patients. PARIS represses the expression of the transcriptional co-activator, PGC-1α and the PGC-1α target gene, NRF-1 by binding to insulin response sequences in the PGC-1α promoter. Conditional knockout of parkin in adult animals leads to progressive loss of dopamine (DA) neurons that is PARIS dependent. Overexpression of PARIS causes selective loss of DA neurons in the substantia nigra, which is reversed by either parkin or PGC-1α co-expression. The identification of PARIS provides a molecular mechanism for neurodegeneration due to parkin inactivation. | 05-17-2012 |
20120122959 | Targeting MicroRNAs for Metabolic Disorders - Provided herein are methods and compositions for the treatment of metabolic disorders. Also provided herein are methods and compositions for the reduction of blood glucose level, the reduction of gluceoneogenesis, the improvement of insulin resistance and the reduction of plasma cholesterol level. In certain embodiments, the methods comprise inhibiting the activity of miR-103. In certain embodiments, the methods comprise inhibiting the activity of miR-107. In certain embodiments, the activity of both miR-103 and miR-107 is inhibited. In certain embodiments, such methods comprise administering a compound comprising an oligonucleotide targeted to a microRNA. | 05-17-2012 |
20120122960 | Organic Compositions to Treat Beta-ENaC-Related Diseases - The present disclosure relates to RNAi agents useful in methods of treating Beta-ENaC-related diseases such as cystic fibrosis, pseudohypoaldosteronism type 1 (PHA1), Liddle's syndrome, hypertension, alkalosis, hypokalemia, and obesity-associated hypertension, using a therapeutically effective amount of a RNAi agent to Beta-ENaC. | 05-17-2012 |
20120122961 | RNAi Inhibition of Serum Amyloid A For Treatment of Glaucoma - RNA interference is provided for inhibition of serum amyloid A mRNA expression in glaucomas involving SAA expression. | 05-17-2012 |
20120129910 | Inhibition of Apoptosis-Specific eIF-5A(elF-5A1") with Antisense Oligonucleotides and siRNA as Anti-Inflammatory Therapeutics - The present invention relates to apoptosis specific eucaryotic initiation factor 5A (eIF-5A), referred to as apoptosis-specific eIF-5A or eIF5A1, nucleic acids and polypeptides and methods for inhibiting or suppressing apoptosis in cells using antisense nucleotides or siRNAs to inhibit expression of apoptosis-specific eIF-5A. The invention also relates to suppressing or inhibiting expression of pro-inflammatory cytokines or inhibiting activation of NFkB by inhibiting expression of apoptosis-specific eIF-5A. | 05-24-2012 |
20120129911 | COMPOSITIONS AND METHODS OF TARGETING APOLIPOPROTEIN B FOR THE REDUCTION OF APOLIPOPROTEIN C-III - Disclosed herein are compositions and methods for lowering Apolipoprotein C-III (ApoC-III) in a subject in need thereof. Subjects in need of ApoC-III reduction include subjects with elevated ApoC-III levels, subjects with a condition associated with ApoC-III, subjects with diabetes, obese subjects and subjects with cardiovascular disease. Compositions to lower ApoC-III include compounds targeting Apolipoprotein B (ApoB) such as Mipomersen and other antisense compound targeting ApoB. | 05-24-2012 |
20120129912 | RNA Targeting in Alpha-Synucleinopathies - Therapies and assays to screen for small molecules that can have therapeutic use in the control of neurodegenerative diseases such as Parkinson's and other alpha-synucleinopathies. | 05-24-2012 |
20120129913 | dsRNA For Treating Viral Infection - The invention relates to double-stranded ribonucleic acids (dsRNAs) targeting gene expression of phosphatidylinositol 4-kinase (PI4K), in particular human phosphatidylinositol 4-kinase, catalytic, beta polypeptide (PIK4CB) or human phosphatidylinositol 4-kinase, catalytic, alpha polypeptide (PIK4CA), and their use for treating infection by positive stranded RNA viruses such as hepatitis C virus (HCV). Each dsRNA comprises an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of the PIK4CB or PIK4CA target mRNA. A plurality of such dsRNA may be employed to provide therapeutic benefit. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier, and including a delivery modality such as fully encapsulated liposomes or lipid complexes. The invention further includes methods for treating diseases caused by positive stranded RNA virus infection using the pharmaceutical compositions; and methods for inhibiting the propogation of positive stranded RNA viruses in and between cells. | 05-24-2012 |
20120129914 | ORGANIC COMPOSITIONS TO TREAT HSF1-RELATED DISEASES - The present disclosure relates to methods of treating heat shock factor 1 (HSF1)-related diseases such as cancer and viral diseases, using a therapeutically effective amount of a RNAi agent to HSF. | 05-24-2012 |
20120129915 | ORGANIC COMPOSITIONS TO TREAT HSF1-RELATED DISEASES - The present disclosure relates to methods of treating heat shock factor 1 (HSF1)-related diseases such as cancer and viral diseases, using a therapeutically effective amount of a RNAi agent to HSF. | 05-24-2012 |
20120129916 | CELL-TARGETING NANOPARTICLES COMPRISING POLYNUCLEOTIDE AGENTS AND USES THEREOF - A method of generating a particle is disclosed, the particle being for delivery of a polynucleotide to a target cell. The method comprises (a) contacting the polynucleotide with a composition comprising cationic molecules, wherein the cationic molecules condense the polynucleotide by electrostatic interactions to generate a complex, wherein the cationic molecules are not comprised in a liposome; and (b) covalently binding the complex to a targeting moiety at a pH equal to or below about 4.5, thereby generating the particle for delivery of the polynucleotide agent to the target cell. Use of the particles and compositions comprising same are also disclosed. | 05-24-2012 |
20120129917 | TREATMENT OF ADIPONECTIN (ADIPOQ) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO AN ADIPONECTIN (ADIPOQ) - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of an Adiponectin (ADIPOQ), in particular, by targeting natural antisense polynucleotides of an Adiponectin (ADIPOQ). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of Adiponectins (ADIPOQ)s. | 05-24-2012 |
20120136039 | SINGLE NUCLEOTIDE POLYMORPHISM (SNP) TARGETING THERAPIES FOR THE TREATMENT OF HUNTINGTON'S DISEASE - The present invention relates to the discovery of (SNPs) significantly associated with Huntington's disease (HD). The present invention utilizes RNA silencing technology (e.g. RNAi) against such SNPs optimally combined with select additional SNP targeting silencing agents, thereby resulting in an effective treatment of significantly-sized patient populations. Silencing agents having enhanced discriminatory properties are also featured. | 05-31-2012 |
20120136040 | HYBRID INTERFERING RNA - The invention relates to a hybrid interfering RNA molecule comprising a duplex RNA and a single stranded DNA molecule and its use in the ablation of mRNA and in polymerase chain reactions. | 05-31-2012 |
20120136041 | Treating Ocular Diseases Using Peroxisome Proliferator-Activated Receptor Delta Antagonists - The present invention provides novel agents, expression constructs, compositions and methods useful for treating an ocular disease associated with unwanted PPARδ activity through the modulation of PPARδ expression. The PPARδ interference RNA (iRNA) agents, expression constructs encoding such agents, and compositions comprising such agents or constructs are directed against RNA molecules encoding PPARδ. The methods comprise treating an ocular disease associated with unwanted PPARδ activity in a patient in need thereof by administering an effective amount of a pharmaceutical composition comprising a PPARδ iRNA agent or expression construct encoding such agent to the patient to reduce a symptom associated with unwanted PPARδ activity in the patient. | 05-31-2012 |
20120136042 | CARBOHYDRATE CONJUGATES AS DELIVERY AGENTS FOR OLIGONUCLEOTIDES - The present invention provides iRNA agents comprising at least one subunit of the formula (I): | 05-31-2012 |
20120136043 | ANTISENSE OLIGONUCLEOTIDES (ODN) AGAINST SMAD7 AND USES THEREOF IN MEDICAL FIELD - The invention relates to antisense oligonucleotidic sequences (ODN) against Smad7 suitably modified, and their uses in medical field as therapeutic biological agents, in particular in the treatment of chronic inflammatory bowel disease, such as Crohn's disease and ulcerative colitis. | 05-31-2012 |
20120136044 | Compositions And Methods Of Inhibiting NADPH Oxidase Expression - The invention relates to one or more inhibitors, in particular siRNAs, which down-regulate the expression of a NOX gene selected from the group consisting of NOX4, NOX1, NOX2 (gp91phox, CYBB), NOX5, DUOX2, NOXO1, NOXA1 and NOXA2 (p67phox). The invention also relates to a pharmaceutical composition comprising the compound, or a vector capable of expressing the compound, and a pharmaceutically acceptable carrier. The present invention also contemplates a method of treating or preventing the incidence or severity of various diseases or conditions associated with NOX gene comprising administering to the patient the pharmaceutical composition in a therapeutically effective dose so as to thereby treat the patient. | 05-31-2012 |
20120136045 | SCREENING FOR COMPOUNDS THAT MODULATE GPR3-MEDIATED BETA-ARRESTIN SIGNALING AND AMYLOID BETA PEPTIDE GENERATION - The invention relates to the field of disorders of the peripheral or central nervous system, in particular, Alzheimer's disease, and the prevention and/or treatment thereof. In particular, the invention relates to the screening of compounds that modulate GPR3 activity and/or beta-arrestin signaling in a mammalian cell and, in particular, compounds that reduce the formation of amyloid beta peptides. The invention also relates to inhibiting agents targeting beta-arrestin signaling and pharmaceutical compositions thereof, and their use in therapeutic applications of those disorders. | 05-31-2012 |
20120136046 | METHOD OF TREATING AGE RELATED DISORDERS - The present invention relates to the use of fujimycin for the treatment of a disorder related to the chronological and/or replicative life-span of a cell, and to methods for increasing the replicative life span of a cell, said method comprising disrupting the function of a polynucleotide or gene encoding a polypeptide comprising SEQ ID No: 1, 3 or 5. | 05-31-2012 |
20120142753 | DIAGNOSIS AND TREATMENT OF ADRENOCORTICAL TUMORS USING HUMAN MICRORNA-483 - Disclosed herein are methods of diagnosing and treating a malignant adrenocortical tumor, including adrenocortical carcinoma. In some examples, methods of diagnosing a malignant adrenocortical tumor include detecting expression of at least one microRNA (miR) gene product, such as miR-100, miR-125b, miR-195, miR-483-3p, miR-483-5p and IGF2 mRNA in a sample obtained from the subject with an adrenocortical tumor and comparing expression of at least one of these miR gene products and IGF2 mRNA in the sample obtained from the subject to a control. Altered expression of at least one of the miR gene products and IGF2 mRNA, such as a decrease in miR-100, miR-125b or miR-195 or an increase in miR-483-3p, miR-483-5p, and an increase in IGF2 mRNA, in the sample obtained from the subject compared to the control indicates a malignant adrenocortical tumor. | 06-07-2012 |
20120142754 | MODULATION OF TIMP1 AND TIMP2 EXPRESSION - Provided herein are compositions, methods and kits for modulating expression of target genes, particularly of tissue inhibitor of metalloproteinase 1 and of tissue inhibitor of metalloproteinase 2 (TIMP1 and TIMP2, respectively). The compositions, methods and kits may include nucleic acid molecules (for example, short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA) or short hairpin RNA (shRNA)) that modulate a gene encoding TIMP1 and TIMP2, for example, the gene encoding human TIMP1 and TIMP2. The composition and methods disclosed herein may also be used in treating conditions and disorders associated with TIMP1 and TIMP2 including fibrotic diseases and disorders including liver fibrosis, pulmonary fibrosis, peritoneal fibrosis and kidney fibrosis. | 06-07-2012 |
20120142755 | COMPOSITIONS FOR PREVENTING, REDUCING OR TREATING KERATINOCYTE-MEDIATED INFLAMMATION - The present invention relates to the field of epidermal repair. More particularly, the invention concerns the use of a molecule able to inhibit a heteromeric receptor comprising OSMRβ as a subunit, for the preparation of a composition for inhibiting the expression of inflammatory factors by the keratinocytes. In particular, the invention concerns the use of antagonists and/or expression inhibitors of OSM, IL-17, TNFα, IL-31, IFN-γ, and/or the OSMRβ subunit, for the preparation of cosmetic or dermatologic compositions, especially for treating inflammatory skin diseases. | 06-07-2012 |
20120142756 | mRNA FOR USE IN TREATMENT OF HUMAN GENETIC DISEASES - Compositions for modulating the expression of a protein in a target cell comprising at least one RNA molecule which comprises at least one modification conferring stability to the RNA, as well as related methods, are disclosed. | 06-07-2012 |
20120142757 | RNAi Modulation of AHA and Therapeutic Uses Thereof - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of an Aha gene (Aha1 gene), comprising an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of an Aha gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by Aha1 expression and the expression of an Aha gene using the pharmaceutical composition; and methods for inhibiting the expression of an Aha gene in a cell. | 06-07-2012 |
20120142758 | TREATMENT OF DOWN SYNDROME GENE RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO A DOWN SYNDROME GENE - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of a Down Syndrome Gene, in particular, by targeting natural antisense polynucleotides of a Down Syndrome Gene. The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of Down Syndrome Genes. | 06-07-2012 |
20120149754 | METHODS FOR MODULATING THE EXPRESSION AND AGGREGATION OF CAG-EXPANDED GENE PRODUCT IN CELLS AND METHODS FOR IDENTIFYING AGENTS USEFUL FOR DOING THE SAME - This invention provides a method for modulating the expression of a first gene in a cell wherein the first gene is one containing more than 36 CAG trinucleotide repeats and encoding a protein that form polyglutamine-mediated protein aggregation. Suppression of the first gene is achieved by reducing the expression of SPT4 gene or SUPT4H gene. It can also be achieved by inhibiting the formation of a Spt4/Spt5 complex or a Supt4h/Supt5h complex. Also provided is a method for identifying an agent useful for modulating the expression and aggregation of CAG-expanded gene product, or treating a polyglutamine disease such as Huntington's disease. | 06-14-2012 |
20120149755 | ANTISENSE OLIGONUCLEOTIDE MODULATION OF RAF GENE EXPRESSION - Oligonucleotides are provided which are targeted to nucleic acids encoding human raf and capable of inhibiting raf expression. The oligonucleotides may have chemical modifications at one or more positions and may be chimeric oligonucleotides. Methods of inhibiting the expression of human raf using oligonucleotides of the invention are also provided. The present invention further comprises methods of inhibiting hyperproliferation of cells and methods of treating or preventing conditions, including hyperproliferative conditions, associated with raf expression. | 06-14-2012 |
20120149756 | TRICYCLO-DNA ANTISENSE OLIGONUCLEOTIDES, COMPOSITIONS, AND METHODS FOR THE TREATMENT OF DISEASE - Provided are tricyclo-DNA (tc-DNA) AON and methods employing tc-DNA AON for modifying splicing events that occur during pre-mRNA processing. Tricyclo-DNA (tc-DNA) AON are described that may be used to facilitate exon skipping or to mask intronic silencer sequences and/or terminal stem-loop sequences during pre-mRNA processing and to target RNase-mediated destruction of processed mRNA. Tc-DNA AON described herein may be used in methods for the treatment of Duchenne Muscular Dystrophy by skipping a mutated exon 23 or exon 51 within a dystrophin gene to restore functionality of a dystrophin protein; in methods for the treatment of Spinal Muscular Atrophy by masking an intronic silencing sequence and/or a terminal stem-loop sequence within an SMN2 gene to yield modified functional SMN2 protein, including an amino acid sequence encoded by exon 7, which is capable of at least partially complementing a non-functional SMN1 protein; and in methods for the treatment of Steinert's Myotonic Dystrophy by targeting the destruction of a mutated DM1 mRNA comprising 3′-terminal CUG repeats. | 06-14-2012 |
20120149757 | COMPOSITIONS AND METHODS FOR MODULATION OF SMN2 SPLICING - Disclosed herein are compounds, compositions and methods for modulating splicing of SMN2 mRNA in a cell, tissue or animal. Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and disorders, including spinal muscular atrophy. | 06-14-2012 |
20120149758 | PHARMACEUTICAL COMPOSITION FOR PREVENTING, STABILISING AND/OR INHIBITING BLOOD AND LYMPH VASCULARIZATION - A pharmaceutical composition including as active agent, an antisens oligonucleotide having the sequence SEQ ID NO: 1, wherein the antisens oligonucleotide is in a concentration from about 0.40 mg/ml to about 2 mg/ml and the use thereof for preventing, stabilizing and/or inhibiting blood and lymph vascularization. | 06-14-2012 |
20120149759 | TREATMENT OF INSULIN GENE (INS) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO AN INSULIN GENE (INS) - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of an Insulin gene (INS), in particular, by targeting natural antisense polynucleotides of an Insulin gene (INS). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of Insulin Gene (INS). | 06-14-2012 |
20120149760 | DISABLING AUTOPHAGY AS A TREATMENT FOR LYSOSOMAL STORAGE DISEASES - Provided herein are methods of treating lysosomal storage disease, for instance Pompe disease, through inhibition of autophagy. Optionally, treatment is administered as an adjunct to enzyme replacement therapy (ERT). | 06-14-2012 |
20120149761 | NUCLEIC ACID MOLECULES AND USES THEREOF - Provided in this application are formulations of double stranded RNA molecules and Krebs Cycle analogs that improving ribonuclease stability, reducing off-target effects of a double stranded siRNA molecule, or of reducing interferon responsiveness of a double stranded siRNA molecule using such dsRNA. Also disclosed are methods of treating a primary tumor or a metastasis by contacting circulating tumor cells, a primary tumor, or a metastasis with a described formulation. | 06-14-2012 |
20120149762 | Gene and Protein Relating to Hepatocellular Carcinoma and Methods of Use Thereof - The present invention provides a novel human gene ZNFN3A1 whose expression is markedly elevated in a great majority of HCCs compared to corresponding non-cancerous liver tissues. The gene encodes a protein having a zinc finger domain as well as a SET domain and has been found to form a regulatory complex with RNA helicase and RNA polymerase. | 06-14-2012 |
20120157507 | USP47 Inhibtors and Methods to Induce Apoptosis - The present invention relates to USP47 (ubiquitin specific protease 47) inhibitors and methods for inducing apoptosis or cell death in a target cell. In certain embodiments, the invention relates to methods and kits to screen for related agents that induce apoptosis. Additionally, the invention relates to assays for screening compounds capable of acting as USP47 inhibitors. | 06-21-2012 |
20120157508 | TARGETING EN2, PAX2, AND/OR DEFB1 FOR TREATMENT OF PROSTATE CONDITIONS - The present invention relates to methods and compositions for treating a prostate condition in a subject. The method comprises administering to the subject a subject effective amount of a pharmaceutical composition having a first agent that inhibits EN2 expression and/or EN2 activity and a second agent that inhibits PAX2 expression and/or PAX2 activity. The pharmaceutical composition may further comprise a third agent that enhances DEFB1 expression or activity. | 06-21-2012 |
20120157509 | GALACTOSE CLUSTER-PHARMACOKINETIC MODULATOR TARGETING MOIETY FOR siRNA - The present invention is directed compositions for targeted delivery of RNA interference (RNAi) polynucleotides to cell in vivo. The pharmacokinetic modulator improve in vivo targeting compared to the targeting ligand alone. Targeting ligand-pharmacokinetic modulator targeting moiety targeted RNAi polynucleotides can be administered in vivo alone or together with co-targeted delivery polymers. | 06-21-2012 |
20120157510 | Controlling The Potential Of Primate Neural Stem Cells By Regulating Pax6 - A transcription factor both necessary and sufficient for human neuroectoderm specification, Pax6, as well as applications thereof, is disclosed. | 06-21-2012 |
20120157511 | 5' PHOSPHATE MIMICS - The present invention provides nucleosides and oligonucleotides comprising a 5′ phosphate mimics of formula (IVc) or (Vc). One aspect of the present invention relates to modified nucleosides and oligonucleotides comprising such dinucleotide of formula (Ia). Another aspect of the invention relates to a method of inhibiting the expression of a gene in call, the method comprising (a) contacting an oligonucleotide of the invention with the cell; and (b) maintaining the cell from step (a) for a time sufficient to obtain degradation of the mRNA of the target gene. | 06-21-2012 |
20120157512 | Preventing and Curing Beneficial Insect Diseases Via Plant Transcribed Molecules - Methods and compositions for transforming plants to express polynucleotides capable of gene silencing gene expression in pathogens of beneficial insets such as IAPV, | 06-21-2012 |
20120165387 | General composition framework for ligand-controlled RNA regulatory systems - The invention provides an improved design for the construction of extensible nucleic acid-based, ligand-controlled regulatory systems, and the nucleic acid regulatory systems resulting therefrom. The invention contemplates improving the design of the switches (ligand-controlled regulatory systems) through the design of an information transmission domain (ITD). The improved ITD eliminates free-floating ends of the switching and the competing strands, and localizes competitive hybridization events to a contiguous strand of competing and switching strands in a strand-displacement mechanism-based switch, thereby improving the kinetics of strand-displacement. The improved regulatory systems have many uses in various biological systems, including gene expression control or ligand-concentration sensing. | 06-28-2012 |
20120165388 | FATTY ACID BINDING PROTEINS AS DRUG TARGETS FOR ENDOCANNABINOIDS - The invention provides a method of modulating the level of an endocannabinoid in a subject in need thereof comprising administering an effective amount of an agent that inhibits the interaction of the endocannabinoid with an intracellular fatty acid binding protein (FABP). The invention also provides a method of identifying an agent for modulating the level of an endo cannabinoid in a subject comprising testing the agent for its ability to modulate binding of the endocannabinoid with an intracellular FABP. The invention also provides a method of identifying an agent for modulating the level of an endocannabinoid in a subject comprising testing the agent for its ability to modulate expression of an intracellular FABP. The invention also provides a method of identifying an agent for treatment of a neurological disorder comprising testing the agent for its ability to modulate the interaction of an endocannabinoid with an intracellular FABP. The invention also relates to modulation of levels of fatty acid amides for treatment or amelioration of diseases or disorders by modulating binding of the fatty acid amides to fatty acid binding proteins. In one embodiment, the fatty acid binding protein is one or more of FABP3, FABP5, and FABP7. In one embodiment, the level of an endocannabinoid is modulated. | 06-28-2012 |
20120165389 | ANTISENSE OLIGONUCLEOTIDES THAT TARGET A CRYPTIC SPLICE SITE IN USH1C AS A THERAPEUTIC FOR USHER SYNDROME - The present invention provides a method for treating Usher's syndrome in a human subject including administering to the human subject an oligonucleotide having 8 to 30 linked nucleosides having a nucleobase sequence comprising a complementary region comprising at least 8 contiguous nucleobases complementary to a target region of equal length within exon 3 of an Usher RNA transcript. | 06-28-2012 |
20120165390 | Compositions and Methods for Therapy and Diagnosis of Cancer - The present invention is directed to siRNA molecules which specifically target and cause RNAi-induced degradation of mRNA from TPTE genes, so that the protein product of the TPTE gene is not produced or is produced in reduced amounts. The siRNA compounds and compositions of the invention are useful for treating diseases which require inhibition of TPTE expression for their treatment, in particular cancer pathologies. The present invention also includes methods which make possible to assess and/or prognose the metastatic behaviour of a cancer disease and/or the occurrence of a relapse of cancer. | 06-28-2012 |
20120165391 | USE OF INHIBITORS OF ZDHHC2 ACTIVITY FOR MODULATION OF ADIPOGENESIS - The present invention concerns Zdhhc2, a new target involved in adipogenesis modulation. Using a siRNA approach, the inventors demonstrated that decrease in Zdhhc2 activity in adipose tissue induces a decrease in adipogenesis. Thus, the present invention relates to modulators of Zdhhc2 activity as well as screening test for identification of modulators of the activity of this target, and their use, especially in pharmaceutical composition, to modulate adipogenesis and thus treat obesity and related disorders. | 06-28-2012 |
20120165392 | Identification of Micro-RNAS Involved in Post-Myocardial Infarction Remodeling and Heart Failure - The present invention relates to the identification of miRNAs that are involved in heart failure and the process of post-myocardial infarction remodeling in heart tissue. Modulation of these identified miRNAs as a treatment for myocardial infarction, cardiac remodelling, and heart failure is described. | 06-28-2012 |
20120165393 | Peptide-Based In Vivo siRNA Delivery System - The present invention is directed compositions for targeted delivery of RNA interference (RNAi) polynucleotides to hepatocytes in vivo. Targeted RNAi polynucleotides are administered together with co-targeted melittin delivery peptides. Delivery peptides provide membrane penetration function for movement of the RNAi polynucleotides from outside the cell to inside the cell. Reversible modification provides physiological responsiveness to the delivery peptides. | 06-28-2012 |
20120165394 | SPINAL MUSCULAR ATROPHY (SMA) TREATMENT VIA TARGETING OF SMN2 SPLICE SITE INHIBITORY SEQUENCES - The present invention is directed to methods and compositions capable of blocking the inhibitory effect of a newly-identified intronic inhibitory sequence element, named ISS-N1 (for “intronic splicing silencer”), located in the SMN2 gene. The compositions and methods of the instant invention include oligonucleotide reagents (e.g., oligoribonucleotides) that effectively target the SMN2 ISS-N1 site in the SMN2 pre-mRNA, thereby modulating the splicing of SMN2 pre-mRNA to include exon 7 in the processed transcript. The ISS-N1 blocking agents of the invention cause elevated expression of SMN protein, thus compensating for the loss of SMN protein expression commonly observed in subjects with spinal muscular atrophy (SMA). | 06-28-2012 |
20120165395 | Bruton's Tyrosine Kinase As Anti-Cancer Drug Target - Receptor protein tyrosine kinases (RPTKs) transmit extracellular signals across the plasma membrane to cytosolic proteins, stimulating formation of complexes that regulate key cellular functions. Over half of the known tyrosine kinases are implicated in human cancers and are therefore highly promising drug targets. A large-scale loss-of-function analysis of the tyrosine kinases using RNA interference in the clinically relevant Erb-B2 positive, BT474 breast cancer cell line showed that Bruton's tyrosine kinase (BTK), a cytosolic, non-receptor tyrosine kinase that has been extensively studied for its role in B cell development, is required, in altered form, for BT474 breast cancer cell survival. This alternative form contains an amino-terminal extension that is also present in tumorigenic breast cells at significantly higher levels than in normal breast cells. | 06-28-2012 |
20120165396 | MODULATION OF EXPORTIN 5 EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of exportin 5. The compositions comprise oligonucleotides, targeted to nucleic acid encoding exportin 5. Methods of using these compounds for modulation of exportin 5 expression and for diagnosis and treatment of diseases and conditions associated with expression of exportin 5 are provided. | 06-28-2012 |
20120165397 | CHEMICAL MODIFICATION OF SHORT SMALL HAIRPIN RNAS FOR INHIBITION OF GENE EXPRESSION - Aspects of the present invention include the production and use of chemically modified RNAi agents (e.g., shRNAs) in gene silencing applications. The chemically modified RNAi agents disclosed herein have reduced immunostimulatory activity, increased serum stability, or both, as compared to a corresponding RNAi agent not having the chemical modification. Compositions containing chemically modified RNAi agents according to aspects of the present invention (including pharmaceutical compositions) and kits containing the same are also provided. | 06-28-2012 |
20120165398 | PHARMACEUTICAL COMPOSITIONS AND METHODS USEFUL FOR MODULATING ANGIOGENESIS, INHIBITING METASTASIS AND TUMOR FIBROSIS, AND ASSESSING THE MALIGNANCY OF COLON CANCER TUMORS - Methods and compositions suitable for modulating angiogenesis in a mammalian tissue are provided. Further provided are methods suitable for inhibiting metastasis and fibrosis in a mammalian tissue and for assessing the malignancy of colon cancer tumors. | 06-28-2012 |
20120165399 | SNORNAI-SMALL NUCLEOLAR RNA DEGRADATION BY RNA INTERFERENCE IN TRYPANOSOMATIDS - Polynucleotides and a method suitable for downregulation of small nuclear RNA which can be used to treat diseases associated with activity of small nuclear RNA are provided. Specifically, the present invention can be used to downregulate snoRNA molecules or box H/ACA-containing RNA molecules which are involved in diseases such as cancer. | 06-28-2012 |
20120172409 | METHODS AND KITS FOR LINKING POLYMORPHIC SEQUENCES TO EXPANDED REPEAT MUTATIONS - Methods and kits are provided for determining which single nucleotide polymorphism (“SNP”) variant of an allele of a heterozygous patient is on the same allele as a disease-causing mutation. Also, provided are kits for multi-SNP diagnosis and treatment, targeting combinations of SNPs having greater joint prevalence of heterozygosity in Huntington's population than individual SNPs considered individually. | 07-05-2012 |
20120172410 | SHORT HAIRPIN RNA FOR GENE KNOCKDOWN OF NR1 SUBUNIT OF THE N-METHYL-D-ASPARTATE RECEPTOR AND ITS APPLICATION ON PHARMACEUTICS - A short hairpin RNA (shRNA) for gene knockdown the genetic expression of NR1 subunit of N-methyl-D-aspartate (NMDA) receptor comprises a first fragment sharing homologous nucleotides among the NR1 subunit of NMDA receptor; a second fragment having complementary sequence to the first fragment; and a connecting fragment having any base in repeated arrangement, and connecting to the first and second fragments. Also, a method of treatment for pathological pain, by applying the shRNA described above to subcutaneous tissues of living organisms for gene knockdown the genetic expression of the NR1 subunit of NMDA receptor in hypoderm. | 07-05-2012 |
20120172411 | NOVEL TRIALKYL CATIONIC LIPIDS AND METHODS OF USE THEREOF - The present invention provides compositions and methods for the delivery of therapeutic agents to cells. In particular, these include novel cationic lipids and nucleic acid-lipid particles that provide efficient encapsulation of nucleic acids and efficient delivery of the encapsulated nucleic acid to cells in vivo. The compositions of the present invention are highly potent, thereby allowing effective knock-down of a specific target protein at relatively low doses. In addition, the compositions and methods of the present invention are less toxic and provide a greater therapeutic index compared to compositions and methods previously known in the art. | 07-05-2012 |
20120172412 | In Vivo Polynucleotide Delivery Conjugates Having Enzyme Sensitive Linkages - The present invention is directed compositions for delivery of RNA interference (RNAi) polynucleotides to cells in vivo. The compositions comprise amphipathic membrane active polyamines reversibly modified with enzyme cleavable dipeptide-amidobenzyl-carbonate masking agents. Modification masks membrane activity of the polymer while reversibility provides physiological responsiveness. The reversibly modified polyamines (dynamic polyconjugate or DPC) are further covalently linked to an RNAi polynucleotide or co-administered with a targeted RNAi polynucleotide-targeting molecule conjugate. | 07-05-2012 |
20120172413 | INCREASING LIFESPAN BY MODULATING CRTC EXPRESSION OR LOCALIZATION, AND METHODS OF SCREENING FOR MODULATORS OF SAME - The invention relates to the field of longevity enhancement. More particularly, the invention provides compositions and methods relating to CRTC modulation. In certain embodiments, the invention provides compositions and methods for enhancing longevity in an organism by inhibiting CRTC activity, such as, for example, inhibiting CRTC expression or cellular localization in the organism. | 07-05-2012 |
20120172414 | BICYCLIC CYCLOHEXOSE NUCLEIC ACID ANALOGS - The present invention provides bicyclic cyclohexose nucleoside analogs and oligomeric compounds comprising these nucleoside analogs. These bicyclic nucleoside analogs are useful for enhancing properties of oligomeric compounds including nuclease resistance. | 07-05-2012 |
20120172415 | Exon Skipping Therapy for Functional Amelioration of Semifunctional Dystrophin in Becker and Duchenne Muscular Dystrophy - Methods for stabilizing unstable proteins or for restoring functionality to non-functional or poorly functioning (semi-functional) proteins using exon skipping technology are provided. The methods involve the administration of antisense oligonucleotides to cause exon skipping, thereby removing one or more exons responsible for protein instability or lack of functionality. For example, exons encoding protease recognition sites may be removed. The method is useful for treating diseases caused by protein instability, such as Becker Muscular Dystrophy, or for treating Duchenne Muscular Distrophy patients with semi-functional dystrophin due to treatment with other exon skipping or stop codon readthrough therapies. | 07-05-2012 |
20120172416 | METHOD FOR THE PREPARATION OF MICRO-RNA AND ITS THERAPEUTIC APPLICATION - The present invention relates to compositions comprising a therapeutically effective amount of miRNAs, their use for the treatment of medical conditions benefiting from being treated with these compositions, as well as methods for the preparation of compositions comprising miRNAs. | 07-05-2012 |
20120178791 | MODULATION OF HUMAN CYTOMEGALOVIRUS REPLICATION BY MICRO-RNA 132 (miR132), MICRO-RNA 145 (miR145) AND MICRO-RNA 212 (miR212) - The present invention related to miR145, miR132, miR212, and the genes or gene products regulated by these miRNAs. miR145 is downregulated in cells infected with HCMV. This downregulation modulates expression of miR145 target genes, including IRS-I. Transfection of cells with a miR145 agent, such as a miR145 mimetic, reduces HCMV replication and protein expression. miR132 and miR212 are upregulated in cells infected with HCMV. This upregulation modulates expression of miR132 and miR212 target genes, including MeCP2 and RICS. Transfection of cells with a miR132 and/or a miR212 antagonist reduces HCMV replication and protein expression. Accordingly, the invention provides methods of attenuating HCMV replication by modulating, for example, miR145, miR132, and/or miR212, and targets thereof. Also provided are methods of detecting an HCMV infection, and compositions and kits useful for attenuating HCMV replication. | 07-12-2012 |
20120178792 | DRG11-RESPONSIVE (DRAGON) GENE FAMILY - This invention features methods and compositions useful for treating and diagnosing diseases of the nervous system, retina, skin, muscle, joint, and cartilage using a Dragon family protein. Protein and nucleic acid sequences of human, murine, zebrafish, and | 07-12-2012 |
20120178793 | NUCLEOTIDE-COCHLEATE COMPOSITIONS AND METHODS OF USE - The present invention is directed to cochleate composition that include a nucleotide. The nucleotide may generally be bound via a linker to a component of the cochleate, or to a lipophilic tail. Additionally or alternatively, the nucleotide may he associated with a transfection agent. The present invention also includes methods for making and using, the compositions provided herein. | 07-12-2012 |
20120178794 | RNAi-Mediated Inhibition of RHO Kinase for Treatment of Ocular Disorders - RNA interference is provided for inhibition of Rho kinase mRNA expression for treating patients with ocular disorders, particularly for treating intraocular pressure, ocular hypertension and glaucoma. Rho kinase mRNA targets include mRNA for ROCK1 and ROCK2. | 07-12-2012 |
20120178795 | RNAI-MEDIATED INHIBITION OF FRIZZLED RELATED PROTEIN-1 FOR TREATMENT OF GLAUCOMA - RNA interference is provided for inhibition of Frizzled Related Protein-1 mRNA expression, in particular, for treating patients having glaucoma or at risk of developing glaucoma. | 07-12-2012 |
20120178796 | SPLICE VARIANTS - We disclose the isolation and characterization of sirtuin 1 [SIRT1] splice variants. | 07-12-2012 |
20120184595 | COMPOSITIONS AND METHODS FOR SILENCING APOLIPOPROTEIN C-III EXPRESSION - The present invention provides compositions comprising therapeutic nucleic acids such as interfering RNA that target apolipoprotein C-III (APOC3) gene expression, lipid particles comprising one or more (e.g., a cocktail) of the therapeutic nucleic acids, methods of making the lipid particles, and methods of delivering and/or administering the lipid particles (e.g., for the treatment of lipid diseases or disorders such as atherosclerosis or a dyslipidemia such as hypertriglyceridemia or hypercholesterolemia). | 07-19-2012 |
20120184596 | MICRORNA INHIBITORS COMPRISING LOCKED NUCLEOTIDES - The invention provides chemically modified oligonucleotides capable of inhibiting the expression (e.g., abundance) of miR-208 family miRNAs, including miR-208a, miR-208b, and/or miR-499. The invention provides in some embodiments, oligonucleotides capable of inhibiting, in a specific fashion, the expression or abundance of each of miR-208a, miR-208b, and miR-499. The invention further provides pharmaceutical compositions comprising the oligonucleotides, and methods of treating patients having conditions or disorders relating to or involving a miR-208 family miRNA, such as a cardiovascular condition. In various embodiments, the oligonucleotides provide advantages in one or more of potency, efficiency of delivery, target specificity, toxicity, and/or stability. | 07-19-2012 |
20120184597 | OLIGORIBONUCLEOTIDES AND METHODS OF USE THEREOF FOR TREATMENT OF ALOPECIA, ACUTE RENAL FAILURE AND OTHER DISEASES - The invention relates to a double-stranded compound, preferably an oligoribonucleotide, which down-regulates the expression of a human p53 gene. The invention also relates to a pharmaceutical composition comprising the compound, or a vector capable of expressing the oligoribonucleotide compound, and a pharmaceutically acceptable carrier. The present invention also contemplates a method of treating a patient suffering from alopecia or acute renal failure or other diseases comprising administering to the patient the pharmaceutical composition in a therapeutically effective dose so as to thereby treat the patient. The alopecia may be induced by chemotherapy or radiotherapy, and the patient may be suffering from cancer, in particular breast cancer. | 07-19-2012 |
20120184598 | POLYNUCLEOTIDES FOR MULTIVALENT RNA INTERFERENCE, COMPOSITIONS AND METHODS OF USE THEREOF - The present invention includes bivalent or multivalent nucleic acid molecules or complexes of nucleic acid molecules having two or more target-specific regions, in which the target-specific regions are complementary to a single target gene at more than one distinct nucleotide site, and/or in which the target regions are complementary to more than one target gene or target sequence. Also included are compositions comprising such nucleic acid molecules and methods of using the same for multivalent RNA interference and the treatment of a variety of diseases and infections. | 07-19-2012 |
20120184599 | Use of MicroRNA for Treating Diseases Associated with a Dysfunction of the Cilia in Multiciliated Epithelial Cells - The present invention relates to a method for evaluating the regenerative and/or differentiation capacity of ciliated epithelial tissue in a vertebrate subject, in particular a mammal, preferably a human, and to the use of microRNA in treating illnesses associated with a dysfunction of multiciliated epithelial cells. | 07-19-2012 |
20120184600 | Inhibition of Glycerol-3-Phosphate Acyltransferase (GPAT) and Associated Enzymes for Treatment of Viral Infections - A method of treating or preventing a viral infection in a mammal by administering a compound or pharmaceutically acceptable derivative thereof that inhibits a phosphatidic acid synthesis enzyme | 07-19-2012 |
20120190726 | FUNCTIONALIZED POLYSACCHARIDES FOR ACTIVE AGENT DELIVERY - Embodiments of the invention include functionalized polysaccharides and compositions and structures including the same. In an embodiment, the invention includes an active agent delivery composition including a polysaccharide functionalized with a coupling group, wherein the polysaccharide lacks charged groups at a pH of between 6 and 8; and a complex comprising a nucleic acid and a transfection agent. In an embodiment, the invention includes an active agent delivery structure including a matrix comprising a polysaccharide covalently cross-linked through the residue of a coupling group on the polysaccharide, the polysaccharide lacking charged groups at a pH of between 6 and 8; and a nucleic acid delivery complex disposed within the active agent delivery structure. In an embodiment, the invention includes a material for medical applications including glycogen functionalized with coupling groups at a degree of substitution of between about 0.01 and 0.5. Other embodiments are also included herein. | 07-26-2012 |
20120190727 | METHOD AND MEANS FOR TREATMENT OF OSTEOARTHRITIS - The present invention relates to in vivo and in vitro methods, agents and compound screening assays for inducing anabolic stimulation of chondrocytes, including cartilage formation enhancing pharmaceutical compositions, and the use thereof in treating and/or preventing a disease involving a systemic or local decrease in mean cartilage thickness in a subject. | 07-26-2012 |
20120190728 | COMPOSITIONS AND METHODS FOR MODULATION OF SMN2 SPLICING IN A SUBJECT - Disclosed herein are compounds, compositions and methods for modulating splicing of SMN | 07-26-2012 |
20120190729 | MIRNA INHIBITION OF SIX1 EXPRESSION - The invention provides a method of treating cancer in a subject comprising administering to said subject an miRNA that inhibits Six1. In some embodiments, the invention further provides for the administration of a second cancer therapy to the subject. | 07-26-2012 |
20120196918 | PREVENTING ISLET INFLAMMATION AND DYSFUNCTION AND MAINTAINING PROPER GLUCOSE LEVELS BY CONTROLLING eIF5A AND ITS HYPUSINATION - Pancreatic islet dysfunction, in both type 1 and type 2 diabetes results, in part, from cytokine-mediated inflammation leading to iNOS generation and the death of pancreatic islets. The production of pro-inflammatory cytokines involved in the generation of iNOS is facilitated by the availability of the hypusine-containing translational factor eIF5A, necessary for the maturation of antigen-presenting cells. Treatment with agents capable of interfering with the mRNA translating iNOS or with agents that can interfere with the hypusination of eIF5A, prevents the death of islets, lowers blood glucose levels, avoids insulin resistance, and generally avoids the inflammatory response in islets associated with type 1 and type 2 diabetes. | 08-02-2012 |
20120196919 | EX-VIVO TREATMENT OF IMMUNOLOGICAL DISORDERS WITH PKC-THETA INHIBITORS - Disclosed is a method for treating a variety of diseases and disorders that are mediated or sustained through the activity of PKC-theta, including immunological disorders and atherosclerosis. Specifically, the invention relates to a method of treating an immunological disorder or atherosclerosis in a patient comprising treating blood from the patient, or a defined component of said blood, with an inhibitor of PKC-theta ex vivo and then re-administering the treated blood to the patient. | 08-02-2012 |
20120196920 | ANTISENSE OLIGONUCLEOTIDES AGAINST ACETYLCHOLINESTERASE FOR TREATING INFLAMMATORY DISEASES - The present invention relates to novel uses of antisense oligolucleotides targeted to the coding region of acetylcholinesterase (AChE) for treating inflammatory disorders other than inflammatory disorders of the central nervous system or the peripheral nervous system innervating voluntary muscles. More particularly, the present invention relates to uses of antisense oligodexoynucleotides targeted to AChE mRNA for treating inflammatory disease of the gastroinstestinal tract including inflammatory bowel disease. | 08-02-2012 |
20120202870 | TREATMENT OF INFLAMMATORY DISEASES USING MIR-124 - Methods of treating, reducing the risk of developing, or delaying the onset of an inflammatory disease are disclosed. The methods involved providing a subject with or at risk of developing an inflammatory disease and administering to the subject an effective amount of a first therapeutic composition comprising miR-124. Further provided are methods of diagnosing a subject with or at risk of developing an inflammatory disease. | 08-09-2012 |
20120202871 | CATIONIC LIPIDS AND METHODS FOR THE DELIVERY OF THERAPEUTIC AGENTS - The present invention provides compositions and methods for the delivery of therapeutic agents to cells. In particular, these include novel cationic lipids and nucleic acid-lipid particles that provide efficient encapsulation of nucleic acids and efficient delivery of the encapsulated nucleic acid to cells in vivo. The compositions of the present invention are highly potent, thereby allowing effective knock-down of a specific target protein at relatively low doses. In addition, the compositions and methods of the present invention are less toxic and provide a greater therapeutic index compared to compositions and methods previously known in the art. | 08-09-2012 |
20120202872 | METHODS AND COMPOSITIONS FOR THE DIAGNOSIS AND PROGNOSIS OF CERVICAL INTRAEPITHELIAL NEOPLASIA AND CERVICAL CANCER - The invention provides methods and compositions for the diagnosis and prognosis of cervical intraepithelial neoplasia and cervical cancer. The methods comprise the step of determining the expression levels or genetic status of specific miRNAs. | 08-09-2012 |
20120202873 | RNAi Probes Targeting Cancer-Related Proteins - RNAi sequences that are useful as therapeutics in the treatment of cancers of various types, including prostate cancer, sarcomas such as osteosarcoma, renal cell carcinoma, breast cancer, bladder cancer, lung cancer, colon cancer, ovarian cancer, anaplastic large cell lymphoma and melanoma; and Alzheimer's disease. These sequences target clusterin, IGFBP-5, IGFBP-2, both IGFBP-2 and -5 simultaneously, Mitf, and B-raf. The invention further provides for the use of these RNAi sequences in the treatment of cancers of various types, including prostate cancer, sarcomas such as osteosarcoma, renal cell carcinoma, breast cancer, bladder cancer, lung cancer, colon cancer, ovarian cancer, anaplastic large cell lymphoma and melanoma; and Alzheimer's disease, and a method of treating such conditions through the administration of the RNA molecules with RNAi activity to an individual, including a human individual in need of such treatment. | 08-09-2012 |
20120202874 | ANTISENSE OLIGONUCLEOTIDE MODULATION OF STAT3 EXPRESSION - Compounds, compositions and methods are provided for inhibiting the expression of human STAT3. The compositions comprise antisense oligonucleotides targeted to nucleic acids encoding STAT3. Methods of using these oligonucleotides for inhibition of STAT3 expression and for promotion of apoptosis are provided. Methods for treatment of diseases, particularly inflammatory diseases and cancers, associated with overexpression or constitutive activation of STAT3 or insufficient apoptosis are also provided. | 08-09-2012 |
20120202875 | Method Of Treatment - The present invention relates to methods for treatment or prevention of autoimmune and inflammatory diseases and conditions by inhibiting or modifying histone demethylation. In a further aspect the invention relates to a method for identifying agents useful in said methods of treatment. The invention particularly describes the role of certain histone demethylase enzymes in these diseases and conditions and their use as therapeutic and screening targets. | 08-09-2012 |
20120208860 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF FACTOR VII GENE - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the Factor VII gene. | 08-16-2012 |
20120208861 | IFN TYPE-I PRODUCTION INHIBITOR AND METHOD FOR SCREENING FOR SAME - It has been found that Spi-B, in cooperation with IRF-7, induces type I IFN production. This invention is based on the finding, and provides a type I IFN production inhibitor comprising an antisense nucleic acid or siRNA against Spi-B, or an expression vector capable of expressing the same; a screening method for a substance capable of inhibiting type I IFN production, comprising selecting a substance that suppresses the expression or function of Spi-B as a substance capable of inhibiting type I IFN production; and a type I IFN production inducer comprising an expression vector capable of expressing Spi-B and an expression vector capable of expressing IRF-7 in combination, and the like. | 08-16-2012 |
20120208862 | RIP140 REGULATION OF GLUCOSE TRANSPORT - Inhibition of RIP140 increases glucose transport. Compounds that inhibit RIP140 expression or activity are useful for treating disorders associated with aberrant glucose transport (e.g., diabetes), treating obesity, increasing metabolism (e.g., fatty acid metabolism), and increasing brown fat. | 08-16-2012 |
20120208863 | MODULATION OF GLUT4 GENE PROMOTER ACTIVITY BY AHNAK - Agents capable of alleviating AHNAK phosphoprotein-mediated repression of GLUT4 gene expression are useful for prevention, treatment, and/or alleviation of insulin resistance associated with obesity, lipotoxicity, hypertension, metabolic syndrome and type 2 diabetes. Preferred agents are double-stranded siRNAs. | 08-16-2012 |
20120208864 | COMPOUNDS AND METHODS FOR MODULATING EXPRESSION OF GCGR - The present disclosure describes short antisense compounds, including such compounds comprising chemically-modified high-affinity monomers 8-16 monomers in length. Certain such short antisense compound are useful for the reduction of target nucleic acids and/or proteins in cells, tissues, and animals with increased potency and improved therapeutic index. Thus, provided herein are short antisense compounds comprising high-affinity nucleotide modifications useful for reducing a target RNA in vivo. Such short antisense compounds are effective at lower doses than previously described antisense compounds, allowing for a reduction in toxicity and cost of treatment. In addition, the described short antisense compounds have greater potential for oral dosing. | 08-16-2012 |
20120208865 | EXON SKIPPING THERAPY FOR DYSFERLINOPATHIES - The present invention relates to methods for restoring the function of a mutated dysferlin comprising the step of preventing splicing of one or more exons which encode amino acid sequences that cause said dysferlin dysfunction. Particularly, the splicing of exon 32 is prevented. The present invention also relates to a method for treating a dysferlinopathy in a patient in need thereof, comprising the step of administering to said patient antisense oligonucleotides complementary to nucleic acid sequences that are necessary for correct splicing of one or more exons which encode amino acid sequences that cause said dysfunction. Particularly, the splicing of exon 32 is prevented. | 08-16-2012 |
20120214860 | METHOD OF REGULATING THE EXPRESSION LEVEL OF SURVIVAL OF MOTOR NEURON 1 (SMN1) AND DETECTING ENZYME ACTIVITY OF UBIQUITIN CARBOXYL-TERMINAL HYDROLASE L1 (UCHL1) - The present invention relates to a method of regulating the expression level of survival of motor neuron 1 (SMN1) comprising administering to a subject in need thereof a therapeutically effective amount of ubiquitin carboxyl-terminal hydrolase L1 (UCHL1) regulator and a pharmaceutically acceptable carrier. The present invention also relates to a method of detecting enzyme activity of ubiquitin carboxyl-terminal hydrolase L1 (UCHL1) in human fibroblasts comprising detecting protein expression level of survival of motor neuron 1 (SMN1). | 08-23-2012 |
20120214861 | METHODS AND COMPOSITIONS FOR TREATING NEUROLOGICAL DISEASE - This invention relates to methods and compositions for treating neurological disease, and more particularly to methods of delivering iRNA agents to neural cells for the treatment of neurological diseases. | 08-23-2012 |
20120214862 | MODULATION OF FACTOR 7 EXPRESSION - Disclosed herein are antisense compounds and methods for decreasing Factor 7 and treating or preventing thromboembolic complications in an individual in need thereof. Examples of disease conditions that can be ameliorated with the administration of antisense compounds targeted to Factor 7 include thrombosis, embolism, and thromboembolism, such as, deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke. Antisense compounds targeting Factor 7 can also be used as a prophylactic treatment to prevent individuals at risk for thrombosis and embolism. | 08-23-2012 |
20120214863 | Anti-miR-1 Therapy for Wound Healing - Methods for modulating gene expression in a skin cell by administering to the cell an amount of a therapeutic composition in an amount sufficient to modulate the expression of miR- | 08-23-2012 |
20120214864 | MIRNAS DYSREGULATED IN TRIPLE-NEGATIVE BREAST CANCER - The invention provides methods of diagnosing and treating cancer in a subject. The inventors have identified a series of dysregulated miRNAs that are indicative of triple-negative breast cancer. In some embodiments, the invention further provides for the administration of a cancer therapy to the subject. | 08-23-2012 |
20120214865 | METHODS FOR SLOWING FAMILIAL ALS DISEASE PROGRESSION - Methods for slowing disease progression in an individual suffering from familial ALS are provided. Also provided are methods of increasing the survival time of an individual suffering from familial ALS. These methods employ antisense oligonucleotides targeted to SOD1, for use in inhibiting the expression of SOD1 in the central nervous system of an individual suffering from familial ALS. | 08-23-2012 |
20120220644 | USE OF TWO MICRORNA MOLECULARS IN LUNG CANCER PROGNOSIS AND MEDICINE PREPARATION - The present invention relates to use of two microRNAs in detection of lung cancer prognosis and in medicine preparation. Particularly, the invention relates to a composition comprising two small RNA molecules microRNA-150 and microRNA-886-3p, a device comprising the composition used in detection of lung cancer prognosis and in preparation of medicaments for inhibiting mammal and human lung cancer metastasis. Specifically, the expression levels of microRNA-150 and microRNA-886-3p can be used as the prognostic criteria of lung cancer prognosis, wherein high expression level of the gene combination indicates favorable therapeutic effect. The invention also relates to a device detecting the expression levels of microRNA-150 and microRNA-886-3p in mammalian and human lung cancer and a method for detecting the expression levels of microRNA-150 and microRNA-886-3p in samples. | 08-30-2012 |
20120220645 | GENETIC CHANGES IN ATM AND ATR/CHEK1 AS PROGNOSTIC INDICATORS IN CANCER - The present invention relates to the discovery that, in human cancer, an 11q deletion of ATM together with an increase in ATR and CHEK1 expression correlates with resistance to ionizing radiation which could be overcome by inhibition of the ATR/CHEK1 pathway. It provides for methods of identifying patients unlikely to exhibit an adequate response to radiation therapy and/or chemotherapy who may benefit from ATR/CHEK1 pathway inhibition, as well as methods of treating said patients. | 08-30-2012 |
20120220646 | Treatment of Cancer by Inhibition of IGFBPs and Clusterin - Agents that reduce the amount of IGFBP-2 and/or IGFBP-5 and that are known to be useful in the treatment of cancer result in increased expression of the protein clusterin. Since clusterin can provide protection against apoptosis, this secondary effect detracts from the efficacy of the therapeutic agent. In overcoming this, the present invention provides a combination of therapeutic agents that is useful in the treatment of cancer. The combination includes an agent that reduces the amount of IGFBP-2 and/or IGFBP-5 and that stimulates expression of clusterin as a secondary effect, and an oligonucleotide that is effective to reduce the amount of clusterin in cancer cells. In some embodiments of the invention, the agent that reduces IGFBP-2 and/or IGFBP-5 is a bispecific antisense species. The oligonucleotide may be an antisense oligonucleotide or an RNAi oligonucleotide. | 08-30-2012 |
20120220647 | NANO-HYBRID OF TARGETABLE SIRNA-LAYERED INORGANIC HYDROXIDE, MANUFACTURING METHOD THEREOF, AND PHARMACEUTICAL COMPOSITION FOR TREATING TUMOR COMPRISING THE NANO-HYBRID - A nanohybrid of the potent gene therapeutic agent siRNA (small interfering RNA) and a target-specific layered inorganic hydroxide, a preparation method thereof, and a pharmaceutical composition for tumor treatment containing the target-specific, siRNA/layered inorganic hydroxide nanohybrid. The nanohybrid increases the in vivo stability of the siRNA, and a target-specific multifunctional ligand, which is bonded to the layered inorganic hydroxide and can bind specifically to a tumor, increases the efficiency of tumor-specific transfer of the siRNA such that the siRNA shows tumor therapeutic activity even at a relatively low dose. Thus, the nanohybrid will be widely useful for target-specific antitumor therapies. | 08-30-2012 |
20120225924 | SINGLE-MONOMER DERIVED LINEAR-LIKE COPOLYMER COMPRISING POLYETHYLENIMINE AND POLY(ETHYLENE GLYCOL) FOR NUCLEIC ACID DELIVERY - A method of synthesizing a random copolymer of polyethyleneimine and polyethylene glycol, comprising exposing ethanolamine in a solution to electromagnetic radiation for a sufficient time to polymerize the ethanolamine (OHCH | 09-06-2012 |
20120225925 | Micro-RNA Biomarkers and Methods of Using Same - A procedure and an apparatus are described for identifying individuals at risk of pulmonary tumour and/or for diagnosing a pulmonary tumour using the study of levels of expression of miRNA in the blood or another biological fluid. Also described are a method and a compound for reducing or eliminating a risk of pulmonary tumour by rebalancing the miRNAs that are underexpressed or overexpressed. | 09-06-2012 |
20120225926 | AMPHIPHILIC MACROMOLECULES FOR NUCLEIC ACID DELIVERY - The invention provides amphiphilic macromolecules that are useful for delivering nucleic acids to cells and that are useful as delivery agents for gene therapy. | 09-06-2012 |
20120225927 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF TRANSTHYRETIN - The invention relates to a double-stranded ribonucleic acid (dsRNA) targeting a transthyretin (TTR) gene, and methods of using the dsRNA to inhibit expression of TTR. | 09-06-2012 |
20120225928 | CANCER CELL-SPECIFIC APOPTOSIS-INDUCING AGENTS THAT TARGET CHROMOSOME STABILIZATION-ASSOCIATED GENES - The present inventors discovered that inhibition of the expression of various genes associated with chromosome stabilization induces cancer cell-specific apoptosis and inhibits cell proliferation. Compounds that inhibit expression of a gene associated with chromosome stabilization or inhibit the function of a protein encoded by such a gene are thought to have cancer cell-specific apoptosis-inducing effects. | 09-06-2012 |
20120232124 | COMPOSITIONS AND METHODS FOR PROGNOSIS AND TREATMENT OF PROSTATE CANCER - Described herein are compositions and methods for prognosis and treatment of prostate cancer patients. Specifically the invention relates to microRNA molecules associated with the prognosis of prostate cancer, as well as various nucleic acid molecules relating thereto or derived therefrom. | 09-13-2012 |
20120232125 | MODULATION OF DIACYLGLYCEROL ACYLTRANSFERASE 1 EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of diacylglycerol acyltransferase 1. The compositions comprise oligonucleotides, targeted to nucleic acid encoding diacylglycerol acyltransferase 1. Methods of using these compounds for modulation of diacylglycerol acyltransferase 1 expression and for diagnosis and treatment of disease associated with expression of diacylglycerol acyltransferase 1, such as obesity and obesity-related conditions, are provided. | 09-13-2012 |
20120232126 | MULTI-TARGETS INTERFERING RNA MOLECULES AND THEIR APPLICATIONS - This invention relates to interfering RNA (iRNA) molecules and their applications, especially multi-targets iRNA molecules and their applications. The said multi-targets iRNA molecules comprised of a sense strand annealed onto at least one antisense strand, each strand is at least 30 nucleotides in length, the sense or antisense strand has at least two segments, which can target at least two RNAs of different genes, or can target at least two portions of an RNA, and wherein the iRNA does not induce an interferon-response when transfected into a cell. The iRNA molecule can interfere with the translation procedure post-transcription, and the target gene is inhibited or blocked, the iRNA does not induce an interferon-response in vivo. The RNA molecules are the active ingredient in preparation of the drug which can regulate one or many genes function. | 09-13-2012 |
20120232127 | REGULATION OF NEUROTRANSMITTER RELEASE THROUGH ANION CHANNELS - A novel use of anion channels, preferably Ca | 09-13-2012 |
20120232128 | TREATMENT OF INFLUENZA - The present invention provides a double-stranded RNA which inhibits replication of influenza B viruses by RNA interference, in which the double-stranded RNA comprises an RNA having 19 to 25 nucleotides homologous with a part of an mRNA transcribed from a genomic RNA of the influenza B viruses and an antisense RNA thereof. | 09-13-2012 |
20120238617 | MICRORNA EXPRESSION SIGNATURE IN PERIPHERAL BLOOD OF PATIENTS AFFECTED BY HEPATOCARCINOMA OR HEPATIC CIRRHOSIS AND USES THEREOF - A method for diagnosing or prognosticating hepatocellular carcinoma, also in the early stages, or for assessing the risk of developing hepatocellular carcinoma, or for monitoring the effectiveness of an anti-tumour therapy against hepatocellular carcinoma by measuring the expression level of at least one miRNA gene product in a peripheral blood sample or in a biological fluid sample. Said method comprises measuring, in an isolated sample of peripheral blood or biological fluid, the expression level of at least one miRNA gene product, and comparing said measured expression level with a reference level. Such method can also be used to diagnose or assess the risk of developing liver cirrhosis in patients affected by chronic hepatitis, or to prognosticate the evolution of cirrhosis in patients affected by cirrhosis, or to monitor the effectiveness of a pharmacological therapy against liver cirrhosis. | 09-20-2012 |
20120238618 | Pharmaceutical Composition Comprising Anti-miRNA Antisense Oligonucleotides - The invention provides pharmaceutical compositions comprising short single stranded oligonucleotides, of length of between 8 and 26 nucleobases which are complementary to human microRNAs selected from the group consisting of miR19b, miR21, miR122a, miR155 and miR375. The short oligonucleotides are particularly effective at alleviating miRNA repression in vivo. It is found that the incorporation of high affinity nucleotide analogues into the oligonucleotides results in highly effective anti-microRNA molecules which appear to function via the formation of almost irreversible duplexes with the miRNA target, rather than RNA cleavage based mechanisms, such as mechanisms associated with RNaseH or RISC. | 09-20-2012 |
20120238619 | MICRO-RNA FOR THE REGULATION OF CARDIAC APOPTOSIS AND CONTRACTILE FUNCTION - The present invention relates to treating or preventing age-related cardiomyopathy by modulating the expression or activity of a miR-34 family member and/or PNUTS. Methods of treating or preventing age-related cardiomyopathy include administering an inhibitor of miR-34 expression or activity or an agonist of PNUTS expression or activity. Also provided herein are methods of treating or preventing cardiac fibrosis and myocardial infarction by administering an inhibitor of miR-34 expression or activity or an agonist of PNUTS expression or activity. | 09-20-2012 |
20120245216 | COMPOSITIONS AND METHODS FOR TREATMENT OF NEUROPATHIC PAIN - The present invention relates to compounds, compositions, methods, systems and kits for treating neuropathic pain regulated by SIP30. The present invention provides SIP30 antagonists for the treatment of neuropathic pain. | 09-27-2012 |
20120245217 | RNAi-MEDIATED INHIBITION OF HIF1A FOR TREATMENT OF OCULAR ANGIOGENESIS - RNA interference is provided for inhibition of HIF1A mRNA expression for treating patients with ocular angiogenesis, particularly for treating retinal edema, diabetic retinopathy, sequela associated with retinal ischemia, posterior segment neovascularization (PSNV), and neovascular glaucoma, and for treating patients at risk of developing such conditions. | 09-27-2012 |
20120252867 | METHOD OF THERAPY AND DIAGNOSIS OF ATHEROSCLEROSIS - There is provided a method of therapy of atherosclerosis, by providing microRNA let-7g, an analogue thereof or modified let-7g to organisms to inhibit the expression of lectin-like oxidized low density lipoprotein receptor-1 (LOX-1), and the binding of LOX-1 and oxidized low-density lipoprotein (oxLDL), so as to block the pathogenesis of atherosclerosis. Also, a method of diagnosis of atherosclerosis comprises determining the levels of microRNA let-7g in serum or plasma samples of organisms, in which the levels of microRNA let-7g is estimated in individuals with atherosclerosis as compared to individuals without atherosclerosis. | 10-04-2012 |
20120252868 | NOVEL MEANS AND METHODS FOR THE TREATMENT OF HEARING LOSS AND PHANTOM HEARING - This invention relates to modulators of NADPH oxidase as a medicament for the treatment and/or prevention of hearing loss and/or phantom hearing. Such modulators preferably act by inhibiting NADPH oxidase activity, wherein the NADPH oxidase comprises or consists of the amino acid sequence of any one of SEQ ID NO: 1, 3 or 5, or (ii) is encoded by a nucleic acid comprising or consisting of the sequence of any one of SEQ ID NO: 2, 4, 6, 23 or 24, or (iii) is a fragment of the protein according to (i) or (ii) and exhibits NADPH oxidase activity, or (iv) has a sequence at least 75% identical with the protein according to (i) or (ii) or with the fragment according to (iii) and exhibits NADPH oxidase activity. Also provided are pharmaceutical compositions, medical uses and diagnostic uses of compounds of the invention. | 10-04-2012 |
20120252869 | TREATMENT OF SIRTUIN (SIRT) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO A SIRTUIN (SIRT) - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of a Sirtuin (SIRT), in particular, by targeting natural antisense polynucleotides of a Sirtuin (SIRT). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of Sirtuins (SIRT)s. | 10-04-2012 |
20120252870 | Indian Hedgehog (Ihh) as a Marker to Predict Osteoarthritis (OA) and Methods for the Prevention and Treatment of OA - Methods of diagnosing osteoarthritis are carried out by measuring levels of Ihh, and methods of treating osteoarthritis comprise inhibiting Ihh to reduce or prevent cartilage degradation. | 10-04-2012 |
20120252871 | DIAGNOSIS AND TREATMENT OF CHRONIC LYMPHOCYTIC LEUKEMIA (CLL) - New markers in the form of miRNA levels in plasma are provided for indicating the presence of CLL in a subject as well as suggesting routes of therapeutic treatment. | 10-04-2012 |
20120252872 | RNAi Modulation of APOB and Uses Thereof - The invention relates to compositions and methods for modulating the expression of apolipoprotein B, and more particularly to the downregulation of apolipoprotein B by chemically modified oligonucleotides. | 10-04-2012 |
20120252873 | siRNA Targeting Interleukin-1 Receptor-associated Kinase 4 (IRAK4) - Efficient sequence specific gene silencing is possible through the use of siRNA technology. By selecting particular siRNAs by rational design, one can maximize the generation of an effective gene silencing reagent, as well as methods for silencing genes. Methods, compositions, and kits generated through rational design of siRNAs are disclosed including those directed to nucleotide sequences for IRAK4. | 10-04-2012 |
20120252874 | METHODS FOR DELIVERY OF SIRNA TO THE SPINAL CORD AND THERAPIES ARISING THEREFROM - The present application relates at least in part to methods for the administration of small interfering RNAs (siRNAs) to the spinal cord of a human or animal patient and also to a method of treatment for spinal cord injury and other diseases and disorders of the CNS. In particular, the application discloses methods to deliver an siRNA compound locally, directly and without the need for transduction vehicles and formulations in effective doses to the injured spinal cord to promote recovery of CNS function and or attenuation of allodynia. | 10-04-2012 |
20120252875 | METHODS AND COMPOSITIONS FOR TREATING DISEASES, DISORDERS OR INJURY OF THE CNS - The present invention relates to non-invasive methods for treating diseases, disorders and injury to the central nervous system (CNS), and in particular to otic compositions and to methods of use thereof. | 10-04-2012 |
20120258998 | Fusion genes in gastrointestinal cancer - A method of treating or preventing a gastrointestinal cancer by inhibiting expression of a CD44-SLC1A2 fusion gene or a functional variant thereof, or by inhibiting the activity of a fusion protein expressed by the CD44-SLC1A2 fusion gene or the functional variant thereof. | 10-11-2012 |
20120258999 | Reagents, Methods and Systems to Suppress Pro-Inflammatory Cytokines - The present invention relates to reagents, methods and systems to treat inflammation and pain in a subject using small interfering RNA (siRNA) molecules targeted to either TNFα, IL1 IL6 and other pro-inflammatory cytokines. | 10-11-2012 |
20120259000 | EPIDERMAL DIFFERENTIATION MICRORNA SIGNATURE AND USES THEREOF - The present invention concerns a method for determining the state of epidermal differentiation of a human keratinocyte in a sample of human epithelium, comprising determining the level of expression of at least one miRNA selected from hsa-miR-455-3p, hsa-miR-141, hsa-miR-148a, hsa-miR-182, hsa-miR-224, hsa-miR-26a, hsa-miR-26b, hsa-miR-361-5p, hsa-miR-425, hsa-miR-92b, hsa-let-7i, hsa-miR-22, hsa-miR-221, hsa-miR-222, hsa-miR-29a, hsa-miR-29b, hsa-miR-663, hsa-miR-30a and hsa-miR-30c within said keratinocyte and comparing the level of expression of the selected miRNA or miRNAs with the mean level of expression of the selected miRNA or miRNAs in non-differentiated keratinocytes, or in differentiated epidermal keratinocytes, preferably originating from the same strain or from the same population. The present invention also concerns various uses of the method for determining the state of epidermal differentiation as well as pharmaceutical or cosmetic compositions. | 10-11-2012 |
20120259001 | Duplex Oligonucleotides with Enhanced Functionality in Gene Regulation - Disclosed are methods of enhancing functionality of duplex oligonucleotides and compositions made by the methods. The duplex oligonucleotides include siRNAs, miRNA mimics, and piRNA mimics which contain modified nucleotides and mismatches between the two strands of the molecule at specific nucleotide positions. | 10-11-2012 |
20120259002 | MOLECULE FOR TREATING AN INFLAMMATORY DISORDER - The invention provides two types of oligonucleotides for treating an inflammatory disorder: an oligonucleotide which is able of altering the splicing of a pre-mRNA encoding a C5 in order to decrease the amount of a C5a and an oligonucleotide which is able of altering the splicing of a pre-mRNA encoding a IL-1RAcP in order to increase the amount of a soluble IL-1RAcP. The invention further provides the use of said oligonucleotides for preventing or treating an inflammatory disorder. | 10-11-2012 |
20120264805 | MEDICAMENT FOR THE TREATMENT AND PREVENTION OF LIVER FAILURE - Small inhibitory RNA (siRNA) molecules, which e.g. are purified and/or isolated, as an active in a medicament, which siRNA molecules are inhibitory RNA molecules that through RNA interference (RNAi) reduce or prevent expression of the p53 upregulated modulator of apoptosis (PUMA). The siRNA molecules can be administered as a medicament to a patient suffering from an impaired liver function or from liver damage for the treatment of a functionally impaired liver, for delaying a deterioration of liver function and/or for prevention of liver failure, especially in patients who suffer from a critical impairment of damage to the liver, e.g. for delaying the complete failure of liver function. | 10-18-2012 |
20120264806 | OLIGOMERIC COMPOUNDS AND EXCIPIENTS - The present invention provides method of optimizing the efficacy and potency of antisense compounds. In certain embodiments, the invention provides assays useful for determining favorable oligonucleotide characteristics and excipients for improved cellular uptake. | 10-18-2012 |
20120264807 | METHOD FOR INTRODUCING SIRNA INTO CELLS BY PHOTOCHEMICAL INTERNALISATION - The present invention relates to a method for introducing an siRNA molecule into the cytosol of a cell, said method comprising i) contacting said cell with an siRNA molecule, a carrier and a photosensitising agent, and ii) irradiating the cell with light of a wavelength effective to activate the photosensitising agent, wherein said carrier comprises a cationic polyamine such as a lipopolyamine in a non-liposomal formulation, polyethyleneimine (PEI), a betacyclodextrin amine polymer, an amine group containing dendrimer, and a cationic peptide. Cells or a population of cells obtainable by the method, a composition containing an siRNA molecule and the carrier molecule, kits and therapeutic uses of the above are also provided. | 10-18-2012 |
20120264808 | METHODS AND COMPOSITIONS FOR MODULATING CALCIUM CHANNELS - The present invention relates to methods and compositions for modulating calcium channels. In particular, the present invention provides methods and compositions for modulating (e.g., disrupting) Cav1.3a calcium channels for research and therapeutic methods (e.g., treating dopaminergic diseases and conditions). | 10-18-2012 |
20120264809 | RNAi-Mediated Inhibition of Histamine Receptor H1-Related Conditions - RNA interference is provided for inhibition of histamine receptor H1 mRNA expression, in particular, for treating patients having an HRH1-related condition or at risk of developing an HRH1-related condition such as allergic conjunctivitis, ocular inflammation, dermatitis, rhinitis, asthma, or allergy. | 10-18-2012 |
20120264810 | COMPOSITIONS AND METHODS FOR ENHANCING CELLULAR UPTAKE AND INTRACELLULAR DELIVERY OF LIPID PARTICLES - Compositions, methods and compounds useful for enhancing the uptake of a lipid particle b\ a cell are described In particular embodiments, the methods of the invention include contacting a cell with a lipid particle and a compound that binds a Na+/K+ ATPase to enhance uptake of the lipid particle b\ the cell Related compositions useful in practicing methods include lipid particles comprising a conjugated compound that enhances uptake of the lipid particles b\ the cell The methods and compositions are useful in delivering a therapeutic agent to a cell, e g for the treatment of a disease or disorder in a subject | 10-18-2012 |
20120264811 | Elongator Proteins and Use Thereof as DNA Demethylases - The invention provides DNA demethylases comprising Elp1, Elp2, Elp3, Elp4, Elp5 and/or Elp6. The invention also provides methods of modulating gene expression, for example, for the treatment of cancer or to modify the cellular transcription program (e.g., for regenerative medicine). Also provided are methods of identifying compounds that modulate the DNA demethylase activity of the DNA demethylases of the invention. | 10-18-2012 |
20120264812 | TREATMENT OF NUCLEAR RESPIRATORY FACTOR 1 (NRF1) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO NRF1 - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Nuclear Respiratory Factor 1 (NRF1), in particular, by targeting natural antisense polynucleotides of Nuclear Respiratory Factor 1 (NRF1). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of NRF1. | 10-18-2012 |
20120264813 | siRNA Targeting Cyclin-dependent Kinase Inhibitor 1B (p27, Kip1) (CDKN1B) - Efficient sequence specific gene silencing is possible through the use of siRNA technology. By selecting particular siRNAs by rational design, one can maximize the generation of an effective gene silencing reagent, as well as methods for silencing genes. Methods, compositions, and kits generated through rational design of siRNAs are disclosed including those directed to nucleotide sequences for CDKN1B. | 10-18-2012 |
20120270920 | COMPOSITIONS AND METHODS FOR TREATMENT OF POUCHITIS - The present invention relates methods of treating pouchitis by administering a pharmaceutical formulation suitable for rectal use, such as an enema or suppository, comprising an antisense oligonucleotide targeted to ICAM-1 to an individual | 10-25-2012 |
20120270921 | Lipid Formulated Compositions and Methods for Inhibiting Expression of a Gene from the Ebola Virus - The invention relates to lipid formulated double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a gene from the Ebola virus. | 10-25-2012 |
20120270922 | Antiangiogenic Agent and Method for Inhibition of Angiogenesis - This invention provides an antiangiogenic agent having a higher treatment effect than those of conventional antiangiogenic agents, and a method for inhibiting angiogenesis using the same. An antiangiogenic agent comprising at least one miRNA type selected from the group consisting of miRNAs, pre-miRNAs, and pri-miRNAs, each having a miRNA activity on VE-cadherin. | 10-25-2012 |
20120270923 | NATRIURETIC PEPTIDE RECEPTOR AS A BIOMARKER FOR DIAGNOSIS AND PROGNOSIS OF CANCER - The invention pertains to biomarkers for clinical detection of malignancies, especially for early detection of cancers. More specifically, this invention pertains to the role of Natriuretic Peptide Receptor A (NPRA) in cancer (e.g., tumor) progression. Thus, the invention includes materials and methods for the detection and prognosis of malignancies. The invention also pertains to methods for treating malignancies. | 10-25-2012 |
20120270924 | Oligomeric Compounds For The Modultion of HIF-1A Expression - Oligonucleotides directed against the hypoxia-inducible factor-1α (HIF-1α) gene are provided for modulating the expression of HIF-1α. The compositions comprise oligonucleotides, particularly antisense oligonucleotides, targeted to nucleic acids encoding the HIF-1α. Methods of using these compounds for modulation of HIF-1α expression and for the treatment of diseases associated with the hypoxia-inducible factor-1α are provided. Examples of diseases are cancer and pre-eclampsia. The oligonucleotides may be composed of deoxyribonucleosides, a nucleic acid analogue, or Locked Nucleic Acid (LNA) or a combination thereof. | 10-25-2012 |
20120270925 | ANTISENSE MOLECULES AND METHODS FOR TREATING PATHOLOGIES - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 59. | 10-25-2012 |
20120270926 | siRNA Targeting Apoliprotein (APOB) - Efficient sequence specific gene silencing is possible through the use of siRNA technology. By selecting particular siRNAs by rational design, one can maximize the generation of an effective gene silencing reagent, as well as methods for silencing genes. Methods, compositions, and kits generated through rational design of siRNAs are disclosed including those directed to nucleotide sequences for APOB. | 10-25-2012 |
20120270927 | Polyamides For Nucleic Acid Delivery - A new class of non-viral transduction vectors that can be used for both in vivo and in vitro applications, including, a gene transfer vector that has comparable efficiency to a viral vector without the potential for a life-threatening immune response is provided. Complexes including a cellular delivery molecule or agent that can facilitate the translocation of the complex or portion thereof into cells is also provided. The cellular delivery molecules may include one or more polymers, e.g., polyamides, dendritic macromolecules and carbohydrate-containing degradable polyesters. | 10-25-2012 |
20120277281 | POLYNUCLEOTIDES FOR MEDICAL USE - The invention pertains to a RNA molecule transcribed form a long terminal repeat (LTR) sequence, comprising
| 11-01-2012 |
20120277282 | POLYNUCLEOTIDES FOR USE IN MEDICINE - The invention refers to polynucleotides selected from the group consisting of a) polynucleotides encoding for the polypeptide RBM20 comprising a P638L mutation for a human polypeptide RBM20, or a P641L mutation for a rat polypeptide RBM20, b) polynucleotides with a reverse complementary sequence of the polynucleotide of a) above, and c) polynucleotides with an identity at least 50% to a polynucleotide of a) or b) above | 11-01-2012 |
20120277283 | Localized Delivery of Gold Nanoparticles for Therapeutic and Diagnostic Applications - The present invention is directed to compositions and methods of localized delivery of a functionalized nanoparticle. | 11-01-2012 |
20120277284 | MODULATION OF SIGNAL TRANSDUCER AND ACTIVATOR OF TRANSCRIPTION 3 (STAT3)EXPRESSION - Disclosed herein are antisense compounds and methods for decreasing STAT3 mRNA and protein expression. Such methods, compounds, and compositions are useful to treat, prevent, or ameliorate hyperproliferative diseases. | 11-01-2012 |
20120277285 | CONTROL OF GENE EXPRESSION - The present invention relates generally to a method of modifying gene expression and to synthetic genes for modifying endogenous gene expression in a cell, tissue or organ of a transgenic organism, in particular a transgenic animal or plant. More particularly, the present invention utilizes recombinant DNA technology to post-transcriptionally modify or modulate the expression of a target gene in a cell, tissue organ or whole organism, thereby producing novel phenotypes. Novel synthetic genes and genetic constructs which are capable of repressing delaying or otherwise reducing the expression of an endogenous gene or target gene in an organism when introduced thereto are also provided. | 11-01-2012 |
20120277286 | COMPOSITIONS AND METHODS FOR THE TREATMENT OR PREVENTION OF MITOCHONDRIAL DISEASES - The present invention features compositions and methods for the treatment or prevention of diseases associated with a mitochondrial defect. | 11-01-2012 |
20120277287 | Modulating the CDC14B-CDH1-PLK1 Axis and Methods for Sensitizing Target Cells to Apoptosis - The invention relates to modulating Cdc14B levels (cell division cycle 14 homolog B) and/or Cdh1 (Fzr1 protein, CDC20-like 1b, or fizzy-related protein) levels to sensitize cells to DNA damage by increasing the abundance of Plk1 (polo-like kinase 1) in a target cell. In certain embodiments, the invention relates to modulating Plk1 levels, and in particular to increasing Plk1 levels, to sensitize target cells such as cancer cells to cell death or apoptosis. In certain embodiments, the invention relates to inhibitors of Cdc14B and Cdh1 that sensitize tumor cells to chemotherapy or radiation induced cell death or apoptosis. In addition to applications relating to cancer therapies and diagnostics, the Plk1 modulators and assays will be employed for identifying novel drugs or drug candidates useful for various proliferative and/or differentiative disorders such as major opportunistic infections, immune disorders, cardiovascular diseases and inflammatory disorders. | 11-01-2012 |
20120277288 | Means and Methods for the Specific Modulation of Target Genes in the CNS and the Eye and Methods for Their Identification - Provided are methods for the treatment of disorders of the central nervous system (CNS) and the eye. In particular, use of compositions comprising a compound capable of modulating a target gene or gene product is described for the preparation of a pharmaceutical composition for the treatment of disorders of the CNS and/or the eye, wherein the composition is designed to be administered outside the blood-CNS and the blood-retina barriers. Furthermore, methods are provided for identifying and obtaining nucleic acid molecules encoding polypeptides involved in CNS disorders or of the eye, methods for diagnosing said disorders as well as transgenic animal deficient in the expression of target genes identified in accordance with the described method. In addition, methods of identifying and isolating drugs that are particularly useful for the treatment of disorders related to the CNS and/or the eye are disclosed. | 11-01-2012 |
20120277289 | ACTIVITY GENERATING DELIVERY MOLECULES - Activity-generating delivery molecules comprising the structure R | 11-01-2012 |
20120277291 | PREVENTIVE FOR ADHESION FOLLOWING ABDOMINAL SURGERY - The present inventors discovered that oligonucleotides which suppress midkine expression and antibodies which suppress midkine activity can be used to prevent post-surgical intraperitoneal adhesions. | 11-01-2012 |
20120277292 | ANTISENSE OLIGONUCLEOTIDES AGAINST cPLA2, COMPOSITIONS AND USES THEREOF - Antisense oligonucleotides against cPLA | 11-01-2012 |
20120283309 | SIRNA COMPOUNDS COMPRISING TERMINAL SUBSTITUTIONS - The invention relates to modified siRNA compounds which down-regulate target gene expression, to pharmaceutical compositions comprising such compounds and to methods of treating and/or preventing the incidence or severity of various diseases or conditions associated with the genes and/or symptoms associated with such diseases or conditions. | 11-08-2012 |
20120283310 | MicroRNA Signatures Associated with Human Chronic Lymphocytic Leukemia (CLL) and Uses Thereof - Methods and compositions for the diagnosis, prognosis and/or treatment of leukemia associated diseases are disclosed. | 11-08-2012 |
20120283311 | siRNA Targeting Glucagon Receptor (GCCR) - Efficient sequence specific gene silencing is possible through the use of siRNA technology. By selecting particular siRNAs by rational design, one can maximize the generation of an effective gene silencing reagent, as well as methods for silencing genes. Methods, compositions, and kits generated through rational design of siRNAs are disclosed including those directed to nucleotide sequences for GCGR. | 11-08-2012 |
20120283312 | MODULATION OF EIF4E EXPRESSION - Oligomeric compounds, compositions and methods are provided for modulating the expression of eIF4E. The antisense compounds may be single- or double-stranded and are targeted to nucleic acid encoding eIF4E. Methods of using these compounds for modulation of eIF4E expression and for diagnosis and treatment of diseases and conditions associated with expression of eIF4E are provided. | 11-08-2012 |
20120283313 | INHIBITION AND TREATMENT OF PROSTATE CANCER METASTASIS - The present invention provides compounds and methods of inhibiting and treating metastatic prostate cancer. The compounds include MEK4 inhibitors. In another aspect the invention provides methods of identifying inhibitors of metastatic prostate cancer by screening for inhibitors of MEK4. | 11-08-2012 |
20120283314 | SODIUM CHANNEL PROTEIN TYPE III ALPHA-SUBUNIT SPLICE VARIANT - The present invention is directed to a splice variant of a human sodium channel alpha subunit and methods and compositions for making and using the same. | 11-08-2012 |
20120289578 | USE OF RNA INTERFERENCE FOR TREATING OR REDUCING PAIN - A use of a nucleic acid molecule mediating RNA interference for treating or reducing pain is disclosed. The nucleic acid molecule has a sequence selected from the group consisting of SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3 and SEQ ID NO:4, and is used for effectively inhibiting expression of bradykinin B2 receptor, treating or reducing pain and preparing a pharmaceutical composition for reducing neuropathic pain. | 11-15-2012 |
20120289579 | IMPAIRED WOUND HEALING COMPOSITIONS AND TREATMENTS - Connexin modulation for the treatment of wounds that do not heal at expected rates, including delayed healing wounds, incompletely healing wounds, and chronic wounds, and associated methods, compositions and articles. | 11-15-2012 |
20120289580 | ANTISENSE MODULATION OF PTP1B EXPRESSION - Provided herein are methods, compounds, and compositions for reducing expression of PTP1B mRNA and protein in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate metabolic disease, for example, diabetes, or a symptom thereof. | 11-15-2012 |
20120289581 | DIAGNOSTIC, PROGNOSTIC AND THERAPEUTIC USES OF LONG NON-CODING RNAS FOR CANCER AND REGENERATIVE MEDICINE - Long non-coding RNAs (lncRNAs) and methods of using them diagnostically and therapeutically for treatment of cancer, stem cell therapy, or regenerative medicine are disclosed. In particular, the invention relates to lncRNAs that that play roles in regulation of genes involved in cell proliferation, differentiation, and apoptosis. Such lncRNAs can be used as biomarkers to monitor cell proliferation and differentiation during cancer progression or tissue regeneration. One of the identified lncRNAs, referred to as PANDA (a P | 11-15-2012 |
20120289582 | METHODS FOR DIAGNOSING AND TREATING A PATHOLOGY ASSOCIATED WITH A SYNONYMOUS MUTATION OCCURING WITHIN A GENE OF INTEREST - The present invention relates to a method for diagnosing and/or prognosing a pathology (such as inflammatory dis-ease, especially Crohn disease) associated with a synonymous mutation occurring within a gene of interest (such as IRGM, NOD2 or BSN) in a subject and to a method for treating such pathology in a subject. | 11-15-2012 |
20120289583 | TREATMENT OF INSULIN RECEPTOR SUBSTRATE 2 (IRS2) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO IRS2 AND TRANSCRIPTION FACTOR E3 (TFE3) - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Insulin Receptor Substrate 2 (IRS2) polynucleotides, in particular, by targeting natural antisense polynucleotides of Insulin Receptor Substrate 2 (IRS2) polynucleotides and Transcription factor E3 (TFE3). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of IRS2. | 11-15-2012 |
20120295949 | MICRORNA-BASED METHODS AND COMPOSITIONS FOR THE DIAGNOSIS, PROGNOSIS AND TREATMENT OF TUMOR INVOLVING CHROMOSOMAL REARRANGEMENTS - Provided are novel methods and compositions for the diagnosis, prognosis and treatment of tumor involving a chromosomal rearrangement, in particular a tumor or neoplasia of the thyroid gland. In addition, methods of identifying anti-tumor agents are described. | 11-22-2012 |
20120295950 | RBP4 IN INSULIN SENSITIVITY/RESISTANCE, DIABETES, AND OBESITY - Methods for screening molecules that modulate the activity of Retinol Binding Protein 4 (RBP4) and their use in treatment of insulin resistance are described. Also described are methods of diagnosing insulin resistance and related conditions by detecting modulation of RBP4 activity. | 11-22-2012 |
20120295951 | GENETIC CHANGES IN ATM AND ATR/CHEK1 AS PROGNOSTIC INDICATORS IN CANCER - The present invention relates to the discovery that, in human cancer, an 11q deletion of ATM together with an increase in ATR and CHEK1 expression correlates with resistance to ionizing radiation which could be overcome by inhibition of the ATR/CHEK1 pathway. It provides for methods of identifying patients unlikely to exhibit an adequate response to radiation therapy and/or chemotherapy who may benefit from ATR/CHEK1 pathway inhibition, as well as methods of treating said patients. | 11-22-2012 |
20120295952 | TREATMENT OF FILAGGRIN (FLG) RELATED DISEASES BY MODULATION OF FLG EXPRESSION AND ACTIVITY - The present invention relates to antisense oligonucleotides and/or compounds that modulate the expression of and/or function of Filaggrin (FLG), in particular, by targeting natural antisense polynucleotides of Filaggrin (FLG). The invention also relates to the identification of these antisense oligonucleotides and/or compounds and their use in treating diseases and disorders associated with the expression of FLG. | 11-22-2012 |
20120295953 | TREATMENT OF TUMOR PROTEIN 63 (P63) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO P63 - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Tumor Protein 63 (p63), in particular, by targeting natural antisense polynucleotides of Tumor Protein 63 (p63). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of p63. | 11-22-2012 |
20120295954 | TREATMENT OF INTERFERON REGULATORY FACTOR 8 (IRF8) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO IRF8 - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Interferon Regulatory Factor 8 (IRF8), in particular, by targeting natural antisense polynucleotides of Interferon Regulatory Factor 8 (IRF8). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with The expression of IRF8. | 11-22-2012 |
20120295955 | RNA ANTAGONIST COMPOUNDS FOR THE MODULATION OF HER3 - The invention relates to oligomer compounds (oligomers), which target HER3 mRNA in a cell, leading to reduced expression of HER3 and/or HER2 and/or EGFR. Reduction of HER3 and/or HER2 and/or EGFR expression is beneficial for a range of medical disorders, such hyperproliferative disorders (e.g., cancer). The invention provides therapeutic compositions comprising oligomers and methods for modulating the expression of HER3 and/or HER2 and/or EGFR using said oligomers, including methods of treatment. | 11-22-2012 |
20120295956 | PREVENTION OF TISSUE ISCHEMIA AND RELATED METHODS - Provided herein are methods for preventing, ameliorating, and/or reducing tissue ischemia and/or tissue damage due to ischemia, increasing blood vessel diameter, blood flow and tissue perfusion in the presence of vascular disease including peripheral vascular disease, atherosclerotic vascular disease, coronary artery disease, stroke and influencing other conditions, by suppressing CD47 and/or blocking TSP1 and/or CD47 activity or interaction. Influencing the interaction of CD47-TSP1 in blood vessels allows for control of blood vessel diameter and blood flow, and permits modification of blood pressure and cardiac function. Under conditions of decreased blood flow, for instance through injury or atherosclerosis, blocking TSP1-CD47 interaction allows blood vessels to dilate and increases blood flow, tissue perfusion and tissue survival. | 11-22-2012 |
20120295957 | PREVENTION OF TISSUE ISCHEMIA AND RELATED COMPOSITIONS - Provided herein are compositions for preventing, ameliorating, and/or reducing tissue ischemia and/or tissue damage due to ischemia, increasing blood vessel diameter, blood flow and tissue perfusion in the presence of vascular disease including peripheral vascular disease, atherosclerotic vascular disease, coronary artery disease, stroke and influencing other conditions, by suppressing CD47 and/or blocking TSP1 and/or CD47 activity or interaction. Influencing the interaction of CD47-TSP1 in blood vessels allows for control of blood vessel diameter and blood flow, and permits modification of blood pressure and cardiac function. Under conditions of decreased blood flow, for instance through injury or atherosclerosis, blocking TSP1-CD47 interaction allows blood vessels to dilate and increases blood flow, tissue perfusion and tissue survival. | 11-22-2012 |
20120295958 | MODULATION OF GLUCAGON RECEPTOR EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of glucagon receptor. The compositions comprise oligonucleotides, targeted to nucleic acid encoding glucagon receptor. Methods of using these compounds for modulation of glucagon receptor expression and for diagnosis and treatment of disease associated with expression of glucagon receptor are provided. | 11-22-2012 |
20120295959 | TREATMENT OF RNASE H1 RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO RNASE H1 - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of RNAse H1, in particular, by targeting natural antisense polynucleotides of RNAse H1. The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of RNase H1. | 11-22-2012 |
20120302622 | CONJUGATES, PARTICLES, COMPOSITIONS, AND RELATED METHODS - Particles and conjugates for delivering nucleic acid agents. Compositions containing the particles, the conjugates, or both. Methods of using the particles, the conjugates, and the compositions. | 11-29-2012 |
20120302623 | Novel Activation and Transfer Cascade for Ubiquitin - A novel activating enzyme for ubiquitin, Uba6, is provided. Compositions and methods for inhibiting ubiquitin via the Uba6 pathway are provided. Methods of identifying novel inhibitors of ubiquitination are also provided. Novel RNAi molecules are also provided. | 11-29-2012 |
20120302624 | BIOMARKER FOR IDENTIFYING SUBGROUP OF EARLY-STAGE LUNG ADENOCARCINOMA PATIENTS - The preset invention relates to a biomarker for identifying the subgroup of early-stage lung adenocarcinoma patients in early-stage non-small cell lung cancer (NSCLC), which is T-lymphokine-activated killer cell-originated protein kinase (TOPK), and a therapeutic target for lung cancer. | 11-29-2012 |
20120302625 | SUPERCOILED MINICIRCLE DNA FOR GENE THERAPY APPLICATIONS - The present invention relates to nucleic acid molecule compositions comprising minivectors encoding a nucleic acid sequence and methods of gene therapy using minivectors encoding a nucleic acid sequence. | 11-29-2012 |
20120302626 | MICRORNA AND USE THEREOF IN IDENTIFICATION OF B CELL MALIGNANCIES - Disclosed are nucleic acid sequences, including microRNA sequences and cDNA sequences, as well as vectors, DNA libraries, microarrays, and recombinant cells comprising the nucleic acid sequences described herein. Methods of determining the B cell stage from which a B cell malignancy is derived. Methods of identifying B cell malignancies are also provided. Methods of diagnosing B cell malignancies are provided. Such methods comprise, in certain embodiments, detecting one or more microRNAs or cDNAs as disclosed herein. | 11-29-2012 |
20120309813 | DELIVERY OF dsRNA TO ARTHROPODS - The invention is to methods of gene silencing in arthropods using dsRNA. The method is include contacting the arthropod with, and/or directly feeding the arthropod, the dsRNA to the arthropods to deliver the dsRNA to arthropod tissues. It is envisaged that the methods of the invention will have use in determining the biological function of genes in arthropods. Methods of pest control of arthropods, and of protecting arthropods against parasites and predators are provided. Transgenic arthropods expressing dsRNA molecules are also provided by the present invention. | 12-06-2012 |
20120309814 | TREATMENT OF PYRROLINE-5-CARBOXYLATE REDUCTASE 1 (PYCR1) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO PYCR1 - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Pyrroline- | 12-06-2012 |
20120316218 | SMALL NON-CODING REGULARTORY RNA's and METHODS FOR THEIR USE - Disclosed are methods and compositions related to small, non-coding RNA molecules having gene regulatory activity, compositions comprising same, and methods for their use. Provided are isolated small non-coding RNA molecules transcribed from an intergenic region of the human genome, wherein the intergenic region contains at least one small nucleotide polymorphism (SNP) associated with one or more human diseases or disorders. Also disclosed are methods for the detection of these small non-coding RNA molecules in a biological sample and related therapeutic, diagnostic, and prognostic methods. | 12-13-2012 |
20120316219 | MODULATION OF APOLIPOPROTEIN(A) EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of apolipoprotein(a). The compositions comprise oligonucleotides, targeted to nucleic acid encoding apolipoprotein(a). Methods of using these compounds for modulation of apolipoprotein(a) expression and for diagnosis and treatment of disease associated with expression of apolipoprotein(a) are provided. | 12-13-2012 |
20120316220 | METHODS AND COMPOSITIONS FOR TREATING INSECTS - Provided herein are methods and compositions for modulating gene expression in insects by administering a composition comprising an RNA effector molecule and a delivery agent. Methods are provided for controlling pest populations by inhibiting insect growth, development, survival, reproduction and/or viability. Also provided herein are methods for treating or preventing disease in an insect caused by a pathogen or by external factors (e.g., pollution, environment, stress, weather, etc.). | 12-13-2012 |
20120316221 | COMPOSITIONS AND THEIR USES DIRECTED TO IL-4R ALPHA - Disclosed herein are compounds, compositions and methods for modulating the expression of IL-4R alpha in a cell, tissue or animal. Also provided are methods of target validation. Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and disorders related to expression of IL 4R-α, airway hyperresponsiveness, and/or pulmonary inflammation. | 12-13-2012 |
20120316222 | NOVEL RNAi THERAPEUTIC FOR TREATMENT OF HEPATITIS C INFECTION - Small interfering RNAs (siRNAs) or small hairpin RNA (shRNAs) and compositions comprising same are provided that target human cyclophilin A (CyPA) to inhibit Hepatitis C (HCV) infection. Such siRNA and shRNAs may have a length of from about 19 to about 29 contiguous nucleotides corresponding to a specific region of human cyclophilin A (CyPA) cDNA of from about nucleotide 155 to about nucleotide 183 having particular potency against CyPA and HCV. Such siRNA and shRNAs may be formulated as naked compositions or pharmaceutical compositions. DNA polynucleotides, plasmids, and viral or non-viral vectors are provided that encode siRNA or shRNA molecules, which may be delivered directly to cells or in combination with delivery agents, such as lipids, polymers, encapsulated lipid particles, such as liposomes. Methods for treating, managing inhibiting, preventing, etc., HCV infection using such siRNA and shRNAs and compositions comprising same are also provided. | 12-13-2012 |
20120322846 | METHODS AND COMPOSITIONS FOR ENHANCING THE EFFICACY AND SPECIFICITY OF SINGLE AND DOUBLE BLUNT-ENDED siRNA - The present invention provides methods of enhancing the efficacy and specificity of RNAi using single or double blunt-ended siRNA. The invention also provides single and double-blunt ended siRNA compositions, vectors, and transgenes containing the same for mediating silencing of a target gene. Therapeutic methods are also featured. | 12-20-2012 |
20120322847 | ANTISENSE ANTIVIRAL COMPOUND AND METHOD FOR TREATING ssRNA VIRAL INFECTION - The invention provides antisense antiviral compounds and methods of their use and production in inhibition of growth of viruses of the Flaviviridae, Picornoviridae, Caliciviridae, Togaviridae, Arteriviridae, Coronaviridae, Astroviridae and Hepeviridae families in the treatment of a viral infection. The antisense antiviral compounds are substantially uncharged morpholino oligonucleotides having a sequence of 12-40 subunits, including at least 12 subunits having a targeting sequence that is complementary to a region associated with stem-loop secondary structure within the 5′-terminal end 40 bases of the positive-sense RNA strand of the virus. | 12-20-2012 |
20120322848 | LNA OLIGONUCLEOTIDES AND THE TREATMENT OF CANCER - The present disclosure concerns LNA oligonucleotides having a (sub)sequence of the general formula 5′-( | 12-20-2012 |
20120322849 | Methods of Inhibiting Staphylobactin-mediated Iron Uptake in S. aureus - Methods of inhibiting | 12-20-2012 |
20120322850 | TRPM-2 ANTISENSE THERAPY - It has now been determined that antisense therapy which reduces the expression of TRPM-2 provides therapeutic benefits in the treatment of cancer. Addition of antisense TRPM-2 ODN to prostatic tumor cells in vivo is effective for delaying the onset of androgen independence. Combined use of antisense TRPM-2 and taxanes synergistically enhances cytotoxic chemosensitivity of androgen-independent prostate cancer. In addition, it has also been found that antisense TRPM-2 has beneficial effect for other cancer types. Specifically, antisense TRPM-2 ODN enhances chemosensitivity in human Renal cell cancer, a normally chemoresistant disease with no active chemotherapeutic agent having an objective response rate higher than 10%. Radiation sensitivity is also enhanced when cells expressing TRPM-2 are treated with antisense TRPM-2 ODN. Thus, the antisense TRPM-2 ODNs can be used to enhance hormone sensitivity, chemosensitivity and radiation sensitivity of a variety of cancer types in which expression of TRPM-2 has been observed. | 12-20-2012 |
20120322851 | ORAL DELIVERY OF THERAPEUTICALLY EFFECTIVE LNA OLIGONUCLEOTIDES - The invention provides for LNA oligomers, for the treatment of a metabolic or liver disorder, wherein the LNA oligomer is administered orally in a unit dose of less than 50 mgs/kg, wherein the LNA oligomer is administered in the presence of a penetration (permeation) enhancer. | 12-20-2012 |
20120322852 | SMNdelta7 Degron: Novel Compositions and Methods of Use - The present invention includes an isolated nucleic acid comprising a nucleic acid sequence encoding a SMNΔ7 degron and the encoded polypeptide. The invention also includes inhibitors of SMNΔ7 degron. The invention also includes compositions and methods for mitigating SMN deficiency by targeting inhibition of factors that mediate SMNΔ7-degron dependent degradation of SMNΔ7. | 12-20-2012 |
20120322853 | TREATMENT OF PANCREATIC DEVELOPMENTAL GENE RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO A PANCREATIC DEVELOPMENTAL GENE - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of a Pancreatic Developmental gene, in particular, by targeting natural antisense polynucleotides of a Pancreatic Developmental gene. The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of Pancreatic Developmental genes. | 12-20-2012 |
20120322854 | REGULATION OF MACROPHAGE ACTIVATION USING MIR-125B - The present disclosure relates to regulation of macrophage activation by delivering of miRNAs, for example miR-125 | 12-20-2012 |
20120322855 | Duplex Oligonucleotide Complexes and Methods for Gene Silencing by RNA Interference - Provided herein are duplex oligonucleotide complexes which can be administered to a cell, tissue or organism to silence a target gene without the aid of a transfection reagent(s). The duplex oligonucleotide complexes of the disclosure include a conjugate moiety that facilitates delivery to a cell, tissue or organism. | 12-20-2012 |
20120322856 | Method for Promoting Angiogenesis, Vascularization, or Vessel Repair or for the Inhibiting Tumor Angiogenesis - The invention relates to a method for influencing the miR-92 expression in a cell, comprising the following steps: (a) providing a cell; and (b1) reducing the miR-92 expression in the cell in order to promote the vascularization or vessel repair by introducing an antisense molecule against miR-92 into the cell, or (b2) increasing the miR-92 expression in the cell for an inhibition of the tumor angiogenesis by introducing a construct into the cell, wherein said construct includes an expressible miR-92 sequence. Furthermore, the invention relates to a pharmaceutical composition, comprising an agent for reducing the miR-92 activity or expression in a cell in the form of an antisense molecule against miR-92, or an agent for increasing the miR-92 expression in a cell in the form of a construct for expressing miR-92. | 12-20-2012 |
20120322857 | METHODS OF INHIBITING TUMOR CELL AGGRESSIVENESS USING THE MICROENVIRONMENT OF HUMAN EMBRYONIC STEM CELLS - The invention provides compositions comprising one or more isolated factors from a microenvironment of human embryonic stem cells (hESCs), including, but not limited to, Lefty and inhibitors of Nodal. The invention also provides methods of utilizing factors derived from human embryonic stem cells (hESC) and their microenvironment to treat and prevent tumor formation and progression and to inhibit tumor cell aggressiveness. The invention further provides methods of inhibiting tumor cell growth and/or treating aggressive tumors in a mammal comprising administering to the mammal, having at least one tumor cell present in its body, an effective amount of an inhibitor of Nodal activity. | 12-20-2012 |
20120322858 | Compositions and Methods for Inhibiting Expression of a Mutant Gene - The present invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a mutant gene, comprising a first strand that has a complementary region that is complementary to at least a portion of an RNA transcript of at least part of the mutant target gene and a second strand of the dsRNA complementary or substantially complementary to the first strand. The invention further relates to a pharmaceutical composition comprising the dsRNA and a pharmaceutically acceptable carrier. The pharmaceutical compositions are useful for inhibiting the expression of a target mutant gene, as well as for treating diseases caused by expression of the target gene. The invention also relates to methods for inhibiting the expression of a target mutant gene, as well as methods for treating diseases caused by the expression of the target gene. | 12-20-2012 |
20120322859 | MicroRNA Fingerprints During Human Megakaryocytopoiesis - Described herein is a method of decreasing expression of HOXA1 in a subject having a cancer and/or myeloproliferative disorder associated with overexpression of a HOXA1 gene product where an effective amount of at least one miR-10a gene product or an isolated variant or biologically-active fragment thereof is administered to the subject sufficient to decrease expression of the HOXA1 gene product in the subject. | 12-20-2012 |
20120329853 | MICRORNA-BASED METHOD FOR ANTI-COLORECTAL CANCER EFFECTS AND PROGNOSIS OF COLORECTAL CANCER - The present invention discloses a method of providing anti-oncogenic effects in a subject suffered from colorectal cancer. The present invention also discloses a method for screening an anti-colorectal cancer agent. The present invention further discloses a method of determining the prognosis of a subject with colorectal cancer. | 12-27-2012 |
20120329854 | Methods and Compounds for the Diagnosis and Treatment for Cancer - The present invention provides in vitro methods for detecting, grading or prognosticating cancer, in particular prostate cancer. The invention further provides isolated polynucleotides suitable for reducing or inhibiting the expression of protein kinase C beta I and/or II and/or alpha (and consequently the levels of histone H3 phosphorylated at threonine 6, histone H3 monomethylated at lysine 4, histone H3 dimethylated at lysine 4, histone H3 trimethylated at lysine 4) and further relates to pharmaceutical compositions comprising said polynucleotides for the treatment or prevention of cancer, in particular prostate cancer. | 12-27-2012 |
20120329855 | TREATMENT OF HEPATOCYTE GROWTH FACTOR (HGF) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO HGF - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Hepatocyte Growth Factor (HGF), in particular, by targeting natural antisense polynucleotides of Hepatocyte Growth Factor (HGF). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of HGF. | 12-27-2012 |
20120329856 | Methods And Compositions For Reducing Viral Genome Amounts In A Target Cell - Methods and compositions for reducing viral genome amounts in a target cell are provided. In the subject methods, the activity of a miRNA is inhibited in a manner sufficient to reduce the amount of viral genome in the target cell, e.g., by introducing a miRNA inhibitory agent in the target cell. Also provided are pharmaceutical compositions, kits and systems for use in practicing the subject methods. The subject invention finds use in a variety of applications, including the treatment of subjects suffering from a viral mediated disease condition, e.g., an HCV mediated disease condition. | 12-27-2012 |
20120329857 | Short Hairpin RNAs for Inhibition of Gene Expression - Methods, compositions, and kits that include small hairpin RNA (shRNA) useful for inhibition of gene expression, such as viral-mediated gene expression, are described. | 12-27-2012 |
20130005791 | RNAi MODULATION OF RSV AND THERAPEUTIC USES THEREOF - The present invention is based on the in vivo demonstration that RSV can be inhibited through intranasal administration of iRNA agents as well as by parenteral administration of such agents. Further, it is shown that effective viral reduction can be achieved with more than one virus being treated concurrently. Based on these findings, the present invention provides general and specific compositions and methods that are useful in reducing RSV mRNA levels, RSV protein levels and viral titers in a subject, e.g., a mammal, such as a human. These findings can be applied to other respiratory viruses. | 01-03-2013 |
20130005792 | BIOMARKERS TO IDENTIFY HIV-SPECIFIC T-CELL SUBSETS - The invention relates to expression profiles of HIV-specific T-cells and their methods of use, including but not limited to treatment of HIV, increasing T-cell function and/or survival in HIV infected subjects, monitoring HIV disease progression and classifying HIV infected subjects as controllers or chronic progressors. | 01-03-2013 |
20130005793 | Compositions and Methods for Inhibiting Gene Expression of Hepatitis B Virus - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a Hepatitis B Virus gene. The invention also relates to a pharmaceutical composition comprising the dsRNA or nucleic acid molecules or vectors encoding the same together with a pharmaceutically acceptable carrier; methods for treating diseases caused by Hepatitis B Virus infection using said pharmaceutical composition; and methods for inhibiting the expression of a Hepatitis B Virus gene in a cell. | 01-03-2013 |
20130012566 | Virion Derived Protein Nanoparticles For Delivering Diagnostic Or Therapeutic Agents For The Treatment of Alopecia - This invention relates to a transdermal delivery system for treating skin related diseases employing papilloma-derived protein nanoparticles to deliver drugs to the keratinocytes and basal membrane cells for the treatment of alopecia. The current invention presents an effective method for delivering small molecule nucleic acids to the epidermal cells. | 01-10-2013 |
20130012567 | RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING CHEMICALLY MODIFIED SHORT INTERFERING NUCLEIC ACID (siNA) - The present invention concerns methods and reagents useful in modulating gene expression in a variety of applications, including use in therapeutic, diagnostic, target validation, and genomic discovery applications. Specifically, the invention relates to synthetic chemically modified small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against target nucleic acid sequences. The small nucleic acid molecules are useful in the treatment of any disease or condition that responds to modulation of gene expression or activity in a cell, tissue, or organism. | 01-10-2013 |
20130012568 | Kits for Detecting Direct Oxidation of Calcium/Calmodulin Dependent Protein Kinase II and Associated Diagnostic and Therapeutic Methods - Calcium/calmodulin dependent protein kinase II (CaMKII) has been found to be directly oxidized, and direct oxidation of CaMKII was observed to result in calcium independent activation of CaMKII. Antibodies that bind specifically to oxidized forms of CaMKII (oxCaMKII) were generated and were utilized to detect oxCaMKII in blood from: (1) mice with cancer; (2) mice with a knock out of the gene encoding methionine sulfoxide reductase; (3) mice injected with angiotensin II; (4) mice injected with bacterial endotoxin; (5) mice fed a pro-oxidant (ketogenic) diet; and (6) mice with cancer that had been treated with experimental therapy. | 01-10-2013 |
20130012569 | METHOD OF TREATMENTS RELATED TO THE FMR1 GENE - A method of treating a human to reduce the risk of malignancies or limit the spread of malignancies includes administering an FMR1 inhibitor to the human to block expression of an FMR1 gene. The FMR1 inhibitor blocks FMR1 genes in the human with at least one of two alleles with less than 26 triple CGG repeats. | 01-10-2013 |
20130012570 | GNAQ TARGETED dsRNA COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION - The invention relates to a double-stranded ribonucleic acid (dsRNA) targeting a G-alpha q subunit (GNAQ) of a heterotrimeric G gene, and methods of using the dsRNA to inhibit expression of GNAQ. | 01-10-2013 |
20130012571 | Organic Compositions to Treat Beta-ENaC-Related Diseases - The present disclosure relates to RNAi agents useful in methods of treating Beta-ENaC-related diseases such as cystic fibrosis, pseudohypoaldosteronism type 1 (PHA1), Liddle's syndrome, hypertension, alkalosis, hypokalemia, and obesity-associated hypertension, using a therapeutically effective amount of a RNAi agent to Beta-ENaC. | 01-10-2013 |
20130012572 | Compositions And Methods For Inhibiting Expression Of GSK-3 Genes - The invention relates to a double-stranded ribonucleic acid (dsRNA) targeting Glycogen Synthase Kinase-3 (GSK-3), and methods of using the dsRNA to inhibit expression of GSK-3. | 01-10-2013 |
20130018081 | AChE ANTISENSE OLIGONUCLEOTIDE AS AN ANTI-INFLAMMATORY AGENT - Disclosed is a novel use for AChE antisense oligonucleotides as anti-inflammatory agents, wherein said oligonucleotides are preferably as denoted by SEQ ID NO:1, SEQ ID NO:2 and SEQ ID NO:7. Methods of treatment of inflammatory conditions, as well as fever, and particularly inflammation-associated neuropathies such as Guillain-Barré Syndrome, are described. | 01-17-2013 |
20130018082 | RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING CHEMICALLY MODIFIED SHORT INTERFERING NUCLEIC ACID (siNA) - The present invention concerns methods and reagents useful in modulating gene expression in a variety of applications, including use in therapeutic, diagnostic, target validation, and genomic discovery applications. Specifically, the invention relates to synthetic chemically modified small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against target nucleic acid sequences. The small nucleic acid molecules are useful in the treatment of any disease or condition that responds to modulation of gene expression or activity in a cell, tissue, or organism. | 01-17-2013 |
20130018083 | USE OF SIRNA TARGETTING SIPA1L1 FOR THE REDUCTION OF ADIPOGENESISAANM Hall; DianaAACI LausanneAACO CHAAGP Hall; Diana Lausanne CHAANM Jimenez; MariaAACI Chavannes-pres-RenensAACO CHAAGP Jimenez; Maria Chavannes-pres-Renens CHAANM Poussin; CarineAACI Evian-les-BainsAACO FRAAGP Poussin; Carine Evian-les-Bains FRAANM Thorens; BernardAACI EpalingesAACO CHAAGP Thorens; Bernard Epalinges CH - The present invention concerns Sipa1l1, a new target involved in adipogenesis modulation. Using a siRNA approach, the inventors demonstrated that decrease in Sipa1l1 activity in preadipocytes and adipose tissue induces a decrease in adipogenesis. Thus, the present invention relates to modulators of Sipa1l1 activity as well as screening test for identification of modulators of the activity of this target, and their use, especially in pharmaceutical composition, to modulate adipogenesis and thus treat obesity and related disorders. | 01-17-2013 |
20130018084 | MICRORNA (miRNA) AND DOWNSTREAM TARGETS FOR DIAGNOSTIC AND THERAPEUTIC PURPOSES - In some embodiments, the present invention concerns antisense oligonucleotides against targets of miR-21. In some embodiments, the invention is directed to a method for diagnosing fibrosis and/or fibrosis related diseases and to a method for screening a pharmaceutically active compound for the treatment of fibrosis and/or fibrosis related diseases. The present invention further relates to compositions for use in the treatment, amelioration, and/or prevention of fibrosis. In certain embodiments, the compositions modulate the activity of a miRNA for the treatment, amelioration, and/or prevention of fibrosis. In certain embodiments, the compositions inhibit the activity of miR-21 for the treatment, amelioration, and/or prevention of fibrosis. | 01-17-2013 |
20130018085 | iRNA Agents Targeting VEGF - The features of the present invention relate to compounds, compositions and methods useful for modulating the expression of vascular endothelial growth factor (VEGF), such as by the mechanism of RNA interference (RNAi). The compounds and compositions include iRNA agents that can be unmodified or chemically-modified. | 01-17-2013 |
20130018086 | SIRNAS TARGETING EXON 10 OF PYRUVATE KINASE M2 - The invention relates to nucleic acid molecules and compositions for specific post-transcriptional inhibition of PKM2 expression. Methods for specific inhibition of PKM2 expression in a target cell, for example a cancer cell, are also provided. | 01-17-2013 |
20130023577 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF Eg5 AND VEGF GENES - This invention relates to compositions containing double-stranded ribonucleic acid (dsRNA) in a SNALP formulation, and methods of using the compositions to inhibit the expression of the Eg5 and Vascular Endothelial Growth Factor (VEGF), and methods of using the compositions to treat pathological processes mediated by Eg5 and VEGF expression, such as cancer. | 01-24-2013 |
20130023578 | siRNA for inhibition of c-Met expression and anticancer composition containing the same - Disclosed are small interfering RNA (siRNA) that complementarily binds to a base sequence of c-Met transcript (mRNA transcript), thereby inhibiting expression of c-Met without inducing immune responses, and use of the siRNA for prevention and/or treatment of cancer. The siRNA that complementarily binds to c-Met-encoding mRNA may inhibit expression of c-Met, which is commonly overexpressed in almost all cancer cells, through RNA interference (RNAi), thereby inhibiting proliferation and metastasis of cancer cells, and thus, the siRNA may be useful as an anticancer agent. | 01-24-2013 |
20130023579 | MODULATION OF ANGIOPOIETIN-LIKE 3 EXPRESSION - Provided herein are methods, compounds, and compositions for reducing expression of an ANGPTL3 mRNA and protein in an animal. Also provided herein are methods, compounds, and compositions for reducing plasma lipids, plasma glucose and atherosclerotic plaques in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate any one or more of cardiovascular disease or metabolic disease, or a symptom thereof. | 01-24-2013 |
20130023580 | Compositions and Methods for Inhibiting Expression of XBP-1 Gene - The invention relates to a double-stranded ribonucleic acid (dsRNA) targeting X-Box Protein 1 (XBP-1), and methods of using the dsRNA to inhibit expression of XBP-1. | 01-24-2013 |
20130030034 | MODULATION OF TIMP1 AND TIMP2 EXPRESSION - Provided herein are compositions, methods and kits for modulating expression of target genes, particularly of tissue inhibitor of metalloproteinase 1 and of tissue inhibitor of metalloproteinase 2 (TIMP1 and TIMP2, respectively). The compositions, methods and kits may include nucleic acid molecules (for example, short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA) or short hairpin RNA (shRNA)) that modulate a gene encoding TIMP1 and TIMP2, for example, the gene encoding human TIMP1 and TIMP2. The composition and methods disclosed herein may also be used in treating conditions and disorders associated with TIMP1 and TIMP2 including fibrotic diseases and disorders including liver fibrosis, pulmonary fibrosis, peritoneal fibrosis and kidney fibrosis. | 01-31-2013 |
20130030035 | IDENTIFICATION OF MICRO-RNAS INVOLVED IN NEUROMUSCULAR SYNAPSE MAINTENANCE AND REGENERATION - The present invention relates to the identification of miRNAs that are involved in the process of neuromuscular synaptic maintenance and regeneration following injury or disease. Modulation of these miRNAs is proposed as treatment for spinal cord injury and neurodegenerative disease. | 01-31-2013 |
20130030036 | MODULATION OF FORKHEAD BOX O1A EXPRESSION - Antisense compounds, compositions and methods are provided for modulating the expression of forkhead box O1A. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding forkhead box O1A. Methods of using these compounds for modulation of forkhead box O1A expression and for treatment of diseases associated with expression of forkhead box O1A are provided, in particular, for methods of treating diabetes. | 01-31-2013 |
20130030037 | RNAi Modulation Of RSV And Therapeutic Uses Thereof - The present invention is based on the in vivo demonstration that RSV can be inhibited through intranasal administration of iRNA agents as well as by parenteral administration of such agents. Further, it is shown that effective viral reduction can be achieved with more than one virus being treated concurrently. Based on these findings, the present invention provides general and specific compositions and methods that are useful in reducing RSV mRNA levels, RSV protein levels and viral titers in a subject, e.g., a mammal, such as a human. These findings can be applied to other respiratory viruses. | 01-31-2013 |
20130030038 | Dermatological, Pharmaceutical Composition Suitable for Oligonucleotides - The invention relates to a cosmetic and/or dermatological and/or pharmaceutical composition for the topical use and application of oligonucleotides, in particular antisense-oligonucleotides such as DNAzyme, siRNAs, asDNAs or ribozymes for use as an agent against inflammatory diseases by means of emulsions having a dispersed, internal, discontinuous aqueous phase. | 01-31-2013 |
20130030039 | NOVEL MULTIDRUG RESISTANCE-ASSOCIATED POLYPEPTIDE - Compositions and methods are disclosed for improving the effectiveness of a chemotherapeutic regimen to eradicate multidrug-resistant transformed cells from the body of a mammal, preferably from the body of a human. The present disclosure capitalizes on the discovery of a novel multidrug-resistance associated protein (MRP), herein designated MRP-β. The disclosed compositions include MRP-β nucleic acids, including probes and antisense oligonucleotides, MRP-β polypeptides and antibodies, MRP-β expressing host cells, and non-human mammals transgenic or nullizygous for MRP-β. The disclosed methods include methods for attenuating aberrant MRP-β gene expression, protein production and/or protein function. In addition, methods are disclosed for identifying and using a modulator, such as an inhibitor, of MRP-β. Preferably, the modulator is a small molecule. | 01-31-2013 |
20130035365 | Anti-sense oligonucleotides targeted against exon 9 of IL-23R alpha gene and method of using same to induce exon skipping and to treat inflammatory bowel diseases - The present invention relates to anti-sense oligonucleotides (AONs) used to induce exon 9 skipping in IL-23Rα gene. Exon 9 skipping of the IL23Rα gene ultimately causes specific induction of a novel soluble truncated IL-23Rα (Δ9) protein, characterized by a lack in a transmembrane domain and has a unique eight (8) amino acids (GLKEGSYC) at its C-terminus end as a result of frame-shift. The present invention provides a utility application of the use of AONs to induce production of a Δ9 protein which inhibits IL-23R-mediated cell signaling. More particularly, Δ9 protein blocks STAT3 formation as well as Th17 maturation. There is provided a therapeutic application of AONs in treating a mammal such as a human patient inflicted with Crohn's disease. | 02-07-2013 |
20130035366 | MODULATION OF HEPATITIS B VIRUS (HBV) EXPRESSION - Disclosed herein are antisense compounds and methods for decreasing HBV mRNA, DNA and protein expression. Such methods, compounds, and compositions are useful to treat, prevent, or ameliorate HBV-related diseases, disorders or conditions. | 02-07-2013 |
20130035367 | ANTISENSE OLIGONUCLEOTIDES THAT TARGET A CRYPTIC SPLICE SITE IN USH1C AS A THERAPEUTIC FOR USHER SYNDROME - The present invention provides a method for treating Usher's syndrome in a human subject including administering to the human subject an oligonucleotide having 8 to 30 linked nucleosides having a nucleobase sequence comprising a complementary region comprising at least 8 contiguous nucleobases complementary to a target region of equal length within exon 3 of an Usher RNA transcript. | 02-07-2013 |
20130035368 | OLIGONUCLEOTIDE COMPOUNDS COMPRISING NON-NUCLEOTIDE OVERHANGS - The invention relates to siRNA compounds comprising one non-nucleotide moiety covalently attached to at least one of the sense or antisense strands to down-regulate the expression of human genes. The invention also relates to pharmaceutical compositions comprising such compounds and a pharmaceutically acceptable carrier and to methods of treating and/or preventing the incidence or severity of various diseases or conditions associated with the target genes and/or symptoms associated with such diseases or conditions. | 02-07-2013 |
20130035369 | DOUBLE STRAND COMPOSITIONS COMPRISING DIFFERENTIALLY MODIFIED STRANDS FOR USE IN GENE MODULATION - The present invention provides double stranded compositions wherein the first strand is modified to have a particular motif and the second strand is modified a selected motif. More particularly, the present compositions comprise an antisense strand that is modified to have a positional/full motif and the sense strand is modified to have an alternating motif, a hemimer motif, a blockmer motif, a gapped motif, a positional motif, a positional/full motif or a fully modified motif. Each strand further comprises one or more phosphorothioate internucleoside linkage. The compositions are useful for targeting selected nucleic acid molecules and modulating the expression of one or more genes. | 02-07-2013 |
20130035370 | COMPOSITIONS AND METHODS FOR MODULATION OF LMNA EXPRESSION - Disclosed herein are compounds, compositions and methods for modulating the expression of LMNA in a cell, tissue or animal. Also provided are methods of target validation. Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and disorders. Further provided are methods of identifying cis splicing regulatory elements of a selected mRNA using the disclosed compounds. | 02-07-2013 |
20130035371 | LIPID FORMULATED DSRNA TARGETING THE PCSK9 GENE - This invention relates to composition and methods using lipid formulated siRNA targeted to a PCSK9 gene. | 02-07-2013 |
20130035372 | TREATMENT OF COLONY-STIMULATING FACTOR 3 (CSF3) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO CSF3 - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Colony-stimulating factor 3 (CSF3), in particular, by targeting natural antisense polynucleotides of Colony-stimulating factor 3 (CSF3). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of CSF3. | 02-07-2013 |
20130035373 | TREATMENT OF FIBROBLAST GROWTH FACTOR 21 (FGF21) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO FGF21 - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Fibroblast growth factor 21 (FGF21), in particular, by targeting natural antisense polynucleotides of Fibroblast growth factor 21 (FGF21). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of FGF21. | 02-07-2013 |
20130035374 | MicroRNA induction of pluripotential stem cells and uses thereof - Compositions and methods for inducing the formation of an induced pluripotential stem (iPS) cell from a somatic cell are disclosed. The compositions comprise miR 302-367 cluster and valproic acid. Further disclosed are methods for treatment of a disease or condition in a subject through the use of the compositions. | 02-07-2013 |
20130041009 | Methods and means for increasing resistance to cell damage - Methods are provided to increase resistance to cell damage in a subject. The increase in resistance to cell damage in a subject in the subject is accomplished by decreasing activity of eEF2 kinase in the subject. The eEF2 kinase activity can be decreased by decreasing the amount of functional eEF2 kinase produced by the subject, including contacting the eEF2 kinase with a compound that inhibits phosphorylation of eEF2 kinase substrate or decreasing the amount of functional eEF2 kinase is decreased by reducing expression of a gene encoding the eEF2 kinase. | 02-14-2013 |
20130041010 | COMPOSITIONS AND METHODS FOR THE SPECIFIC INHIBITION OF GENE EXPRESSION BY DSRNA CONTAINING MODIFIED NUCLEOTIDES - The invention features compositions and methods that are useful for reducing the expression or activity of a specified gene in eukaryotic cell. | 02-14-2013 |
20130041011 | BASE MODIFIED BICYCLIC NUCLEOSIDES AND OLIGOMERIC COMPOUNDS PREPARED THEREFROM - Provided herein are novel base modified bicyclic nucleosides, oligomeric compounds prepared therefrom and methods of using the oligomeric compounds. More particularly, novel pyrimidine bicyclic nucleosides are provided wherein each pyrimidine base is substituted at the 5 position with an optionally substituted, aromatic or heteroaromatic ring system comprising from 5 to 7 ring atoms selected from C, N, O and S. In certain embodiments, the oligomeric compounds provided herein hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA. | 02-14-2013 |
20130041012 | NEW ISOFORM OF BRUTON'S TYROSINE KINASE (BTK) PROTEIN - The use of compounds is described which are capable of functionally blocking at least one of the genes chosen from the group composed of EphAI, EphA2, EphA8, EphB2, CSF1R, VEGFR2, RAMP2, RAMP3, CLRN1, MAPK4, PIK3C2A, PIK3CG, GSK3alpha, GSK3beta, IRAK3, DAPK1, JAK1, PIM1, TRB3, BTG1, LATS1, LIMK2, MYLK, PAK1, PAK2, CDC2, BTK, PNRC2, NCOA4, NR2C1, TPR, RBBP8, TRPC7, FXYD1, ERNI, PRSS16, RPS3, CCL23 and SERPINE1, for the manufacture of a medicament destined to diminish the resistance to chemotherapeutic drugs in the therapeutic treatment of epithelial tumour pathologies. Also described is a method for the determination of the drug resistance in tumour cells, as well as a method for the identification of tumour stem cells. | 02-14-2013 |
20130041013 | ISOFORM OF BRUTON'S TYROSINE KINASE (BTK) PROTEIN - The use of compounds is described which are capable of functionally blocking at least one of the genes chosen from the group composed of EphA1, EphA2, EphA8, EphB2, CSF1R, VEGFR2, RAMP2, RAMP3, CLRN1, MAPK4, PIK3C2A, PIK3CG, GSK3alpha, GSK3beta, IRAK3, DAPK1, JAK1, PIM1, TRB3, BTG1, LATS1, LIMK2, MYLK, PAK1, PAK2, CDC2, BTK, PNRC2, NCOA4, NR2C1, TPR, RBBP8, TRPC7, FXYD1, ERNI, PRSS16, RPS3, CCL23 and SERPINE1, for the manufacture of a medicament destined to diminish the resistance to chemotherapeutic drugs in the therapeutic treatment of epithelial tumour pathologies. Also described is a method for the determination of the drug resistance in tumour cells, as well as a method for the identification of tumour stem cells. | 02-14-2013 |
20130041014 | ISOFORM OF BRUTON'S TYROSINE KINASE (BTK) PROTEIN - The use of compounds is described which are capable of functionally blocking at least one of the genes chosen from the group composed of EphAl, EphA2, EphA8, EphB2, CSF1R, VEGFR2, RAMP2, RAMP3, CLRN1, MAPK4, PIK3C2A, PIK3CG, GSK3alpha, GSK3beta, IRAK3, DAPK1, JAK1, PIM1, TRB3, BTG1, LATS1, LIMK2, MYLK, PAK1, PAK2, CDC2, BTK, PNRC2, NCOA4, NR2C1, TPR, RBBP8, TRPC7, FXYD1, ERNI, PRSS16, RPS3, CCL23 and SERPINE1, for the manufacture of a medicament destined to diminish the resistance to chemotherapeutic drugs in the therapeutic treatment of epithelial tumour pathologies. Also described is a method for the determination of the drug resistance in tumour cells, as well as a method for the identification of tumour stem cells. | 02-14-2013 |
20130041015 | Use of the Lactosylceramide Synthase Isoform B1,4GALT-V as a Biomarker for Cancer - In one aspect, B1,4GalT-V, an isoform of the enzyme lactosylceramide synthase, is provided as a biomarker for cancer. Also provided are methods and compositions directed at cancers characterized by the overexpression or upregulation of the lactosylceramide synthase isoform B1,4GalT-V. | 02-14-2013 |
20130041016 | Compositions and Methods for Preventing and Treating Cancer via Modulating UBE1L, ISG215 and/or UBP43 - Compositions and methods of using compositions that induce UBE1L or a ubiquitin-like protein ISG15, or inhibit a deconjugase UBP43 to degrade oncogenic proteins and enhance apoptosis of cancer (neoplastic) or pre-cancerous (pre-neoplastic) cells are provided. Methods for the prevention or treatment of cancer via administration of these compositions are also provided. | 02-14-2013 |
20130041017 | SIRNA-BASED THERAPY OF FIBRODYPLASIA OSSIFICANS PROGRESSIVA (FOP) - This invention is directed to mutated Activin A type I receptor proteins (ACVR1) and isolated nucleic acids encoding same. The invention also relates to compositions and methods for siRNA-based regulation of mutated ACVR1 expression in the treatment of Fibrodysplasia Ossificans Progressiva (FOP). | 02-14-2013 |
20130046006 | INHIBITORS OF FAM3B GENE, INHIBITOR COMPOSITIONS, INHIBITING METHODS AND APPLICATIONS OF INHIBITORS IN PREPARING PHARMACEUTICALS - Inhibitors that can inhibit expression of FAM3B gene to reduce the levels of expression products, or can combine the expression products to reduce the activity of promoting lipid synthesis of FAM3B gene product are provided, wherein the inhibitors are one or more inhibitors selected from the group consisting of small interfering RNAs, antisense oligonucleotides, antibodies against FAM3B proteins and active organic compounds. Cells, vectors or inhibitor compositions, comprising such inhibitors, methods for inhibiting expression of FAM3B gene or inhibiting the activity of promoting lipid synthesis of FAM3B gene product using the inhibitors are provided. Methods for treating diseases mediated by expression of FAM3B gene using such inhibitors and uses of the inhibitors in preparing pharmaceuticals for preventing and/or treating the disease mediated by FAM3B gene expression are also provided. | 02-21-2013 |
20130046007 | SELECTIVE REDUCTION OF ALLELIC VARIANTS - Disclosed herein are antisense compounds and methods for selectively of reducing expression of an allelic variant of a gene containing a single nucleotide polymorphism (SNP). Such methods, compounds, and composition are useful to treat, prevent, or ameliorate diseases, including neurodegenerative, such as Huntington's Disease (HD). | 02-21-2013 |
20130046008 | SELECTIVE REDUCTION OF ALLELIC VARIANTS - Disclosed herein are antisense compounds and methods for selectively reducing expression of an allelic variant of a huntingtin gene containing a single nucleotide polymorphism (SNP). Such methods, compounds, and composition are useful to treat, prevent, or ameliorate Huntington's Disease (HD). | 02-21-2013 |
20130046009 | RHO KINASE INHIBITORS FOR TREATMENT OF MASTOCYTOSIS AND ACUTE MYELOID LEUKEMIA - The disclosure is directed to methods of treating hematologic malignancies. More particularly, the disclosure is directed to methods of treating hematologic malignancies using Rho kinase (ROCK) inhibitors and myosin light chain-specific inhibitory RNA molecules. The disclosure is further directed to methods of identifying drug candidates for inhibiting ROCK in hematologic malignancies. | 02-21-2013 |
20130046010 | SUMO AS A MARKER OF CANCER DEVELOPMENT AND TARGET FOR CANCER THERAPY - Disclosed herein are methods relating to inhibiting or reducing proliferation of a cancer cell, for treating cancer in a subject in need of treatment, predicting the risk of progression of cancer to a more aggressive cancer, and screening for cancer in a subject, that comprise detecting and/or decreasing the levels of SUMO conjugated proteins and detecting and/or interfering with SUMO conjugation. | 02-21-2013 |
20130053426 | Composition For Delivery Of Genetic Material - The present invention relates to exosomes, loaded with genetic material and methods of producing them and to the use of such exosomes for delivering genetic material in vivo, in particular the use of such exosomes in methods of gene therapy or gene silencing. | 02-28-2013 |
20130053427 | Conjugate constructs, delivery, and use for treatment of disease - Pharmaceutical formulations of antisense peptide-conjugated phosphorodiamidate morpholino olgomers and methods of use for treatment of apicomplexan infections are disclosed. The invention is particularly directed to treatment of | 02-28-2013 |
20130053428 | NATURAL ANTISENSE AND NON-CODING RNA TRANSCRIPTS AS DRUG TARGETS - Small interfering RNA (siRNA) knock down antisense transcripts, and regulate the expression of their sense partners. This regulation can either be discordant (antisense knockdown results in sense transcript elevation) or concordant (antisense knockdown results in concomitant sense transcript reduction). | 02-28-2013 |
20130053429 | Treatment of Fibrosis Using Microrna 19b - The present invention provides a method for treating or preventing fibrosis comprising administering to a patient in need of such treatment or prevention an amount of microRNA-19b effective to treat or prevent said fibrosis. In some embodiments, the invention relates to inhibiting the activation of collagen-producing cells and thereby treating or preventing fibrosis. The methods of the invention also include detection of biomarkers that can be used to diagnose disease and/or evaluate the prognosis of a patient suffering from fibrosis or at risk of developing fibrosis, such as hepatic fibrosis. Such methods may be used to characterize the progression of diseases associated with fibrosis. | 02-28-2013 |
20130053430 | MODULATION OF CETP EXPRESSION - Provided herein are methods, compounds, and compositions for reducing expression of a CETP mRNA and protein in an animal. Also provided herein are methods, compounds, and compositions for increasing HDL levels and/or HDL activity and reducing plasma lipids, plasma glucose and atherosclerotic plaques in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate any one or more of cardiovascular disease or metabolic disease, or a symptom thereof. | 02-28-2013 |
20130053431 | MODULATION OF GROWTH HORMONE RECEPTOR EXPRESSION AND INSULIN-LIKE GROWTH FACTOR EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of growth hormone receptor and/or insulin like growth factor-I (IGF-I). The compositions comprise oligonucleotides, targeted to nucleic acid encoding growth hormone receptor. Methods of using these compounds for modulation of growth hormone receptor expression and for diagnosis and treatment of disease associated with expression of growth hormone receptor and/or insulin-like growth factor-I are provided. Diagnostic methods and kits are also provided. | 02-28-2013 |
20130059901 | Pre-MRNA Trans-Splicing Molecule (RTM) Molecules and Their Uses - The present invention relates to specific and markedly improved pre-mRNA trans-splicing molecule (RTM) molecules which are designed to correct specific genes expressed within cells to be targeted, and which are associated with epidermolysis bullosa, cystic fibrosis, pachyonychia congenital, and psoriasis or neurodermitis, as well as cancers of the skin. In particular, the RTMs of the present invention are genetically engineered to interact with a specific target pre-mRNA expressed in cells to be targeted so as to result in correction of genetic defects or reprogramming of gene expression responsible for a variety of different skin disorders. | 03-07-2013 |
20130059902 | METHODS AND COMPOSITIONS USEFUL IN TREATMENT OF DISEASES OR CONDITIONS RELATED TO REPEAT EXPANSION - The present invention is drawn to chemically-modified oligomers that are complementary to, and capable of hybridizing within the repeat region of CAG, CUG, or CCUG nucleotide repeat-containing RNAs (NRRs). | 03-07-2013 |
20130059903 | Compositions and Methods for Characterizing Breast Cancer - The invention provides compositions and methods for characterizing breast cancer stem In particular, the invention provides for the identification of cells expressing Twist and CD44 that express little or virtually undetectable levels of CD24 (i.e. a Twist | 03-07-2013 |
20130059904 | METHODS, AGENTS, AND COMPOUND SCREENING ASSAYS FOR INDUCING DIFFERENTIATION OF UNDIFFERENTIATED MAMMALIAN CELLS INTO OSTEOBLASTS - The present invention relates to methods, agents and compound screening assays for inducing differentiation of undifferentiated mammalian cells into osteoblasts. The invention thus provides a method, comprising contacting a compound with a polypeptide comprising an amino acid sequence selected from the group consisting of SEQ ID No: 194-309; and measuring a compound-polypeptide property related to the differentiation of said cells. The invention further relates to a bone formation enhancing pharmaceutical composition, and the use thereof in treating and/or preventing a disease involving a systemic or local decrease in mean bone density in a subject. Furthermore, the invention relates to a method for the in vitro production of bone tissue. | 03-07-2013 |
20130065938 | Mutator Activity Induced by microRNA-155 (miR-155) Links Inflammation and Cancer - Methods of reducing spontaneous mutation rate of a cell in a subject in need thereof by reducing endogenous levels of miR-155 are described. | 03-14-2013 |
20130065939 | COMPOSITIONS AND METHODS FOR SILENCING GENES EXPRESSED IN CANCER - The present invention provides therapeutic nucleic acids such as interfering RNA (e.g., siRNA) that target the expression of genes associated with tumorigenesis and/or cell transformation, lipid particles (e.g., nucleic acid-lipid particles) comprising one or more (e.g., a cocktail) of the therapeutic nucleic acids, methods of making the lipid particles, and methods of delivering and/or administering the lipid particles, e.g., for the treatment of a cell proliferative disorder such as cancer. | 03-14-2013 |
20130065940 | DOUBLE-STRANDED RNA MOLECULES WITH STABILITY IN MAMMALIAN BODY FLUID, PREPARATION AND APPLICATION THEREOF - The present invention discloses preparation and application of double-stranded RNA molecules stable in mammalian body fluids. The mammalian-body-fluid-stable RNA molecules disclosed in the present invention are comprised of only unmodifide nucleotides. For the first time, the present invention discloses the applications of mammalian-body-fluid-stable RNA molecules for immunotherapy and siRNA drug development. | 03-14-2013 |
20130065941 | COMPOSITIONS AND THEIR USES FOR GENE THERAPY OF BONE CONDITIONS - In certain preferred embodiments, the present invention provides compositions and methods for the treatment of bone conditions associated with low bone density. In preferred embodiments, the present invention provides compositions and methods for the treatment of osteoprotegerin-responsive conditions. | 03-14-2013 |
20130065942 | Nucleic Acid-Lipopolymer Compositions - Compositions, methods, and applications that increase the efficiency of nucleic acid transfection are provided. In one aspect, a pharmaceutical composition may include at least about 0.5 mg/ml concentration of a nucleic acid condensed with a cationic lipopolymer suspended in an isotonic solution, where the cationic lipopolymer includes a cationic polymer backbone having cholesterol and polyethylene glycol covalently attached thereto, and wherein the molar ratio of cholesterol to cationic polymer backbone is within a range of from about 0.1 to about 10, and the molar ratio of polyethylene glycol to cationic polymer backbone is within a range of from about 0.1 to about 10. The composition further may include a filler excipient. | 03-14-2013 |
20130065943 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF CD45 GENE - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the CD45 gene. | 03-14-2013 |
20130065944 | REVERSE MICELLE SYSTEM COMPRISING NUCLEIC ACIDS AND USE THEREOF - The present invention relates to reverse micelle system based on sterols, acylglycerols, phospholipids or sphingolipids and nucleic acids. The reverse micelle system of the invention is able to cross mucosa and cellular membranes. It thus allows vectorization of nucleic acids to target sites. It is advantageously useful in the pharmaceutical and dietetic fields. | 03-14-2013 |
20130065945 | NLK AS A MARKER FOR DIAGNOSIS OF LIVER CANCER AND AS A THERAPEUTIC AGENT THEREOF - A novel marker for diagnosis of liver cancer and use thereof are provided. To be specific, a marker for diagnosis of liver cancer using over-expression of NLK (neuro-like kinase) in liver cancer cell is provided, along with a composition for diagnosis of liver cancer, a kit, a microarray, and a method for diagnosing liver cancer using the marker. Additionally, a method for screening a substance to prevent or treat liver cancer by decreasing expression of the marker gene or protein, and a composition for preventing or treating liver cancer including such substance are provided. Accordingly, the NLK gene can be efficiently used as a target for diagnosis and treatment of liver cancer. | 03-14-2013 |
20130065946 | Materials and Methods Related to Modulation of Mismatch Repair and Genomic Stability by miR-155 - The present invention provides materials and methods related to modulation of mismatch and genomic stability by miR-155. | 03-14-2013 |
20130065947 | TREATMENT OF PAR4 RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO PAR4 - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of PAR4, in particular, by targeting natural antisense polynucleotides of PAR4. The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of PAR4. | 03-14-2013 |
20130072540 | RNA interference of galectin-3 expression and methods of use thereof - Galectin-3 is a pro-inflammatory molecule functioning as a cytokine hub, and also regulates unfolded protein responses (UPR) and ER stress. Thus, galectin-3 serves as a target for ameliorating inflammatory diseases such as allergic inflammation and diabetic inflammation and insulin resistance. RNA interference of endogenous galectin-3 expression, upregulates IL-12, IL-10 while downregulating IL-23 production, which offers protection against allergic inflammation. In addition, endogenous galectin-3 knockdown causes upregulation of XBP1, alleviating ER stress. Together, upregulated XBP1 and IL-10 offer protection against obesity-induced inflammation. Therefore, the embodiment of the invention resides in RNA interference of endogenous galectin-3 in appropriate cell types in order to rectify allergic and/or diabetic inflammation. | 03-21-2013 |
20130072541 | ADENO-ASSOCIATED VIRAL VECTOR FOR EXON SKIPPING IN A GENE ENCODING A DISPENSIBLE-DOMAIN PROTEIN - The invention concerns an adeno-associated viral vector comprising:
| 03-21-2013 |
20130072542 | PISCINE REOVIRUS DIAGNOSTIC COMPOSITIONS - The invention is directed to a isolated a Piscine reovirus associated with HSMI in teleosts, and isolated nucleic acids sequences and peptides thereof. The invention also relates to diagnostic antibodies against antigens derived from Piscine re-oviruses. In another aspect, the invention relates to iRNAs which target nucleic acid sequences of Piscine reoviruses. In another aspect, the invention is related to methods for detecting the presence or absence of Piscine reoviruses in an animal. | 03-21-2013 |
20130072543 | Compounds and Compositions for Nucleic Acid Formulation and Delivery - The invention relates to compositions containing compounds of formula I: | 03-21-2013 |
20130072544 | DETECTION OF HBX/8P11 HYBRID SEQUENCE IN HUMAN HEPATOCELLULAR CARCINOMA - The present invention provides a method for diagnosing a particular type of human hepatocellular carcinoma (HCC), HBx/8p11-positive HCC, in a subject by detecting the presence of a specific, non-naturally occurring polynucleotide sequence that indicates integration of a portion of the human hepatitis B virus (HBV) sequence into the human genome on chromosome 8 in the 8p11 integration region. A kit and device useful for such a method are also provided. In addition, the present invention provides a method for treating an HBx/8p11-positive HCC. | 03-21-2013 |
20130072545 | MiRNA MOLECULE DEFINED BY ITS SOURCE AND ITS DIAGNOSTIC AND THERAPEUTIC USES IN DISEASES OR CONDITIONS ASSOCIATED WITH EMT - The invention relates to the diagnostic and therapeutic uses of a miRNA molecule or an equivalent thereof wherein a source of said miRNA molecule or equivalent thereof comprises at least 80 nucleotides and comprises a motif having at least 98% identity with the motif represented by SEQ ID NO:1 or a source thereof in a disease and condition associated with EMT (Epithelial to Mesenchymal Transition). | 03-21-2013 |
20130072546 | TREATMENT OF METHIONINE SULFOXIDE REDUCTASE A (MSRA) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO MSRA - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Methionine Sulfoxide Reductase A (MSRA), in particular, by targeting natural antisense polynucleotides of Methionine Sulfoxide Reductase A (MSRA). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of MSRA. | 03-21-2013 |
20130079382 | Methods and Compositions for Modulating Gene Expression Using Oligonucleotide Based Drugs Administered in vivo or in vitro - Compositions and methods for down modulating target gene expression with RNA interference, as well as methods for administering said compositions are disclosed. The method comprises administering a first strand to a cell, incubating the cell for a time period suitable for uptake of the first oligo prior to administering a second strand, wherein the first strand and said second strand form an intracellular duplex which is effective to catalyze degradation of gene target mRNA or inhibit translation of said mRNA. | 03-28-2013 |
20130079383 | Lipid Compounds Targeting VLA-4 - The invention relates to the compounds of formula I: | 03-28-2013 |
20130079384 | Means and Methods for Determining Risk of Cardiovascular Disease - The invention relates to medicine, in particular to internal medicine and/or cardiology. The present invention provides means and methods for typing a sample and identifying and/or treating a patient suffering from or at risk of suffering from cardiovascular disease by measuring mi RNA present in a sample of said patient. The present invention further provides means and methods for identifying new cardiovascular disease therapies. | 03-28-2013 |
20130079385 | USP47 Inhibtors and Methods to Induce Apoptosis - The present invention relates to USP47 (ubiquitin specific protease 47) inhibitors and methods for inducing apoptosis or cell death in a target cell. In certain embodiments, the invention relates to methods and kits to screen for related agents that induce apoptosis. Additionally, the invention relates to assays for screening compounds capable of acting as USP47 inhibitors. | 03-28-2013 |
20130079386 | DIAGNOSTICS OF B-CELL LYMPHOMA - The present invention relates to the fields of genetics and oncology and provides methods and means for diagnosing and monitoring of patients having B-cell lymphomas, such methods and means allowing an early diagnosis of the B-cell lymphoma. Specifically, the present invention relates to a novel method and a biomarker for diagnosing B-cell lymphomas and for differentiating the B-cell lymphomas into prognostic groups of indolent and aggressive B-cell lymphomas. | 03-28-2013 |
20130079387 | ANTISENSE OLIGONUCLEOTIDE MODULATION OF RAF GENE EXPRESSION - Oligonucleotides are provided which are targeted to nucleic acids encoding human raf and capable of inhibiting raf expression. The oligonucleotides may have chemical modifications at one or more positions and may be chimeric oligonucleotides. Methods of inhibiting the expression of human raf using oligonucleotides of the invention are also provided. The present invention further comprises methods of inhibiting hyperproliferation of cells and methods of treating or preventing conditions, including hyperproliferative conditions, associated with raf expression. | 03-28-2013 |
20130079388 | FORMULATIONS COMPRISING ANTISENSE NUCLEOTIDES TO CONNEXINS - A therapeutic and/or cosmetic formulation comprising at least one anti-sense polynucleotide to a connexin protein together with a pharmaceutically acceptable carrier or vehicle is useful in site specific down regulation of connexin protein expression, particularly in reduction of neuronal cells death, wound healing, reduction of inflammation, decrease of scar formation and skin rejuvenation and thickening. | 03-28-2013 |
20130079389 | siRNA And Their Use In Methods And Compositions For The Treatment And/Or Prevention Of Eye Conditions - The invention relates to methods and compositions for the treatment/and or prevention of eye conditions related to high levels of expression and/or activity of the vanilloid-1 receptor (TRPV). | 03-28-2013 |
20130085173 | SUPERCOILED MINICIRCLE DNA FOR GENE THERAPY APPLICATIONS - The present invention relates to nucleic acid molecule compositions comprising minivectors encoding a nucleic acid sequence and methods of gene therapy and prophylaxis against infection using minivectors encoding a nucleic acid sequence. | 04-04-2013 |
20130090366 | MODULATION OF EPIDERMAL GROWTH FACTOR RECEPTOR LIGANDS - The present invention relates to a method for modulating the expression and/or activity of an epidermal growth factor receptor (EGFR) ligand in a cell or tissue, the method comprising contacting the cell or tissue with a miR-7 miRNA, a pre-cursor or variant thereof, a miRNA comprising a seed region comprising the sequence GGAAGA, or an antagonist of any such miRNA. | 04-11-2013 |
20130090367 | Compositions and Methods for Inhibiting Human Host Factors Required for Influenza Virus Replication - This application relates to the modulation of host cell factors required for influenza virus replication. The application relates to compounds, including nucleic acid compounds (such as, e.g., small interfering RNAs (siRNAs)) and small molecules, that target human host cell factors involved in influenza virus replication, and the use of such compounds for modulating influenza virus replication and as antiviral agents. The application also relates to methods of treating an influenza virus infection and methods of treating or preventing a symptom or disease associated with influenza virus infection, comprising administering to a subject a composition comprising a compound, such as a nucleic acid compound (e.g., an siRNA) or small molecule, that targets a human host cell factor involved in influenza virus replication. | 04-11-2013 |
20130090368 | THERAPEUTIC ANTISENSE OLIGONUCLEOTIDE COMPOSITIONS FOR THE TREATMENT OF INFLAMMATORY BOWEL DISEASE - Disclosed herein is a method for the sustained amelioration and/or treatment of ulcerative colitis comprising rectal administration of a compound comprising an antisense oligonucleotide having the sequence 5′-GCCCAAGCTGGCATCCGTCA-3′, ISIS 2302. The method results in a decrease in the indications of ulcerative colitis for an extended period (greater than 90 days) after the conclusion of the administration of the composition. The composition is well tolerated and systemic exposure is minimal. | 04-11-2013 |
20130090369 | TRANSFECTION SHEETS AND METHODS OF USE - The present disclosure relates to nucleic acid-lipid compositions for use in delivering nucleic acids to cells in vitro or in vivo. In particular, it relates to the preparation and use of resilient transfection sheets that comprise the nucleic acid-lipid compositions. | 04-11-2013 |
20130090370 | APOPTOSIS INDUCER FOR CANCER CELL - The present invention revealed that by suppressing the expression of the WRN gene, the BLM gene, or the RecQ1 gene, which belong to the RecQ helicase family, apoptosis is induced in various cancer cells and their proliferation is suppressed. Compounds that suppress the expression of RecQ helicase family genes or the functions of RecQ helicase proteins are thought to have the activity of inducing apoptosis. | 04-11-2013 |
20130090371 | METHODS AND COMPOSITIONS FOR INHIBITION OF BETA2-ADRENERGIC RECEPTOR DEGRADATION - The present invention generally relates to compositions and kits comprising a β2-AR agonist and a modulator of a β2-AR regulator gene, where the modulator of the β2-AR regulator gene inhibits the internalization and/or degradation of the β2-ad-renergic receptor (β2-AR). More specifically, the present invention relates to the use of an agonist of β2-adrenergic receptor (β2-AR) and an agent which inhibits agonist induced β2-adrenergic receptor (β2-AR) internalization and/or degradation in method for the treatment of a respiratory disorder in a subject. | 04-11-2013 |
20130090372 | Novel Low Molecular Weight Cationic Lipids for Oligonucleotide Delivery - The instant invention provides for novel cationic lipids that can be used in combination with other lipid components such as cholesterol and PEG-lipids to form lipid nanoparticles with oligonucleotides. It is an object of the instant invention to provide a cationic lipid scaffold that demonstrates enhanced efficacy along with lower liver toxicity as a result of lower lipid levels in the liver. The present invention employs low molecular weight cationic lipids with one short lipid chain to enhance the efficiency and tolerability of in vivo delivery of siRNA. | 04-11-2013 |
20130090373 | AGENT FOR SUPPRESSING EXPRESSION OF DOMINANT ALLELE - An agent for selectively suppressing the expression of a dominant allele while allowing expression of wild-type or desired alleles and methods for using the agent are described. The RNAi agent has a structure obtained by assigning a dominant point mutation in the targeted allele as a standard point, setting a base length from the standard point to the 5′ end to a predetermined length, and introducing one mismatch base differing from the target sequence to a predetermined position downstream from the standard point. | 04-11-2013 |
20130096176 | MODULATION OF INSULIN LIKE GROWTH FACTOR I RECEPTOR EXPRESSION - The present invention provides compositions and methods for modulating the expression of growth factor gene. In particular, this invention relates to compounds, particularly oligonucleotide compounds, which, in preferred embodiments, hybridize with nucleic acid molecules encoding the Insulin Like Growth Factor I receptor (IGF-I receptor or IGF-IR) and in particular human IGF-IR. Such compounds are exemplified herein to modulate proliferation which is relevant to the treatment of proliferative and inflammatory skin disorders and cancer. It will be understood, however, that the compounds can be used for any other condition in which the IGF-IR is involved including inflammatory condition. | 04-18-2013 |
20130096177 | POLYMERS FOR DELIVERING MOLECULES OF INTEREST - The present invention relates to a new class of cationic polymers that self-assemble with a pH-sensitive dissolution switch, and their uses to deliver molecules of interest to a cell. The present invention also relates to compositions comprising said cationic polymers non-covalently associated with a molecule of interest, in particular with a siRNA. | 04-18-2013 |
20130096178 | GENETIC MARKERS FOR PAGET'S DISEASE - The present invention is based on the identification of a number of genetic markers that are associated with susceptibility to Paget's disease of bone (PDB). This invention provides details of markers and nucleotide sequences as well as associated proteins/peptides and/or compositions and methods, for use in treating, preventing and/or detecting/diagnosing PDB and/or a susceptibility/predisposition thereto. | 04-18-2013 |
20130096179 | SIRT4 ACTIVITIES - Methods of modulating insulin secretion and treating metabolic disorders by modulating the expression or activity of Sirt4 are provided. | 04-18-2013 |
20130096180 | Bispecific Antisense Oligonucleotides that Inhibit IGFBP-2 and IGFBP-5 and Methods of Using Same - Bispecific antisense oligonucleotides which consist essentially of a sequence of bases that is complementary to portions of both the gene encoding human IGFBP-2 and the gene encoding human IGFBP-5 are useful in as antisense therapeutics in the treatment of endocrine-regulated cancers. | 04-18-2013 |
20130096181 | METHODS OF USING SCD1 ANTAGONISTS - Provided herein are therapies for the treatment of pathological conditions, such as cancer, and method of using SCD1 antagonists. | 04-18-2013 |
20130096182 | RECOMBINANT ADENO-ASSOCIATED VECTORS FOR TARGETED TREATMENT - Novel adeno-associated virus (AAV) vectors in nucleotide and amino acid forms and uses thereof are provided. The isolates show specific tropism for certain target tissues, such as blood stem cells, liver, heart and joint tissue, and may be used to transduce stem cells for introduction of genes of interest into the target tissues. Certain of the vectors are able to cross tightly controlled biological junctions, such as the blood-brain barrier, which open up additional novel uses and target organs for the vectors, providing for additional methods of gene therapy and drug delivery. | 04-18-2013 |
20130096183 | TREATMENT OF SODIUM CHANNEL, VOLTAGE-GATED, ALPHA SUBUNIT (SCNA) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO SCNA - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Sodium channel, voltage-gated, alpha subunit (SCNA), in particular, by targeting natural antisense polynucleotides of Sodium channel, voltage-gated, alpha subunit (SCNA). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of SCNA. | 04-18-2013 |
20130102651 | GENERAL COMPOSITION FRAMEWORK FOR LIGAND-CONTROLLED RNA REGULATORY SYSTEMS - The invention provides an improved design for the construction of extensible nucleic acid-based, ligand-controlled regulatory systems, and the nucleic acid regulatory systems resulting therefrom. The invention contemplates improving the design of the switches (ligand-controlled regulatory systems) through the design of an information transmission domain (ITD). The improved ITD eliminates free-floating ends of the switching and the competing strands, and localizes competitive hybridization events to a contiguous strand of competing and switching strands in a strand-displacement mechanism-based switch, thereby improving the kinetics of strand-displacement. The improved regulatory systems have many uses in various biological systems, including gene expression control or ligand-concentration sensing. | 04-25-2013 |
20130102652 | METHODS AND COMPOSITIONS RELATED TO MODIFIED ADENOSINES FOR CONTROLLING OFF-TARGET EFFECTS IN RNA INTERFERENCE - Disclosed are compositions and methods related to modified nucleobases. Also disclosed are compositions and methods related to modified interfering RNAs. Also disclosed are compositions and methods related to modified adenonsine for controlling off-target effects in RNA interference. | 04-25-2013 |
20130102653 | GNA11 AND GNAQ EXON 4 MUTATIONS IN MELANOMA - The present invention provides methods of detecting activating mutations in exon 4 of a GNAQ or a GNA11 gene in a melanocytic neoplasm for diagnostic and prognostic purposes. The invention further provides methods of treating such melanocytic neoplasm by modulating the activity of the mutated GNAQ or GNA11. | 04-25-2013 |
20130102654 | RNA APTAMERS AGAINST BAFF-R AS CELL-TYPE SPECIFIC DELIVERY AGENTS AND METHODS FOR THEIR USE - In one embodiment, a B cell specific aptamer-siRNA chimera is provided. The B cell specific aptamer-siRNa chimera may include an RNA aptamer that binds BAFF-R and an siRNA molecule conjugated to the RNA aptamer via a nucleotide linker. In another embodiment, a B cell specific RNA aptamer is provided. The RNA aptamer may be a molecule that binds to BAFF-R that has the sequence SEQ ID NO:37, SEQ ID NO:38 or SEQ ID NO:39. In some embodiments, the RNA aptamer is conjugated, via a nucleotide linker, to an siRNA molecule that suppresses expression of one or more target oncogenes in one or more B cells. In one aspect, the one or more target oncogenes are selected from Bcl6, Bcl2, STAT3, Cyclin D1, Cyclin E2 and c-myc. In another embodiment, methods for treating a B cell malignancy in a cancer patient are provided. Such methods may include administering a therapeutically effective amount of a therapeutic composition, the therapeutic composition comprising a B cell specific RNA aptamer that binds BAFF-R. | 04-25-2013 |
20130109736 | METHOD FOR ENHANCED UPTAKE OF VIRAL VECTORS IN THE MYOCARDIUM | 05-02-2013 |
20130109737 | MEDIATOR AND COHESIN CONNECT GENE EXPRESSION AND CHROMATIN ARCHITECTURE | 05-02-2013 |
20130109738 | Control of Cardiac Growth, Differentiation and Hypertrophy | 05-02-2013 |
20130109739 | COMPOSITIONS AND METHODS FOR SHORT INTERFERING NUCLEIC ACID INHIBITION OF NAV1.8 | 05-02-2013 |
20130109740 | METHODS AND COMPOSITIONS FOR THE SPECIFIC INHIBITION OF BETA-CATENIN BY DOUBLE-STRANDED RNA | 05-02-2013 |
20130109741 | MiRNA AND ITS DIAGNOSTIC AND THERAPEUTIC USES IN DISEASES OR CONDITIONS ASSOCIATED WITH MELANOMA, OR IN DISEASES OR CONDITIONS ASSOCIATED WITH ACTIVATED BRAF PATHWAY | 05-02-2013 |
20130116299 | METHODS AND COMPOSITIONS FOR INCREASING SENSITIVITY TO TYROSINE KINASE INHIBITORS - The present invention relates to a method for sensitizing a disease cell expressing the epidermal growth factor receptor (EGFR) to a tyrosine kinase inhibitor selective or specific for EGFR and/or its signalling pathway, the method comprising contacting the cell with a miR-7 miRNA, a precursor or variant thereof, or a miRNA comprising a seed region comprising the sequence GGAAGA. | 05-09-2013 |
20130116300 | TREATMENT OF MEMBRANE BOUND TRANSCRIPTION FACTOR PEPTIDASE, SITE 1 (MBTPS1) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO MBTPS1 - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Membrane Bound Transcription Factor Peptidase, site 1 (MBTPS1), in particular, by targeting natural antisense polynucleotides of Membrane Bound Transcription Factor Peptidase, site 1 (MBTP-S1). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of MBTPS1. | 05-09-2013 |
20130116301 | ANTISENSE MODULATION OF GCGR EXPRESSION - Provided herein are methods, compounds, and compositions for reducing expression of GCGR mRNA and protein in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate metabolic disease, for example, diabetes, or a symptom thereof. | 05-09-2013 |
20130116302 | PHARMACEUTICAL COMPOSITION FOR THE TREATMENT OF CHLAMYDIAL INFECTION - Subject of the present invention is a pharmaceutical composition comprising at least one inhibitor of a microorganism selected from the family Chlamydiaceae. | 05-09-2013 |
20130116303 | Antagonists of miRNA-29 Expression and Their Use in the Prevention and Treatment of Aneurysm - The present invention relates to antagonists of the expression and/or the function of the micro RNA miRNA-29 for use in the prevention and/or treatment of aortic aneurysms. Further disclosed is a method for the identification of miRNA-29 antagonists, a pharmaceutical composition comprising said miRNA-29 antagonists and a method for preventing and treating age-related aortic aneurysm formation in a subject in need of such a treatment. | 05-09-2013 |
20130116304 | TMEM195 ENCODES FOR TETRAHYDROBIOPTERIN-DEPENDENT ALKYLGLYCEROL MONOOXYGENASE ACTIVITY - The present invention relates to the provision of a pharmaceutical composition comprising a nucleic acid molecule encoding a alkylglycerol monooxygenase (TMEM195; glyceryl ether monooxygenase; EC 1.14.16.5). The present invention also provides for a method for producing said alkylglycerol monooxygenase (TMEM195; glyceryl ether monooxygenase; EC 1.14.16.5) polypeptides encoded by said polynucleotides. Moreover, the use of such polypeptides as well as of antagonists/inhibitors of such polypeptides in a medical setting (e.g. in from of a pharmaceutical composition) and methods for assessing the activity of a candidate molecule suspected of being an antagonist/inhibitor or agonist/activator in order to identify potential antagonists/inhibitors or agonists/activators of the polypeptide are also provided in the present invention. Finally, the present invention provides kits for carrying out said methods wherein the kits comprise polynucleotides and/or antibodies capable of detecting the activity of alkylglycerol monooxygenase. | 05-09-2013 |
20130116305 | METHODS AND COMPOSITIONS FOR THE INHIBITION OF HIV-1 REPLICATION - This invention relates to methods and compositions for the attenuation of HIV-1 replication in human cells, and especially in human macrophages. The invention particularly concerns the use of inhibitors of P21 (CDKNIA) expression to attenuate such replication. The invention particularly concerns the use of antisense P21 oligonucleotides, siRNA and/or 2-cyano-3,12-dioxooleana-1,9-dien28-oic (CDDO) to attenuate such replication. | 05-09-2013 |
20130116306 | SYSTEM FOR DELIVERING NUCLEIC ACIDS FOR SUPPRESSING TARGET GENE EXPRESSION BY UTILIZING ENDOGENOUS CHYLOMICRON - The object of present invention is to provide a system that can deliver in vivo nucleic acids such as an siRNA for suppressing a target gene expression in vivo more safely and efficiently, and to provide an expression-suppressing agent and a pharmaceutical composition utilizing the system. An introduction substance into chylomiclon, particularly nucleic acids to which an alpha-tocopherol is bound for suppressing a target gene expression, can be delivered more safely and efficiently into hepatic cells in vivo by administering the nucleic aids under the condition where the production of chylomicron is induced in the body. Alternatively, alpha-tocopherol-bound nucleic acids are mixed with extracted chylomiclon, and then they are administered. Consequently, a target gene expression is suppressed, thereby a disease caused by an elevated expression of the target gene can be treated more safely and efficiently. | 05-09-2013 |
20130116307 | NOVEL CYCLIC CATIONIC LIPIDS AND METHODS OF USE - The present invention provides compositions and methods for the delivery of therapeutic agents to cells. In particular, these include novel cationic lipids and nucleic acid-lipid particles that provide efficient encapsulation of nucleic acids and efficient delivery of the encapsulated nucleic acid to cells in vivo. The compositions of the present invention are highly potent, thereby allowing effective knock-down of a specific target protein at relatively low doses. In addition, the compositions and methods of the present invention are less toxic and provide a greater therapeutic index compared to compositions and methods previously known in the art. | 05-09-2013 |
20130116308 | CD36 INHIBITION TO CONTROL OBESITY AND INSULIN SENSITIVITY - The disclosure relates to the therapeutic utility of CD36 antagonists to reduce body weight, inhibit fat accumulation and especially visceral fat accumulation, improve insulin sensitivity, lower blood glucose levels, and treat and prevent metabolic syndrome, pre-diabetes and diabetes, and lower plasma cholesterol levels and decrease fat deposit in the liver. CD36 antagonists, including SAB or its metabolites, such as RA and DSS, are useful for these purposes. | 05-09-2013 |
20130116309 | OLIGOMERIC COMPOUNDS FOR THE MODULATION OF HIF-1A EXPRESSION - Oligonucleotides directed against the hypoxia-inducible factor-1α (HIF-1α) gene are provided for modulating the expression of HIF-1α. The compositions comprise oligonucleotides, particularly antisense oligonucleotides, targeted to nucleic acids encoding the HIF-1α. Methods of using these compounds for modulation of HIF-1α expression and for the treatment of diseases associated with the hypoxia-inducible factor-1α are provided. Examples of diseases are cancer and pre-eclampsia. The oligonucleotides may be composed of deoxyribonucleosides, a nucleic acid analogue, or Locked Nucleic Acid (LNA) or a combination thereof. | 05-09-2013 |
20130116310 | ANTISENSE OLIGONUCLEOTIDES FOR INDUCING EXON SKIPPING AND METHODS OF USE THEREOF - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202. | 05-09-2013 |
20130123327 | COMBINED USE OF PRAME INHIBITORS AND HDAC INHIBITORS - The invention relates to the cancer antigen PRAME (PReferentially expressed Antigen in MElanoma) and its use in a method of treatment of a tumour which comprises administering to a subject in need of treatment an effective amount of an inhibitor of PRAME, in combination with a second agent selected from the group of an inhibitor of HDAC (an HDACi) and a retinoid. | 05-16-2013 |
20130123328 | METHODS AND COMPOSITIONS FOR TREATING CANCER - We describe a method of determining whether a cancer cell is likely to be resistant to treatment by an mTOR inhibitor. The method may comprise detecting PPP2R2B (GenBank Accession Number: NM_18167) in or of the cell. It may, alter-natively, or in addition, comprise detecting PDK1 (GenBank Accession Number: NM_002613), in or of the cell. The method may comprise detecting methylation of the PPP2R2B promoter in or of the cell. It may comprise detecting the expression and/or activity of PPP2R2B in or of the cell. It may comprise detecting PDK1 mediated Myc phosphorylation activity. Methods of choosing a treatment for an individual suffering from or suspected to be suffering from a cancer, determining whether an individual suffering from or suspected to be suffering from a cancer will respond to treatment by an mTOR inhibitor, increasing the sensitivity of a cancer cell to treatment by an mTOR inhibitor, for treating or preventing cancer in an individual suffering or suspected to be suffering from cancer are also provided. We further provide for a combination of an inhibitor of PDK1 expression and/or activity and an mTOR inhibitor for use in a method of treatment or prevention of cancer. | 05-16-2013 |
20130123329 | MICRORNA COMPOSITIONS AND METHODS - Provided herein are compositions comprising oligomeric compounds. In certain embodiments, the oligomeric compounds are useful as miRNA mimics. The oligomeric compounds may mimic the activity of miR-34. Also provided herein are methods for the treatment of cancer. | 05-16-2013 |
20130123330 | Dual Targeted siRNA Therapeutics for Treatment of Diabetic Retinopathy and Other Ocular Neovascularization Diseases - The present invention relates to compositions and methods for treating diabetic retinopathy and other ocular neovascularization diseases. In one embodiment, the composition comprises at least two different siRNA duplexes and a pharmaceutically acceptable carrier. One of the duplexes binds to an mRNA molecule that encodes VEGF, and the other binds to an mRNA molecule that encodes VEGFR2. In another embodiment, the composition further comprises an siRNA duplex that binds to an mRNA molecule that encodes TGFβ1. | 05-16-2013 |
20130123331 | MODULATION OF DIACYLGLYCEROL ACYLTRANSFERASE 2 EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of diacylglycerol acyltransferase 2. The compositions comprise oligonucleotides, targeted to nucleic acid encoding diacylglycerol acyltransferase 2. Methods of using these compounds for modulation of diacylglycerol acyltransferase 2 expression and for diagnosis and treatment of diseases and conditions associated with expression of diacylglycerol acyltransferase 2 are provided. | 05-16-2013 |
20130123332 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF MYLIP/IDOL GENE - The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the Mylip/Idol gene, and methods of using such dsRNA compositions to inhibit expression of Mylip/Idol. | 05-16-2013 |
20130123333 | Nucleic Acid Functionalized Nanoparticles for Therapeutic Applications - Materials and methods for regulating gene expression using nanoparticles functionalized with antisense oligonucleotides are provided. | 05-16-2013 |
20130123334 | NOVEL SIRNA STRUCTURES - The invention relates to siRNA compounds possessing novel sequences and structural motifs which down-regulate the expression of specific human genes. The invention also relates to pharmaceutical compositions comprising such compounds and a pharmaceutically acceptable carrier. The present invention also provides a method of treating and/or preventing the incidence or severity of various diseases or conditions associated with the genes and/or symptoms associated with such diseases or conditions comprising administering to a subject in need of treatment for such disease or condition and/or symptom the compound or the pharmaceutical composition in a therapeutically effective dose so as to thereby treat the subject. | 05-16-2013 |
20130123335 | IDH1 AND IDH2 MUTATIONS IN CHOLANGIOCARCINOMA - This document relates to methods and materials involved in assessing isocitrate dehydrogenase 1 (IDH1) or isocitrate dehydrogenase 2 (IDH2) mutations in a mammal (e.g., human). For example, this document provides methods and materials for diagnosis, characterization, determining prognosis, and treatment of cholangiocarcinoma tumor in a mammal. | 05-16-2013 |
20130123336 | Polyplexes of Hydrophobically-Modified siRNA for Delivery of siRNA - The present invention provides compositions and methods for delivering nucleic acid molecules to a cell. | 05-16-2013 |
20130123337 | RNAi Inhibition of Serum Amyloid A For Treatment of Glaucoma - RNA interference is provided for inhibition of serum amyloid A mRNA expression in glaucomas involving SAA expression. | 05-16-2013 |
20130123338 | NOVEL CATIONIC LIPIDS AND METHODS OF USE THEREOF - The present invention provides compositions and methods for the delivery of therapeutic agents to cells. In particular, these include novel cationic lipids and nucleic acid-lipid particles that provide efficient encapsulation of nucleic acids and efficient delivery of the encapsulated nucleic acid to cells in vivo. The compositions of the present invention are highly potent, thereby allowing effective knock-down of a specific target protein at relatively low doses. In addition, the compositions and methods of the present invention are less toxic and provide a greater therapeutic index compared to compositions and methods previously known in the art. | 05-16-2013 |
20130123339 | COMPOSITIONS AND METHODS FOR SILENCING APOLIPOPROTEIN B - The present invention provides compositions and methods for the delivery of interfering RNAs such as siRNAs that silence APOB expression in cells such as liver cells. In particular, the nucleic acid-lipid particles provide efficient encapsulation of nucleic acids and efficient delivery of the encapsulated nucleic acid to cells such as liver cells in vivo. The compositions of the present invention are highly potent, thereby allowing effective knock-down of APOB at relatively low doses. In addition, the compositions and methods of the present invention are less toxic and provide a greater therapeutic index compared to compositions and methods previously known in the art. | 05-16-2013 |
20130123340 | COMPOSITIONS AND METHODS FOR THE TREATMENT AND PREVENTION OF CARDIAC ISCHEMIC INJURY - Disclosed herein are compositions and methods for the treatment and/or prevention of pathological conditions associated with ischemia/reperfusion injury and/or hypoxic injury of myocardial cell or tissue. | 05-16-2013 |
20130123341 | Methods, compositions and kits for diagnosing and treating Alzheimer's disease using mitochondrial CO3 gene mutations - Methods and kits are provided for diagnosing, prognosing and treating Alzheimer's disease (AD) by identifying heteroplasmic mitochondrial mutations in cytochrome c oxidase subunit 3 (CO3). The methods are efficient, economical, and rapid, for diagnosis, prognosis and subsequent early treatment of AD in subjects. | 05-16-2013 |
20130123342 | METHODS AND COMPOSITIONS FOR THE SPECIFIC INHIBITION OF KRAS BY ASYMMETRIC DOUBLE-STRANDED RNA - This invention relates to compounds, compositions, and methods useful for reducing KRAS target RNA and protein levels via use of Dicer substrate siRNA (DsiRNA) agents possessing asymmetric end structures. | 05-16-2013 |
20130123343 | Methods for Reverting Methylation by Targeting Methyltransferase and Compositions Useful Therefor - Methods for restoring a desired pattern of DNA methylation, inducing re-expression of methylation-silenced tumor suppressor genes (TSGs), and/or inhibiting tumorigenicity both in vitro and in vivo in a subject in need thereof by administering an effective amount of one or more miR-29s sufficient to target one or more of DNMT3A and DNMT3B are disclosed. | 05-16-2013 |
20130123344 | METHOD OF PREVENTING OR TREATING VIRAL INFECTION - Disclosed are compounds and pharmaceutical compositions containing compounds that inhibit JMJD2 proteins, including those of the formula (I): | 05-16-2013 |
20130123345 | METHOD OF TREATING A VIRAL INFECTION DYSFUNCTION BY DISRUPTING AN ADENOSINE RECEPTOR PATHWAY - Described herein is a method of treating a viral infection such as an influenza infection, in a subject comprising administering an effective amount of a pharmaceutical composition to disrupt a adenosine receptor pathway, such as the Aradenosine receptor pathway, in a subject. The adenosine receptor pathway includes the steps of 1) producing the adenosine precursor adenosine triphosphate (ATP), 2) releasing ATP into the extracel lular space, 3) enzymatic conversion of ATP to adenosine, 4) activation of the adenosine receptor and the adenosine receptor cascade, and 5) clearance of adenosine from the extracellular space by degradation or uptake into a cell. The method includes affecting at least one of these steps so as to decrease the activation of the adenosine receptor pathway. This may be accomplished by decreasing the production, release, or conversion of ATP to adenosine, decreasing the expression of the adenosine receptor, antagonizing adenosine receptor activation, and/or increasing adenosine clearance. | 05-16-2013 |
20130131139 | ROR1 AS A GENE TARGET IN ACUTE LYMPHOBLASTIC LEUKEMIA - Disclosed are methods of selecting a subject suspected of having or having leukemia, such as lymphoblast leukemia (B-ALL), for treatment with an agent that inhibits ROR1-regulated signaling activity. In some examples, cells obtained from the subject are screened for over expression of ROR1. In other examples, the cells are contacted with an agent that inhibits ROR1 signaling activity and a ROR1-regulated signaling activity is detected. An alteration in the ROR1-regulated signaling activity as compared to a control identifies the subject as one that would benefit from treatment with an agent that inhibits ROR1 signaling activity. Also disclosed are methods for identifying an agent for treating a subject with a ROR1-dependent leukemia or with a predisposition for developing a ROR1-dependent leukemia, and methods for treating or inhibiting a ROR1-dependent leukemia, such as B-ALL in a subject. | 05-23-2013 |
20130131140 | TREATMENT OF DIABETES AND DISORDERS ASSOCIATED WITH VISCERAL OBESITY WITH INHIBITORS OF HUMAN ARACHIDONATE 12 LIPOXYGENASE AND ARACHIDONATE 15-LIPOXYGENASE - A basis for understanding the arachidonate 12-lipoxygenase pathway, as well as and methods and kits for inhibiting the arachidonate 12-lipoxygenase pathway for the treatment, reversal, reduction, modulation or prevention of disease states and conditions related to type 1 or type 2 diabetes, are disclosed. Also disclosed are inflammatory forms of ALOX12 and 15, which are selectively expressed in omental adipose tissue of obese humans. Inhibitors of ALOX12 and 15 can be used to treat, prevent, modulate or reduce complications associated with increased visceral obesity and inflammation, including type 2 diabetes. Also disclosed are methods for developing selective ALOX inhibitors for treating or reducing complications associated with increased visceral obesity and inflammation. | 05-23-2013 |
20130131141 | REDUCED SIZE SELF-DELIVERING RNAI COMPOUNDS - The present invention relates to methods for in vivo administration of sd-rxRNA molecules. | 05-23-2013 |
20130131142 | RNA INTERFERENCE IN OCULAR INDICATIONS - The present invention relates to ocular administration of sd-rxRNA and rxRNAori molecules. | 05-23-2013 |
20130131143 | RTP801L SIRNA COMPOUNDS AND METHODS OF USE THEREOF - The invention provides chemically modified siRNA oligonucleotides that target RTP801L, compositions comprising same and to the use of such molecules to treat, inter alia, respiratory diseases including acute and chronic pulmonary disorders, eye diseases including glaucoma and ION, microvascular disorders, angiogenesis- and apoptosis-related conditions, and hearing impairments. | 05-23-2013 |
20130131144 | GDE Compositions and Methods - The present invention relates to compositions to treat glycerophosphodiester phosphodiesterase (GDE) related disorders. The invention also relates to methods treating GDE related disorders. The invention further relates to kits for treating GDE related disorders in a subject. The invention further relates to methods of identifying novel treatments for treating GDE related disorders in a subject. | 05-23-2013 |
20130131145 | COMPOSITIONS AND METHODS FOR ALTERING RNAi - The present invention relates to compositions and methods for altering (e.g., enhancing) RNAi. In particular, the present invention provides systems and methods for identifying regulators of RNAi. For example, the present invention provides RNAi regulators (e.g., HPS1 and HPS4) and methods of altering (e.g., inhibiting) these regulators in order to alter (e.g., enhance) RNAi. The present invention also provides methods of identifying inhibitors (e.g., small molecule, nucleic acid (e.g., siRNA), and antibody) of RNAi regulators and methods of using the same (e.g., to enhance RNAi). Compositions and methods of the present invention find use in research (e.g., functional genomics), therapeutic (e.g., drug discovery and delivery) and clinical applications. | 05-23-2013 |
20130131146 | Compositions and Methods for Treating Pulmonary Conditions - The present invention relates to the role of cystic fibrosis transmembrane conductance regulator (CFTR) in pulmonary conditions. In one embodiment, a method for assessing the severity of lung damage from a pulmonary condition in a subject comprises the steps of (a) measuring the level and/or functional activity of membrane/lipid-raft cystic fibrosis transmembrane conductance regulator (CFTR)in a sample from the subject; (b) measuring the level of ceramide or its species in a sample from the subject; and (c) comparing the membrane/lipid- raft CFTR level and/or functional activity and ceramide level to a control sample, wherein a difference in membrane/lipid-raft CFTR level and/or functional activity and ceramide level is indicative of the severity of lung damage. The method can further comprise treating the subject based on the severity of lung damage. In particular embodiments, the treatment comprises administering a CFTR agonist and/or an agent that inhibits the synthesis of ccramide or its species. | 05-23-2013 |
20130131147 | SUBSTITUTED 2'-AMINO AND 2'-THIO-BICYCLIC NUCLEOSIDES AND OLIGOMERIC COMPOUNDS PREPARED THEREFROM - Provided herein are 2′-amino and 2′-thio bicyclic nucleosides and oligomenc compounds prepared therefrom. The novel bicyclic nucleosides provided herein are expected to be useful for enhancing one or more properties of the oligomeric compounds they are incorporated into such as nuclease resistance. | 05-23-2013 |
20130131148 | MICRO-RNA FOR CANCER DIAGNOSIS, PROGNOSIS AND THERAPY - The present invention relates to polymorphic binding sites for micro-RNA and to micro-RNA-based cancer diagnosis, cancer therapy and personalized medicine. In particular, the present invention relates to diagnosis, therapy and personalized medicine with the specific miR-515-5p molecule. | 05-23-2013 |
20130131149 | METHODS AND COMPOSITIONS FOR THE SPECIFIC INHIBITION OF ANDROGEN RECEPTOR BY DOUBLE-STRANDED RNA - This invention relates to compounds, compositions, and methods useful for reducing AR target RNA and protein levels via use of dsRNAs, e.g., Dicer substrate siRNA (DsiRNA) agents. | 05-23-2013 |
20130131150 | Antisense Formulation - A room temperature stable and minimal aggregate liquid formulation comprises an oligonucleotide comprising Seq ID No. 1: or comprising a variant oligonucleotide in which no more than 3 non-sequential bases are different from Seq. ID NO. 1 and an aqueous carrier comprising a aggregation-preventing compound selected from the group consisting of mono and disaccharides and/or sugar alcohols. | 05-23-2013 |
20130137747 | DOUBLE-STRANDED RNA-BASED NANOPARTICLES FOR INSECT GENE SILENCING - Nanoparticles for insect RNAi via oral delivery are provided, along with methods of silencing a target gene in a target insect using RNAi are provided. The nanoparticles comprise a polymer matrix and insect dsRNA. The dsRNA comprises at least one sequence having a region of complementarity substantially complementary to at least a portion of an mRNA transcript of the target gene. Insect baits comprising the nanoparticles are also provided. Methods of screening target gene functions are also provided using the methods disclosed herein. | 05-30-2013 |
20130137748 | WHSC1 AND WHSC1L1 FOR TARGET GENES OF CANCER THERAPY AND DIAGNOSIS - Objective methods for diagnosing a predisposition to developing cancer, for example, bladder cancer, breast cancer, cholangiocellular carcinoma, CML, esophageal cancer, HCC, NSCLC, SCLC, osteosarcoma, pancreatic cancer, prostate cancer, renal cell carcinoma, soft tissue tumor and lymphoma, are described herein. In one embodiment, the diagnostic method involves determining an expression level of a WHSC1 or WHSC1L1 gene. The present invention further provides methods of screening for therapeutic agents useful in the treatment of WHSC1 or WHSC1L1 associated disease, such as a cancer, e.g., bladder cancer, breast cancer, cholangiocellular carcinoma, CML, esophageal cancer, HCC, NSCLC, SCLC, osteosarcoma, pancreatic cancer, prostate cancer, renal cell carcinoma, soft tissue tumor and lymphoma. The present invention further provides methods of inhibiting the cell growth and treating or alleviating symptoms of WHSC1 or WHSC1L1 associated diseases. The present invention also features products, including double-stranded molecules and vectors encoding thereof as well as to compositions including them. Also, disclosed are methods of identifying substances for treating or/and preventing lung cancer, using as an index their effect on expression of a WHSC1 or WHSC1L1 gene, or a biological activity of a WHSC1 or WHSC1L1 polypeptide. | 05-30-2013 |
20130137749 | Compositions and Methods for Gene Silencing - Compositions and methods for modulating the expression of a protein of interest are provided. | 05-30-2013 |
20130137750 | DOUBLE STRANDED RNA COMPOUNDS TO RHOA AND USE THEREOF - The present invention relates to compounds, pharmaceutical compositions comprising same, methods of use thereof and kits for the down-regulation of RhoA gene. The compounds, compositions, methods and kits are useful in the treatment of subjects suffering from diseases or conditions and or symptoms associated with diseases or conditions in which RhoA expression has adverse consequences and for conferring neuroprotection. | 05-30-2013 |
20130137751 | TREATMENT OF GLIAL CELL DERIVED NEUROTROPHIC FACTOR (GDNF) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO GDNF - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Glial cell derived neurotrophic factor (GDNF), in particular, by targeting natural antisense polynucleotides of Glial cell derived neurotrophic factor (GDNF). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of GDNF. | 05-30-2013 |
20130137752 | RNA Interference Mediated Inhibition of Catenin (Cadherin-Associated Protein), Beta 1 (CTNNB1) Gene Expression Using Short Interfering Nucleic Acid (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of CTNNB1 gene expression and/or activity, and/or modulate a beta-catenin gene expression pathway. Specifically, the invention relates to double-stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules that are capable of mediating or that mediate RNA interference (RNAi) against CTNNB1 gene expression. | 05-30-2013 |
20130137753 | METHODS AND COMPOSITIONS FOR THE DIAGNOSIS AND TREATMENT OF BREAST CANCER - Embodiments of the present disclosure relate to methods and compositions for the diagnosis and treatment of breast cancer. In some embodiments, the present disclosure relates to the use of Merlin, OPN and particular microRNAs for evaluating the presence of breast cancer in a subject and for identifying therapeutic compounds. | 05-30-2013 |
20130143943 | MODULATION OF GLUCOCORTICOID RECEPTOR EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of glucocorticoid receptor. The compositions comprise oligonucleotides, targeted to nucleic acid encoding glucocorticoid receptor. Methods of using these compounds for modulation of glucocorticoid receptor expression and for diagnosis and treatment of diseases and conditions associated with expression of glucocorticoid receptor are provided. | 06-06-2013 |
20130143944 | CHEMO- AND RADIATION-SENSITIZATION OF CANCER BY ANTISENSE TRPM-2 OLIGODEOXYNUCLEOTIDES - Administration of antisense oligodeoxynucleotides (ODN) targeted against the testosterone-repressed prostate message-2 (TRPM-2) gene can reduce the amount of TRPM-2 in renal cell cancer (RCC) cells and other cancer cells, and as a result enhance chemosensitivity of these cells to chemotherapy agents and radiation. Thus, for example, the sensitivity of renal cell cancer cells to a chemotherapeutic agent can be increased by exposing renal cell cancer cells to a chemotherapeutic agent and an agent which reduces the amount of TRPM-2 in the renal cell cancer cells. This provides an improved method for treatment of renal cell cancer, which is generally resistant to treatment with known chemotherapy agents. | 06-06-2013 |
20130143945 | METHODS AND COMPOSITIONS INVOLVING MIRNA AND MIRNA INHIBITOR MOLECULES - The present invention concerns methods and compositions for introducing miRNA activity or function into cells using synthetic nucleic acid molecules. Moreover, the present invention concerns methods and compositions for identifying miRNAs with specific cellular functions that are relevant to therapeutic, diagnostic, and prognostic applications wherein synthetic miRNAs and/or miRNA inhibitors are used in library screening assays. | 06-06-2013 |
20130143946 | TREATMENT OF DISCS LARGE HOMOLOG (DLG) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO DLG - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Discs large homolog (DLG), in particular, by targeting natural antisense polynucleotides of Discs large homolog (DLG). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of DLG. | 06-06-2013 |
20130143947 | Injectable Pharmaceutical Composition for Preventing, Stabilising and/or Inhibiting Pathological Neovascularization-Related Conditions - This invention relates to a pharmaceutical composition for the treatment and/or prevention of at least one pathological neovascularization-related conditions of the interior of the eye, the composition comprising a therapeutically effective amount of an antisens oligonucleotide having the sequence SEQ ID NO: 1: 5′-TCTCCGGAGGGCTCGCCATGCTGCT-3′ or any function conservative sequence comprising from 9 to 30 nucleotides that has 75%, 80%, 85%, 90%, 95% or more than 95%, 96%, 97%, 98%, 99% of identity compared to SEQ ID NO: 1 and that conserves the capacity of inhibiting IRS-1 gene expression as SEQ ID NO: 1, and the composition being administered within the posterior segment of the eye to a subject in need thereof; this invention also relates to a method for treating a pathological neovascularization-related condition of the interior of the eye in a subject in need thereof comprising administering to the subject a therapeutically effective amount of said pharmaceutical composition. | 06-06-2013 |
20130143948 | MST1 AS A PROGNOSTIC BIOMARKER AND THERAPEUTIC TARGET IN HUMAN CANCER - The present invention relates to MST1 and MST2 cancer biomarkers. The inventors demonstrate herein that MST1 and/or MST2 can be used as biomarkers for the detection and prognosis of prostate cancer. The invention further discloses that enforced expression of MST1 can be used to inhibit and/or suppress the progression of prostate cancer. | 06-06-2013 |
20130150425 | ANTISENSE MODULATION OF GCCR EXPRESSION - Provided herein are methods, compounds, and compositions for reducing expression of GCCR mRNA and protein in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate metabolic disease, for example, diabetes, or a symptom thereof. | 06-13-2013 |
20130150426 | METHODS OF DIAGNOSING AND TREATING IDIOPATHIC PULMONARY FIBROSIS - Described herein are materials and methods for the diagnosis of idiopathic pulmonary fibrosis. | 06-13-2013 |
20130150427 | REGULATION OF METABOLISM BY MIR-378 - The present invention provides a method of regulating fatty acid metabolism in a cell by contacting the cell with a modulator of miR-378 and/or miR-378* activity or expression. The present invention also provides a method of treating or preventing a metabolic disorder, such as obesity, diabetes, or metabolic syndrome, in a subject by administering to the subject an inhibitor of miR-378 and/or miR-378* expression or activity. Methods of treating or preventing pathologic cardiac hypertrophy, cardiac remodeling, myocardial infarction, or heart failure in a subject by inhibiting the expression or activity of miR-378 and/or miR-378* in a subject are also disclosed. | 06-13-2013 |
20130150428 | MIR27B IS A NOVEL TARGET FOR TREATMENT OF LIVER FIBROSIS - Methods are provided for treating fibrosis of a tissue, including fibrosis of the liver, using combinations of antagomirs and/or locked nucleic acids. Compositions therefor are also provided. | 06-13-2013 |
20130150429 | P27KIP1 AS A MOLECULAR MARKER FOR SUITABILITY AND EFFICACY OF TREATMENT WITH HSP27 INHIBITORS - Cells expressingHsp27 exhibit reduced levels of p27kip1. Accordingly, a method for treatment of cancer using hsp27 inhibition that includes a preliminary test to ascertain the status of the p27kip1 in the target cells. In this test, a sample of cancerous tissue from the patient from the patient (including a human patient) and evaluated to determine an expression of level of functional p27kip1. In the case where the expression level of p27kip1 is below a threshold level, a therapeutic composition comprising as an active agent a composition effective to inhibit the expression or activity of hsp27 in administered to the patient. | 06-13-2013 |
20130150430 | Methods for Impairing the P53/HDM2 Auto-Regulatory Loop in Multiple Myeloma Development Using mIR-192, mIR-194 and mIR-215 - Methods and compositions for detecting, treating, characterizing, and diagnosing multiple myeloma are described. | 06-13-2013 |
20130150431 | MIR-33 INHIBITORS AND USES THEREOF - The miRNA miR-33 is shown to inhibit the expression of carnitine O-octaniltransferase (CROT), Carnitine palmitoyltransferase 1A (CPT1a) and hydroxyacyl-CoA-dehydrogenase (HADHB), reduce fatty acid oxidation in hepatic cells, and target the insulin receptor substrate 2 (IRS-2) independent of its ability to elevating plasma high density lipoprotein (HDL) levels. MiR-33 inhibitors are also shown to increase cholesterol efflux from peripheral cells, such as cholesterol-laden macrophages present in atherosclerotic plaques. Compositions and methods are therefore provided for treating or preventing metabolic syndrome and atherosclerosis using miR-33 inhibitors. The miR-33 inhibitors are preferably antagomirs having a single-stranded nucleic acid sequence that is complementary to at least 12 contiguous nucleotides in miR-33 and therefore forms a duplex with miR-33 under physiological conditions. | 06-13-2013 |
20130158095 | EML4-ALK FUSION GENE - The present inventors found that a fusion gene present in some cancer patients is an oncogene. The present invention relates to a polypeptide as a novel fusion protein, a polynucleotide encoding the polypeptide, a vector comprising the polynucleotide, a transformed cell comprising the vector, a method for detecting the fusion protein or polynucleotide, a method for screening a therapeutic agent for cancer, and a method for treating cancer that is shown to be positive for the fusion gene. Further, the present invention relates kit, primer set, and probe useful in the detection of cancer that is shown to be positive for the fusion gene. | 06-20-2013 |
20130158096 | MIRNAS INVOLVED IN THE BLOOD BRAIN BARRIER FUNCTION - The current invention relates to use of particular nucleic acids for modulating (increasing or decreasing) blood-brain barrier function, and for use of such nucleic acids in treatment of conditions involving blood brain barrier function, including multiple sclerosis, HIV infection, Alzheimer's disease, Parkinson's disease, epilepsy, and so on. Also provided is an assay for identifying drugs useful in modulating blood brain barrier function. | 06-20-2013 |
20130158097 | COMPOSITIONS AND METHODS DIRECTED TO TREATING LIVER FIBROSIS - The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the COL1A1, TGF-β, and SMAD2/3 genes, and methods of using such dsRNA compositions to inhibit expression of COL1A1, TGF-β, and SMAD2/3. | 06-20-2013 |
20130158098 | Alkenyl Substituted Cycloaliphatic Compounds as Chemical Inducers of Proximity - Methods of inducing proximity of chimeric molecules in a cell are provided. Aspects of the methods include contacting a cell with an amount of alkenyl substituted cycloaliphatic (ASC) inducer compound, e.g., abscisic acid, effective to induce proximity of first and second chimeric molecules. Also provided are compositions and kits for practicing various embodiments of the methods. Methods of the invention find use in a variety of different applications, including transcription induction applications. | 06-20-2013 |
20130158099 | Methods for Identifying Agents that Inhibit Cell Migration, Promote Cell Adhesion and Prevent Metastasis - Disclosed are methods for identification of agents that modulate cell attachment, cell migration and cell viability. Cancer and primary cells adhered to a matrix are treated with agent(s) that modulate ActRII signaling and cell adhesion. Agents are tested that modulate cell adhesion, detachment, invasion and viability. Agents that modulate the expression, phosphorylation, function and translocation of ActRII signaling pathway members also can predict agents that modulate cell adhesion, detachment, invasion and viability. The methods have utility in identifying agents that prevent cancer cell metastasis, wound dehiscence, aortic dissection and aid retina attachment and skin replacement and fertility. | 06-20-2013 |
20130158100 | INTRACELLULAR DNA RECEPTOR - Provided herein are methods of identifying and using compounds that modulate an AIM2 polypeptide-mediated immune response. Further provided herein are methods of treating disease comprising administering to a patient a compound that decreases expression of an AIM2 polypeptide. Further provided herein are methods of providing gene therapy to a patient comprising administering to the patient a gene therapy agent and a compound that decreases expression of an AIM2 polypeptide. In certain embodiments, a compound that decreases expression of an AIM2 polypeptide comprises an siRNA or an shRNA. | 06-20-2013 |
20130158101 | REGULATORS OF NFAT AND/OR STORE-OPERATED CALCIUM ENTRY - Embodiments of the inventions relate to modulating NFAT activity, modulating store-operated Ca | 06-20-2013 |
20130158102 | Compositions and Methods for Inhibiting Expression of a Gene from the JC Virus - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a gene from the JC Virus (JC virus genome), comprising an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of a gene from the JC Virus. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by JC virus expression and the expression of a gene from the JC Virus using the pharmaceutical composition; and methods for inhibiting the expression of a gene from the JC Virus in a cell. | 06-20-2013 |
20130165496 | COMPOUNDS AND METHODS FOR MODULATING EXPRESSION OF GCCR - The present disclosure describes short antisense compounds, including such compounds comprising chemically-modified high-affinity monomers 8-16 monomers in length. Certain such short antisense compound are useful for the reduction of target nucleic acids and/or proteins in cells, tissues, and animals with increased potency and improved therapeutic index. Thus, provided herein are short antisense compounds comprising high-affinity nucleotide modifications useful for reducing a target RNA in vivo. Such short antisense compounds are effective at lower doses than previously described antisense compounds, allowing for a reduction in toxicity and cost of treatment. In addition, the described short antisense compounds have greater potential for oral dosing. | 06-27-2013 |
20130165497 | MONITORING OF IMMUNE SYSTEM USING PERIPHERAL BLOOD MICRO-RNA EXPRESSION PROFILE ANALYSIS AND USES THEREOF - The present invention relates to a method for monitoring the immune system of an individual, which comprises measuring, preferably by quantitative RT-PCR, the expression level of at least one microRNA (miRNA) gene product in a peripheral blood sample or in a biological fluid sample, and comparing said measured expression level with a reference level. In particular, the at least one miRNA gene product, which the method of the invention measures, is expressed by lymphocyte populations of an individual, in particular by naive CD4+T, TH1, TH2 and TH17 lymphocytes. The method of the invention is useful for the diagnosis, prognosis, prevention, control and/or the treatment of a pathological condition caused by or associated with an immune system dysfunction. Moreover, the method of the present invention is useful for monitoring, in an individual, the evolution of conditions mediated by the immune system, such as the response to a vaccination. | 06-27-2013 |
20130165498 | INVERTEBRATE MICRORNAS - This invention provides plants having resistance to invertebrate pests. More specifically, this invention discloses a non-natural transgenic plant cell expressing at least one invertebrate miRNA in planta for suppression of a target gene of an invertebrate pest or of a symbiont associated with the invertebrate pest. Also provided are recombinant DNA constructs for expression of at least one invertebrate miRNA in planta, a non-natural transgenic plant containing the non-natural transgenic plant cell of this invention, a non-natural transgenic plant grown from the non-natural transgenic plant cell of this invention, and non-natural transgenic seed produced by the non-natural transgenic plants, as well as commodity products produced from a non-natural transgenic plant cell, plant, or seed of this invention. This invention further provides a method of suppressing at least one target gene of an invertebrate pest of a plant or of a symbiont associated with the invertebrate, including providing a plant including the non-natural transgenic plant cell of this invention, wherein the invertebrate is the invertebrate pest, the recombinant DNA is transcribed in the non-natural transgenic plant cell to the recombinant miRNA precursor, and when the invertebrate pest ingests the recombinant miRNA precursor, the at least one target gene is suppressed. | 06-27-2013 |
20130165499 | Methods And Compositions For Prevention Or Treatment Of RSV Infection - Methods and compositions are provided for the prevention or treatment of RSV infection in a human. The methods include administering one or more doses of a composition comprising an siRNA. The dose can be formulated for topical or parenteral administration. Topical administration includes administration as a nasal spray, or by inhalation of respirable particles or droplets. | 06-27-2013 |
20130165500 | RNA Interference Mediated Inhibition of Prolyl Hydroxylase Domain 2 (PHD2) Gene Expression Using Short Interfering Nucleic Acid (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond expressed/synthetic to the modulation of PHD2 gene expression and/or activity, and/or modulate a beta-catenin gene expression pathway. Specifically, the invention relates to double-stranded nucleic acid molecules including small nucleic acid molecules, such as short inter-fering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsR-NA), micro-RNA (miRNA), and short hair-pin RNA (shRNA) molecules that are capa-ble of mediating or that mediate RNA inter-ference (RNAi) against PHD2 gene expres-sion. | 06-27-2013 |
20130172399 | SELECTIVE INHIBITION OF POLYGLUTAMINE PROTEIN EXPRESSION - The present invention relates to the selective inhibition of protein expression of CAG repeat-related disease proteins such as Huntingtin Disease Protein and Ataxin-3 using double-stranded RNAs and nucleic acid analogs. Chemically-modified RNAs having at least one mismatch as compared to the target CAG repeat sequence are specifically contemplated. | 07-04-2013 |
20130172400 | CANCER CELL IDENTIFICATION MARKER AND CANCER CELL PROLIFERATION INHIBITOR - Disclosed is an identification marker which can be utilized for detection of various human cancer cells and whose expression closely relates to malignant alteration of cells, and compositions for human cancer treatment which are based on suppression of cancer cell proliferation through inhibition of expression of the identification marker. The marker is human heterochromatin protein 1γ (HP1γ), and the compositions for cancer treatment comprises one or more agents which suppresses the expression of human HP1γ gene, such as siRNAs to human HP1γ. | 07-04-2013 |
20130172401 | COMPOSITION FOR REGENERATING NORMAL TISSUE FROM FIBROTIC TISSUE - The present invention relates to a pharmaceutical composition and a method for regenerating normal tissue from fibrotic tissue, the pharmaceutical composition and the method employing a collagen-reducing substance. In accordance with the present invention, normal tissue can be therapeutically regenerated from fibrotic tissue. | 07-04-2013 |
20130172402 | OLIGONUCLEOTIDE, AND THERAPEUTIC AGENT FOR DYSLIPIDEMIA CONTAINING OLIGONUCLEOTIDE AS ACTIVE INGREDIENT - An object of the present invention is to provide an oligonucleotide useful as a therapeutic agent for dyslipidemia that has excellent binding affinity to the PCSK9 gene as well as stability and safety. The oligonucleotide of the present invention contains a sugar-modified nucleoside, the sugar-modified nucleoside has a bridging structure between 4′-position and 2′-position, and the oligonucleotide can bind to the human PCSK9 gene. Also, the present invention provides a therapeutic agent for dyslipidemia containing the oligonucleotide as an active ingredient, and the therapeutic agent preferably contains a bioabsorbable material as a carrier. The bioabsorbable material is preferably atelocollagen or peptide gel. | 07-04-2013 |
20130178510 | CONNECTIVE TISSUE GROWTH FACTOR ANTISENSE OLIGONUCLEOTIDES - The present invention relates to antisense oligonucleotides that target human CTGF mRNA and inhibit CTGF mRNA expression. Additionally, regions of human CTGF mRNA that are exceptionally sensitive to antisense inhibition are disclosed. Pharmaceutical compositions comprising the antisense oligonucleotides are further disclosed. These compositions are useful for treating disorders and conditions that are associated with or influenced by CTGF expression. | 07-11-2013 |
20130178511 | SILENCING OF CSN5 GENE EXPRESSION USING INTERFERING RNA - The present invention provides compositions comprising nucleic acids that target CSN5 gene expression and methods of using such compositions to silence CSN5 gene expression. More particularly, the present invention provides unmodified and chemically modified interfering RNA molecules which silence CSN5 gene expression and methods of use thereof, e.g., for treating cell proliferative disorders such as cancer. The present invention also provides nucleic acid-lipid particles that target CSN5 gene expression comprising an interfering RNA molecule, a cationic lipid, a non-cationic lipid, and optionally a conjugated lipid that inhibits aggregation of particles. | 07-11-2013 |
20130178512 | CARBOHYDRATE CONJUGATES AS DELIVERY AGENTS FOR OLIGONUCLEOTIDES - The present invention provides iRNA agents comprising at least one subunit of the formula (I): | 07-11-2013 |
20130178513 | MODULATION OF EIF4E EXPRESSION - Oligomeric compounds, compositions and methods are provided for modulating the expression of eIF4E. The antisense compounds may be single- or double-stranded and are targeted to nucleic acid encoding eIF4E. Methods of using these compounds for modulation of eIF4E expression and for diagnosis and treatment of diseases and conditions associated with expression of eIF4E are provided. | 07-11-2013 |
20130178514 | Use of miR-29 for Cell protection - The present invention relates to the regulation of apoptosis and expression of the BH3-only family of genes by miR-29. The invention further relates to the use of miR-29 to protect cells from apoptosis and to treat disorders associated with apoptosis. | 07-11-2013 |
20130184324 | Dual Targeting siRNA Agents - The invention relates to dual targeting siRNA agents targeting a PCSK9 gene and a second gene, and methods of using dual targeting siRNA agents to inhibit expression of PCSK.9 and to treat PCSK.9 related disorders, e.g., hyperlipidemia. | 07-18-2013 |
20130184325 | TREATMENT OF HEPATOCYTE GROWTH FACTOR (HGF) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO HGF - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Hepatocyte Growth Factor (HGF), in particular, by targeting natural antisense polynucleotides of Hepatocyte Growth Factor (HGF). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of HGF. | 07-18-2013 |
20130184326 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF FACTOR VII GENE - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the Factor VII gene. | 07-18-2013 |
20130184327 | CELL GROWTH INHIBITOR AND SCREENING METHOD THEREOF - An object is to provide a cell growth inhibitor also effective for androgen-independent prostate cancer. The present invention provides a cell growth inhibitor having, as an active ingredient, an expression inhibitor or function inhibitor of an antisense RNA (CTBP1-AS) expressed in the vicinity of an androgen receptor (AR) binding site of a C-terminal binding protein (CTBP1) gene. | 07-18-2013 |
20130184328 | LIGAND-CONJUGATED MONOMERS - This invention relates composition and methods for making and using chemically modified oligonucleotides agents for inhibiting gene expression. | 07-18-2013 |
20130184329 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF MUTANT EGFR GENE - The invention relates to a double-stranded ribonucleic acid (dsRNA) targeting a mutant Epidermal Growth Factor Receptor (EGFR), and methods of using the dsRNA to inhibit expression of mutant EGFR. | 07-18-2013 |
20130184330 | COMPOSITIONS AND METHODS FOR INDUCING CANCER CELL DEATH - Described herein are pharmaceutical compositions including a sugar or mannose analog (e.g., 2-DG) and an inhibitor of at least one of PERK and GCN2 (e.g., an inhibitor of PERK and an inhibitor of GCN2) for treating cancer, and methods of treating cancer in a subject involving administration of these pharmaceutical compositions. Pharmaceutical compositions [or inducing death of cancer cells include a therapeutically effective amount of a pharmaceutical composition including: a pharmaceutically acceptable carrier, a sugar analog in an amount effective for inhibiting the growth of cancer cells, and an inhibitor of at least one of: PERK and GCN2 in an amount effective for blocking phosphorylation of eif2-1″t in the cancer cells, wherein the combined amounts of the sugar analog and the inhibitor of at least one of: PERK and GCN2 are sufficient for inducing death of the cancer cells. | 07-18-2013 |
20130184331 | TREATMENT OF NEURODEGENERATIVE DISEASES BY TARGETING MIRNA - The present invention relates to a pharmaceutical composition for preventing or treating neurodegenerative diseases by targeting a specific miRNA. In addition, the present invention relates to a kit for diagnosing neurodegenerative diseases. A miR-206 target found in the present invention, which is highly expressed in both animal models of Alzheimer's disease and human brain samples, is a substantial treatment target selected without artifact errors. An antisense oligonucleotide of the present invention as an inhibitor for miR-206 suggests a successful result in treatment of neurodegenerative diseases by targeting miRNA. The antisense oligonucleotide of the present invention inhibits the function of miR-206 to greatly increase the levels of BDNF and IGF-1 and to increase the regeneration of synapses, thereby treating neurodegenerative diseases, particularly Alzheimer's disease. | 07-18-2013 |
20130190379 | SMALL RNA MOLECULES, PRECURSORS THEREOF, MEANS AND METHODS FOR DETECTING THEM, AND USES THEREOF IN TYPING SAMPLES - The invention is related to small RNA molecules, precursors thereof and methods for detecting such molecules. The invention is in particular concerned with differentially expressed small RNA molecules and precursors thereof. Various collections of small RNA molecules, precursors thereof and collections of probe and primers that can be used to detect small RNA molecules, precursors thereof are provided. Further provided are diagnostic test based on this differential expression. Also provided are therapeutic applications using one or more of the members of the presented collections. | 07-25-2013 |
20130190380 | ANTISENSE OLIGONUCLEOTIDES DIRECTED AGAINST CONNECTIVE TISSUE GROWTH FACTOR AND USES THEREOF - This invention provides compounds which comprise modified oligonucleotides capable of inhibitory expression of connective tissue factor and composition containing same as well as methods of treating hyperprolific disorders and fibrotic diseases, and of reducing scarring resulting from wound healing using such compounds. | 07-25-2013 |
20130190381 | INHIBITORS OF LONG AND VERY LONG CHAIN FATTY ACID METABOLISM AS BROAD SPECTRUM ANTI-VIRALS - The present invention provides methods and compounds for treating viral infections using modulators of host cell enzymes relating to long chain fatty acid and lipid droplet metabolism. It includes a method of treating viral infections using triacsin C and its relatives, analogues and derivatives as well as other inhibitors of long chain fatty acid metabolism and lipid droplet metabolism. | 07-25-2013 |
20130190382 | METHODS FOR INHIBITING EXPRESSION OF CONNECTIVE TISSUE GROWTH FACTOR - This invention provides compounds which comprise modified oligonucleotides capable of inhibitory expression of connective tissue factor and composition containing same as well as methods of treating hyperprolific disorders and fibrotic diseases, and of reducing scarring resulting from wound healing using such compounds. | 07-25-2013 |
20130190383 | NUCLEIC ACID COMPOUNDS WITH CONFORMATIONALLY RESTRICTED MONOMERS AND USES THEREOF - This disclosure provides single-stranded and multi-stranded nucleic acid compounds having one or more double-stranded regions that regulate the function or expression of nucleic acid molecules expressed in a cell or a cell regulatory system dependent upon a nucleic acid. The disclosure provides a range of nucleic acid compounds having one or more conformationally restricted nucleomonomers (CRN). Certain nucleic acid compounds may have one or more conformationally restricted nucleomonomers and one or more hydroxymethyl substituted nucleomonomers (UNA). The nucleic acid compounds are useful in various therapeutic modalities. | 07-25-2013 |
20130190384 | MODULATION OF FACTOR 11 EXPRESSION - Disclosed herein are antisense compounds and methods for decreasing Factor 11 and treating or preventing thromboembolic complications in an individual in need thereof. Examples of disease conditions that can be ameliorated with the administration of antisense compounds targeted to Factor 11 include thrombosis, embolism, and thromboembolism, such as, deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke. Antisense compounds targeting Factor 11 can also be used as a prophylactic treatment to prevent individuals at risk for thrombosis and embolism. | 07-25-2013 |
20130190385 | METHOD FOR MODULATING DOUBLE-STRAND BREAK-INDUCED HOMOLOGOUS RECOMBINATION - The present invention concerns a method for modulating double-strand break-induced homologous recombination through the identification of effectors that modulate said double-strand break-induced homologous recombination by uses of interfering agents; these agents are capable of modulating double-strand break-induced homologous recombination through their respective actions on said effectors. The present invention also concerns the uses of these effectors and interfering agents and derivatives, respectively, by introducing them in an eukaryotic cell in order to modulate and more particularly to increase double-strand break-induced homologous recombination and gene targeting efficiency. The present invention also relates to specific derivatives of identified effectors and interfering agents, vectors encoding them, compositions and kits comprising such derivatives in order to modulate and more particularly to increase double-strand break-induced homologous recombination and gene targeting efficiency. | 07-25-2013 |
20130190386 | Breast Cancer Biomarker Signatures for Invasiveness and Prognosis - MicroRNA profiles transition from normal breast to ductal carcinoma in situ and transition to invasive ductal carcinoma (IDC) and methods of use thereof are described. Methods of diagnosis and prognosis using microRNA signatures to differentiate invasive from in situ carcinoma are described. Also described is the use of microRNA expression for predicting overall survival and time to metastasis. | 07-25-2013 |
20130190387 | TREATMENT OR PREVENTION OF OTO-PATHOLOGIES BY INHIBITION OF PRO-APOPTOTIC GENES - The invention relates to one or more inhibitors, in particular siRNAs, which down-regulate the expression of human pro-apoptotic genes. The invention also relates to a pharmaceutical composition comprising the compound, or a vector capable of expressing the compound, and a pharmaceutically acceptable carrier. The present invention also contemplates a method of treating or preventing the incidence or severity of hearing impairment (or balance impairment), particularly hearing impairment associated with cell death of the inner ear hair cells or outer ear hair cells, comprising administering to the patient the pharmaceutical composition in a therapeutically effective dose so as to thereby treat the patient. | 07-25-2013 |
20130190388 | Methods and Compositions Related to DLK-1 and the P38 MAPK Pathway in Nerve Regeneration - Disclosed are compositions and methods for treating neurodegenerative disease. | 07-25-2013 |
20130190389 | Method For Producing Novel Hipsc By Means Of Mirna Introduction - A novel compound to induce a pluripotent stem cell is provided. A novel anti-malignant-tumor substance is provided. A pluripotent stem cell-inducing agent, including a single-stranded or double-stranded polynucleotide containing the base sequence shown in SEQ ID NO:41 or a base sequence including deletion, substitution, or addition of 1 to 3 bases in SEQ ID No: 41, in which the pluripotent stem cell-inducing agent induces a cell to become a pluripotent stem cell is provided. | 07-25-2013 |
20130190390 | MULTIPLE EXON SKIPPING COMPOSITIONS FOR DMD - Provided are antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon skipping, and methods of use thereof to treat muscular dystrophy. | 07-25-2013 |
20130197055 | INHIBITION OF PCSK9 THROUGH RNAI - The invention relates to various PCSK9 RNAi constructs with gene silencing activities, and uses thereof The construct has a double-stranded region of 19-49 nucleotides, preferably 25, 26, or 27 nucleotides, and preferably blunt-ended The construct has selective minimal modifications to confer an optimal balance of biological activity, toxicity, stability, and target gene specificity The sense strand may be modified such that the construct is not cleaved by Dicer or other RNAse III, and the entire length of the antisense strand is loaded into RISC In addition, the antisense strand may also be modified by 2′-O-methyl groups at the 2nd 5′-end nucleotide to greatly reduce off-target silencing The constructs of the invention largely avoid the interferon response and sequence-independent apoptosis in mammalian cells, exhibits better serum stability, and enhanced target specificity. | 08-01-2013 |
20130197056 | NOVEL BIOMARKERS AND TARGETS FOR OVARIAN CARCINOMA - Novel biomarkers and targets associated with ovarian cancer, particularly clear-cell carcinoma, endometrioid carcinoma, and uterine carcinoma, are disclosed. Mutations in genes encoding proteins that form part of the SWI/SNF chromatin remodelling protein complex, including ARID1A, or loss of expression of such proteins, including BAF250a, can be used to evaluate the likelihood endometriosis will progress or transform to cancer, to provide a prognosis for a patient with cancer, to assess whether conventional treatment is likely to be effective against a cancer, and/or in a synthetic lethal screen to identify novel targets and therapeutics for the treatment of cancer. | 08-01-2013 |
20130197057 | METHOD FOR REDUCING EXPRESSION OF DOWNREGULATED IN RENAL CELL CARCINOMA IN MALIGNANT GLIOMAS - The present invention relates to novel compositions and therapeutic methods for the treatment of cancer, in particular malignant glioma. The compositions include antisense oligonucleotides or RNAs or vectors encoding them which reduce expression of downregulated in renal cell carcinoma (DRR) in tumor cells, and inhibit malignant glioma cell invasion. | 08-01-2013 |
20130197058 | INHIBITING STRIATED MUSCLE ACTIVATOR OF RHO (STARS) TO IMPROVE GLYCEMIC CONTROL - Described are methods of improving glycemic control/improving insulin sensitivity by administering an inhibitor of Striated Muscle Activator of Rho Signaling (STARS) activity, and methods of identifying new compounds for use in the described methods of treatment. | 08-01-2013 |
20130197059 | INTEGRIN ANTAGONIST CONJUGATES FOR TARGETED DELIVERY TO CELLS EXPRESSING LFA-1 - The invention relates to compounds of formula I: | 08-01-2013 |
20130197060 | MICRORNA PATTERNS FOR THE DIAGNOSIS, PROGNOSIS AND TREATMENT OF MELANOMA - The present invention relates to methods for diagnosing, staging, prognosticating and treating melanoma based on evaluating the expression of specific patterns of oncogenic or suppressive microRNA (miR) molecules in a patient in need thereof. | 08-01-2013 |
20130197061 | AGENT FOR SUPPRESSING EXPRESSION OF DOMINANT MUTANT GENE - An RNAi molecule that can selectively and effectively suppress only the expression of a particular dominant mutant gene, while permitting the expression of the wild-type gene or a desired mutant gene, and a design method thereof is presented. | 08-01-2013 |
20130197062 | OLIGOMERIC COMPOUNDS COMPRISING TRICYCLIC NUCELOSIDES AND METHODS FOR THEIR USE - The present disclosure provides tricyclic nucleosides, oligomeric compounds comprising at least one of the tricyclic nucleosides and methods of using the oligomeric compounds. The methods provided herein include contacting a cell or administering to an animal at least one of the oligomeric compounds. In certain embodiments, the oligomeric compounds hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA. | 08-01-2013 |
20130197063 | USE OF A GROWTH-STIMULATING PROTEIN - This invention relates to the inhibition of a newly discovered growth-stimulating protein in an individual. Further, the invention relates to a method for preventing or treating a cancer, or preventing or treating cancer growth, invasion or metastasis, or preventing or treating other hyperproliferative diseases in an individual, by down regulating the expression of said growth-stimulating protein or by inactivating said protein. Still further, the invention concerns a method for diagnosing cancer or other hyperproliferative diseases in an individual based on said growth-stimulating protein. | 08-01-2013 |
20130203835 | INHIBITORY RNAS TO RNA BINDING PROTEINS HNRNPA1, HNRNPA2 AND PTB AND USES THEREOF - Provided herein are methods to reduce or slow down cell growth, for example in a cancer cell comprising contacting a cell with an effective amount of a combination of inhibitory RNA molecules targeting hnRNPA1, hnRNPA2 and PTB. Provided are methods to identify agents which reduce the levels of hnRNPA1, hnRNPA2 or PTB. Provided are methods to identify agents which increase ratio of PKM1/PKM2 proteins, or reduce PKM2 levels, or increase PKM1 levels. | 08-08-2013 |
20130203836 | 2' AND 5' MODIFIED MONOMERS AND OLIGONUCLEOTIDES - The present invention provides nucleosides of formula (1) and oligonucleotides comprising at least on nucleoside of formula (2):Formula (1) and Formula (2). Another aspect of the invention relates to a method of inhibiting the expression of a gene in call, the method comprising (a) contacting an oligonucleotide of the invention with the cell; and (b) maintaining the cell from step (a) for a time sufficient to obtain degradation of the mRNA of the target gene. | 08-08-2013 |
20130203837 | PREPARATION OF MICROVESICLE-siRNA COMPLEXES AND USE THEREOF IN AIDS TREATMENT - The present invention provides drugs for treating AIDS, which comprises microvesicles carrying anti-HIV specific siRNA. The present invention also provides a preparation method of the drug. | 08-08-2013 |
20130203838 | METHODS AND COMPOSITIONS FOR INHIBITION OF AXONAL DEGENERATION BY MODULATION OF THE DLK/JNK PATHWAY - Methods of reducing Wallerian degeneration are disclosed. These methods comprise inhibiting expression or activity of a mixed lineage kinase such as a dual leucine-zipper-bearing kinase (DLK), inhibiting expression or activity of a molecule acting downstream from DLK, such as a c-Jun N-terminal kinase (JNK), or a combination thereof. Further disclosed are methods of screening candidate compounds for DLK inhibition activity. These methods comprise providing a neuronal culture comprising a plurality of axons; contacting the culture with a candidate compound and with an axon degeneration-triggering agent; and comparing axonal degeneration in the culture to a control culture comprising the axon degeneration-triggering agent but not the candidate compound. | 08-08-2013 |
20130203839 | ANTISENSE OLIGONUCLEOTIDES (ODN) AGAINST SMAD7 AND USES THEREOF IN MEDICAL FIELD - The invention relates to antisense oligonucleotidic sequences (ODN) against Smad7 suitably modified, and their uses in medical field as therapeutic biological agents, in particular in the treatment of chronic inflammatory bowel disease, such as Crohn's disease and ulcerative colitis. | 08-08-2013 |
20130210887 | DENDRIMERS AS NON-VIRAL VEHICLES FOR GENE THERAPY - The present invention relates to novel compounds of general formula (I) and (II) for their use in gene therapy as non-viral vehicles and their use for the preparation of a medicament. It also discloses the process of synthesis of said compounds of general formula (I) and (II). | 08-15-2013 |
20130210888 | Histone Demethylation Mediated by the Nuclear Amine Oxidase Homolog LSD1 - LSD1, a homolog of nuclear amine oxidases, functions as a histone demethylase and transcriptional co-repressor. LSD1 specifically demethylates histone H3 lysine 4, which is linked to active transcription. Lysine demethylation occurs via an oxidation reaction that generates formaldehyde. Importantly, RNAi inhibition of LSD1 causes an increase in H3 lysine 4 methylation and concomitant de-repression of target genes, suggesting that LSD1 represses transcription via histone demethylation. The results thus identify a histone demethylase conserved from | 08-15-2013 |
20130210889 | COMPOSITION AND METHOD FOR INNER EAR SENSORY HAIR CELL REGENERATION AND REPLACEMENT - A composition and method for replacement and regeneration of hair cells of the inner ear is provided. The composition comprises an active agent in an amount effective to decrease Hes1 gene expression in a tissue of the inner ear. The active agent can be short interfering RNA (siRNA) molecules encapsulated in a biodegradable nanoparticle. The method involves administering a solution to the inner ear where the solution contains an active agent in an amount effective to decrease Hes1 gene expression. | 08-15-2013 |
20130210890 | CANCER THERAPY - The present invention provides agents useful in the treatment of cancer, as well as systems for identifying and/or characterizing such agents, and systems for identifying and/or characterizing patient populations responsive to particular agents. | 08-15-2013 |
20130210891 | PHARMACEUTICAL COMPOSITION FOR TRANSCOLONIC ABSORPTION - The present invention aims to provide a pharmaceutical composition for transcolonic absorption capable of delivering a physiologically active substance (in particular, a water-soluble physiologically active substance of high molecular weight) having an intracellular site of action into specific tissue cells with high specificity, noninvasively by a means of administration other than injection. The pharmaceutical composition for transcolonic absorption of the present invention is characterized by comprising at least the following (a) and (b); | 08-15-2013 |
20130210892 | Method of Treatment - A method of treating autoimmune and inflammatory diseases or conditions in a mammal, such as a human, which comprises the administration of a inhibitor of the bromodomain-containing protein: SP110 | 08-15-2013 |
20130210893 | TREATMENT OF INTERFERON-RELATED DEVELOPMENTAL REGULATOR 1 (IFRD1) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO IFRD1 - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Interferon-related developmental regulator 1 (IFRD1), in particular, by targeting natural antisense polynucleotides of Interferon-related developmental regulator 1 (IFRD1). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of IFRD1. | 08-15-2013 |
20130217749 | MODULATION OF PHOSPHOENOLPYRUVATE CARBOXYKINASE-MITCHONDRIAL (PEPCK-M) EXPRESSION - Provided herein are methods, compounds, and compositions for reducing expression of phosphoenolpyruvate carboxykinase-mitochondrial (PEPCK-M) mRNA and protein in an animal. Also provided herein are methods, compounds, and compositions for preventing or decreasing diabetes, obesity, metabolic syndrome, diabetic dyslipidemia, and/or hypertriglyceridemia in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate any one or more of diabetes, obesity, metabolic syndrome, diabetic dyslipidemia, and/or hypertriglyceridemia, or a symptom thereof. | 08-22-2013 |
20130217750 | Cell Growth Inhibitor and Screening Method Thereof - An object is to provide a cell growth inhibitor also effective for androgen-independent prostate cancer. The present invention provides a cell growth inhibitor having, as an active ingredient, an expression inhibitor or function inhibitor of PSF. | 08-22-2013 |
20130217751 | POLYNUCLEOTIDES FOR REDUCING RESPIRATORY SYNCYTIAL VIRUS GENE EXPRESSION - This invention pertains to polynucleotides, such as small interfering RNA (siRNA), useful for reducing the expression of respiratory syncytial virus (RSV) genes within a subject; and methods for treating a patient suffering from, or at risk of developing, an RSV infection by administering such polynucleotides to the subject. | 08-22-2013 |
20130217752 | METHOD OF DERIVING MATURE HEPATOCYTES FROM HUMAN EMBRYONIC STEM CELLS - A method for producing mature hepatocytes having functional hepatic enzyme activity from human pluripotent cells is disclosed. The method includes the step of transferring an external vector comprising the DNA sequence coding for a microRNA having the seed sequence of the microRNA miR-122, the DNA sequence coding for a microRNA having the seed sequence of the microRNA miR-let-7c, a microRNA having the seed sequence of the microRNA miR-122, a microRNA having the seed sequence of the microRNA miR-let-7c, or a combination thereof into one or more fetal hepatocytes. The resulting cells differentiate into mature hepatocytes that exhibit functional hepatic enzyme activity, and can be used in drug metabolism and toxicity testing, in the study of viruses that target hepatic tissue, and as therapeutics. | 08-22-2013 |
20130217753 | AMPHIPHILIC MACROMOLECULES FOR NUCLEIC ACID DELIVERY - The invention provides amphiphilic macromolecules that are useful for delivering nucleic acids to cells and that are useful as delivery agents for gene therapy. | 08-22-2013 |
20130217754 | PREVENTIVE OR THERAPEUTIC AGENT FOR FIBROSIS - Provided is siRNA effective for the treatment of fibrosis and a pharmaceutical containing the siRNA. An siRNA having a full length of 30 or fewer nucleotides and targeting a sequence consisting of 17 to 23 consecutive bases selected from the group consisting of bases at positions 1285 to 1318, bases at positions 1398 to 1418, bases at positions 1434 to 1463, bases at positions 1548 to 1579, bases at positions 1608 to 1628, bases at positions 1700 to 1726, bases at positions 1778 to 1798, bases at positions 1806 to 1826, and bases at positions 1887 to 1907 of SEQ ID NO: 1. | 08-22-2013 |
20130217755 | ANTISENSE OLIGONUCLEOTIDES FOR INDUCING EXON SKIPPING AND METHODS OF USE THEREOF - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202. | 08-22-2013 |
20130217756 | RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACIDS (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of gene expression and/or activity, and/or modulate a gene expression pathway. Specifically, the invention relates to double-stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA) molecules that are capable of mediating or that mediate RNA interference (RNAi) against target gene expression. | 08-22-2013 |
20130225651 | siRNA Compositions and Methods for Potently Inhibiting Viral Infection - No antiviral regimen has been consistently successful in treating H5N1 virus infection. We demonstrate that a group of highly effective siRNAs targeting different H5N1 viral genes shares a unique motif, GGAGU/ACUCC. We further demonstrate that the effectiveness of siRNAs containing this motif is not sequence specific. The results suggested that the structure of the unique motif is critical in determining the potency of siRNA-mediated protective effects against viral infection and this potent in vivo protection is associated with early productions of β-defensin and IL-6 induced by the motif. Provided are methods and prophylactic and therapeutic agents useful against other viral infections in addition to the H5N1 influenza virus. | 08-29-2013 |
20130225652 | SEGMENTED MICRO RNA MIMETICS - This invention relates generally to segmented oligonucleotides capable of modulating gene expression. Specifically, the instant invention relates to segmented microRNA (miRNA) oligonucleotides, including segmented miRNA precursors and segmented pre-microRNAs. The invention also relates to compositions comprising such segmented oligonucleotides, as well as to methods of making and using such oligonucleotides for diagnosis and treatment of diseases associated or causally linked to aberrant levels or activities of gene expression, including aberrant levels of coding and/or non-coding RNA. | 08-29-2013 |
20130225653 | MICRORNA-BASED SHORT HAIRPIN RNA FOR GENE KNOCKDOWN OF NR1 SUBUNIT OF N-METHYL-D-ASPARTATE RECEPTOR AND ITS APPLICATION ON PHARMACEUTICS - The present invention relates to a microRNA-based short hairpin RNA for gene silencing the genetic expression of NR1 subunit of N-methyl-D-aspartate receptor comprises a single strand RNA fragment comprising a first fragment, a second fragment and a connecting fragment, wherein the first fragment and the second fragment are complementary to each other, and are spaced and connected by the connecting fragment, with the connecting fragment being randomly arranged nucleotides, with the first fragment having a Drosha recognized cleavage site, a silencing site and a Dicer recognized cleavage site, with the Drosha recognized cleavage site and the Dicer recognized cleavage site being spaced and connected by the silencing site, with the silencing site encoding homologous nucleotides corresponding to NR1 subunit of subcutaneous N-methyl-D-aspartate receptor. | 08-29-2013 |
20130225654 | Compositions And Methods for Inhibiting Expression Of A Gene From the Ebola Virus - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a gene from the Ebola virus. | 08-29-2013 |
20130225655 | Combinations of TGFBeta and COX-2 Inhibitors and Methods for Their Therapeutic Application - The present invention provides compositions and methods for using combinations of TGFβ1 and Cox-2 inhibitors and TGFβ1 and Hoxb13 inhibitors for the treatment of various medical conditions, including skin scaring due to trauma wounds and surgery, corneal and retina scaring due to injury and surgery, internal organ scaring due to injury and surgery, heart tissue scaring due to heart attack and surgery, and lung, liver, and kidney fibrosis due to inflammation and injury. One example is to use siRNA inhibitors to silence TGFβ1 and Cox-2 at the same time, resulting in significant less scar formation. | 08-29-2013 |
20130225656 | ANALYZING SEMAPHORIN7A (Sema7A) LEVELS FOR ASSESSING CANCER METASTATIC POTENTIAL AND METHODS OF TREATMENT - Methods, assays, and kits for determining a cancer's (e.g., breast cancer) metastatic potential and tumor aggressiveness in a subject (e.g., a human patient) and for measuring a subject's response to cancer therapy involve analyzing expression of Sema7A in a biological sample from the subject, and correlating increased expression of Sema7A in the biological sample compared to a control sample with metastatic potential of the cancer, wherein the expression of Sema7A is linearly proportional to the metastatic potential of the cancer in the subject. These methods, kits and assays provide for individualized diagnosis and treatment options for cancer (e.g., breast cancer) patients. They can be used independently, or can be combined with additional diagnostic tests and/or prognostic methods. Compositions, kits and methods for treating a subject having cancer (e.g., breast cancer) include administering a composition for inhibiting Sema7A expression or activity to the subject. | 08-29-2013 |
20130225657 | SiRNA TARGETING ETS1 AND ELK1 AND METHOD OF USING SAME IN THE INHIBITION OF CIP2A GENE IN CANCER TREATMENT - Disclosed are methods of attenuating activity of the gene promoter of CIP2A. siRNAs are used to target against Ets1 and Elk1 transcriptional factors, thereby blocking the binding of Ets1 and Elk1 to the CIP2A gene promoter. It is disclosed that the siRNAs targeted against Ets1 and Elk1 attenuate the gene expression of CIP2A. A kit containing siRNA reagents for attenuating the CIP2A gene expression is also disclosed. | 08-29-2013 |
20130225658 | MICRORNAS THAT REGULATE MUSCLE CELL PROLIFERATION AND DIFFERENTIATION - The presently disclosed subject matter provides methods and compositions for modulating gene expression in myocytes. Also provided are cells comprising the compositions of the presently disclosed subject matter. | 08-29-2013 |
20130225659 | MODULATION OF NUCLEAR-RETAINED RNA - Provided herein are methods, compounds, and compositions for reducing expression of a nrRNA in an animal. Also provided herein are methods, compounds, and compositions for treating, ameliorating, delaying or reducing a symptom of a disease or disorder associated with a nuclear-retained RNA in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate a disease or condition associated with a nuclear-retained RNA, or a symptom thereof. | 08-29-2013 |
20130225660 | COMPOSITIONS AND METHODS FOR SPECIFIC CLEAVAGE OF EXOGENOUS RNA IN A CELL - There are provided compositions for cleaving an exogenous RNA of interest only in the presence of an endogenous signal RNA sequence, thereby activating expression of a polynucleotide of interest only in the presence of the endogenous signal RNA sequence. There are provided methods for the preparation of the composition and uses thereof in treatment and diagnosis of various conditions and disorders, for example by selectively activating expression of a toxin only in specific target cell populations. | 08-29-2013 |
20130225661 | Inhibitors Of SP140 And Their Use In Therapy - A method of treating autoimmune and inflammatory diseases or conditions in a mammal, such as a human, which comprises the administration of a inhibitor of bromodomain-containing protein: SP140. | 08-29-2013 |
20130231382 | LIPOPEPTIDES FOR DELIVERY OF NUCLEIC ACIDS - Lipopeptide compounds comprising a peptide having 2 to 100 amino acid residues, and having a lipophilic group attached to at least one terminus of the peptide or to at least one amino acid residue of the peptide, and salts and uses thereof. The lipophilic group may be attached to the N-terminus, C-terminus or both termini of the peptide. The lipophilic group may be attached to at least one interal amino acid residue (i.e., an amino acid residue that is not the N-terminus or the C-terminus amino acid residue of the peptide). The lipophilic group may be attached to either termini or both and at least one internal amino acid residue. | 09-05-2013 |
20130231383 | NUCLEIC ACID HAVING AN ANTI-METABOLIC SYNDROME EFFECT - The problem of the present invention is to prove a medicament for decreasing body weigh, a medicament for decreasing visceral fat, a medicament for decreasing triglyceride in the liver, and a method for screening a medicament for ameliorating obesity and fatty liver. The problem is solved by a method comprising measuring an activity of a candidate material for inhibiting a sphingomyelin synthetase wherein if the candidate material has an activity for inhibiting a sphingomyelin synthetase, the candidate material is judged to have at least one function selected from the consisting of an anti-obesity drug, a drug for decreasing visceral fat, a drug for treating fatty liver and an agent for increasing adiponectin expression. | 09-05-2013 |
20130237584 | CANCER THERAPY USING Bcl-XL-SPECIFIC siNA - The invention relates to a double-stranded short interfering nucleic acid (siNA) molecule specific to the Bcl-X | 09-12-2013 |
20130237585 | MODULATION OF DYSTROPHIA MYOTONICA-PROTEIN KINASE (DMPK) EXPRESSION - Provided herein are methods, compounds, and compositions for reducing expression of a DMPK mRNA and protein in an animal. Also provided herein are methods, compounds, and compositions for preferentially reducing CUGexp DMPK RNA, reducing myotonia or reducing spliceopathy in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate type 1 myotonic dystrophy, or a symptom thereof. | 09-12-2013 |
20130237586 | DELIVERY OF dsRNA TO ARTHROPODS - The invention is to methods of gene silencing in arthropods using dsRNA. The method is include contacting the arthropod with, and/or directly feeding the arthropod, the dsRNA to the arthropods to deliver the dsRNA to arthropod tissues. It is envisaged that the methods of the invention will have use in determining the biological function of genes in arthropods. Methods of pest control of arthropods, and of protecting arthropods against parasites and predators are provided. Transgenic arthropods expressing dsRNA molecules are also provided by the present invention. | 09-12-2013 |
20130237587 | MIR 204, MIR 211, THEIR ANTI-MIRS, AND THERAPEUTIC USES OF SAME - Embodiments of the invention provide methods of preventing or treating detrimental epithelial cell proliferation, loss of epithelial cell differentiation, age-related macular degeneration and/or proliferative vitreal retinopathy in an individual comprising administering to an individual in need thereof an effective amount of miR 204, an effective amount of miR 211, or an effective amount of a mixture of miR 204 and miR 211. A further embodiment of the invention provides a method of facilitating the transport of a substance across an epithelium in an individual comprising administrating to an individual an effective amount of anti-miR 204, an effective amount of anti-miR 211, or an effective amount of a mixture of anti-miR 204 and anti-miR 211. Additional embodiments of the invention include pharmaceutical compositions of miR 204 and/or miR 211 and pharmaceutical compositions of anti-miR 204 and/or anti-miR 211. | 09-12-2013 |
20130245090 | IDENTIFICATION OF NOVEL GENES CODING FOR SMALL TEMPORAL RNAS | 09-19-2013 |
20130245091 | Compositions for Targeted Delivery of siRNA - The present invention is directed compositions for targeted delivery of RNA interference (RNAi) polynucleotides to hepatocytes in vivo. Targeted RNAi polynucleotides are administered together with co-targeted delivery polymers. Delivery polymers provide membrane penetration function for movement of the RNAi polynucleotides from outside the cell to inside the cell. Reversible modification provides physiological responsiveness to the delivery polymers. | 09-19-2013 |
20130245092 | MICRO-RNAS THAT CONTROL MYOSIN EXPRESSION AND MYOFIBER IDENTITY - The present invention relates to the identification of two microRNAs, miR-499 and miR-208b, that repress fast skeletal muscle contractile protein genes. Expression of miR-499 and/or miR-208b can be used to repress fast fiber genes and activate slow fiber genes in the treatment of musculoskeletal disorders. Inhibition of miR-499 and/or miR-208b is proposed as a treatment for cardiac hypertrophy, myocardial infarction, and/or heart failure. Pharmaceutical compositions comprising antagonists and agonists of miR-499 and miR-208b function are also disclosed. | 09-19-2013 |
20130245093 | METHODS TARGETING MIR-33 MICRORNAS FOR REGULATING LIPID METABOLISM - Compositions comprising nucleic acid sequences that target MiR-33a/b microRNAs are described, together with uses of the same in the treatment of certain disorders related to elevated serum triglyceride levels and obesity. | 09-19-2013 |
20130245094 | APTZAYME CAPABLE OF SELECTIVE SILENCING OF TARGET miRNA BY RELEASING AN ANTISENSE SEQUENCE IN HEPATITIS C VIRUS-INFECTED CELLS AND USE THEREOF - The present invention relates to an aptazyme comprising an aptamer for hepatitis C virus (HCV) RNA-encoding component; a hammerhead ribozyme comprising an antisense sequence to microRNA at the site released by self-cleavage; and a communication module sequence that connects the aptamer and hammerhead ribozyme and triggers a self-cleavage activity of the hammerhead ribozyme upon binding of the aptamer with the HCV RNA-encoding component. The present aptazyme inhibits microRNA activity specifically in HCV proliferating cells and thus a composition of the present invention comprising the aptazyme can be effectively used for treatment of HCV-related diseases. | 09-19-2013 |
20130245095 | TREATMENT OF SIALIDASE 4 (NEU4) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO NEU4 - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Sialidase 4 (NEU4), in particular, by targeting natural antisense polynucleotides of Sialidase 4 (NEU4). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of NEU4. | 09-19-2013 |
20130245096 | COMPOSITIONS AND METHODS FOR ACTIVATING EXPRESSION BY A SPECIFIC ENDOGENOUS miRNA - There are provided compositions and methods for activating expression of an exogenous polynucleotide of interest only in the presence of a specific endogenous miRNA in a cell. Further provided are uses for the compositions in treatment and diagnosis of various conditions and disorders, for example by selectively activating expression of a toxin only in target cell populations. | 09-19-2013 |
20130245097 | CANCER CELL-SPECIFIC APOPTOSIS-INDUCING AGENTS THAT TARGET CHROMOSOME STABILIZATION-ASSOCIATED GENES - The present inventors discovered that inhibition of the expression of various genes associated with chromosome stabilization induces cancer cell-specific apoptosis and inhibits cell proliferation. Compounds that inhibit expression of a gene associated with chromosome stabilization or inhibit the function of a protein encoded by such a gene are thought to have cancer cell-specific apoptosis-inducing effects. | 09-19-2013 |
20130245098 | RNAi-MEDIATED INHIBITION OF HIF1A FOR TREATMENT OF OCULAR ANGIOGENESIS - RNA interference is provided for inhibition of HIF1A mRNA expression for treating patients with ocular angiogenesis, particularly for treating retinal edema, diabetic retinopathy, sequela associated with retinal ischemia, posterior segment neovascularization (PSNV), and neovascular glaucoma, and for treating patients at risk of developing such conditions. | 09-19-2013 |
20130245099 | ANTAGONAT COMPOSITIONS AND METHODS OF USE - Provided herein are compositions, compounds, and methods of modulating gene expression. In certain embodiments described herein is a composition, wherein the composition comprises an antagoNAT. In some embodiments, the antagoNAT is an oligonucleotide comprising modified and unmodified sugar subunits, wherein the antagoNAT hybridizes with a natural antisense transcript. Certain embodiments of the present invention provide a method for modulating gene expression in a cell comprising contacting the cell with an antagoNAT. In some embodiments, the method includes forming a hybrid comprising the antagoNAT and a natural antisense transcript of the gene, wherein the hybrid sterically blocks the normal function of the natural antisense transcript. | 09-19-2013 |
20130253032 | Use of Apoptosis-specific eIF-5A siRNA to Down Regulate Expression of Proinflammatory Cytokines to Treat Sepsis - The present invention relates to apoptosis specific eucaryotic initiation factor 5A (eIF-5A), referred to as apoptosis-specific eIF-5A or eIF5-A1, nucleic acids and polypeptides and methods for down regulating pro-inflammatory cytokines in a mammal by administering siRNA against eIF-5A1 to the mammal to treat/prevent sepsis and/or hemorrhagic shock. | 09-26-2013 |
20130253033 | ANTISENSE OLIGONUCLEOTIDES FOR INDUCING EXON SKIPPING AND METHODS OF USE THEREOF - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202. | 09-26-2013 |
20130253034 | 2'-Arabino-Fluorooligonucleotide N3'-->P5' Phosphoramidates: Their Synthesis and Use - Oligonucleotides with a novel sugar-phosphate backbone containing at least one 2′-arabino-fluoronucleoside and an internucleoside | 09-26-2013 |
20130253035 | CAMKK-BETA AS A TARGET FOR TREATING CANCER - Provided herein are compounds, compositions, including pharmaceutical compositions, having anti-cancer activity. Also provided are methods for diagnosing, detecting, and treating cancer in a subject, as well as a method for evaluating cancer stage in a subject, wherein the methods include determining the amount of a Ca | 09-26-2013 |
20130253036 | TREATMENT OF ALPHA-L-IDURONIDASE (IDUA) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO IDUA - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Alpha-L-Iduronidase (IDUA), in particular, by targeting natural antisense polynucleotides of Alpha-L-Iduronidase (IDUA). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of IDUA. | 09-26-2013 |
20130253037 | AURORA A KINASE EFFECTORS - Two proteins (PHLDA1 and LIMK2) have been identified as direct targets of Aurora A kinase activity. PHLDA1 downregulation and Aurora A upregulation are strong predictors of poor prognosis for breast cancer patients. In accordance with one embodiment a method of detecting, prognosing and monitoring the presence/progression of cancer, and more specifically breast or prostate cancer, is provided. In one embodiment the method comprises the step of analyzing a biological sample from a patient to detect and/or quantitate the presence of Aurora A, PHLDA1 or LIMK2 amino acid sequences. In one embodiment a method of treating cancer is provided comprising the administration of therapies that enhance the activity of PHLDA1 and/or decrease the activity of LIMK2. | 09-26-2013 |
20130253038 | Modified Single-Stranded Polynucleotide - It is intended to provide a polynucleotide that is resistant to RNase and has an RNA interference effect, etc. The present invention provides a single-stranded polynucleotide that is derived from a double-stranded polynucleotide comprising a sense strand polynucleotide corresponding to a target gene, and an antisense strand polynucleotide having a nucleotide sequence complementary to the sense strand polynucleotide, and has a structure in which the 5′-end of the antisense strand and the 3′-end of the sense strand are linked via a phenyl group-containing linker to form a phosphodiester structure at each of these ends. | 09-26-2013 |
20130261166 | METHODS AND COMPOSITIONS FOR TREATING NEUROLOGICAL DISEASE - This invention relates to methods and compositions for treating neurological disease, and more particularly to methods of delivering iRNA agents to neural cells for the treatment of neurological diseases. | 10-03-2013 |
20130261167 | ANCCA as a Diagnostic Biomarker and Therapeutic Target for Breast Cancers - The present invention provides methods of diagnosing breast cancer, confirming a diagnosis of breast cancer, predicting the survival of a breast cancer patient, and providing a therapeutic target of treatment in a breast cancer patient by measuring relatively increased expression levels of ANCCA. Expression levels of ANCCA can be measured be determining the levels mRNA or protein. The expression levels can be compared to a predetermined threshold level or to a control, e.g., a positive or negative control. | 10-03-2013 |
20130261168 | NUCLEIC ACID COMPLEXES - The invention relates to nucleic acid complexes, methods of preparation thereof, and uses thereof for delivering a nucleic acid into a cell. | 10-03-2013 |
20130261169 | Micro-RNA Family That Modulates Fibrosis and Uses Thereof - The present invention relates to the identification of a microRNA family, designated miR-29a-c, that is a key regulator of fibrosis in cardiac tissue. The inventors show that members of the miR-29 family are down-regulated in the heart tissue in response to stress, and are up-regulated in heart tissue of mice that are resistant to both stress and fibrosis. Also provided are methods of modulating expression and activity of the miR-29 family of miRNAs as a treatment for fibrotic disease, including cardiac hypertrophy, skeletal muscle fibrosis other fibrosis related diseases and collagen loss-related disease. | 10-03-2013 |
20130261170 | BACTERIALLY DERIVED INTACT MINICELLS THAT ENCOMPASS PLASMID FREE FUNCTIONAL NUCLEIC ACID FOR IN VIVO DELIVERY TO MAMMALIAN CELLS - Intact, bacterially-derived minicells can safely introduce therapeutically effective amounts of plasmid-free functional nucleic acid to target mammalian cells. To this end, functional nucleic acid can be packaged into intact minicells directly, without resort to expression constructs, the expression machinery of the host cell, harsh chemicals or electroporation. | 10-03-2013 |
20130261171 | PROSTATE CANCER PROGNOSTIC COMPOSITIONS AND KITS - Described herein are method, compositions and kits for prognosis of prostate cancer. The methods include determining the ratio of PCA3 and of a prostate-specific marker expression in a urine sample and correlating the value of the PCA3/prostate-specific marker ratio with the aggressiveness and mortality risk of prostate cancer in the subject. The method for prognosing prostate cancer in a sample of a patient includes assessing the amount of a prostate cancer specific PCA3 mRNA and the amount of prostate-specific marker in the sample; determining a ratio value of this amount of prostate cancer specific PCA3 mRNA over the amount of prostate-specific marker; comparing the ratio value to at least one predetermined cut-off value, wherein a ratio value above the predetermined cut-off value is indicative of a higher risk of mortality of prostate cancer as compared to a ratio value below the predetermined cut-off value. | 10-03-2013 |
20130267575 | CANCER TREATMENT TARGETING NON-CODING RNA OVEREXPRESSION - Provided herein are methods directed to modulating the pro-oncogenic effects of noncoding RNAs (ncRNAs) through their interactions with specificity protein transcription factors (SpTFs). In one aspect, the disclosure provides a method of inhibiting growth of a cell, such as a transformed or cancer cell, characterized by overexpression of at least one specificity protein (Sp)-regulated ncRNA and expression of at least one Sp transcription factor (SpTF), the method comprising contacting the cell with an effective amount of an SpTF agent. In some embodiments, the ncRNA is a long noncoding RNA (lncRNA). In some embodiments, the ncRNA is a microRNA (miR). Also provided are methods of treating a cell proliferative disease, predicting the response of a subject to SpTF agent-based treatment, and monitoring the efficacy of a SpTF agent-based treatment in a subject. | 10-10-2013 |
20130267576 | (NUCLEIC ACID)-POLYSACCHARIDE COMPLEX - The present invention provides a nucleic acid-polysaccharide complex that is highly stable and has reduced cytotoxicity in a high yield. That is, the present invention provides a nucleic acid-polysaccharide complex of an antisense DNA having polydeoxyadenine (dA) as a polysaccharide binding site and a polysaccharide having a β-1,3-glucan skeleton wherein at least part of phosphodiester links of the polydeoxyadenine is phosphorothioated (provided that the phosphodiester links of the antisense DNA and the polydeoxyadenine are not entirely phosphorothioated). | 10-10-2013 |
20130267577 | Gene Silencing by Single-Stranded Polynucleotides - The present invention relates to compositions and methods for concurrently activating antisense and double-stranded RNase (dsRNase) mechanisms for inhibiting expression of a targeted gene, by delivering a single stranded bifunctional chimeric DNA/RNA oligonucleotide optimized for siRNA activity as well as antisense activity, into the nucleus of a target cell. | 10-10-2013 |
20130267578 | COMPOSITIONS AND METHODS FOR INHIBITING NADPH OXIDASE EXPRESSION - The invention relates to one or more inhibitors, in particular siRNAs, which down-regulate the expression of a NOX gene selected from the group consisting of NOX4, NOX1, NOX2 (gp91phox, CYBB), NOX5, DUOX2, NOXO1, NOXA1 and NOXA2 (p67phox). The invention also relates to a pharmaceutical composition comprising the compound, or a vector capable of expressing the compound, and a pharmaceutically acceptable carrier. The present invention also contemplates a method of treating or preventing the incidence or severity of various diseases or conditions associated with NOX gene comprising administering to the patient the pharmaceutical composition in a therapeutically effective dose so as to thereby treat the patient. | 10-10-2013 |
20130267579 | Methods and Compositions for Inducing Deregulation of EPHA7 and ERK Phosphorylation in Human Acute Leukemias - Methods for assessing a pathological condition in a subject include measuring one or more markers where a difference is indicative of acute lymphoblastic leukemia (ALL) or a predisposition to ALL, uses and compositions are disclosed. | 10-10-2013 |
20130267580 | Compositions and Methods for the Diagnosis and Therapy of BCL2-Associated Cancers - Provided are methods and compositions for the treatment of cancers associated with overexpression of a BCL2 gene and/or gene product in a subject, and methods and compositions for the improvement of anti-cancer therapy, such as chemotherapy and radiation therapy. Also provided are methods for determining the efficacy of a cancer therapy in a subject, methods for diagnosing cancer, methods for assessing patient prognosis, and methods for inducing apoptosis of a cell. | 10-10-2013 |
20130267581 | AGENT FOR TREATING MYELOFIBROSIS - Disclosed is a substance delivery carrier for an extracellular-matrix-producing cell in the bone marrow, which comprises a retinoid. Also disclosed in an agent for treating myelofibrosis by utilizing a substance capable of regulating the activity or proliferation of an extracellular-matrix-producing cell in the bone marrow. | 10-10-2013 |
20130274308 | MODULATION OF FACTOR 11 EXPRESSION - Disclosed herein are antisense compounds and methods for decreasing Factor 11 and treating or preventing thromboembolic complications in an individual in need thereof. Examples of disease conditions that can be ameliorated with the administration of antisense compounds targeted to Factor 11 include thrombosis, embolism, and thromboembolism, such as, deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke. Antisense compounds targeting Factor 11 can also be used as a prophylactic treatment to prevent individuals at risk for thrombosis and embolism. | 10-17-2013 |
20130274309 | COMPOSITIONS AND METHODS FOR NON-PARENTERAL DELIVERY OF OLIGONUCLEOTIDES - The present invention relates to compositions and methods which enhance the local and systemic uptake and delivery of oligonucleotides and nucleic acids via non-parenteral routes of administration. Pharmaceutical compositions comprising oligonucleotides disclosed herein include, for systemic delivery, emulsion and microemulsion formulations for a variety of applications and oral dosage formulations. It has also surprisingly been discovered that oligonucleotides may be locally delivered to colonic sites by rectal enemas and suppositories in simple solutions, e.g., neat or in saline. Such pharmaceutical compositions of oligonucleotides may further include one or more penetration enhancers for the transport of oligonucleotides and other nucleic acids across mucosal membranes. The compositions and methods of the invention are utilized to effect the oral, buccal, rectal or vaginal administration of an antisense oligonucleotide to an animal in order to modulate the expression of a gene in the animal for investigative, therapeutic, palliative or prophylactic purposes | 10-17-2013 |
20130274310 | RNAi MODULATION OF SCAP AND THERAPEUTIC USES THEREOF - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a SCAP gene (Human SCAP gene), comprising an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of a SCAP gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by Human SCAP expression and the expression of a SCAP gene using the pharmaceutical composition; and methods for inhibiting the expression of a SCAP gene in a cell. | 10-17-2013 |
20130274311 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF Eg5 GENE - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the Eg5 gene (Eg5 gene), comprising an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of the Eg5 gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by Eg5 expression and the expression of the Eg5 gene using the pharmaceutical composition; and methods for inhibiting the expression of the Eg5 gene in a cell. | 10-17-2013 |
20130274312 | siRNA Against p22phox - The invention relates to siRNA against p22phox, compositions comprising the siRNA, methods of treating diseases with the siRNA and cell based systems for studying the effect of p22 phox modulation by siRNA or cells. | 10-17-2013 |
20130274313 | ANTISENSE OLIGONUCLEOTIDES FOR INDUCING EXON SKIPPING AND METHODS OF USE THEREOF - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202. | 10-17-2013 |
20130274314 | MITOCHONDRIAL TARGETED RNA EXPRESSION SYSTEM AND USE THEREOF - Described herein is a mitochondrial-targeted RNA expression system (mtTRES) for delivery of RNA molecules to mitochondria. mtTRES vectors generate RNAs in vivo that are un-capped, non-polyadenylated, and actively directed to mitochondria. The disclosed vectors are capable of delivering either non-coding RNA molecules or RNA molecules encoding a protein of interest to the mitochondria. In particular, the disclosed vectors include (1) an RNAPIII initiation (promoter) sequence, (2) a non-coding leader sequence (NCL), (3) a mitochondrial translation initiation sequence and an ORF encoding a protein of interest, or a sequence encoding a non-coding RNA, and (4) an RNAPIII termination sequence. | 10-17-2013 |
20130274315 | PRO-ANGIOGENIC GENES IN OVARIAN TUMOR ENDOTHELIAL CELL ISOLATES - A gene profiling signature for ovarian tumor endothelial cells is disclosed herein. The gene signature can be used to diagnosis or prognosis an ovarian tumor, identify agents to treat an ovarian tumor, to predict the metastatic potential of an ovarian tumor and to determine the effectiveness of ovarian tumor treatments. Thus, methods are provided for identifying agents that can be used to treat ovarian cancer, for determining the effectiveness of an ovarian tumor treatment, or to diagnose or prognose an ovarian tumor. Methods of treatment are also disclosed which include administering a composition that includes a specific binding agent that specifically binds to one of the disclosed ovarian endothelial cell tumor-associated molecules and inhibits ovarian tumor in the subject. | 10-17-2013 |
20130274316 | MUC1 AND GALECTIN-3 - The invention provides methods of identifying and making compounds that inhibit the interaction between MUC1 and galectin-3. Also embraced by the invention are in vivo and in vitro methods of inhibiting such an interaction and of inhibiting the expression of galectin-3 by a cell. | 10-17-2013 |
20130274317 | DERIVATIVES OF SMALL INTERFERING RNAS AND USE THEREOF - The present invention relates to a small interfering RNA (siRNA) being 2′-O-methyl modified and there being attached thereto by a phosphodiester bond a position 3′, wherein group R in position 3′, wherein R is selected from among: a C | 10-17-2013 |
20130274318 | Novel Method of Protecting Islet Cells From Apoptosis during the Donor Harvesting Process - The present invention relates to methods for improving the viability and recovery of islets that are separated from a donor organ for subsequent transplantation and more particularly relates to the use of eIF-5A1 siRNAs to enhance the viability of islets. | 10-17-2013 |
20130281508 | MicroRNA target site for cell- or tissue-specific inhibition of expression of a transgene - The present invention is directed to an isolated miR-206 target site, comprising or consisting of a nucleic acid sequence with a sequence identity of at least 80% compared to wild type miR-206 target site with SEQ ID No. 1, characterized in that the nucleic acid sequence comprises at least one nucleotide substitution at a position from nucleotide 2 to 8 and/or at least one nucleotide substitution at a position from nucleotide 12 to 16 of SEQ D No. 1, wherein the nucleotide positions of SEQ ID No. 1 are numbered from the 3′- to the 5′-end; as well as to an expression cassette, vector and pharmaceutical composition comprising at least one isolated miR-206 target site of the invention. | 10-24-2013 |
20130281509 | ANTISENSE MODULATION OF FIBROBLAST GROWTH FACTOR RECEPTOR 4 EXPRESSION - Provided herein are methods, compounds, and compositions for reducing expression of fibroblast growth factor receptor 4 (FGFR4) mRNA and protein in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate a metabolic disease, or a symptom thereof. | 10-24-2013 |
20130281510 | siRNA Therapy for Transthyretin (TTR) Related Ocular Amyloidosis - The invention relates to a method of treating ocular amyloidosis by reducing TTR expression in a subject by administering a double-stranded ribonucleic acid (dsRNA) that targets a TTR gene to the retinal pigment epithelium of the subject. | 10-24-2013 |
20130281511 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF THE ALAS1 GENE - The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the ALAS1 gene, and methods of using such dsRNA compositions to alter (e.g., inhibit) expression of ALAS1. | 10-24-2013 |
20130281512 | AGENTS FOR TREATING DISORDERS INVOLVING MODULATION OF RYANODINE RECEPTORS - The present invention relates to 1,4-benzothiazepine derivatives and their use to treat conditions, disorders and diseases associated with ryanodine receptors (RyRs) that regulate calcium channel functioning in cells. The invention also discloses pharmaceutical compositions comprising the compounds and uses thereof to treat diseases and conditions associated with RyRs, in particular cardiac, musculoskeletal and central nervous system (CNS) disorders. | 10-24-2013 |
20130281513 | siRNA FOR INHIBITION OF Hif1alpha EXPRESSION AND ANTICANCER COMPOSITION CONTAINING THE SAME - Disclosed are small interfering RNA (siRNA) that complementarily binds to a base sequence of Hif1α mRNA transcript, thereby inhibiting expression of Hif1α without inducing immune responses, and a use of the siRNA for prevention and/or treatment of cancer. Since Hif1α is commonly overexpressed in almost all cancer cells, the siRNA that complementarily binds to Hif1α-encoding mRNA may inhibit expression of Hif1α through RNA-mediated interference (RNAi), thereby inhibiting proliferation and metastasis of cancer cells, and thus, the siRNA may be useful as an anticancer agent. | 10-24-2013 |
20130281514 | TARGETING GLIOMA STEM CELLS BY SEQUENCE-SPECIFIC FUNCTIONAL INHIBITION OF PRO-SURVIVAL ONCOMIR-138 - Methods for malignant glioma diagnosis/prognosis using miR-138 as a prognostic biomarker and methods for treating malignant glioma and inhibiting glioma stem cell growth by suppressing miR-138. Also disclosed herein are pharmaceutical compositions for use in treating malignant glioma, prolonging survival of malignant glioma patients, or eliminating GSCs and in turn tumor growth, the pharmaceutical composition comprising an oligonucleotide that targets miR-138. | 10-24-2013 |
20130289091 | ANTISENSE ANTIBACTERIAL METHOD AND COMPOUND - A method and antisense compound for inhibiting the growth of pathogenic bacterial cells are disclosed. The compound contains no more than 12 nucleotide bases and has a targeting nucleic acid sequence of no fewer than 10 bases in length that is complementary to a target sequence containing or within 10 bases, in a downstream direction, of the translational start codon of a bacterial mRNA that encodes a bacterial protein essential for bacterial replication. The compound binds to a target mRNA with a T | 10-31-2013 |
20130289092 | COMPOUNDS AND METHODS FOR MODULATING INTERACTION BETWEEN PROTEINS AND TARGET NUCLEIC ACIDS - Provided herein are antisense compounds and methods for recruiting one or more non-cleaving protein to a target nucleic acid in a cell. In certain instances such recruitment of a non-cleaving protein alters the function or activity of the target nucleic acid. In certain such instances, the target nucleic acid a pre-mRNA and the recruitment of the non-cleaving protein results in a change in splicing of the pre-mRNA. | 10-31-2013 |
20130289093 | MICRORNA COMPOUNDS AND METHODS FOR MODULATING MIR-21 ACTIVITY - Described herein are compositions and methods for the inhibition of miR-21 activity. The compositions have certain nucleoside modification patterns that yield potent inhibitors of miR-21 activity. The compositions may be used to inhibit miR-21, and also to treat diseases associated with abnormal expression of miR-21, such as fibrosis and cancer. | 10-31-2013 |
20130289094 | Compositions and Methods for Inhibition of PCSK9 Genes - The invention relates to siRNAs targeting a PCSK9 gene, and methods of using siRNAs to inhibit expression of PC-SK9 and to treat PCSK9 related disorders, e.g., hyperlipidemia. | 10-31-2013 |
20130289095 | SYNTHETIC LETHALITY IN CANCER - There is described herein compounds, compositions and methods for inducing synthetic lethality in a cancer cell(s). | 10-31-2013 |
20130289096 | Oligomers - Molecules are provided for inducing or facilitating exon skipping in forming spliced mRNA products from pre-mRNA molecules in cells. The molecules may be provided directly as oligonucleotides or expression products of vectors that are administered to a subject. High rates of skipping can be achieved. High rates of skipping reduce the severity of a disease like Duchene Muscular Dystrophy so that the disease is more like Becker Muscular Dystrophy. This is a severe reduction in symptom severity and mortality. | 10-31-2013 |
20130289097 | COMPOSITIONS FOR CONFERRING TOLERANCE TO VIRAL DISEASE IN SOCIAL INSECTS, AND THE USE THEREOF - Compositions and methods for reducing susceptibility to infectious disease in bees using RNA interference technology, and more particularly, prevention and treatment of viral infections in honeybees such as Israel acute paralysis virus (IAPV) by feeding of pathogen-specific dsRNA. Further, multiple-pathogen specific dsRNA is disclosed. | 10-31-2013 |
20130289098 | COMPOSITIONS AND METHODS FOR TREATMENT OF OVARIAN CANCER - The disclosure provides compositions and methods for treating an ovarian cancer in a subject. More specifically, the disclosure provides microRNA (miRNA) inhibitor molecules that target to different miRNAs for treating different types of ovarian cancers in a subject. Furthermore, different modifications of miRNA inhibitor molecules as well as different derivatives of miRNA inhibitor molecules are also described. | 10-31-2013 |
20130289099 | ABCG1 GENE AS A MARKER AND A TARGET GENE FOR TREATING OBESITY - The invention relates to a method for treating obesity in a patient, which method comprises administering an effective quantity of ABCG1 inhibitor to a patient in need thereof. The invention further provides an in vitro method for determining whether a patient is at risk of developing obesity, which method comprises detecting the presence of a mutation, substitution or deletion of at least one nucleotide in ABCG1 20 gene or regulatory sequences thereof. | 10-31-2013 |
20130296399 | microRNA Biomarkers for Human Breast and Lung Cancer - The present invention relates to novel molecular markers for diagnosis and classification of human breast cancer and lung cancer. | 11-07-2013 |
20130296400 | ANTIDOTES TO ANTISENSE COMPOUNDS - The present invention relates to antisense antidote compounds and uses thereof. Such antidote compounds reduce the magnitude and/or duration of the antisense activity of an antisense compound. | 11-07-2013 |
20130296401 | HBV TREATMENT - RNA interference (RNAi) agents and the use of the RNAi agents for treating hepatitis B infection in individuals, as well as pharmaceutical compositions containing the RNAi agents are provided. The RNAi agents, or constructs for expressing them are utilized to inhibit expression of at least one Hepatitis B virus (HBV) gene, wherein each agent comprises an effector sequence complementary to or substantially complementary to a predicted sequence transcribed from a target region. In some embodiments of the present invention, the agents have more than one effector sequence; wherein the multiple effectors may target the same region of an HBV gene, different (possibly overlapping) regions of the same gene and/or different HBV genes. | 11-07-2013 |
20130296402 | BASE MODIFIED OLIGONUCLEOTIDES - The present invention relates to oligonucleotides with base modified nucleosides for enhancement of binding affinity. | 11-07-2013 |
20130296403 | TARGETING EN2, PAX2, AND/OR DEFB1 FOR TREATMENT OF PROSTATE CONDITIONS - The present invention relates to methods and compositions for treating a prostate condition in a subject. The method comprises administering to the subject a subject effective amount of a pharmaceutical composition having a first agent that inhibits EN2 expression and/or EN2 activity and a second agent that inhibits PAX2 expression and/or PAX2 activity. The pharmaceutical composition may further comprise a third agent that enhances DEFB1 expression or activity. | 11-07-2013 |
20130303586 | OLIGONUCLEOTIDE COMPOSITIONS WITH ENHANCED EFFICIENCY - The oligonucleotide compositions of the present invention make use of combinations of oligonucleotides. In one aspect, the invention features an oligonucleotide composition including at least 2 different oligonucleotides targeted to a target gene. This invention also provides methods of inhibiting protein synthesis in a cell and methods of identifying oligonucleotide compositions that inhibit synthesis of a protein in a cell. | 11-14-2013 |
20130303587 | NON-LIPOSOMAL SYSTEMS FOR NUCLEIC ACID DELIVERY - The present invention provides novel, stable lipid particles having a non-lamellar structure and comprising one or more active agents or therapeutic agents, methods of making such lipid particles, and methods of delivering and/or administering such lipid particles. More particularly, the present invention provides stable nucleic acid-lipid particles (SNALP) that have a non-lamellar structure and that comprise a nucleic acid (such as one or more interfering RNA), methods of making the SNALP, and methods of delivering and/or administering the SNALP. | 11-14-2013 |
20130303588 | COMBINATION OF DNA REPAIR INHIBITION WITH BENDAMUSTINE OR GEMCITABINE IN THE TREATMENT OF CANCER - The invention provides methods for enhancing the cytotoxicity of DNA damage in cancer cells that express thymine DNA glycosylase, and treating tumors accordingly. The methods comprise inhibiting the expression or biologic activity of thymine DNA glycosylase, and inducing DNA damage in the cancer cells. DNA damage may be induced by administration of bendamustine or gemcitabine to the cancer cells. | 11-14-2013 |
20130303589 | DESIGN OF RNAI MOLECULES WITH NON-WATSON CRICK PAIRING BASED ON ARTIFICIAL MUTATION CONSENSUS SEQUENCES TO COUNTER ESCAPE MUTATIONS - Universal RNA interference (RNAi) molecules having an inhibitory RNA sequence which binds a target pathologic RNA sequence are provided according to some embodiments. Such RNAi molecules bind the target pathologic RNA sequence via at least one non-Watson Crick paired base. In some embodiments, the target pathologic RNA sequence is a target viral RNA sequence derived from a human immunodeficiency HIV virus, a hepatitis B virus (HBV), a hepatitis C virus (HCV), or an influenza virus. | 11-14-2013 |
20130303590 | THERAPEUTIC USES OF INHIBITORS OF RTP801L - The present invention provides novel molecules, compositions, methods and uses for treating microvascular disorders, eye diseases respiratory conditions and hearing disorders based upon inhibition of the RTP801L gene and/or protein. | 11-14-2013 |
20130303591 | METHODS AND COMPOSITIONS INVOLVING MIRNA AND MIRNA INHIBITOR MOLECULES - The present invention concerns methods and compositions for introducing miRNA activity or function into cells using synthetic nucleic acid molecules. Moreover, the present invention concerns methods and compositions for identifying miRNAs with specific cellular functions that are relevant to therapeutic, diagnostic, and prognostic applications wherein synthetic miRNAs and/or miRNA inhibitors are used in library screening assays. | 11-14-2013 |
20130303592 | Treatment of Cancer by Inhibition of IGFBPs and Clusterin - Agents that reduce the amount of IGFBP-2 and/or IGFBP-5 and that are known to be useful in the treatment of cancer result in increased expression of the protein clusterin. Since clusterin can provide protection against apoptosis, this secondary effect detracts from the efficacy of the therapeutic agent. In overcoming this, the present invention provides a combination of therapeutic agents that is useful in the treatment of cancer. The combination includes an agent that reduces the amount of IGFBP-2 and/or IGFBP-5 and that stimulates expression of clusterin as a secondary effect, and an oligonucleotide that is effective to reduce the amount of clusterin in cancer cells. In some embodiments of the invention, the agent that reduces IGFBP-2 and/or IGFBP-5 is a bispecific antisense species. The oligonucleotide may be an antisense oligonucleotide or an RNAi oligonucleotide. | 11-14-2013 |
20130303593 | Methods and Compositions for the Specific Inhibition of HIF-1a by Double-Stranded RNA - This invention relates to compounds, compositions, and methods useful for reducing HIF-1α target RNA and protein levels via use of dsRNAs, e.g., Dicer substrate siRNA (DsiRNA) agents. | 11-14-2013 |
20130310439 | METHOD OF REDUCING PROTEINS MISFOLDING AND/OR AGGREGATION - The present invention is directed to methods of reducing protein misfolding and/or aggregation in a subject and to method of treating a condition mediated by a dysfunction in protein homeostasis comprising modulating cholinergic signaling activity. | 11-21-2013 |
20130310440 | METHOD FOR TREATING NON-SMALL CELL LUNG CANCER - The present invention provides methods for treating a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer comprising periodically administering to the human patient chemotherapy comprising an amount of docetaxel; and 640 mg of an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, thereby treating the human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer. The present invention also provides compositions and combinations, packages, and uses thereof for treating a human patient afflicted with unresectable, advanced or metastatic non-small cell lung cancer. | 11-21-2013 |
20130310441 | ANTISENSE OLIGONUCLEOTIDES AGAINST AchE IN THE TREATMENT OF GASTROINTESTINAL INFLAMMATION DISORDERS - AChE antisense oligonucleotides are used as antiinflammatory agents, such oligonucleotides preferably having the sequence of SEQ ID NO:1 and SEQ ID NO:7. Methods of treatment of inflammatory conditions, as well as fever, and particularly inflammation of the gastrointestinal tract, are described. | 11-21-2013 |
20130317079 | Poly(acrylate) Polymers for In Vivo Nucleic Acid Delivery - The present invention is directed membrane active poly(acrylate) polymers and compositions for targeted delivery of RNA interference (RNAi) polynucleotides cells in vivo. RNAi polynucleotides are conjugated to the poly(acrylate) polymers and the polymers are reversibly modified to enable in vivo targeted delivery. Membrane activity of the poly(acrylate) provides for movement of the RNAi polynucleotides from outside the cell to inside the cell. Reversible modification provides physiological responsiveness. | 11-28-2013 |
20130317080 | MODIFIED iRNA AGENTS - The present invention provides effective motifs for RNA agents conjugated to at least one ligand, which are advantageous for the in vivo delivery of iRNA duplex agents. Additionally, the present invention provides methods of making these compositions, as well as methods of introducing these iRNA duplex agents into cells using these compositions, e.g., for the treatment of various disease conditions. | 11-28-2013 |
20130317081 | SERPINC1 iRNA COMPOSITIONS AND METHODS OF USE THEREOF - The invention relates to iRNA, e.g., double-stranded ribonucleic acid (dsRNA), compositions targeting the Serpinc1 gene, and methods of using such iRNA, e.g., dsRNA, compositions to inhibit expression of Serpinc1 and methods of treating subjects having a bleeding disorder, such as a hemophilia. | 11-28-2013 |
20130317082 | METHODS AND COMPOSITIONS FOR THE DIAGNOSIS AND TREATMENT OF CANCER - Methods and compositions are provided for the diagnosis and treatment of gastric cancers associated with amplification or overexpression of the c-Myb gene. | 11-28-2013 |
20130317083 | NON-CODING TRANSCRIPTS FOR DETERMINATION OF CELLULAR STATES - Disclosed herein are novel methods, assays and systems for determining a given state of a cell or a tissue by detecting the presence or absence of a short RNA molecule originating from (a) at least one or more exons of at least one or more protein-coding genes, or from (b) at least one or more segments of at least one or more non-coding transcripts, or from (c) both (a) and (b), in a biological sample from a subject. In some embodiments, the methods, assays and systems described herein can be used to identify an origin and/or a type of a cell or tissue, and/or distinguish a cell or tissue from another cell or tissue. In some embodiments, the methods, assays and systems described herein can also be used to diagnose a disease or disorder, or prognose a given stage and/or progression of the disease or disorder in a subject. | 11-28-2013 |
20130317084 | METHOD OF TREATING DIABETES - The present invention relates to a method for treating a subject having or at risk of a diabetes-related disorder. In a preferred embodiment, the method involves increasing the level or activity of Hypoxia Induced Factor 1 (HIF-1α) in pancreatic-β-cells or insulin-sensitive tissues in the subject by administering to the subject an inhibitor of a protein that decreases the level or activity of HIF-1α. The present invention also relates to a method of transplanting pancreatic islet cells in a subject. | 11-28-2013 |
20130317085 | MODULATION OF APOLIPOPROTEIN C-III EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of apolipoprotein C-III. The compositions comprise oligonucleotides, targeted to nucleic acid encoding apolipoprotein C-III. Methods of using these compounds for modulation of apolipoprotein C-III expression and for diagnosis and treatment of disease associated with expression of apolipoprotein C-III are provided | 11-28-2013 |
20130317086 | NEURAL TRANSFECTION REAGENTS - The invention is directed to transfection reagents for the delivery of nucleic acids into neural cells, compositions including the reagents, methods of preparation of such reagents, methods of transfecting cells with such reagents, and uses thereof. In preferred embodiments the reagents comprise horseradish peroxidase and/or a polycarboxylic acid such as poly(acrylic acid) or poly(methacrylic acid). | 11-28-2013 |
20130317087 | METHODS AND COMPOSITIONS RELATED TO STAUFEN 1 BINDING SITES FORMED BY DUPLEXING ALU ELEMENTS - Disclosed are compositions and methods for identifying binding sites of targets of Staul-mediated mRNA decay; methods and compositions for treating subjects with conditions resulting from Staul-mediated mRNA decay, and method of screening for therapeutic agents. Also disclosed is the new pathway as a means for cells to down-regulate the expression of Staul-binding mRNAs. | 11-28-2013 |
20130317088 | Selective Reduction of the Deleterious Activity of Extended Tri-Nucleotide Repeat Containing Genes - Aspects of the invention include methods of selectively reducing the deleterious activity of mutant extended trinucleotide repeat containing genes in a cell, as well as compositions used in such methods. The deleterious activity (e.g., toxicity and/or dis-functionality of products encoded thereby) of a mutant extended trinucleotide repeat containing gene may be selectively reduced in a variety of different ways, e.g., by selectively decreasing SPT4 mediated transcriptional activity, by enhancing functionality of proteins encoded thereby, etc. Aspects of the invention further include assays for identifying agents that find use in methods of the invention, e.g. as summarized above. Methods and compositions of the invention find use in a variety of different applications, including the prevention or treatment of disease conditions associated with the presence of genes containing mutant extended trinucleotide repeats, such as Huntington's Disease (HD). | 11-28-2013 |
20130324586 | Inhibition of Hairless Protein mRNA - Methods for inhibition of hairless protein mRNA using RNA interference is described, in particular methods for hair removal. Also described are nucleic acid constructs for RNAi-mediated inhibition of hairless protein mRNA and compositions including such constructs. | 12-05-2013 |
20130324587 | Factors Controlling Skin and Hair Color - Use of autophagic activity in regulation of the amount of melanin in a keratinocyte, the control of skin or hair color, or selection of an agent for regulating the amount of melanin in a keratinocyte or an agent for controlling skin or hair color. | 12-05-2013 |
20130324588 | RNA Interference Mediated Inhibition of Catenin (Cadherin-Associated Protein), Beta 1 (CTNNB1) Gene Expression Using Short Interfering Nucleic Acid (siNA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of CTNNB1 gene expression and/or activity, and/or modulate a beta-catenin gene expression pathway. Specifically, the invention relates to double-stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules that are capable of mediating or that mediate RNA interference (RNAi) against CTNNB1 gene expression. | 12-05-2013 |
20130324589 | Methods for Diagnosing Pancreatic Cancer Using MicroRNAs - Described herein are methods for diagnosing pancreatic cancer using microRNAs. Also described are methods and compositions for the diagnosis and treatment of solid cancers. Methods of identifying inhibitors of tumorigenesis are also provided. | 12-05-2013 |
20130324590 | PRODUCTION AND UTILIZATION OF A NOVEL ANTI-CANCER DRUG IN THERAPY - This invention generally relates to a design and method for developing novel anti-tumor and/or anti-cancer drugs, vaccines and therapies, using microRNA and/or its shRNA homologues/mimics/derivatives. More specifically, the present invention relates to an use of a prokaryote-produced miRNA precursor (pro-miRNA) composition capable of being delivered into human cells and processed by the cells into mature miRNA effectors to elicit specific silencing effects on mir-302-targeted genes, subsequently leading to a beneficial result of tumor suppression and cancer therapy. The prokaryotic cells do not naturally express or process eukaryotic miRNA precursors (pre-miRNA); meanwhile, the present invention also teaches an inducible method for expressing pre-miRNAs, particularly mir-302 precursors by using the prokaryotic transcription system. Since mir-302 is a known tumor suppressor in human, this novel finding advances the design and method for developing new anti-cancer drugs, vaccines and/or therapies directed against multiple kinds of human tumors and cancers. | 12-05-2013 |
20130324591 | DOUBLE STRANDED OLIGONUCLEOTIDE COMPOUNDS COMPRISING POSITIONAL MODIFICATIONS - Disclosed herein are double stranded RNA molecules which have been modified to exhibit one of the following, increased activity, enhanced nuclease stability, reduced off target activity and or reduced immunogenicity, to pharmaceutical compositions comprising such compounds and to methods of use. Further disclosed is a method for the synthesis of threose nucleic acid phosphoramidites and methods of use thereof. | 12-05-2013 |
20130324592 | Lipid Nanoparticles for Treating Ocular Diseases - The present invention relates to the use of a lipid nanoparticle system, where the nanoparticles comprise a nucleic acid, a lipid component, a cationic surfactant, a non-ionic surfactant, a polysaccharide, and optionally a positively charged peptide for the treatment and prevention of eye diseases. | 12-05-2013 |
20130331430 | Compositions And Methods For Inhibiting Expression Of The PCSK9 Gene - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the PCSK9 gene (PCSK9 gene), comprising an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of the PCSK9 gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by PCSK9 gene expression and the expression of the PCSK9 gene using the pharmaceutical composition; and | 12-12-2013 |
20130331431 | ANALGESIC MEDICATION - An analgesic medication includes an oligonucleotide being a double strand RNA comprising 18 to 70 base pairs, and a pharmaceutical acceptable vehicle for delivering the said oligonucleotide into cells, wherein a dosage of the oligonucleotide in the analgesic is 50 μg to 200 μg/kg per time, and the pharmaceutical acceptable vehicle is selected from a group of polyethyleneimine, lipofectamine and iFect. | 12-12-2013 |
20130331432 | METABOLIC GENE, ENZYME, AND FLUX TARGETS FOR CANCER THERAPY - A novel pathway in cancer cell metabolism is identified. Targeting of any gene, protein, or enzyme that modulates activity or flux through this pathway, including, but not limited to IDH1, isocitrate dehydrogenase 2 (IDH2), aconitase 1 (ACO1), aconitase 2 (ACO2), glutaminase (GLS), glutamate dehydrogenase (GDH) and transaminase, provides effective means of inhibiting tumor growth. | 12-12-2013 |
20130331433 | MIRNA MODULATORS OF THERMOGENESIS - Provided are novel methods and compositions for the modulation of thermogenesis. Such methods are particularly advantageous in that they allow for the reduction of body fat in a subject without the subject having to adjust their caloric intake through dieting, modify their physical activity or undergo bariatric surgery. Accordingly, the methods of the invention are particularly useful for treating or preventing obesity. Also provided are methods of screening for novel agents that modulate the activity of thermogenic regulators. | 12-12-2013 |
20130331434 | METHODS FOR MODULATING FACTOR 12 EXPRESSION - Disclosed herein are methods for decreasing Factor 12 and treating or preventing thromboembolic conditions in an individual in need thereof. Examples of disease conditions that can be ameliorated with the administration of antisense compounds targeted to Factor 12 include thrombosis, embolism, and thromboembolism, such as, deep vein thrombosis, pulmonary embolism, myocardial infarction, stroke, and mesenteric thrombosis. Methods for inhibiting Factor 12 can also be used as a prophylactic treatment to prevent individuals at risk for thrombosis and embolism. | 12-12-2013 |
20130331435 | ANTISENSE MODULATION OF KINESIN-LIKE 1 EXPRESSION - Antisense compounds, compositions and methods are provided for modulating the expression of kinesin-like 1. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding kinesin-like 1. Methods of using these compounds for modulation of kinesin-like 1 expression and for treatment of diseases associated with expression of kinesin-like 1 are provided. | 12-12-2013 |
20130331436 | MICRORNAS AS NEW THERAPEUTIC TARGETS FOR THE PREVENTION AND/OR TREATMENT OF RETINOPATHY - Methods and compositions are disclosed to identify plasma and vitreous microRNA (miRNA) signatures of diabetic retinopathy (DR), and then as diagnostic biomarkers for the onset and progression of DR. | 12-12-2013 |
20130331437 | METHODS FOR MODULATING THE EXPRESSION AND AGGREGATION OF CAG-EXPANDED GENE PRODUCT IN CELLS AND METHODS FOR IDENTIFYING AGENTS USEFUL FOR DOING THE SAME - This invention provides a method for modulating the expression of a first gene in a cell wherein the first gene is one containing more than 36 CAG trinucleotide repeats and encoding a protein that form polyglutamine-mediated protein aggregation. Suppression of the first gene is achieved by reducing the expression of SPT4 gene or SUPT4H gene. It can also be achieved by inhibiting the formation of a Spt4/Spt5 complex or a Supt4h/Supt5h complex. Also provided is a method for identifying an agent useful for modulating the expression and aggregation of CAG-expanded gene product, or treating a polyglutamine disease such as Huntington's disease. | 12-12-2013 |
20130331438 | ANTISENSE OLIGONUCLEOTIDES FOR INDUCING EXON SKIPPING AND METHODS OF USE THEREOF - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202. | 12-12-2013 |
20130331439 | Methods for Diagnosing Stomach Cancer Using MicroRNAs - Described herein are methods for diagnosing stomach cancer using microRNAs. Also described are methods and compositions for the diagnosis and treatment of solid cancers. Methods of identifying inhibitors of tumorigenesis are also provided. | 12-12-2013 |
20130338210 | COMPOSITIONS FOR NUCLEIC ACID DELIVERY - A method for delivering a nucleic acid to a cell can include exposing sample cells to a composition which includes charged lipids. | 12-19-2013 |
20130338211 | NOVEL REPRESSOR ON IFN-LAMBDA PROMOTER AND SIRNA AGAINST ZEB1 AND BLIMP-1 TO INCREASE IFN-LAMBDA GENE ACTIVITY - The present invention is directed to the identification of a novel repressor located between ˜1.2 kb to ˜1.6 kb from the translation start site of the IFN-λ1 promoter. The present invention provides a method of using siRNAs against ZEB1 (binds to the repressor region) and BLIMP-1 (binds outside the repressor region) and increases the promoter activity of IFN-λ1 (i.e., increases the production of IFN-λ1 protein). siRNAs against ZEB1 mRNA or BLIMP-1 mRNA increase IFN-λ1 gene activity. There is provided a therapeutic application of siRNAs against ZEB1 and BLIMP-1 mRNAs in treating a mammal (including a human) by increasing the production of IFN-λ1 protein that promotes an anti-viral response as well as treats asthma diseases. | 12-19-2013 |
20130338212 | Genetic Changes In ATM And ATR/Chek1 As Prognostic Indicators In Cancer - The present invention relates to the discovery that, in human cancer, an 11q deletion of ATM together with an increase in ATR and CHEK1 expression correlates with resistance to ionizing radiation which could be overcome by inhibition of the ATR/CHEK1 pathway. It provides for methods of identifying patients unlikely to exhibit an adequate response to radiation therapy and/or chemotherapy who may benefit from ATR/CHEK1 pathway inhibition, as well as methods of treating said patients. | 12-19-2013 |
20130338213 | RNAi-MEDIATED INHIBITION OF TUMOR NECROSIS FACTOR ALPHA-RELATED CONDITIONS - RNA interference is provided for inhibition of tumor necrosis factor α (TNFα) by silencing TNFα cell surface receptor TNF receptor-1 (TNFR1) mRNA expression, or by silencing TNFα converting enzyme (TACE/ADAM17) mRNA expression. Silencing such TNFα targets, in particular, is useful for treating patients having a TNFα-related condition or at risk of developing a TNFα-related condition such as the ocular conditions dry eye, allergic conjunctivitis, or ocular inflammation, or such as dermatitis, rhinitis, or asthma, for example. | 12-19-2013 |
20130338214 | METHOD FOR SUPPRESSING RECEPTOR TYROSINE KINASE-MEDIATED PRO-SURVIVAL SIGNALING IN CANCER CELL - In order to provide a screening method for a compound capable of suppressing a mechanism of ROR1 by targeting ROR1 and to provide a drug comprising as an active ingredient a compound capable of suppressing the mechanism, it has been found out that suppressing a function of ROR1 makes it possible to suppress receptor tyrosine kinase-mediated pro-survival signaling in a cancer cell. Further, it has been found out that suppressing a function of ROR1 also effectively suppresses growth of cancer cell lines having acquired resistance to inhibitors of receptor tyrosine kinases such as EGFR and MET. | 12-19-2013 |
20130338215 | COMPOSITION AND METHOD FOR OLIGONUCLEOTIDE DELIVERY - The invention provides aptamer-gene modulator conjugates, where the aptamer and the gene modulator are linked together. The invention further provides a method for cell-specific delivery of gene modulators to hard to transfect cells such as CD4+ cell. | 12-19-2013 |
20130345284 | siRNA Compositions and Methods for Treatment of HPV and Other Infections - The invention provides siRNA compositions that (1) interfere with viral replication of human papillomavirus (HPV), herpes simplex virus (HSV), and human immunodeficiency virus (HIV) in mucosal tissues, such as genital tissues, and (2) treat fungal infections. The compositions include siRNA molecules that target HPV, complexed with a dendrimer that treats and prevents genital herpes (HSV) and HIV. The compositions also include siRNA molecules that target HPV, complexed with a histidine-lysine (HK) polymer that treats and prevent fungus infection. The combined formulations of siRNA and dendrimer provide treatment of the infections from HPVs, HSVs, and HIVs. The combined formulations of siRNA and HK polymer provide treatment of HPVs and fungus infections. | 12-26-2013 |
20130345285 | Methods and Compositions for Inhibiting the Proliferation of Cancer Cells - A method of decreasing the expression of LIM kinase 1 in a cancer cell comprising; providing an oligonucleotide consisting of the sequence of SEQ ID NO: 1; providing a cancer cell comprising an mRNA encoding LIM kinase 1; and introducing the oligonucleotide into the cancer cell, wherein the oligonucleotide decreases the expression of LIM kinase 1 in the cancer cell. The method also provides compositions of an antisense RNA LIM kinase 1 that can be administered to an individual for the purpose of inhibiting a protein kinase pathway and which further comprises methods for treating and monitoring the proliferation and metastasis of cancer cells. A kit may be used in the detection and treatment of cancer. | 12-26-2013 |
20130345286 | LIPID FORMULATED COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF EG5 AND VEGF GENES - This invention relates to compositions containing double-stranded ribonucleic acid (dsRNA) in a liquid particle formulation, methods of using the compositions to inhibit the expression of the Eg5/KSP and VEGF, and methods of using the compositions to treat pathological processes mediated by Eg5/KSP and VEGF expression, such as endometrial cancer. | 12-26-2013 |
20130345287 | METHODS OF ANALYSIS OF POLYMORPHISMS AND USES THEREOF - The present invention provides methods for the assessment of diseases that result from the combined or interactive effects of two or more genetic variants, and in particular for diagnosing risk of developing such diseases in subjects using an analysis of genetic polymorphisms. Methods for the derivation of a net score indicative of a subject's risk of developing a disease are provided. | 12-26-2013 |
20130345288 | INHIBITORS OF THE MIR-15 FAMILY OF MICRO-RNAS - The invention provides chemically modified oligonucleotides capable of inhibiting the expression (e.g., abundance) of miR-15 family miRNAs, including miR-15 | 12-26-2013 |
20130345289 | ADULT STEM CELLS, MOLECULAR SIGNATURES, AND APPLICATIONS IN THE EVALUATION, DIAGNOSIS, AND THERAPY OF MAMMALIAN CONDITIONS - The present invention relates to the identification of a stem cell-specific signature or signatures composed of protein and/or nucleic acid markers expressed by virtue of the position of a cell or cells in the time line of its/their development and the impact of the cells' environment on this signature as it relates to the cells' stem cell potential. The composition and combination of these signatures provides a means of identifying, manipulating and differentiating said adult stem cells and thus, their acquisition and utilization in research, diagnosis, and therapy of normal and pathological conditions. | 12-26-2013 |
20130345290 | PHARMACEUTICAL COMPOSITION CONTAINING L-DNA - The invention relates to the use of an L-DNA which is capable of binding to an L-RNA, in particular in an antisense reaction, and optionally of cleaving the L-RNA in the range of a target sequence of the L-RNA, for preparing a pharmaceutical composition for the treatment of undesired physiological side reactions due to the administration of a therapeutic molecule containing the L-RNA. The L-DNA can alternatively also be used for cleaving an endogenous target RNA or DNA. | 12-26-2013 |
20130345291 | METHODS AND COMPOSITIONS FOR THE SPECIFIC INHIBITION OF GENE EXPRESSION BY DOUBLE-STRANDED RNA - The invention provides compositions and methods for selectively reducing the expression of a gene product from a desired target gene, as well as treating diseases caused by expression of the gene. The method involves introducing into the environment of a cell an amount of a double-stranded RNA (dsRNA) such that a sufficient portion of the dsRNA can enter the cytoplasm of the cell to cause a reduction in the expression of the target gene. The dsRNA has a first oligonucleotide sequence that is between 26 and about 30 nucleotides in length and a second oligonucleotide sequence that anneals to the first sequence under biological conditions. In addition, a region of one of the sequences of the dsRNA having a sequence length of from about 19 to about 23 nucleotides is complementary to a nucleotide sequence of the RNA produced from the target gene. | 12-26-2013 |
20140005249 | NKX2.2 INHIBITORS AS DRUGS | 01-02-2014 |
20140005250 | Compositions and Methods for Increasing Drug Efficacy in Cancer | 01-02-2014 |
20140005251 | MiRNA for Treating Diseases and Conditions Associated with Neo-angiogenesis | 01-02-2014 |
20140005252 | MODULATION OF ALPHA SYNUCLEIN EXPRESSION | 01-02-2014 |
20140005253 | COMPOSITIONS AND METHODS FOR TREATING LUNG DISEASE AND INJURY | 01-02-2014 |
20140011858 | Inhibitor of IRS-1 for Treating Skin Disorders - The present invention relates to an inhibitor of the expression of IRS-1 for treating an angiogenic and/or inflammatory skin disease. The present invention also relates to a transdermal composition, preferably an ointment, comprising an inhibitor of the expression of IRS-1, and to the use thereof for treating an angiogenic and/or inflammatory skin disease. | 01-09-2014 |
20140011859 | ANTIMIR-451 FOR THE TREATMENT OF POLYCYTHEMIAS - The present invention provides methods of treating diseases and disorders associated with aberrant erythropoiesis. Specifically, the present invention provides a method for treating polycythemia in a subject by administering an inhibitor of miR-451. Methods of increasing red blood cell count and treating anemia in a subject by administering miR-451 mimetics are also disclosed. | 01-09-2014 |
20140011860 | COMPOUNDS AND METHODS FOR MODULATING TARGET NUCLEAR AND SUB-NUCLEAR NUCLEIC ACID MOLECULES IN CELLS AND ANIMALS - Compounds and methods for modulating target nucleic acids found in organelles or sub-organelles of cells are provided. The compounds and methods modulate target nucleic acids in a sub-nuclear organelle include, but are not limited to, the nucleolus and/or a cajal body of animal cells. | 01-09-2014 |
20140011861 | Materials and Methods for Determining Diagnosis and Prognosis of Prostate Cancer - Materials and methods related to diagnosing and/or determining prognosis of prostate cancer. | 01-09-2014 |
20140011862 | Compositions and Methods for Treating Leukemia - The invention provides compositions, methods, and kits for the treatment of acute myeloid leukemia in a subject. | 01-09-2014 |
20140011863 | METHODS AND COMPOSITIONS FOR ASSESSMENT OF PULMONARY FUNCTION AND DISORDERS - The present invention provides methods for the assessment of risk of developing chronic obstructive pulmonary disease (COPD), emphysema or both COPD and emphysema in smokers and non-smokers using analysis of genetic polymorphisms. | 01-09-2014 |
20140018408 | OLIGONUCLEOTIDES FOR TREATING INFLAMMATION AND NEOPLASTIC CELL PROLIFERATION - There is provided oligonucleotides directed against the CCR3 receptor and the common beta sub-unit of IL-3, IL-5 and GMCSF receptors. The oligonucleotides are useful to inhibit general inflammation, including inflammation associated with asthma, COPD, allergy, Cystic fibrosis (CF), hypereosinophilia and neoplastic cell proliferation such as cancer. | 01-16-2014 |
20140018409 | Method for Determining Hepatocellular Carcinoma Subtype and Detecting Hepatic Cancer Stem Cells - Described herein are methods of determining an HCC subtype in a subject which includes a) obtaining a sample from the subject, b) assaying the sample to detect the expression of 1 or more biomarkers, and c) correlating the expression of the biomarkers with an HCC subtype in a subject. Also described are methods of detecting HCC stem cells in a sample, and methods and compositions for treating subjects with HCC that take advantage of the biomarkers associated with HCC stem cells. | 01-16-2014 |
20140018410 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF KLF-1 AND BCL11A GENES - The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the KLF1 gene and the BCL11A gene, and methods of using such dsRNA compositions to inhibit expression of KLF1 and BCL11 A, respectively. | 01-16-2014 |
20140018411 | Methods for Diagnosing Prostate Cancer using MicroRNAs - Described herein are methods for diagnosing prostate cancer using microRNAs. Also described are methods and compositions for the diagnosis and treatment of solid cancers. Methods of identifying inhibitors of tumorigenesis are also provided. | 01-16-2014 |
20140018412 | Methods for Diagnosing Lung Cancer using MicroRNAs - Described herein are methods for diagnosing lung cancer using microRNAs. Also described are methods and compositions for the diagnosis and treatment of solid cancers. Methods of identifying inhibitors of tumorigenesis are also provided. | 01-16-2014 |
20140018413 | MIRNA LENTIVIRUS VECTOR - A miRNA lentivirus vector including a sequence No. 11. The vector is capable of improving the fertility of animals by inhibiting the expression of inhibin of animals. | 01-16-2014 |
20140024698 | METHODS FOR TREATING PROGEROID LAMINOPATHIES USING OLIGONUCLEOTIDE ANALOGUES TARGETING HUMAN LMNA - Provided are methods of treatment in subjects having progeroid diseases and related conditions which rely upon LMNA-targeted antisense oligonucleotides for reducing expression of one or more aberrantly spliced LMNA mRNA isoforms that encode progerin. | 01-23-2014 |
20140024699 | COMPOSITIONS AND METHODS FOR INCREASING ERYTHROPOIETIN (EPO) PRODUCTION - The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting one or more EGLN genes, EGLN1, EGLN2 and/or EGLN3 and methods of using such dsRNA compositions to inhibit expression of these genes. | 01-23-2014 |
20140024700 | BLOOD-BORNE MIRNAS AS SURROGATE MARKERS OF DRUG EFFICACY FOR CARDIAC CONDITIONS - The present invention provides methods for evaluating or monitoring the efficacy of a therapeutic intervention for treating a cardiac disorder. Such methods comprise measuring or detecting the level of at least one miRNA in a biological sample from a patient receiving the therapeutic intervention and comparing the level to the level of said at least one miRNA in a control sample, wherein the measured level of said at least one miRNA is indicative of the therapeutic efficacy of the therapeutic intervention. Methods of predicting or assessing the severity or progression of heart failure in a patient by measuring one or more miRNAs in a biological sample from the patient are also disclosed. | 01-23-2014 |
20140031409 | METHODS FOR TREATING ANDROGEN RECEPTOR DEPENDENT DISORDERS INCLUDING CANCERS - The invention provides the combination use of antisense oligomers targeting androgen receptor mRNA and androgen receptor binding inhibitors that reduce androgen receptor activity for the treatment of androgen receptor related medical disorders, such as cancers, particularly prostate cancers and breast cancers. | 01-30-2014 |
20140031410 | COMPOSITIONS AND METHODS FOR MODULATING ANGIOGENESIS - The invention generally features compositions and methods that are useful for modulating angiogenesis. | 01-30-2014 |
20140031411 | GPNMB/OSTEOACTIVIN AS A BIOMARKER AND DRUG TARGET IN CARDIAC DISEASES - The present invention relates to the gene Gpnmb and its use as a genetic marker in the incidence of cardiovascular conditions and cardiac diseases, such as complications derived from myocardial infarction. Gpnmb provides a valuable tool both for diagnostic as well as therapeutic approaches, in order to treat or prevent cardiovascular conditions and cardiac diseases, in particular complications derived from myocardial infarction. | 01-30-2014 |
20140031412 | METHOD OF TREATMENT - The present disclosure teaches the treatment of a blood pathology, such as a blood pathology associated with impaired hemoglobin synthesis including the treatment of β-thalassemia or a related hemoglobinopathy. An RNA molecule such as a short interfering RNA or a hairpin RNA which targets an mRNA species encoding α-globin is administered to a subject to reduce the amount of α-globin produced to non-zero levels and ameliorate the effects of an α- and β-globin chain imbalance. | 01-30-2014 |
20140031413 | METHOD AND COMPOSITIONS COMPRISING SMALL RNA AGONIST AND ANTAGONISTS TO MODULATE INFLAMMATION - The disclosure provides methods and compositions for modulating inflammation. | 01-30-2014 |
20140031414 | SIRNA TARGETING VEGFA AND METHODS FOR TREATMENT IN VIVO - Vascular endothelial growth factor A (VEGFA) is a chemical signal produced by cells that stimulates the growth of new blood vessels, and overexpression of VEGFA can lead to undesirable physiological conditions. Through the identification of new siRNA and modifications that improve the silencing ability of these siRNA in vivo, therapeutic compositions and methods have been invented to address the problems associated with this overexpression. | 01-30-2014 |
20140031415 | METHODS AND COMPOSITIONS INVOLVING MIRNA AND MIRNA INHIBITOR MOLECULES - The present invention concerns methods and compositions for introducing miRNA activity or function into cells using synthetic nucleic acid molecules. Moreover, the present invention concerns methods and compositions for identifying miRNAs with specific cellular functions that are relevant to therapeutic, diagnostic, and prognostic applications wherein synthetic miRNAs and/or miRNA inhibitors are used in library screening assays. | 01-30-2014 |
20140039032 | LIPID NANO PARTICLES COMPRISING CATIONIC LIPID FOR DRUG DELIVERY SYSTEM - The present invention provides a lipid nano-particles, which allow nucleic acids to be easily introduced into cells, comprising a cationic lipid represented by formula (I)
| 02-06-2014 |
20140039033 | NOVEL PANCREATIC CANCER BIOMARKER USING THE CHARACTERISTICS OF PANCREATIC CANCER STEM CELLS, AND USE THEREOF - The present invention relates to a novel molecular marker for pancreatic cancer stem cells and pancreatic cancer, to a marker detection method, and to a screening method. The present invention is a marker discovered from the cell lines of pancreatic cancer, wherein the marker may detect pancreatic cancer, in particular early pancreatic cancer, through the detection of a pancreatic cancer stem cell marker. In addition, the marker of the present invention may enable an accurate diagnosis and prognosis analysis of pancreatic cancer. | 02-06-2014 |
20140039034 | COMPOSITION FOR SUPPRESSING EXPRESSION OF TARGET GENE - The present invention provides a composition that comprises a lipidparticle encapsulating a double-stranded nucleic acid molecule,
| 02-06-2014 |
20140039035 | COMPOSITIONS AND METHODS FOR TREATING OBESITY - The present invention relates to the field of obesity. More specifically, the present invention provides methods and compositions useful in treating obesity and obesity-associated conditions. In a specific embodiment, a method for treating obesity comprises administering an effective amount of an agent that inhib its expression of neuropeptide Y (NPY). In another embodiment, the present invention provides a recombinant nucleic acid construct comprising a nucleic acid sequence encoding an oligonucleic acid, wherein the oligonucleic acid comprises at least one sequence substantially complementary to at least a part of the neuropeptide Y (NPY) gene or transcript thereof, and wherein the oligonucleic acid inhibits or reduces the expression of NPY. | 02-06-2014 |
20140039036 | Methods for Identifying Subjects with a Genetic Risk for Developing IgA Nephropathy - Seven protective alleles for IgA nephropathy have been discovered that can be identified by analyzing a DNA sample for seven respective SNPs. A method is provided for identifying and treating subjects at risk of developing IgA neuropathy based on a new seven-SNP genetic risk score. Also provided are screening methods to identify compounds that bind to and reduce the expression or biological activity of a either CFHR1 or CFHR3. | 02-06-2014 |
20140039037 | ANTISENSE OLIGONUCLEOTIDE DIRECTED REMOVAL OF PROTEOLYTIC CLEAVAGE SITES, THE HCHWA-D MUTATION, AND TRINUCLEOTIDE REPEAT EXPANSIONS - Described are methods for removing a proteolytic cleavage site, the HCHWA-D mutation or the amino acids encoded by a trinucleotide repeat expansion from a protein comprising providing a cell that expresses pre-mRNA encoding the protein with an anti-sense oligonucleotide that induces skipping of the exonic sequence that comprises the proteolytic cleavage site, HCHWA-D mutation or trinucleotide repeat expansion, respectively, the method further comprising allowing translation of mRNA produced from the pre-mRNA. | 02-06-2014 |
20140039038 | MULTI-CONJUGATE OF SIRNA AND PREPARING METHOD THEREOF - The present invention relates to a multi-conjugate of small interfering RNA (siRNA) and a preparing method of the same, more precisely a multi-conjugate of siRNA prepared by direct binding of double stranded sense/antisense siRNA monomers or indirect covalent bonding mediated by a cross-linking agent or a polymer, and a preparing method of the same. The preparing method of a siRNA multi-conjugate of the present invention is characterized by simple and efficient reaction and thereby the prepared siRNA multi-conjugate of the present invention has high molecular weight multiple times the conventional siRNA, so that it has high negative charge density, suggesting that it has excellent ionic interaction with a cationic gene carrier and high gene delivery efficiency. | 02-06-2014 |
20140039039 | ORGANIC COMPOSITIONS TO TREAT HSF1-RELATED DISEASES - The present disclosure relates to methods of treating heat shock factor 1 (HSF1)-related diseases such as cancer and viral diseases, using a therapeutically effective amount of a RNAi agent to HSF. | 02-06-2014 |
20140039040 | ANALGESIC METHOD - An analgesic medication includes an oligonucleotide being a double strand RNA comprising 18 to 70 base pairs, and a pharmaceutical acceptable vehicle for delivering the said oligonucleotide into cells, wherein a dosage of the oligonucleotide in the analgesic is 50 μg to 200 μg/kg per time, and the pharmaceutical acceptable vehicle is selected from a group of polyethyleneimine, lipofectamine and iFect. | 02-06-2014 |
20140045913 | LIPID NANO PARTICLES COMPRISING COMBINATION OF CATIONIC LIPID - The present invention provides a lipid nano-particles, which allow nucleic acids to be easily introduced into cells, comprising a cationic lipid represented by formula (I)
| 02-13-2014 |
20140045914 | RECOMBINANT PROTEIN FOR SIRNA DELIVERY AND COMPOSITION COMPRISING THE SAME - This invention relates to a recombinant protein for siRNA delivery and a composition comprising the same. The recombinant proteins for siRNA delivery of the invention can secure the stability of siRNAs from external attacks such as various degradation enzymes, have selective binding affinity to cancer cells by virtue of target-oriented peptides having various cancer cells as their target, and silence target genes by effectively delivering the siRNAs to cells and biological tissues by the release of the siRNAs to the cytoplasms after the cell penetration thereof. Therefore, they are expected to be effectively employed as siRNA delivery vehicles for siRNA therapeutic agents, cell-based drug screening compositions and research. | 02-13-2014 |
20140045915 | CANCER-RELATED BIOLOGICAL MATERIALS IN MICROVESICLES - Disclosed herein are methods for assaying a biological sample from a subject by analyzing components of microvesicle fractions in aid of risk, diagnosis, prognosis or monitoring of or directing treatment of the subject for, a disease or other medical condition in the subject. Also disclosed are methods of treatment and identifying biomarkers using a microvesicle fraction of a subject. Kits, pharmaceutical compositions, and profiles related to the methods are also disclosed. | 02-13-2014 |
20140045916 | SPLICE-REGION ANTISENSE COMPOSITION AND METHOD - Antisense compositions targeted against an mRNA sequence coding for a selected protein, at a region having its 5′ end from 1 to about 25 base pairs downstream of a normal splice acceptor junction in the preprocessed mRNA, are disclosed. The antisense compound is RNase-inactive, and is preferably a phosphorodiamidate-linked morpholino oligonucleotide. Such targeting is effective to inhibit natural mRNA splice processing, produce splice variant mRNAs, and inhibit normal expression of the protein. | 02-13-2014 |
20140045917 | Composition Containing Antisense Oligonucleotide to Micro RNA - Provided is a composition that contains an antisense oligonucleotide to a micro RNA and is capable of inhibiting the growth of cancer cells. The present invention, as one aspect, relates to a composition for suppressing the growth of human cancer cells, the composition containing an antisense oligonucleotide to a micro RNA, wherein the micro RNA is selected from the group consisting of hsa-miR-133a, hsa-miR-133b, hsa-miR-346 and hsa-miR-361-3p. The present invention, as another aspect, relates to a composition for suppressing the growth of human head/neck cancer cells, the composition containing an antisense oligonucleotide to a micro RNA, wherein the micro RNA is selected from the group consisting of hsa-miR-92a, hsa-miR-133a, hsa-miR-133b, hsa-miR-139-5p, hsa-miR-197, hsa-miR-328, hsa-miR-346, hsa-miR-361-3p, hsa-miR-605, hsa-miR-766, hsa-miR-1228, hsa-miR-1252, hsa-miR-1260 and hsa-miR-1271. | 02-13-2014 |
20140045918 | Materials and Methods Related to MicroRNA-21, Mismatch Repair, and Colorectal Cancer - The present invention discloses the discovery that miR-21 targets and down-regulates the core mismatch repair (MMR) recognition protein complex hMSH2 and hMSH6. Anti-sense miR-21 is therefore proven as therapeutic herein. Therefore, compositions, kits, therapies and other methods, including methods of treatment/amelioration of symptoms, are disclosed in the present invention. | 02-13-2014 |
20140045919 | Folate Conjugates - The present invention provides iRNA agent including at least one monomer having the structure shown in formula (I′) | 02-13-2014 |
20140045920 | METHODS AND COMPOSITIONS FOR THE DIAGNOSIS, CLASSIFICATION, AND TREATMENT OF CANCER - Some embodiments of the present technology relate to methods and compositions for the diagnosis and treatment of cancer. Some embodiments include methods and compositions for the diagnosis and treatment of castration-resistant prostate cancer. Some embodiments include methods and compositions for the diagnosis and treatment of pancreatic cancer. | 02-13-2014 |
20140045921 | TRANSCRIPTIONAL REPRESSION LEADING TO PARKINSON'S DISEASE - Parkinson's disease is caused by the preferential loss of substantia nigra dopamine neurons. A Parkin Interacting Substrate, PARIS (ZNF746) is identified. The levels of PARIS are regulated by the ubiquitin proteasome system via binding to and ubiquitination by the E3 ubiquitin ligase, parkin. PARIS is a KRAB and zinc finger protein that accumulates in models of parkin inactivation and in human brain Parkinson's disease patients. PARIS represses the expression of the transcriptional co-activator, PGC-1α and the PGC-1α target gene, NRF-1 by binding to insulin response sequences in the PGC-1α promoter. Conditional knockout of parkin in adult animals leads to progressive loss of dopamine (DA) neurons that is PARIS dependent. Overexpression of PARIS causes selective loss of DA neurons in the substantia nigra, which is reversed by either parkin or PGC-1α co-expression. The identification of PARIS provides a molecular mechanism for neurodegeneration due to parkin inactivation. | 02-13-2014 |
20140045922 | RNAi Modulation Of ApoB And Uses Thereof - The invention relates to compositions and methods for modulating the expression of apolipoprotein B, and more particularly to the downregulation of apolipoprotein B by chemically modified oligonucleotides. | 02-13-2014 |
20140051743 | REGULATOR, PHARMACEUTICAL COMPOSITION ENCOMPASSING THE REGULATOR AND APPLICATION THEREOF - The present disclosure is directed to a regulator, a pharmaceutical composition encompassing the regulator and the application thereof The regulator modulates the expression integrins and/or EMP2, and is employed for treating integrins-associated and/or EMP2-associated diseases. | 02-20-2014 |
20140051744 | Markers For Assessing the Susceptibility of Cancer to Survivin-Targeting miRNA Treatment - The present invention relates to the use of miRNA treatment of survivin-positive cancer cells to increase sensitivity of cells to chemotherapy. | 02-20-2014 |
20140051745 | MICRO-RNAS OF THE MIR-15 FAMILY MODULATE CARDIOMYOCYTE SURVIVAL AND CARDIAC REPAIR - A family of microRNAs, called the miR-15 family, which includes miR-195, are shown to be up-regulated during pathological cardiac remodeling and repress the expression of mRNAs required for cell proliferation and survival, with consequent loss of cardiomyocytes. Strategies to block expression of the miR-15 family in the heart as a treatment for diverse cardiac disease are provided. | 02-20-2014 |
20140051746 | METHODS TARGETING MIR-128 FOR REGULATING CHOLESTEROL/LIPID METABOLISM - Methods for targeting microRNA 128 (miR-128) for regulating cholesterol/lipid metabolism and insulin sensitivity. | 02-20-2014 |
20140051747 | Compositions and Methods for Inhibiting Expression of an RNA from West Nile Virus - This invention relates to double-stranded ribonucleic acid (dsRNA), and its use in mediating RNA interference to inhibit the expression of an RNA from the West Nile virus (WNV), and the use of the dsRNA to treat pathological processes mediated by WNV infection, such as viral encephalitis. | 02-20-2014 |
20140057960 | NOVEL REPRESSOR ON IFN-LAMBDA PROMOTER AND SIRNA AGAINST ZEB1 AND BLIMP-1 TO INCREASE IFN-LAMBDA GENE ACTIVITY - The present invention is directed to the identification of a novel repressor located between ˜1.2 kb to ˜1.6 kb from the translation start site of the IFN-λ1 promoter. The present invention provides a method of using siRNAs against ZEB1 (binds to the repressor region) and BLIMP-1 (binds outside the repressor region) and increases the promoter activity of IFN-λ1 (i.e., increases the production of IFN-λ1 protein). siRNAs against ZEB1 mRNA or BLIMP-1 mRNA increase IFN-λ1 gene activity. There is provided a therapeutic application of siRNAs against ZEB1 and BLIMP-1 mRNAs in treating a mammal (including a human) by increasing the production of IFN-λ1 protein that promotes an anti-viral response as well as treats asthma diseases and colon diseases. | 02-27-2014 |
20140057961 | SIN3B COMPLEX INHIBITION AND USE THEREOF IN THE PREVENTION OF PRO-ONCOGENIC INFLAMMATION AND CANCER - Methods for inactivating Sin3B and its associated activities to prevent, inhibit or attenuate pro-oncogenic inflammation and cancer progression, in particular pancreatic cancer progression are provided. | 02-27-2014 |
20140057962 | Compositions and Methods for the Treatment of Cancer - Compositions and methods for treating, detecting, and diagnosing cancer are disclosed. | 02-27-2014 |
20140057963 | OLIGOMERIC COMPOUNDS AND COMPOSITIONS FOR USE IN MODULATION OF SMALL NON-CODING RNAS - Compounds, compositions and methods are provided for modulating the expression and function of small non-coding RNAs. The compositions comprise oligomeric compounds, targeted to small non-coding RNAs. Methods of using these compounds for modulation of small non-coding RNAs as well as downstream targets of these RNAs and for diagnosis and treatment of disease associated with small non-coding RNAs are also provided. | 02-27-2014 |
20140057964 | Oligomers - Molecules are provided for inducing or facilitating exon skipping in forming spliced mRNA products from pre-mRNA molecules in cells. The molecules may be provided directly as oligonucleotides or expression products of vectors that are administered to a subject. High rates of skipping can be achieved. High rates of skipping reduce the severity of a disease like Duchene Muscular Dystrophy so that the disease is more like Becker Muscular Dystrophy. This is a severe reduction in symptom severity and mortality. | 02-27-2014 |
20140057965 | dsRNA For Treating Viral Infection - The invention relates to double-stranded ribonucleic acids (dsRNAs) targeting gene expression of phosphatidylinositol 4-kinase (PI4K), in particular human phosphatidylinositol 4-kinase, catalytic, beta polypeptide (PIK4CB) or human phosphatidylinositol 4-kinase, catalytic, alpha polypeptide (PIK4CA), and their use for treating infection by positive stranded RNA viruses such as hepatitis C virus (HCV). Each dsRNA comprises an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of the PIK4CB or PIK4CA target mRNA. A plurality of such dsRNA may be employed to provide therapeutic benefit. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier, and including a delivery modality such as fully encapsulated liposomes or lipid complexes. The invention further includes methods for treating diseases caused by positive stranded RNA virus infection using the pharmaceutical compositions; and methods for inhibiting the propogation of positive stranded RNA viruses in and between cells. | 02-27-2014 |
20140057966 | METASTASIS SPECIFIC SPLICE VARIANTS OF MENA AND USES THEREOF IN DIAGNOSIS, PROGNOSIS AND TREATMENT OF TUMORS - Methods and kits for diagnosis, prognosis and treatment of metastatic tumors are provided where the metastatic tumor is characterized by changes in expression of +++, ++ and/or 11 | 02-27-2014 |
20140057967 | METHOD OF SCREENING FOR CHAPERONIN MODULATOR - The present invention relates to a method of screening for modulator of chaperonin that is involved in protein aggregation inducing neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease and Huntington's disease, use of the chaperonin modulator screened by the method for prevention and treatment of neurodegenerative diseases. According to the present invention, novel negative chaperonin modulator is provided, and chaperonin modulator may be more rapidly and conveniently screened with the negative modulator as a target. Furthermore, by using the screened material, neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease and Huntington's disease may be effectively prevented or treated without concern for cell death due to autophagy, which is the existing method of removing protein aggregate. | 02-27-2014 |
20140066490 | SYSTEM AND METHOD FOR MODIFYING DEOXYRIBOZYMES - A system and method for programming DNAzymes to be utilized as programmable drugs, which are active only in the presence of specific input combinations and/or certain conditions. | 03-06-2014 |
20140066491 | CHEMICAL MODIFICATION MOTIFS FOR MIRNA INHIBITORS AND MIMETICS - The present invention provides polynucleotides having chemistry patterns that provide for improved stability, potency, and/or toxicity relative to their use as miRNA inhibitors or miRNA mimetics. The invention further provides pharmaceutical compositions and formulations comprising the polynucleotides, and methods for treating patients having a condition associated with miRNA or mRNA expression. | 03-06-2014 |
20140066492 | SPINAL MUSCULAR ATROPHY (SMA) TREATMENT VIA TARGETING OF SMN2 SPLICE SITE INHIBITORY SEQUENCES - The present invention is directed to methods and compositions capable of blocking the inhibitory effect of a newly-identified intronic inhibitory sequence element, named ISS-N1 (for “intronic splicing silencer”), located in the SMN2 gene. The compositions and methods of the instant invention include oligonucleotide reagents (e.g., oligoribonucleotides) that effectively target the SMN2 ISS-N1 site in the SMN2 pre-mRNA, thereby modulating the splicing of SMN2 pre-mRNA to include exon 7 in the processed transcript. The ISS-N1 blocking agents of the invention cause elevated expression of SMN protein, thus compensating for the loss of SMN protein expression commonly observed in subjects with spinal muscular atrophy (SMA). | 03-06-2014 |
20140073683 | MODIFIED SMALL INTERFERING RNA MOLECULES AND METHODS OF USE - The present invention provides double-stranded RNA molecules that mediate RNA interference in target cells, preferably hepatic cells. The invention also provides double-stranded RNA molecules that are modified to be resistant to nuclease degradation, which inactivates a virus, and more specifically, hepatitis C virus (HCV). The invention also provides a method of using these modified RNA molecules to inactivate virus in mammalian cells and a method of making modified small interfering RNAs (siRNAs) using human Dicer. | 03-13-2014 |
20140073684 | CHEMICALLY MODIFIED OLIGONUCLEOTIDES FOR USE IN MODULATING MICRO RNA AND USES THEREOF - This invention relates generally to chemically modified oligonucleotides useful for modulating expression of microRNAs and pre-microRNAs. More particularly, the invention relates to single stranded chemically modified oligonucleotides for inhibiting microRNA and pre-microRNA expression and to methods of making and using the modified oligonucleotides. Also included in the invention are compositions and methods for silencing microRNAs in the central nervous system. | 03-13-2014 |
20140073685 | METHOD OF INHIBITING NONSENSE-MEDIATED mRNA DECAY - Provided are methods for treating a NAD comprising administering to a patient suffering from a NAD a composition comprising an eIF5A inhibitor compound in an amount effective to prevent intracellular hypusination of eIF5A, whereby gene expression of NMD-susceptible mRNA is increased. | 03-13-2014 |
20140080892 | ANTISENSE MODULATION OF FIBROBLAST GROWTH FACTOR RECEPTOR 4 EXPRESSION - Antisense compounds, compositions and methods are provided for modulating the expression of fibroblast growth factor receptor 4 (FGFR4). The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding fibroblast growth factor receptor 4. Methods of using these compounds for modulation of fibroblast growth factor receptor 4 expression and for treatment of diseases associated with expression of fibroblast growth factor receptor 4 are provided. | 03-20-2014 |
20140080893 | MODULATION OF PHOSPHATIDYLINOSITOL-5-PHOSPHATE-4-KINASE ACTIVITY - The invention features methods for identifying compounds that modulate the activity of phosphatidylinositol 5-phosphate 4-kinase (PI5P4K) Inhibitors of PI5P4K can be used in, for example, the treatment or prevention of cell proliferation dis orders (e.g., the prevention of tumor cell growth in p53 mutated cancers). | 03-20-2014 |
20140080894 | ENHANCED BIODISTRIBUTION OF OLIGOMERS - This invention relates generally to oligomers useful for modulating expression and/or activity of RNAs or genes. More particularly, the invention relates to single stranded, double stranded, partially double stranded and hairpin structured chemically modified oligomers that have a broad biodistribution profile for inhibiting RNA expression in a plurality of cells, tissues, or organs, and to methods of making and using the modified oligomers. | 03-20-2014 |
20140080895 | COMBINATION OF ANTI-CLUSTERIN OLIGONUCLEOTIDE WITH HSP90 INHIBITOR FOR THE TREATMENT OF PROSTATE CANCER - The present invention provides a method for treating a mammalian subject affected by prostate cancer comprising i) an oligonucleotide which reduces clusterin expression and ii) a Heat Shock Protein 90 (Hsp90) inhibitor each in an amount that when in combination with the other is effective to treat the mammalian subject. The present invention also provides pharmaceutical compositions comprising an amount of an oligonucleotide which reduces clusterin expression, and a Hsp90 inhibitor for use in treating a mammalian subject affected by prostate cancer. Also provided are oligonucleotides which reduce clusterin expression for use in combination with a Hsp90 inhibitor in treating a mammalian subject affected by prostate cancer, and a composition for treating a mammalian subject affected by prostate cancer comprising i) an oligonucleotide which reduces clusterin expression and ii) a Hsp90 inhibitor each in an amount that when in combination with the other is effective to treat the mammalian subject. | 03-20-2014 |
20140080896 | IDENTIFICATION OF SMALL MOLECULES THAT FACILITATE THERAPEUTIC EXON SKIPPING - This invention relates, e.g., to a method for enhancing exon skipping in a pre-mRNA of interest, comprising contacting the pre-mRNA with an effective amount of a small molecule selected from the compounds shown in Table 1, or a pharmaceutically acceptable salt, hydrate, solvate, or isomer thereof, and, optionally, with an antisense oligonucleotide that is specific for a splicing sequence in the pre-mRNA Methods for treating Duchenne muscular dystrophy (DMD) are disclosed. | 03-20-2014 |
20140080897 | HYALURONIC ACID-NUCLEIC ACID CONJUGATE AND COMPOSITION FOR NUCLEIC ACID DELIVERY CONTAINING THE SAME - The present invention relates to a hyaluronic acid-nucleic acid conjugate for the development of in vivo nucleic acid delivery system, and the development of nucleic acid delivery system using the same. Specifically, a hyaluronic acid-nucleic acid complex wherein a hyaluronic acid-alkylenediamine conjugate and nucleic acid are connected by a disulfide bond; a composition for nucleic acid delivery comprising the hyaluronic acid-nucleic acid complex as an active ingredient; a method for preparing the hyaluronic acid-nucleic acid complex; and a method for in vivo delivery of nucleic acid, comprising administering the hyaluronic acid-nucleic acid complex to a subject are provided. | 03-20-2014 |
20140080898 | ANTISENSE OLIGONUCLEOTIDES FOR INDUCING EXON SKIPPING AND METHODS OF USE THEREOF - Antisense molecules capable of binding to a selected target site in the dystrophin gene to induce exon skipping are described. | 03-20-2014 |
20140080899 | miR-33 Inhibitors and Uses Thereof to Decrease Inflammation - The inhibition of miRNA miR-33 is shown to promote the polarization of macrophages from an M1 to an M2 phenotype. MiR-33 inhibitors are therefore useful for treating inflammation in subjects. Endogenous microRNAs can be silenced using antagomirs. The miR-33 inhibitor is preferably an antagomir having a single-stranded nucleic acid sequence that is complementary to at least 12 contiguous nucleotides in miR-33 and therefore forms a duplex with miR-33 under physiological conditions. | 03-20-2014 |
20140088169 | GENETIC CHANGES IN ATM AND ATR/CHEK1 AS PROGNOSTIC INDICATORS IN CANCER - The present invention relates to the discovery that, in human cancer, an 11q deletion of ATM together with an increase in ATR and CHEK1 expression correlates with resistance to ionizing radiation which could be overcome by inhibition of the ATR/CHEK1 pathway. It provides for methods of identifying patients unlikely to exhibit an adequate response to radiation therapy and/or chemotherapy who may benefit from ATR/CHEK1 pathway inhibition, as well as methods of treating said patients. | 03-27-2014 |
20140088170 | DIFFERENTIALLY EXPRESSED MICRORNA MOLECULES FOR THE TREATMENT AND DIAGNOSIS OF CANCER - A significant challenge in cancer research field is to define molecular features that distinguish cancer stem cells from normal stem cells. In this study, microRNA (miRNA) expression profiles in human glioblastoma stem cells were compared to that of normal neural stem cells using combined microarray and deep sequencing analyses. These studies led to the identification of several miRNAs that are differentially expressed in glioblastoma stem cells and normal neural stem cells. Characterizing the role of these miRNAs in glioblastoma stem cells is important for the development of miRNA-based therapies that specifically target tumor stem cells, but spare normal stem cells. | 03-27-2014 |
20140088171 | AGENTS FOR TREATING DISORDERS INVOLVING MODULATION OF RYANODINE RECEPTORS - The present invention relates to 1,4-benzothiazepine derivatives and their use to treat conditions, disorders and diseases associated with ryanodine receptors (RyRs) that regulate calcium channel functioning in cells. The invention also discloses pharmaceutical compositions comprising the compounds and uses thereof to treat diseases and conditions associated with RyRs, in particular cardiac, musculoskeletal and central nervous system (CNS) disorders. | 03-27-2014 |
20140088172 | RNAi-Mediated Inhibition of Histamine Receptor H1-Related Conditions - RNA interference is provided for inhibition of histamine receptor H1 mRNA expression, in particular, for treating patients having an HRH1-related condition or at risk of developing an HRH1-related condition such as allergic conjunctivitis, ocular inflammation, dermatitis, rhinitis, asthma, or allergy. | 03-27-2014 |
20140088173 | AGING MARKER, METHOD FOR EVALUATING AGING INHIBITOR, AND CANCER INHIBITOR - The present invention aims to elucidate a miRNA involved in cellular senescence and to provide a method of use thereof. The senescence marker of the present invention comprises a gene transcript of miR-22. Further, the method for evaluating a senescence inhibitor of the present invention comprises the step of measuring the expression level of a gene transcript of miR-22 in a sample in the presence of a test compound and in the absence of the test compound; and the step of comparing the expression level of the gene transcript of miR-22 in the sample in the presence of the test compound with the expression level of the gene transcript of miR-22 in the sample in the absence of the test compound. Further, the cancer inhibitor of the present invention comprises as an effective component a gene transcript of miR-22, which cancer inhibitor promotes cellular senescence and inhibits invasion and/or metastasis of cancer. | 03-27-2014 |
20140088174 | COMPOUNDS AND METHODS FOR ALTERING ACTIVIN RECEPTOR-LIKE KINASE SIGNALING - Described are compounds and methods useful in the promotion of muscle growth, the treatment of muscle loss or insufficient muscle growth, and the treatment of fibrotic conditions. | 03-27-2014 |
20140094500 | MULTIPLE EXON SKIPPING COMPOSITIONS FOR DMD - Provided are antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon skipping, and methods of use thereof to treat muscular dystrophy. | 04-03-2014 |
20140094501 | SiRNA Sequence-Independent Modification Formats for Reducing Off-Target Phenotypic Effects in RNAi, and Stabilized Forms Thereof - Modification formats having modified nucleotides are provided for siRNA. Short interfering RNA having modification formats and modified nucleotides provided herein reduce off-target effects in RNA interference of endogenous genes. Further modification formatted siRNAs are demonstrated to be stabilized to nuclease-rich environments. Unexpectedly, increasing or maintaining strand bias, while necessary to maintain potency for endogenous RNA interference, is not sufficient for reducing off-target effects in cell biology assays. | 04-03-2014 |
20140094502 | RNAi INHIBITION OF CTGF FOR TREATMENT OF OCULAR DISORDERS - RNA interference is provided for inhibition of connective tissue growth factor mRNA expression in ocular disorders involving CTGF expression. Ocular disorders involving aberrant CTGF expression include glaucoma, macular degeneration, diabetic retinopathy, choroidal neovascularization, proliferative vitreoretinopathy and wound healing. Such disorders are treated by administering interfering RNAs of the present invention. | 04-03-2014 |
20140094503 | RNA INTERFERENCE MEDIATED INHIBITION OF ISOCITRATE DEHYDROGENASE (IDH1) GENE EXPRESSION - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of IDH1 and mutant IDH1 gene expression and/or activity, and/or modulate an IDH1 or mutant IDH1 gene expression pathway. Specifically, the invention relates to double-stranded nucleic acid molecules, including small nucleic acid molecules such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules, that are capable of mediating or that mediate RNA interference (RNAi) against IDH1 or mutant IDH1 gene expression. | 04-03-2014 |
20140100261 | TRPM-2 ANTISENSE THERAPY - A method for treating an individual suffering from a cancer comprising administering to the individual a chemotherapeutic agent, and ii) one antisense oligonucleotide having nucleotides in the sequence set forth in Seq. ID No. 4 and which antisense oligonucleotide has a phosphorothioate modification that increases the stability thereof in vivo, wherein the cancer expresses testosterone-repressed prostate message-2 (TRPM-2), thereby treating said individual. | 04-10-2014 |
20140100262 | Methods and Compositions for Maintaining Blood-Brain Barrier Integrity - Methods of maintaining or improving blood-brain barrier integrity and increasing resistance to cytokine-induced cell permeability are disclosed. It has been discovered that down-regulating the expression or production of sulfoglucuronyl glycolipids, for example SGPG, in endothelial cells of the blood-brain barrier or the blood-nerve barrier reduces apoptosis of these endothelial cells and thereby promotes the integrity of the barriers. Promoting the integrity of these barriers includes, but is not limited to reducing or inhibiting passage of immune cells, pathogenic immunoglobins, or bio-degrading molecules across the blood-brain barrier or blood-nerve barrier into the nervous system. Down-regulating expression or production or SGPG also increases the resistance of the endothelial cells to cytokine-induced cell permeability. | 04-10-2014 |
20140100263 | METHODS FOR TREATMENT OF ALPORT SYNDROME - Provided herein are methods for the treatment of Alport Syndrome, using modified oligonucleotides targeted to miR-21. In certain embodiments, a modified oligonucleotide targeted to miR-21 improves kidney function and/or reduces fibrosis in subjects having Alport Syndrome. In certain embodiments, administration of a modified oligonucleotide targeted to miR-21 delays the onset of end-stage renal disease in a subject having Alport Syndrome. In certain embodiments, a modified oligonucleotide targeted to miR-21 delays the need for dialysis or kidney transplant in a subject having Alport Syndrome. | 04-10-2014 |
20140100264 | METHODS OF TREATMENT RELATING TO THE FMR1 GENE - A method of treating a human female to increase embryo survival and embryo quality includes administering an FMR1 enhancer to a human embryo to cause an increase in expression of an FMR1 gene. The FMR1 enhancer increases the expression of FMR1 genes in the human embryo with at least one of two alleles with less than 26 triple CGG repeats. | 04-10-2014 |
20140107176 | METHOD OF MODULATING A PROSTATE CANCER CELL - There is provided a method of modulating a prostate cancer cell, the method comprising administering to the prostate cancer cell an agent that augments vinculin expression levels in the cell. | 04-17-2014 |
20140107177 | Methods and Compositions for Transdermal Delivery of Nucleotides - The present invention relates to formulations and related methods for transdermal delivery of nucleic acids. Specifically, the invention relates to a formulation containing lipids and an alcohol and which is capable of providing effective transdermal delivery of nucleic acid. The formulation can be used effectively to deliver nucleic acids for gene therapy and the treatment of disease. | 04-17-2014 |
20140107178 | METHODS AND COMPOSITIONS FOR THE SPECIFIC INHIBITION OF MYC BY DOUBLE-STRANDED RNA - This invention relates to compounds, compositions, and methods useful for reducing MYC target RNA and protein levels via use of dsRNAs, e.g., Dicer substrate siRNA (DsiRNA) agents. | 04-17-2014 |
20140107179 | ORGANIC COMPOSITIONS TO TREAT Beta-ENaC-RELATED DISEASES - The present disclosure relates to RNAi agents useful in methods of treating Beta-ENaC-related diseases such as cystic fibrosis, pseudohypoaldosteronism type 1 (PHA1), Liddle's syndrome, hypertension, alkalosis, hypokalemia, and obesity-associated hypertension, using a therapeutically effective amount of a RNAi agent to Beta-ENaC. | 04-17-2014 |
20140107180 | MODULATION OF ANDROGEN RECEPTOR EXPRESSION - Certain embodiments are directed to compounds and compositions targeted to human androgen receptor (AR) for inhibiting androgen receptor levels in a cell, which can be useful for methods of treating cancer and inhibiting cancer cell growth or proliferation. | 04-17-2014 |
20140107181 | METHODS AND MEANS FOR TREATMENT OF OSTEOARTHRITIS - The present invention relates to in vivo and in vitro methods, agents and compound screening assays for inducing anabolic stimulation of chondrocytes, including cartilage formation enhancing pharmaceutical compositions, and the use thereof in treating and/or preventing a disease involving a systemic or local decrease in mean cartilage thickness in a subject. | 04-17-2014 |
20140107182 | SYNTHETIC MIMICS OF MIR-34 - Embodiments concern methods and compositions involving miR-34 mimics, including miR-34a and miR-34c mimics. In some embodiments, there are double-stranded RNA molecules with modified nucleotides having an active strand with a miR-34a sequence and a complementary passenger strand. In additional embodiments, there are double-stranded RNA molecules with modified nucleotides having an active strand with a miR-34c sequence and a complementary passenger strand. | 04-17-2014 |
20140107183 | MICRORNA COMPOUNDS AND METHODS FOR MODULATING MIR-21 ACTIVITY - Described herein are compositions and methods for the inhibition of miR-21 activity. The compositions have certain nucleoside modification patterns that yield potent inhibitors of miR-21 activity. The compositions may be used to inhibit miR-21, and also to treat diseases associated with abnormal expression of miR-21, such as fibrosis and cancer. | 04-17-2014 |
20140107184 | MODULATION OF HEPATITIS B VIRUS (HBV) EXPRESSION - Disclosed herein are antisense compounds and methods for decreasing HBV mRNA, DNA and protein expression. Such methods, compounds, and compositions are useful to treat, prevent, or ameliorate HBV-related diseases, disorders or conditions. | 04-17-2014 |
20140113950 | INTERFERENCE IN DERMAL AND FIBROTIC INDICATIONS - The present invention relates to RNAi constructs with improved tissue and cellular uptake characteristics and methods of use of these compounds in dermal and fibrotic applications. | 04-24-2014 |
20140113951 | Method of Treating Cancer by Inhibition of DNA Repair Proteins - Methods of treating cancer using antisense oligonucleotides directed against DNA double-strand break repair proteins such as BRCA2 or RAD51 are provided. The antisense oligonucleotides can be used alone, in tandem or in combination with other cancer therapies, in particular with therapies that lead to DNA damage, inhibition of DNA repair or inhibition of DNA synthesis, such as radiation, platinum drugs, alkylating agents, PARP inhibitors, or inhibitors of thymidylate synthase. | 04-24-2014 |
20140113952 | TRANSPOSABLE ELEMENTS, TDP-43, AND NEURODEGENERATIVE DISORDERS - A method that includes measuring the expression level of at least one transposon in a biological sample from a subject; and determining whether the measured transposon expression exceeds a predetermined level, and if so, administering to the subject a transposon inhibitor in an amount effective to reduce the expression level of a transposon. | 04-24-2014 |
20140113953 | Targeting MicroRNAs for Metabolic Disorders - Provided herein are methods and compositions for the treatment of metabolic disorders. Also provided herein are methods and compositions for the reduction of blood glucose level, the reduction of gluceoneogenesis, the improvement of insulin resistance and the reduction of plasma cholesterol level. In certain embodiments, the methods comprise inhibiting the activity of miR-103. In certain embodiments, the methods comprise inhibiting the activity of miR-107. In certain embodiments, the activity of both miR-103 and miR-107 is inhibited. In certain embodiments, such methods comprise administering a compound comprising an oligonucleotide targeted to a microRNA. | 04-24-2014 |
20140113954 | The Micrornaome - MicroRNAs (miR-NAs) are a class of small noncoding RNAs that have important regulatory roles in multicellular organisms. The public miRNA database contains 321 human miRNA sequences, 234 of which have been experimentally verified. To explore the possibility that additional miRNAs are present in the human genome, we have developed an experimental approach called miRNA serial analysis of gene expression (miRAGE) and used it to perform the largest experimental analysis of human miRNAs to date. Sequence analysis of 273,966 small RNA tags from human colorectal cells allowed us to identify 200 known mature miRNAs, 133 novel miRNA candidates, and 112 previously uncharacterized miRNA* forms. To aid in the evaluation of candidate miRNAs, we disrupted the Dicer locus in three human colorectal cancer cell lines and examined known and novel miRNAs in these cells. The miRNAs are useful to diagnose and treat cancers. | 04-24-2014 |
20140113955 | METHODS AND MEANS FOR EFFICIENT SKIPPING OF EXON 45 IN DUCHENNE MUSCULAR DYSTROPHY PRE-mRNA - The invention relates to a method for inducing or promoting skipping of exon 45 of DMD pre-mRNA in a Duchenne Muscular Dystrophy patient, preferably in an isolated (muscle) cell, the method comprising providing an isolate muscle cell with a molecule that binds to a continuous stretch of at least 21 nucleotides within said exon. The invention further relates to such molecule used in the method. | 04-24-2014 |
20140113956 | ERK INHIBITORS FOR USE IN TREATING SPINAL MUSCULAR ATROPHY - The present invention relates to a method for treating spinal muscular atrophy and other related neuromuscular disorders in a subject in need thereof, said method comprising administering a therapeutically effective amount of an ERK inhibitor, such as Selumetinib to said subject. | 04-24-2014 |
20140113957 | Compositions and Methods for Inhibition of Expression of Apolipoprotein C-III (APOC3) Genes - The invention relates to double-stranded ribonucleic acid (dsRNA) targeting an APOC3 gene, and methods of using the dsRNA to inhibit expression of APOC3. | 04-24-2014 |
20140113958 | HCV Combination Therapy - The present invention relates to the treatment of hepatitis C (HCV) infection by the combination treatment with a miR-122 inhibitor and a HCV NS5B RNA dependant RNA polymerase inhibitor. | 04-24-2014 |
20140121261 | C-MYC ANTISENSE OLIGONUCLEOTIDES AND METHODS FOR USING THE SAME TO TREAT CELL-PROLIFERATIVE DISORDERS - Provided herein are antisense oligonucleotides that can effectively prevent or decrease c-myc protein expression as well as decrease overall rates of cell proliferation in in vitro and mammalian in vivo models of cell proliferative disorders as well as methods for using the same. | 05-01-2014 |
20140121262 | Methods of Using microRNA-26a to Promote Angiogenesis - Methods for promoting angiogenesis, and for diagnosing the presence or risk of developing disorders associated with impaired angiogenesis or blood flow to a tissue in the body, using microRNA-26a (miR-26a). | 05-01-2014 |
20140121263 | LIPID FORMULATED DSRNA TARGETING THE PCSK9 GENE - This invention relates to composition and methods using lipid formulated siRNA targeted to a PCSK9 gene. | 05-01-2014 |
20140121264 | MICRORNA (miRNA) AND DOWNSTREAM TARGETS FOR DIAGNOSTIC AND THERAPEUTIC PURPOSES - In some embodiments, the invention is directed to a method for diagnosing fibrosis and/or fibrosis related diseases and to a method for screening a pharmaceutically active compound for the treatment of fibrosis and/or fibrosis related diseases. The present invention further relates to compositions for use in the treatment, amelioration, and/or prevention of fibrosis. In certain embodiments, the compositions modulate the activity of a miRNA for the treatment, amelioration, and/or prevention of fibrosis. In certain embodiments, the compositions inhibit the activity of miR-21 for the treatment, amelioration, and/or prevention of fibrosis. | 05-01-2014 |
20140128447 | NOVEL NON-PRIMATE HEPACIVIRUS - The invention is directed to immunogenic compositions and methods for inducing an immune response against Non-Primate Hepacivirus in an animal. In another aspect, the invention relates to antibodies that bind Non-Primate Hepacivirus polypeptides. In yet another aspect, the invention relates to methods for preventing, or reducing NPHV infection in an animal. | 05-08-2014 |
20140128448 | NUCLEIC ACID/POLYSACCHARIDE COMPLEX - An object of the present invention is to provide a highly stable nucleic acid-polysaccharide complex of an siRNA and schizophyllan. A nucleic acid-polysaccharide complex is formed by adding polydeoxyadenine in which at least part of the phosphodiester link portion is phosphorothioated to an siRNA and allowing the siRNA and schizophyllan to form a complex. | 05-08-2014 |
20140128449 | OLIGONUCLEOTIDE MODULATION OF SPLICING - The present invention relates to the selective modulation of pre-mRNA splicing, in particular, for that involving alternative splicing in disease-related proteins such as those involved in Duschenne's Muscular Dystropy and Spinal Muscular Atrophy. | 05-08-2014 |
20140128450 | Cancer Therapy - The present invention provides a method for treating a hyperproliferative disorder characterized by expression of a mutant form of p53 in a subject, the method comprising administering to the subject a therapeutically effective amount of an agent which inhibits promyelocytic leukemia (PML) protein. | 05-08-2014 |
20140128451 | Compositions and Methods for Delivery of MicroRNA to Cells - Provided herein are gold nanoparticles mediated non-viral delivery of miRNAs, siRNAs, genes and drugs. Nanoparticle platforms and combinatorial drug delivery vehicles comprises gold nanoparticles with a plurality of thilolated hyperbranched dendrons conjugated to the nanoparticle surface. The thiolated hyperbranched dendrons comprise chemically-modifiable surface groups, functionalized interior groups and nano-cavities within the hyperbranched structure to which a variety of payload molecules may be conjugated, optionally via a linker. Payload molecules may comprise nucleic acids, anticancer drugs and small molecule inhibitors, optionally with, non-cytotoxic signaling agents, for example, fluoroscein isothiocyanate. Successful manipulation of the degree of PEGylation and the amount of gold nanoparticles in a polyelectrolyte complex to evaluate the best formulation for highest payload delivery of chemically unmodified miRNA duplexes and stemloops is presented. Also provided are methods for delivering one or more therapeutic agents to a cell or tissue or for treating a pathophysiological condition in a subject by delivering the combinatorial drug delivery vehicles to a cell or tissue associated with the pathophysiological condition to facilitate internalization of the vehicle to effect treatment. | 05-08-2014 |
20140128452 | SUGAR CHAIN-RELATED GENE AND USE THEREOF - As a result of dedicated studies, the present inventors succeeded in discovering, for the first time, that fibrogenesis could be suppressed at the physiological tissue level by inhibiting sulfation at position 4 or 6 of GalNAc, which is a sugar that constitutes sugar chains. Furthermore, the present inventors conducted studies using various disease model animals, and as a result, successfully demonstrated that inhibitors of sulfation at position 4 or 6 of GalNAc had therapeutic effects on diseases caused by tissue fibrogenesis (tissue fibrogenic disorders). | 05-08-2014 |
20140128453 | MODULATION OF APOLIPOPROTEIN CIII (APOCIII) EXPRESSION - Provided herein are methods, compounds, and compositions for reducing expression of ApoCIII mRNA and protein in an animal. Also provided herein are methods, compounds, and compositions for increasing HDL levels and/or improving the ratio of TG to HDL and reducing plasma lipids and plasma glucose in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate any one or more of cardiovascular disease or metabolic disorder, or a symptom thereof. | 05-08-2014 |
20140135375 | Edible Transgenic Plants as Oral Delivery Vehicles for RNA-Based Therapeutics - Compositions and methods for delivery of therapeutic RNA molecules are disclosed. | 05-15-2014 |
20140135376 | NANOGELS - The present invention relates to a polymer according to Formulas (1) or (2): The present invention further relates to nanogels and nanoparticles made of a polymer according to general Formulas (1) and (2). The nanogels may comprise a biologically active component such as siRNA, miRNA, DNA, an (oligo)peptide or a proteins. | 05-15-2014 |
20140135377 | COMBINATION THERAPY - The invention is based on a finding that silencing PME-1 gene sensitizes cancer cells for apoptosis-inducing activity of certain small molecule chemotherapeutic agents. Thus, the invention is directed to a respective combination therapy, sensitization method and pharmaceutical compositions. | 05-15-2014 |
20140135378 | TARGETING EN2, PAX2, AND/OR DEFB1 FOR TREATMENT OF PROSTATE CONDITIONS - The present invention relates to methods and compositions for treating a prostate condition in a subject. The method comprises administering to the subject a subject effective amount of a pharmaceutical composition having a first agent that inhibits EN2 expression and/or EN2 activity and a second agent that inhibits PAX2 expression and/or PAX2 activity. The pharmaceutical composition may further comprise a third agent that enhances DEFB1 expression or activity. | 05-15-2014 |
20140135379 | METHOD OF FIXING AND EXPRESSING PHYSIOLOGICALLY ACTIVE SUBSTANCE - The present invention provides methods for retaining and expressing physiologically active substances in a target tissue-specific-manner, by administering the physiologically active substances to target submucous tissue. Specifically, the present inventors demonstrated that, when physiologically active substances were directly administered into submucous tissues without using a carrier, the physiologically active substances were effectively and safely retained at the administration sites over long periods without loss and diffusion, and produced the effect acting in a reservoir-like fashion. The physiologically active substances administered as described above were demonstrated to produce the therapeutic effect without having an influence on organs other than the administered organ. | 05-15-2014 |
20140142160 | Polycomb-associated Non-Coding RNAs - This invention relates to long non-coding RNAs (lncRNAs), libraries of those ncRNAs that bind chromatin modifiers, such as Polycomb Repressive Complex 2, inhibitory nucleic acids and methods and compositions for targeting lncRNAs. | 05-22-2014 |
20140142161 | RAAV-BASED COMPOSITIONS AND METHODS FOR TREATING ALPHA-1 ANTI-TRYPSIN DEFICIENCIES - The invention relates to isolated nucleic acids and rAAV-based compositions, methods and kits useful for treating genetic diseases (e.g., alpha-1 antitrypsin deficiency). | 05-22-2014 |
20140142162 | Compositions and Methods for Inhibition of Expression of Protein C (PROC) Genes - The invention relates to double-stranded ribonucleic acid (dsRNA) targeting a PROC gene, and methods of using the dsRNA to inhibit expression of PROC. At least one nucleotide of the dsRNA can be a modified nucleotide, e.g., a 2-0-methyl modified nucleotide, a nucleotide comprising a 5′-phosphorothioate group, and a terminal nucleotide linked to a cholesteryl derivative or dodecanoic acid bisdecylamide group. Other examples of modified nucleotides include a 2′-deoxy-2′-fluoro modified nucleotide, a 2′-deoxymodified nucleotide, a locked nucleotide, an abasic nucleotide, 2′-amino-modified nucleotide, 2′-alkyl-modified nucleotide, morpholino nucleotide, a phosphoramidate, and a non-natural base comprising nucleotide. A dsRNA of the invention can include one or more of any of these modified nucleotides. | 05-22-2014 |
20140142163 | Antisense Oligonucleotides (ODN) Against SMAD7 and Uses Thereof in Medical Field - The invention relates to antisense oligonucleotidic sequences (ODN) against Smad7 suitably modified, and their uses in medical field as therapeutic biological agents, in particular in the treatment of chronic inflammatory bowel disease, such as Crohn's disease and ulcerative colitis. | 05-22-2014 |
20140148496 | Therapeutic and Diagnostic Method for Ataxia-Telangiectasia - ATM kinase is shown to regulate proteasome-mediated protein turnover through suppression of the expression of the ubiquitin-like protein ISG15 (Interferon Stimulated Gene 15). Silencing of the ISG15 pathway restored both the ubiquitin and autophagy pathways, and the UV-mediated degradation of their substrates in A-T cells. The ATM kinase negatively regulates the ISG15 pathway, and the constitutively elevated ISG15 pathway induces proteinopathy in A-T cells, and in A-T patients. These findings indicate that proteasome-mediated protein degradation is impaired in A-T cells due to elevated expression of the ISG15 conjugation pathway, which contributes to progressive neurodegeneration in A-T patients. The ISG15 pathway is a new target for both detection and treatment of A-T Inhibitors if ISG15 expression can be used to inhibit or attenuate neurodegeneration in A-T patients. In addition, an inhibitor of the early phase of autophagy, 3-MA, was shown to be effective in decreasing the impaired proteasome-mediated protein degradation in A-T cells, and thus would be effective in decreasing the neurodegeneration in A-T patients. | 05-29-2014 |
20140148497 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF CD274/PD-L1 GENE - The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the CD274/PD-L1 gene, and methods of using such dsRNA compositions to inhibit expression of CD274/PD-L1. | 05-29-2014 |
20140148498 | METHODS AND COMPOSITIONS FOR THE TREATMENT OF MARFAN SYNDROME AND ASSOCIATED DISORDERS - The instant invention provides methods and compositions for the treatment and prevention of Marfan syndrome and related diseases, disorders and conditions. The invention further provides pharmaceutical compositions and kits for the treatment and prevention of Marfan syndrome and related diseases, disorders and conditions. | 05-29-2014 |
20140148499 | METHODS AND REAGENTS FOR EFFICIENT CONTROL OF HIV PROGRESSION - The invention relates to methods for the identification of HIV-1 infected subjects capable of controlling viral load based on the determination of the expression levels of several miRNAs. In addition, the invention also relates to methods for controlling HIV infection by using some of the differentially expressed miRNAs or polynucleotides encoding said miRNAs, as well as to compositions comprising a miRNA or a polynucleotide encoding said miRNA and an anti-HIV agent. | 05-29-2014 |
20140155458 | Compositions and Methods for Treating Neoplasia - The invention features compositions comprising microRNAs that are differentially regulated in dormant versus fast growing neoplasias, and related methods of using the microRNAs for inducing or prolonging dormancy in a neoplastic cell or otherwise inhibiting the growth of a neoplastic cell. | 06-05-2014 |
20140155459 | Compositions and Methods of Using Micro RNAs - The present invention provides compositions and methods of using microRNAs to treat pulmonary arterial hypertension. In one aspect, methods are disclosed that are useful for identifying a subject in need of therapeutic intervention to reduce or improve a symptom of pulmonary arterial hypertension, reducing proliferation of pulmonary vascular cells in a subject, or treating pulmonary arterial hypertension in a subject. In another aspect, compositions include an inhibitor of fibroblast growth factor 2 (FGF2) expression comprising at least one of: a mature sequence of miR-424 or miR-503; a pri-miRNA of miR-424 or miR-503; a pre-miRNA of miR-424 or miR-503; and the complement thereof. Pharmaceutical compositions for reducing proliferation of pulmonary vascular cells in a subject in need thereof and biomarker panels are also disclosed. | 06-05-2014 |
20140155460 | MICRO-RNA'S THAT REGULATE MUSCLE CELLS - The present invention describes microRNAs that regulate the differentiation, proliferation and death of cardiac and skeletal muscles cells. These molecules represent unique targets in the developmental pathways of muscle cells. They also can be used as active agents to induce differentiation in progenitor cells, and their down-regulation permits the maintenance and expansion of progenitor cell populations. | 06-05-2014 |
20140155461 | MOLECULAR TARGETS AND COMPOUNDS, AND METHODS TO IDENTIFY THE SAME, USEFUL IN THE TREATMENT OF BONE AND JOINT DEGENERATIVE DISEASES - The present invention relates to methods for identifying agents capable of inhibiting the expression or activity of proteins involved in the processes modulating osteoclastogenesis, which inhibition is useful in the prevention and/or treatment of bone and joint degenerative diseases and diseases involving aberrant activity or differentiation of osteoclasts. In particular, the present invention provides methods for identifying agents for use in the prevention and/or treatment of rheumatoid arthritis. | 06-05-2014 |
20140155462 | METHODS AND COMPOSITIONS FOR THE SPECIFIC INHIBITIONS OF EGFR BY DOUBLE-STRANDED RNA - This invention relates to compounds, compositions, and methods useful for reducing EGFR target RNA and protein levels via use of dsRNAs, e.g., Dicer substrate siRNA (DsiRNA) agents. | 06-05-2014 |
20140155463 | SPINAL MUSCULAR ATROPHY TREATMENT VIA TARGETING SMN2 CATALYTIC CORE - The present invention is directed to methods and compositions for blocking the effect of the intronic inhibitory splicing region of intron 7 of the SMN2 gene. The compositions and methods of the instant invention include short oligonucleotide reagents (e.g., oligoribonucleotides) that effectively target sites in the SMN2 pre-mRNA, thereby modulating the splicing of SMN2 pre-mRNA to include exon 7 in the processed transcript. The short target regions are 8-mers and 5-mers and also include the identification of a single nucleotide base that is essential for initiating a long distance stearic inhibitory interactions as well as novel targets distant from intron 7 which block the intronic inhibitory splicing of the same. These short target regions and concomitant inhibitory blocking oligonucleotides are less expensive and easier to manufacture and are small enough to cross the blood brain barrier. | 06-05-2014 |
20140155464 | TREATMENT OF TRISTETRAPROLINE (TTP) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO TTP - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Tristetraproline (TTP), in particular, by targeting natural antisense polynucleotides of Tristetraproline (TTP). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of TTP. | 06-05-2014 |
20140163084 | METHODS AND COMPOSITIONS FOR CONTROLLING EFFICACY OF RNA SILENCING - Based at least in part on an understanding of the mechanisms by which small RNAs (e.g., naturally-occurring miRNAs) mediate RNA silencing in plants, rules have been established for determining, for example, the degree of complementarity required between an RNAi-mediating agent and its target, i.e., whether mismatches are tolerated, the number of mismatches tolerated, the effect of the position of the mismatches, etc. Such rules are useful, in particular, in the design of improved RNAi-mediating agents which allow for more exact control of the efficacy of RNA silencing. | 06-12-2014 |
20140163085 | Oligonucleotide Inhibitors with Chimeric Backbone and 2-Amino-2'-Deoxyadenosine - There is provided herein, an oligonucleotide directed against a target gene, wherein the oligonucleotide is capable of hybridizing to at least a portion of a nucleic acid sequence encoding the gene under stringent conditions, and wherein, at least one nucleotide of the oligonucleotide is 2-amino-2′-deoxyadenosine (DAP); and the internucleoside linkages of the oligonucleotide comprises at least three alternating segments, each segment consisting of either at least one phosphorothioate or at least one phosphodiester bond. | 06-12-2014 |
20140163086 | Methods of Modulating MicroRNAs in the Treatment of Pulmonary Arterial Hypertension - The present invention provides a method of treating or preventing pulmonary arterial hypertension in a subject in need thereof by administering to the subject an inhibitor of miR-145 expression or activity. Pharmaceutical compositions and kits comprising miR-145 inhibitors for treating pulmonary arterial hypertension are also disclosed. | 06-12-2014 |
20140163087 | COMBINED INHIBITION OF THE VITAMIN D RECEPTOR AND DNA REPLICATION IN THE TREATMENT OF CANCER - Methods for treating tumors comprising cells expressing the vitamin D receptor are provided, and comprise inhibiting the expression or the biologic activity of the vitamin D receptor in the tumor cells, and/or inhibiting the expression or the biologic activity of a constituent of the vitamin D receptor signaling pathway in the tumor cells, and administering to the tumor cells an effective amount of gemcitabine. | 06-12-2014 |
20140163088 | COMPOUNDS, COMPOSITION, METHODS, TARGETS FOR CANCER THERAPY - This invention describes methods and pharmaceutical compositions for combinational cancer treatments that are capable of inducing JNK phosphorylation and induce programmed cell death. It also identified genes as target for anti-cancer drug development and enhancement of the chemotherapeutic drug effect for the treatment of cancer. This invention points to a novel method and principle for a new avenue of developing more efficient and low or non cytotoxic cancer treatment. | 06-12-2014 |
20140163089 | MICRO-RNAS AND COMPOSITIONS COMPRISING SAME FOR THE TREATMENT AND DIAGNOSIS OF SEROTONIN-, ADRENALIN-, NORADRENALIN-, GLUTAMATE-, AND CORTICOTROPIN-RELEASING HORMONE- ASSOCIATED MEDICAL CONDITIONS - microRNAs and compositions comprising same for the treatment and diagnosis of serotonin-, adrenalin-, noradrenalin-, glutamate-, and corticotropin-releasing hormone-associated medical conditions are provided. | 06-12-2014 |
20140171482 | Nanotubes as Carriers of Nucleic Acids into Cells - The present invention is directed to transfection complexes of rosette nanotubes and one or more nucleic acids. | 06-19-2014 |
20140171483 | COMPOSITIONS AND METHODS FOR TREATMENT OF TAMOXIFEN RESISTANT BREAST CANCER - The inventors found that the gene, HOXB7, was frequently overexpressed in breast cancer, and is a major upstream regulator of events leading to tamoxifen resistance. The present invention provides double-stranded short interfering nucleic acid (siNA) molecules that targets the HOXB7 gene in cells, and also provides methods of use of this siNA molecule for methods of screening, diagnosis and prediction of treatment outcomes as well as treatment of cancer. | 06-19-2014 |
20140171484 | TISSUE-SPECIFIC MICRORNAS AND COMPOSITIONS AND USES THEREOF - The invention provides for isolated nucleic acid sequences of newly discovered micro RNAs that have been identified to exist in normal Human B cells and/or in tumor-related Human B cells, using an integrated bioinformatics method and pipeline described herein. | 06-19-2014 |
20140171485 | MODIFIED POLYNUCLEOTIDES ENCODING CD28 MOLECULE - The invention relates to compositions and methods for the preparation, manufacture and therapeutic use of polynucleotides, primary transcripts and mmRNA molecules. | 06-19-2014 |
20140171486 | Single-Stranded Nucleic Acid Molecule Having Nitrogen-Containing Alicyclic Skeleton - Provided is a novel nucleic acid molecule that can be produced easily and efficiently and can inhibit the expression of a gene. The nucleic acid molecule is a single-stranded nucleic acid molecule including an expression inhibitory sequence that inhibits expression of a target gene. The single-stranded nucleic acid molecule includes: a region (X); a linker region (Lx); and a region (Xc). The linker region (Lx) is linked between the regions (Xc) and (Xc). The region (Xc) is complementary to the region (X). At least one of the regions (X) and (Xc) includes the expression inhibitory sequence. The linker region (Lx) has a non-nucleotide structure including at least one of a pyrrolidine skeleton and a piperidine skeleton. According to this single-stranded nucleic acid molecule, it is possible to inhibit the expression of the target gene. | 06-19-2014 |
20140171487 | RNAi-MEDIATED INHIBITION OF PHOSPHODIESTERASE TYPE 4 FOR TREATMENT OF cAMP-RELATED OCULAR DISORDERS - RNA interference is provided for inhibition of phosphodiesterase type 4 mRNA expression for treating patients with a cAMP-related ocular disorder. Phosphodiesterase type 4 mRNA targets include mRNA for 4A, 4B, 4C, and 4D phosphodiesterase isoforms. | 06-19-2014 |
20140171488 | COMPOSITION FOR INHIBITING ANGIOGENESIS CONTAINING A PEROXIDASIN INHIBITOR AS AN ACTIVE INGREDIENT - The invention relates to a composition for angiogenesis inhibition comprising a peroxidasin inhibitor as an effective ingredient, and more particularly, to a method of screening angiogenesis inhibitor, which includes steps of treating a test agent, and analyzing peroxidasin gene expression or protein activity, and comparing peroxidasin gene expression or protein activity between a case treated with the test agent and a case not treated with the test agent. Accordingly, since the inhibitor of the peroxidasin expression or protein activity according to the present invention can effectively inhibit migration, proliferation and tube formation of endothelial cells, the inhibitor can be effectively used for preventing or treating a variety of diseases or conditions of the diseases derived from abnormal regulation of angiogenesis. | 06-19-2014 |
20140171489 | HUMAN RESISTIN RECEPTOR AND USE THEREOF - The present invention concerns a human resistin receptor. More particularly, the present invention provides a method for screening a receptor of human resistin protein, a method for preventing or treating an inflammatory disease and arteriosclerosis using an expression- or activity-regulator for a human resistin receptor, and a pharmaceutical composition including an expression- or activity-regulator for the human resistin receptor. The method for screening a human resistin protein receptor according to the present invention enables separation of a receptor which directly binds to resistin from human monocyte, reveals a mechanism of signal transduction of the resistin receptor, and therefore, is expected to contribute to regulation of an inflammatory effect of monocyte, molecular detection of causes for vascular inflammation and arteriosclerosis, and developments of prevention and a treating agent for an inflammatory disease and arteriosclerosis. | 06-19-2014 |
20140179755 | USE OF VEGFR1 AS A BIOMARKER - The present invention is related to the use of VEGFR1 or of a nucleic acid coding for VEGFR1 as a biomarker in a method for the treatment of a subject, wherein the method for the treatment comprises administering to the subject a PKN3 inhibitor. | 06-26-2014 |
20140179756 | MODIFIED SIRNA MOLECULES AND USES THEREOF - The present invention provides chemically modified siRNA molecules and methods of using such siRNA molecules to silence target gene expression. Advantageously, the modified siRNA of the present invention is less immunostimulatory than its corresponding unmodified siRNA sequence and retains RNAi activity against the target sequence. The present invention also provides nucleic acid-lipid particles comprising a modified siRNA, a cationic lipid, and a non-cationic lipid, which can further comprise a conjugated lipid that inhibits aggregation of particles. The present invention further provides methods of silencing gene expression by administering a modified siRNA to a mammalian subject. Methods for identifying and/or modifying an siRNA having immunostimulatory properties are also provided. | 06-26-2014 |
20140179757 | Nucleic acids involved in viral infection - Provided herein are isolated viral and human nucleic acids associated with viral infection and various nucleic acid molecules relating thereto or derived therefrom. The nucleic acids may be useful for the prevention, treatment and diagnosis of viral infections. | 06-26-2014 |
20140179758 | PRNA MUTLIVALENT JUNCTION DOMAIN FOR USE IN STABLE MULTIVALENT RNA NANOPARTICLES - Trifurcate RNA junction domains derived from phi29 pRNA are described that assemble with high affinity and that are stable in vitro and in vivo. Further expansion of trifurcated RNA domains to multiple way junction scaffolds via creative designs enable an array of toolkit to construct nanoparticle architectures with diverse shapes and angles. The scaffolds can be used to form RNA nanoparticles having a wide variety of uses, including promotion of RNA crystallization, creation of RNA aptamer with high affinity to mimic antibody, delivery of therapeutic and/or diagnostic agents such as biologically active RNA-based moieties, including siRNA, ribozymes, aptamers, and others. | 06-26-2014 |
20140179759 | Lipid Formulated Compositions and Methods for Inhibiting Expression of Serum Amyloid A Gene - The invention relates to a double-stranded ribonucleic acid (dsRNA) targeting a Serum Amyloid A (SAA) gene, and methods of using the dsRNA to inhibit expression of SAA | 06-26-2014 |
20140179760 | IN VIVO PRODUCTION OF SMALL INTERFERING RNAS THAT MEDIATE GENE SILENCING - The invention provides engineered RNA precursors that when expressed in a cell are processed by the cell to produce targeted small interfering RNAs (siRNAs) that selectively silence targeted genes (by cleaving specific mRNAs) using the cell's own RNA interference (RNAi) pathway. By introducing nucleic acid molecules that encode these engineered RNA precursors into cells in vivo with appropriate regulatory sequences, expression of the engineered RNA precursors can be selectively controlled both temporally and spatially, i.e., at particular times and/or in particular tissues, organs, or cells. | 06-26-2014 |
20140179761 | TARGETING LIPIDS - The present invention provides targeting lipids of structure | 06-26-2014 |
20140179762 | METHODS AND COMPOSITIONS REDUCING TARGET GENE EXPRESSION USING COCKTAILS OF siRNAS OR CONSTRUCTS EXPRESSING siRNAS - The present invention concerns methods and compositions involving the production or generation of siRNA mixtures or pools capable of triggering RNA-mediated interference (RNAi) in a cell. Compositions of the invention include kits that include reagents for producing or generating siRNA pools. The present invention further concerns methods using polypeptides with RNase III activity for generating siRNA mixtures or pools that effect RNAi, including the generation of a number of RNA molecules to the same target gene. | 06-26-2014 |
20140179763 | REDUCTION OF ALMS1 GENE EXPRESSION OR INHIBITION OF ALTROM PROTEIN TO INDUCE CARDIOMYOCYTE PROLIFERATION - The present invention relates to the field of cardiology. More specifically, the present invention provides methods and compositions for inducing proliferation of cardiomyocytes. In a specific embodiment, a method for inducing proliferation of cardiomyocytes comprises the step of administering an effective amount of an ALMS1 inhibitor. | 06-26-2014 |
20140179764 | DUAL TARGETING OF MIR-208 AND MIR-499 IN THE TREATMENT OF CARDIAC DISORDERS - The present invention provides a method of treating or preventing cardiac disorders in a subject in need thereof by inhibiting the expression or function of both miR-499 and miR-208 in the heart cells of the subject. In particular, specific protocols for administering inhibitors of the two miRNAs that achieve efficient, long-term suppression are disclosed. In addition, the invention provides a method for treating or preventing musculoskeletal disorders in a subject in need thereof by increasing the expression or activity of both miR-208 and miR-499 in skeletal muscle cells of the subject. | 06-26-2014 |
20140179765 | PHASE CHANGING FORMULATIONS OF NUCLEIC ACID PAYLOADS - The present invention is based, at least in part, upon discovery of a process for identifying phase changing peptides. Such phase changing peptides are capable of enhancing in vitro and in vivo delivery of oligonucleotides (e.g., dsRNAs) in lipidic, vesicular, micellar and/or naked oligonucleotide formulations. | 06-26-2014 |
20140179766 | IDENTIFICATION OF THROMBOSIS OR BLEEDING RISK IN AN INDIVIDUAL WITH AND WITHOUT ANTI-PLATELET THERAPY - The invention relates to a method for identification of an individual at increased risk of thrombosis or an atherothrombotic event, or a major bleeding event, comprising a step of assaying a biological sample from the individual for the presence of a SNP in the PPARGC1β, CNTN4, LZTS1 and KCNE4 genes, wherein the presence of a SNP in the PPARGC1β, CNTN4, LZTS1 and KCNE4 genes correlates with the individual being at increased risk of thrombosis or an atherothrombotic event, or a major bleeding event. Typically, the SNP is selected from the SNPs provided in Tables 1 and 2. The invention also provides a method of identifying an individual most likely to gain benefit from single anti-platelet therapy in the primary prevention of cardiovascular events, a method of identifying an individual most likely to gain benefit from dual anti-platelet therapy in the secondary prevention of cardiovascular events, and a method of identifying an individual likely to suffer a significant bleeding complication when undergoing treatment with drugs which influence haemostasis. | 06-26-2014 |
20140179767 | METHODS FOR THE TREATMENT OF LEBER CONGENITAL AMAUROSIS - The present invention relates to a method for treating a Leber congenital amaurosis in a patient harbouring the mutation c.2991+1655 A>G in the CEP290 gene, comprising the step of administering to said patient at least one antisense oligonucleotide complementary to nucleic acid sequence that is necessary for preventing splicing of the cryptic exon inserted into the mutant c.2291+1655 A>G CEP290 mRNA | 06-26-2014 |
20140179768 | ANGIOPOIETIN-LIKE 3 (ANGPTL3) iRNA COMPOSITIONS AND METHODS OF USE THEREOF - The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the ANGPTL3 gene, as well as methods of inhibiting expression of ANGPTL3 and methods of treating subjects having a disorder of lipid metabolism, such as hyperlipidemia or hypertriglyceridemia, using such dsRNA compositions. | 06-26-2014 |
20140179769 | CANCER-CELL-SPECIFIC CYTOSTATIC AGENT - The present inventors discovered that although suppressing expression of the RecQ1 gene, a RecQ helicase family gene, shows suppressive effects on cell proliferation in cancer cells, such effects are not observed in human TIG3 cells (a normal diploid fibroblast cell line), which are normal cells. Hence, the present inventors discovered that siRNAs against RecQ1 gene have cancer cell-specific cell proliferation-suppressing effects that are mediated by suppression of the expression of said gene. | 06-26-2014 |
20140187601 | ANTISENSE OLIGONUCLEOTIDE MODULATION OF RAF GENE EXPRESSION - Oligonucleotides are provided which are targeted to nucleic acids encoding human raf and capable of inhibiting raf expression. The oligonucleotides may have chemical modifications at one or more positions and may be chimeric oligonucleotides. Methods of inhibiting the expression of human raf using oligonucleotides of the invention are also provided. The present invention further comprises methods of inhibiting hyperproliferation of cells and methods of treating or preventing conditions, including hyperproliferative conditions, associated with raf expression. | 07-03-2014 |
20140187602 | Anti-Sense Oligonucleotides Targeted Against Exon 9 of IL-23R alpha Gene and Method of Using Same to Induce Exon Skipping and to Treat Inflammatory Bowel Diseases - The present invention relates to anti-sense oligonucleotides (AONs) used to induce exon 9 skipping in IL-23Rαgene. Exon 9 skipping of the IL23Rα gene ultimately causes specific induction of a novel soluble truncated IL-23Rα (Δ9) protein, characterized by a lack in a transmembrane domain and has a unique eight (8) amino acids (GLKEGSYC) at its C-terminus end as a result of frame-shift. The present invention provides a utility application of the use of AONs to induce production of a Δ9 protein which inhibits IL-23R-mediated cell signaling. More particularly, Δ9 protein blocks STAT3 formation as well as Th17 maturation. There is provided a therapeutic application of AONs in treating a mammal such as a human patient inflicted with Crohn's disease. | 07-03-2014 |
20140187603 | MICRORNA INHIBITORS COMPRISING LOCKED NUCLEOTIDES - The invention provides chemically modified oligonucleotides capable of inhibiting the expression (e.g., abundance) of miR-208 family miRNAs, including miR-208a, miR-208b, and/or miR-499. The invention provides in some embodiments, oligonucleotides capable of inhibiting, in a specific fashion, the expression or abundance of each of miR-208a, miR-208b, and miR-499. The invention further provides pharmaceutical compositions comprising the oligonucleotides, and methods of treating patients having conditions or disorders relating to or involving a miR-208 family miRNA, such as a cardiovascular condition. In various embodiments, the oligonucleotides provide advantages in one or more of potency, efficiency of delivery, target specificity, toxicity, and/or stability. | 07-03-2014 |
20140187604 | THERAPEUTIC AND DIAGNOSTIC TARGET GENE IN ACUTE MYELOID LEUKEMIA - Methods are provided for treating a cancer in a subject comprising administering to the subject an agent which inhibits expression of an HLX gene in the subject, or an agent which inhibits activity of an expression product of the HLX gene, and also for diagnosing a subject as likely to develop a cancer comprising determining whether a stem cell obtained from the subject expresses a HLX gene at a level in excess of predetermined control level. Kits therefor are also provided. | 07-03-2014 |
20140187605 | PROTECTION AGAINST ENDOTHELIAL BARRIER DYSFUNCTION THROUGH INHIBITION OF THE TYROSINE KINASE ABL-RELATED GENE (ARG) - The invention relates to the field of endothelial barrier dysfunction, particular, the invention relates to new methods for the treatment of endothelial barrier dysfunction, such as inflammatory edema by inhibiting Abl-related gene (ARG). | 07-03-2014 |
20140187606 | TREATMENT OF FRATAXIN (FXN) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO FXN - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Frataxin (FXN), in particular, by targeting natural antisense polynucleotides of Frataxin (FXN). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of FXN. | 07-03-2014 |
20140187607 | METHODS OF MODULATING COMPLIANCE OF THE TRABECULAR MESHWORK - The present invention relates to method, system, and composition for modulating the compliance of the trabecular meshwork, which may provide treatment to glaucoma. | 07-03-2014 |
20140187608 | INHIBITOR OF NEURONAL CONNECTIVITY LINKED TO SCHIZOPHRENIA SUSCEPTIBILITY AND COGNITIVE DYSFUNCTION - The present invention relates to methods and compositions for enhancing neuronal connectivity. It is based, at least in part, on the discovery of a protein, termed “Mirta22,” that inhibits the formation of structures which create connections between neurons. It is further based, in part, on the discovery that inhibiting Mirta22 activity by short hairpin RNA was able to restore these structures. Mirta22 was discovered in experiments relating to 22q11 microdeletions, which have been linked to schizophrenia. Accordingly, the present invention provides for methods of treating schizophrenia comprising administering an agent that inhibits Mirta22 activity. It may also be used in the treatment of other disorders that would benefit from enhanced neural connectivity, including learning and memory disorders. | 07-03-2014 |
20140187609 | Mutator Activity Induced by microRNA-155 (miR-155) Links Inflammation and Cancer - Methods of reducing spontaneous mutation rate of a cell in a subject in need thereof by reducing endogenous levels of miR-155 are described. | 07-03-2014 |
20140187610 | Connective Tissue Growth Factor Antisense Oligonucleotides - The present invention relates to antisense oligonucleotides that target human CTGF mRNA and inhibit CTGF mRNA expression. Additionally, regions of human CTGF mRNA that are exceptionally sensitive to antisense inhibition are disclosed. Pharmaceutical compositions comprising the antisense oligonucleotides are further disclosed. These compositions are useful for treating disorders and conditions that are associated with or influenced by CTGF expression. | 07-03-2014 |
20140187611 | MITOCHONDRIAL RIBOSOMAL PROTEINS AS AGING REGULATORS - The present invention relates to methods of increasing lifespan, delaying aging, and/or preventing or treating an age-related disease or a mitochondrial disease in a subject, comprising inducing a nuclear-mitochondrial OXPHOS protein dyssynchrony, including inhibiting the mitochondrial translation machinery function, as well as methods for screening agents that are able to increase lifespan, inhibit or delay aging, and/or prevent or treat an age-related disease or disorder, or a mitochondrial disease or disorder, in a subject. | 07-03-2014 |
20140194488 | MODULATION OF RADIATION RESPONSE USING MICRORNA - The present invention relates to a technology of enhancing sensitivity to radiotherapy using microRNA, more particularly to a radiosensitizer composition comprising at least one selected from the group consisting of microRNA-26b, microRNA-203 and microRNA-200c, an anticancer supplement, and a method for enhancing sensitivity to radiotherapy of cancer cells using the same. | 07-10-2014 |
20140194489 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF TMPRSS6 GENE - The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the TMPRSS6 gene, and methods of using such dsRNA compositions to inhibit expression of TMPRSS6. | 07-10-2014 |
20140194490 | SEQUENCE-SPECIFIC INHIBITION OF SMALL RNA FUNCTION - The present invention relates to the discovery of a method for inhibiting RNA silencing in a target sequence-specific manner. RNA silencing requires a set of conserved cellular factors to suppress expression of gene-encoded polypeptide. The invention provides compositions for sequence-specific inactivation of the RISC component of the RNA silencing pathway, and methods of use thereof. The RISC inactivators of the present invention enable a variety of methods for identifying and characterizing miRNAs and siRNAs, RISC-associated factors, and agents capable of modulating RNA silencing. Therapeutic methods and compositions incorporating RISC inactivators and therapeutic agents identified through use of RISC inactivators are also featured. | 07-10-2014 |
20140194491 | MODULATION OF MICRORNA-138 FOR THE TREATMENT OF BONE LOSS - There is provided nucleic acids (mir-138 Antimirs) for use in treating or preventing bone loss in a patient. Also there is provided a method for reducing the levels of endogenous mir-138 in a cell. | 07-10-2014 |
20140194492 | METHODS FOR TREATING HYPERCHOLESTEROLEMIA - Disclosed herein are antisense compounds and methods for decreasing LDL-C in an individual having elevated LDL-C. Additionally disclosed are antisense compounds and methods for treating, preventing, or ameliorating hypercholesterolemia and/or atherosclerosis. Further disclosed are antisense compounds and methods for decreasing coronary heart disease risk. Such methods include administering to an individual in need of treatment an antisense compound targeted to a PCSK9 nucleic acid. The antisense compounds administered include gapmer antisense oligonucleotides. | 07-10-2014 |
20140194493 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF TRANSTHYRETIN - The invention relates to a double-stranded ribonucleic acid (dsRNA) targeting a transthyretin (TTR) gene, and methods of using the dsRNA to inhibit expression of TTR. | 07-10-2014 |
20140200257 | PEGYLATED LIPIDS AND THEIR USE FOR DRUG DELIVERY - The invention provides poly(ethylene glycol)-lipid conjugates for use in drug delivery. | 07-17-2014 |
20140200258 | Methods and Means for Treatment of Osteoarthritis - The invention relates to the field of medicinal research, cartilage physiology and diseases involving the degeneration of cartilage tissue. More specifically, the invention relates to methods and means for identifying compounds that inhibit catabolic processes in chondrocytes and that decrease the degradation of cartilage and/or ECM. The invention also relates to the compounds that are useful in the treatment of osteoarthritis. The invention also relates to targets, the modulation of which results in a decrease in the degradation of ECM and/or cartilage and decrease inflammation. In addition, the invention relates to compositions and methods for the use thereof in treating conditions that are characterized by the degradation of ECM and/or cartilage and inflammation. | 07-17-2014 |
20140200259 | RNAi-MEDIATED INHIBITION OF SELECT RECEPTOR TYROSINE KINASES FOR TREATMENT OF PATHOLOGIC OCULAR NEOVASCULARIZATION-RELATED CONDITIONS - RNA interference is provided for inhibiton of expression of select receptor tyrosine kinase (RTK) targets in ocular neovascularization-related conditions, including those cellular changes resulting from the signal transduction activity of the select RTK targets that lead directly or indirectly to ocular NV, abnormal angiogenesis, retinal vascular permeability, retinal edema, diabetic retinopathy particularly proliferative diabetic retinopathy, diabetic macular edema, exudative age-related macular degeneration, sequela associated with retinal ischemia, and posterior segment neovascularization. | 07-17-2014 |
20140200260 | METHODS FOR DETERMINING AND INHIBITING RHEUMATOID ARTHRITIS ASSOCIATED WITH THE BRAF ONCOGENE IN A SUBJECT - The invention provides methods for determining whether a subject is suffering from a rheumatoid arthritis associated with the BRAF oncogene comprising contacting isolated fibroblasts from the subject with a molecule or pool of molecules directed to the BRAF oncogene; and culturing the sample in the presence of the agent and determining whether BRAF oncogene expression by the cell is decreased and/or whether cells in the sample return to a less transformed phenotype, exhibit decreased cell proliferation and/or exhibit increased contact inhibition, any of which is indicative that the subject is suffering from a rheumatoid arthritis associated with the BRAF oncogene. | 07-17-2014 |
20140206744 | ROTATIONALLY SEQUESTERED TRANSLATORS - Provided are nucleic acid translators capable of carrying out logic operations with improved efficiency, maximized output and reduced off-target effects, in particular in a biological system. Methods of using these translators to transduce signal are also provided. | 07-24-2014 |
20140206745 | METHODS FOR MODULATING KALLIKREIN (KLKB1) EXPRESSION - Disclosed herein are methods for decreasing kallikrein and treating or preventing thromboembolic conditions in an individual in need thereof. Examples of disease conditions that can be ameliorated with the administration of antisense compounds targeted to kallikrein include thrombosis, embolism, and thromboembolism, such as, deep vein thrombosis, pulmonary embolism, myocardial infarction, and stroke. Methods for inhibiting kallikrein can also be used as a prophylactic treatment to prevent individuals at risk for thrombosis and embolism. | 07-24-2014 |
20140206746 | MODULATION OF GROWTH HORMONE RECEPTOR EXPRESSION AND INSULIN-LIKE GROWTH FACTOR EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of growth hormone receptor and/or insulin like growth factor-I (IGF-I). The compositions comprise oligonucleotides, targeted to nucleic acid encoding growth hormone receptor. Methods of using these compounds for modulation of growth hormone receptor expression and for diagnosis and treatment of disease associated with expression of growth hormone receptor and/or insulin-like growth factor-I are provided. Diagnostic methods and kits are also provided. | 07-24-2014 |
20140206747 | Compositions And Methods For Inhibiting Expression of Factor V - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of Factor V, comprising an antisense strand having a nucleotide sequence which is less that 25 nucleotides in length and which is substantially complementary to at least a part of Factor V. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by the expression of Factor V using the pharmaceutical composition; and methods for inhibiting the expression of Factor V in a cell. | 07-24-2014 |
20140206748 | COMPOSITIONS AND METHODS RELATED TO PROSTATE CANCER - This disclosure describes markers that can identify patients at risk of developing castration-resistant prostate cancer. The markers, and analyses that use the markers, can be used by health professionals to guide treatment decisions by, for example, helping to evaluate the likelihood that a patient will respond to or develop resistance to prostate cancer therapies targeted to the androgen receptor. Thus, in some cases, methods described herein may be used to identify subjects under treatment for prostate cancer as at risk for developing castration-resistant prostate cancer. Such an evaluation may indicate that a change in prescribed therapy is appropriate. In some of these instances, the change may involve modifying the subject's treatment regimen to include administration of a pharmaceutical composition effective for treating castration-resistant prostate cancer before resistance to androgen receptor-based treatments develops. | 07-24-2014 |
20140206749 | Targeting the Steroidogenic Pathway For Treating and/or Preventing Allergic Diseases - The present invention relates to methods and compositions for treating and/or preventing allergic diseases or conditions by inhibiting one or more components of the steroidogenic pathway. | 07-24-2014 |
20140206750 | MODULATION OF APOLIPOPROTEIN (a) EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of apolipoprotein(a). The compositions comprise oligonucleotides, targeted to nucleic acid encoding apolipoprotein(a). Methods of using these compounds for modulation of apolipoprotein(a) expression and for diagnosis and treatment of disease associated with expression of apolipoprotein(a) are provided. | 07-24-2014 |
20140206751 | METHODS FOR PRODUCING INTERFERING RNA MOLECULES IN MAMMALIAN CELLS AND THERAPEUTIC USES FOR SUCH MOLECULES - Methods for producing interfering RNA molecules in mammalian cells are provided. Therapeutic uses for the expressed molecules, including inhibiting expression of HIV, are also provided. | 07-24-2014 |
20140213628 | COMPOSITIONS AND METHODS FOR THE TREATMENT OF SEPSIS AND OTHER DISORDERS INVOLVING PHOSPHOLIPASE A2 INDUCTION - The present invention provides antisense oligomers to PLA | 07-31-2014 |
20140213629 | MOLECULAR TARGETS FOR HEALING OR TREATING WOUNDS - The invention relates to at least one molecular target for healing or treating wounds and, in particular chronic, human wounds. The molecular target is PTPRK, or a protein 50% homologous therewith, and which retains the same activity as PTPRK protein. Further, the invention concerns a novel therapeutic for treating said wounds and a novel gene therapy approach, involving said molecular target, for treating said wounds. | 07-31-2014 |
20140213630 | METHODS AND PHARMACEUTICAL COMPOSITIONS FOR TREATING LYMPHOID MALIGNANCY - The present invention provides, inter alia, methods for treating, preventing, or ameliorating the effects of a lymphoid malignancy, such as those associated with a mutated phosphatase and tensin homolog (PTEN) gene, or T-cell acute lymphoblastic leukemia (T-ALL). These methods include administering to a subject an effective amount of a phosphoinositide 3-kinase-delta (PI3Kδ) inhibitor and a phosphoinositide 3-kinase-gamma (PI3Kγ) inhibitor. The present invention also provides pharmaceutical compositions for treating the effects of a lymphoid malignancy. This invention further provides a method for identifying a subject who may benefit from co-treatment with a PI3Kδ inhibitor and a PI3Kγ inhibitor. This method includes determining from a sample of the subject whether the subject has a mutated PTEN gene. Additionally, this invention provides methods for identifying a compound that has both PI3Kδ and PI3Kγ inhibitory activity. | 07-31-2014 |
20140213631 | METHODS FOR MODULATING KALLIKREIN (KLKB1) EXPRESSION - Disclosed herein are methods for decreasing kallikrein and treating or preventing inflammatory conditions in an individual in need thereof. Examples of disease conditions that can be ameliorated with the administration of antisense compounds targeted to kallikrein include hereditary angioedema (HAE). Methods for inhibiting kallikrein can also be used as a prophylactic treatment to prevent individuals at risk for developing an inflammatory condition, such as, hereditary angioedema. | 07-31-2014 |
20140213632 | HCV Combination Therapy - The present invention relates to the treatment of hepatitis C (HCV) infection by the combination treatment with a miR-122 inhibitor and a HCV NS5A RNA protein inhibitor. | 07-31-2014 |
20140213633 | METHOD FOR PROLIFERATION CARDIOMYOCYTES USING MICRO-RNA - The present invention addresses the problems of providing a method for proliferating cardiomyocytes using a miRNA that promotes the proliferation of cardiomyocytes, a vector for use in the treatment of heart disease, a pharmaceutical composition for treating heart disease, and so forth. | 07-31-2014 |
20140213634 | METHOD FOR PROLIFERATION CARDIOMYOCYTES USING MICRO-RNA - The present invention addresses the problems of providing a method for proliferating cardiomyocytes using a miRNA that promotes the proliferation of cardiomyocytes, a vector for use in the treatment of heart disease, a pharmaceutical composition for treating heart disease, and so forth. | 07-31-2014 |
20140213635 | MODULATION OF EXON RECOGNITION IN PRE-MRNA BY INTERFERING WITH THE SECONDARY RNA STRUCTURE - The invention relates to oligonucleotides for inducing skipping of exon 53 of the dystrophin gene. The invention also relates to methods of inducing exon 53 skipping using the oligonucleotides. | 07-31-2014 |
20140221454 | Extended Dicer Substrate Agents and Methods for the Specific Inhibition of Gene Expression - The invention provides compositions and methods for reducing expression of a target gene in a cell, involving contacting a cell with an isolated double stranded nucleic acid (dsNA) in an amount effective to reduce expression of a target gene in a cell. The dsNAs of the invention possess a pattern of deoxyribonucleotides (in most embodiments, the pattern comprises at least one deoxyribonucleotide-deoxyribonucleotide base pair) designed to direct the site of Dicer enzyme cleavage within the dsNA molecule. Deoxyribonucleotides of the dsNA molecules of the invention are located within a region of the dsNA that can be excised via Dicer cleavage to generate an active siRNA agent that no longer contains the deoxyribonucleotide pattern (e.g., deoxyribonucleotide-deoxyribonucleotide base pairs). Such DNA-extended Dicer-substrate siRNAs (DsiRNAs) were demonstrated to be more effective RNA inhibitory agents than corresponding double stranded RNA-extended DsiRNAs. DsiRNA agents were also found to tolerate guide strand mismatches. | 08-07-2014 |
20140221455 | DIFFERENTIATION MODULATING AGENTS AND USES THEREFOR - The present invention is directed to methods and agents for modulating the differentiation potential and/or proliferation of preadipocytes. More particularly, the present invention discloses methods and agents for modulating a fibroblast growth factor (FGF) signaling pathway, especially the FGF-1 or FGF-2 signaling pathway, for treating or preventing adiposity-related conditions including, but not limited to, obesity, lipoma, lipomatosis, cachexia or lipodystrophy or the loss of adipose tissue in trauma or atrophic conditions. | 08-07-2014 |
20140221456 | TARGETING p63 TO RE-ACTIVATE DORMANT RESERVE STEM CELLS IN OLFACTORY EPITHELIUM - Disclosed herein is a method for activating a dormant epithelial stem cell, or population thereof, to a state of multipotency comprising, reducing the level of ΔNp63 in the cell(s). The dormant epithelial stem cell(s) may be a horizontal basal cell (HBC) of the olfactory epithelium and the level of ΔNp63 may be reduced by contacting the cell or population with an effective amount of one or more agents that downmodulate ΔNp63. One example of an agent is an RNAi. Also disclosed is a method for treating olfactory dysfunction in a subject, comprising activating HBCs of the subject by reducing the level of ΔNp63 in one or more HBCs of the subject, to thereby treat the olfactory dysfunction. Activated horizontal basal cell (HBCs) are also disclosed. | 08-07-2014 |
20140221457 | AMELIORATING OXIDATIVE STRESS IN NEURODEGENERATIVE DISEASE VIA NOX1 TARGETING - Disclosed herein are methods, compounds and compositions designed for ameliorating oxidative stress in cells. In particular, disclosed are viral vectors that express RNA interfering molecules for inhibiting expression or activity of Nox1 or RAC1. Depending on the location of administration, expression of inhibiting molecules can reduce oxidative stress in neurons associated with a particular neurodegenerative condition. | 08-07-2014 |
20140221458 | METHODS AND MEANS FOR EFFICIENT SKIPPING OF EXON 45 IN DUCHENNE MUSCULAR DYSTROPHY PRE-mRNA - The invention relates to a method for inducing or promoting skipping of exon 45 of DMD pre-mRNA in a Duchenne Muscular Dystrophy patient, preferably in an isolated (muscle) cell, the method comprising providing an isolate muscle cell with a molecule that binds to a continuous stretch of at least 21 nucleotides within said exon. The invention further relates to such molecule used in the method. | 08-07-2014 |
20140221459 | BACTERIALLY-DERIVED, INTACT MINICELLS THAT ENCOMPASS PLASMID-FREE FUNCTIONAL NUCLEIC ACID FOR IN VIVO DELIVERY TO MAMMALIAN CELLS - Intact, bacterially-derived minicells can safely introduce therapeutically effective amounts of plasmid-free functional nucleic acid to target mammalian cells. To this end, functional nucleic acid can be packaged into intact minicells directly, without resort to expression constructs, the expression machinery of the host cell, harsh chemicals or electroporation. | 08-07-2014 |
20140221460 | METHOD FOR IDENTIFYING MODULATORS OF HCV TRANSLATION OR REPLICATION INVOLVING THE NS5B POLYPEPTIDE AND A PSEUDOKNOT - The invention relates to a method for identifying compounds that act as modulators of hepatitis C (HCV) translation and/or replication, and to compounds identified by this method, and their uses in medicine. The invention also relates to an RNA useful for identifying modulators of HCV translation and/or replication. The invention further relates to a method for producing a replication-competent HCV virus. | 08-07-2014 |
20140221461 | NUCLEIC ACID MOLECULES AND USES THEREOF - Provided in this application are formulations of double stranded RNA molecules and Krebs Cycle analogs that improving ribonuclease stability, reducing off-target effects of a double stranded siRNA molecule, or of reducing interferon responsiveness of a double stranded siRNA molecule using such dsRNA. Also disclosed are methods of treating a primary tumor or a metastasis by contacting circulating tumor cells, a primary tumor, or a metastasis with a described formulation. | 08-07-2014 |
20140235693 | SERPINA1 SIRNAS: COMPOSITIONS OF MATTER AND METHODS OF TREATMENT - The technology described herein relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the Serpinal gene, and methods of using such dsRNA compositions to inhibit expression of Serpinal. In one embodiment, an iRNA for inhibiting expression of a Serpinal gene includes at least two sequences that are complementary to each other. The iRNA includes a sense strand having a first sequence and an antisense strand having a second sequence. The antisense strand includes a nucleotide sequence that is substantially complementary to at least part of an mRNA encoding Serpinal, and the region of complementarity is 30 nucleotides or less, and at least 15 nucleotides in length. Generally, the iRNA is 19 to 24, e.g., 19 to 21 nucleotides in length. | 08-21-2014 |
20140235694 | ANTISENSE MODULATION OF PTP1B EXPRESSION - Provided herein are methods, compounds, and compositions for reducing expression of PTP1B mRNA and protein in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate metabolic disease, for example, diabetes, or a symptom thereof. | 08-21-2014 |
20140235695 | MODULATION OF HSP47 EXPRESSION - Provided herein are compositions, methods and kits for modulating expression of target genes, particularly heat shock protein 47 (hsp47). The compositions, methods and kits may include nucleic acid molecules (for example, short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA) or short hairpin RNA (shRNA)) that modulate a gene encoding hsp47, for example, the gene encoding human hsp47. The composition and methods disclosed herein may also be used in treating conditions and disorders associated with hsp47 such as liver fibrosis, pulmonary fibrosis, peritoneal fibrosis and kidney fibrosis. | 08-21-2014 |
20140235696 | INHIBITION OF MICRORNA-134 FOR THE TREATMENT OF SEIZURE-RELATED DISORDERS AND NEUROLOGIC INJURIES - A method for preventing or treating epilepsy or status epilepticus, or a brain-related disorder characterised by precipitation of seizures, in an individual, the method comprising the step of treating the individual with an agent capable of inhibiting the activity of miR-134 in the individual, wherein the agent is delivered to the brain of the individual. | 08-21-2014 |
20140235697 | MICRORNAS IN NEURODEGENERATIVE DISORDERS - The invention provides methods for diagnosing neurodegenerative disorders (e.g., amyotrophic lateral sclerosis and multiple sclerosis) in a subject, identifying subjects at risk of developing a neurodegenerative disorder, predicting the rate of disease progression in a subject having a neurodegenerative disorder, selecting a subject for treatment of a neurodegenerative disorder, selecting a subject for participation in a clinical study, and determining the efficacy of treatment of a neurodegenerative disorder. These methods include determining the level of one or more microRNAs and/or one or more inflammatory markers in a monocyte (e.g., a CD14 | 08-21-2014 |
20140243387 | METHODS FOR IMPROVING CARDIAC CONTRACTILITY - The present invention relates to regulation of cardiac contractile function. The present invention is based on the discovery that microRNAs contribute to the loss of cardiac contractility. Specifically, miR-25 binds to SERCA2a which results in a loss of function and interferes with Ca | 08-28-2014 |
20140243388 | ANTISENSE OLIGONUCLEOTIDES THAT TARGET A CRYPTIC SPLICE SITE IN USH1C AS A THERAPEUTIC FOR USHER SYNDROME - The present invention provides a method for treating Usher's syndrome in a human subject including administering to the human subject an oligonucleotide having 8 to 30 linked nucleosides having a nucleobase sequence comprising a complementary region comprising at least 8 contiguous nucleobases complementary to a target region of equal length within exon 3 of an Usher RNA transcript. | 08-28-2014 |
20140243389 | COMPOSITIONS COMPRISING EICOSAPENTAENOIC ACID AND MIPOMERSEN AND METHODS OF USE THEREOF - The present invention relates to, inter alia, pharmaceutical compositions comprising a polyunsaturated fatty acid and to methods of using the same to treat or prevent cardiovascular-related diseases. | 08-28-2014 |
20140243390 | NOVEL KIF5B-RET FUSION MOLECULES AND USES THEREOF - Novel RET fusion molecules and uses are disclosed. | 08-28-2014 |
20140243391 | PHOSPHOLIPID-DETERGENT CONJUGATES AND USES THEREOF - The invention relates to novel compounds, in particular novel O-substituted phospholipids that are useful for the in vitro and in vivo delivery of drugs as well as nucleic acids into cells. The invention also relates to pharmaceutical compositions and supramolecular complexes comprising said compounds and the use of these compounds in therapeutic treatment, in particular in gene therapy. | 08-28-2014 |
20140243392 | MicroRNA-Based Methods and Assays for Osteosarcoma - Provided are methods and compositions useful in the diagnosis, treatment, and monitoring of osteosarcoma. Antisense to certain microRNA (miRNA) found to be associated with cancer stem cells (CSCs) or tumor-initiating cells (TICs) of osteosarcoma are useful to suppress tumor growth and metastasis, and prolong survival. Antisense oligonucleotides to miR-133a are synergistic in combination with standard chemotherapy such as cisplatin in the treatment of osteosarcoma. | 08-28-2014 |
20140243393 | METHODS OF DIAGNOSING AND TREATING MOTOR NEURON DISEASES - Use of an agent which upregulates an activity or amount of miRNA-9 or miRNA-9* is disclosed for the preparation of a medicament for the treatment of a motor neuron disease (MND). | 08-28-2014 |
20140243394 | Compositions and Methods for Inhibiting Expression of a Gene from the Ebola Virus - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a gene from the Ebola virus. | 08-28-2014 |
20140243395 | SPRAY SYSTEM FOR PRODUCTION OF A MATRIX FORMED IN SITU - A spray system for production of a matrix formed in situ is described, which comprises at least one lipophilic component comprising at least one polymer based on glycolic acid and lactic acid and at least one biocompatible solvent having an X log P3 value of less than 0.2, and at least one hydrophilic component, wherein the at least two components are present separately from each other prior to use and are not mixed until or in the course of spraying, with components forming a film when sprayed onto human tissue. | 08-28-2014 |
20140243396 | METHOD OF TREATING MUCOEPIDERMOID CARCINOMA - Imidazoquinolines, as set forth in formula (I), are useful for inhibiting growth or proliferation of mucoepidermoid carcinoma cells. The therapeutic and prophylactic treatments provided by this invention are practiced by administering to a patient in need thereof an amount of a compound of formula (I) that is effective to inhibit growth or proliferation of the mucoepidermoid carcinoma cells. | 08-28-2014 |
20140243397 | CXCR4 INHIBITING CARRIERS FOR NUCLEIC ACID DELIVERY - The present invention generally relates to carriers including polymers and lipids that comprise a CXCR4 inhibiting moiety. More specifically, these carriers are biodegradable and can be bioreducible polymers that comprise a CXCR4 inhibiting moiety. These carriers can be suitable for delivery of nucleic acids to cells. These carriers and pharmaceutical compositions can be used to treat various conditions including cancers and inflammation conditions. | 08-28-2014 |
20140249202 | TARGETED NANOPARTICLES - Described herein are carrier nanoparticles comprising a polymer containing a polyol coupled to a polymer containing a boronic acid, configured to present the polymer containing a boronic acid to an environment external to the nanoparticle. Targeted versions of the described nanoparticles are also described, as are related compositions, methods and systems. | 09-04-2014 |
20140249203 | NANOPARTICLES STABILIZED WITH NITROPHENYLBORONIC ACID COMPOSITIONS - Described herein are carrier nanoparticles comprising a polymer containing a polyol coupled to a polymer containing a boronic acid, configured to present the polymer containing a boronic acid to an environment external to the nanoparticle. Targeted versions of the described nanoparticles are also described, as are related compositions, methods and systems. | 09-04-2014 |
20140249204 | IDENTIFICATION OF A JAK2 MUTATION IN POLYCYTHEMIA VERA - The present invention concerns the V617F variant of the protein-tyrosine kinase JAK2, said variant being responsible for Vaquez Polyglobulia. The invention also relates to a first intention diagnostic method for erythrocytosis and thrombocytosis allowing their association with myeloproliferative disorders, or to the detection of the JAK2 V617F variant in myeloproliferative disorders allowing their reclassification in a new nosological group. | 09-04-2014 |
20140249205 | ACTIVATION OF QUIESCIENT STEM CELLS - Compositions and methods are provided for altering the activation of quiescent stem cells by modulating activity of the microRNA miR-489. | 09-04-2014 |
20140249206 | OLIGONUCLEOTIDES FOR MODULATION OF TARGET RNA ACTIVITY - The present invention relates to oligonucleotides for modulation of target RNA activity. Thus, the invention provides oligonucleotides that bind to microRNA binding sites of target RNA. The oligonucleotides may activate RNase H or RNAi. In a preferred embodiment, the oligonucleotides prevents a microRNA from binding to its binding site of the target RNA and thereby prevent the microRNA from regulating the target RNA. Such oligonucleotides have uses in research and development of new therapeutics. | 09-04-2014 |
20140249207 | MEANS FOR INHIBITING THE EXPRESSION OF ORC-1 - The present invention is related to a nucleic acid molecule comprising a double-stranded structure, whereby the double-stranded structure comprises a first strand and a second strand, whereby the first strand comprises a first stretch of contiguous nucleotides and said first stretch is at least partially complementary to a target nucleic acid, and whereby the second strand comprises a second stretch of contiguous nucleotides and said second stretch is at least partially complementary to the first stretch, whereby the first stretch comprises a nucleic acid sequence which is at least complementary to a nucleotide core sequence of the nucleic acid sequence according to SEQ ID NO: 1, whereby the nucleotide core sequence comprises the nucleotide sequence from nucleotide positions 1755 to 1763 of SEQ ID NO: 1; from nucleotide positions 1904 to 1912 of SEQ ID NO: 1; from nucleotide positions 1905 to 1913 of SEQ ID NO: 1; from nucleotide positions 2548 to 2556 of SEQ ID NO: 1; whereby the first stretch is additionally at least partially complementary to a region preceding the 5′ end of the nucleotide core sequence and/or to a region following the 3′ end of the nucleotide core sequence. | 09-04-2014 |
20140256785 | SITE SPECIFIC DELIVERY OF NUCLEIC ACIDS BY COMBINING TARGETING LIGANDS WITH ENDOSOMOLYTIC COMPONENTS - The invention relates to compositions and methods for site-specific delivery of nucleic acids by combining them with targeting ligands and endosomolytic components. | 09-11-2014 |
20140256786 | COMPOSITIONS AND METHODS FOR TREATMENT OF MITOCHONDRIAL DISEASES - Methods and compositions are provided for the treatment of a mitochondrial disease in an individual with the mitochondrial disease. Aspects of the methods include administering an inhibitor of a mitochondrial transport protein to a subject having a mitochondrial disease. Also provided are reagents and kits for practicing the subject methods. | 09-11-2014 |
20140256787 | COMPOSITIONS AND METHODS FOR SHORT INTERFERING NUCLEIC ACID INHIBITION OF Nav 1.8 - The invention provides short interfering nucleic acids, either single-stranded or double-stranded, that cause RNAi-induced degradation of mRNA from the Na.sub.v1.8 sodium channel gene; to pharmaceutical compositions comprising such short interfering nucleic acids; recombinant vectors comprising such short interfering nucleic acids; a method for inhibiting translation of an mRNA; a method for inhibiting expression of a polypeptide; a method for blocking the membrane potential in a cell; a method for blocking the sodium current in a cell; and a method for inhibiting chronic pain. | 09-11-2014 |
20140256788 | Antisense Oligonucleotides (ODN) Against SMAD7 and Uses Thereof in Medical Field - The invention relates to antisense oligonucleotidic sequences (ODN) against Smad7 suitably modified, and their uses in medical field as therapeutic biological agents, in particular in the treatment of chronic inflammatory bowel disease, such as Crohn's disease and ulcerative colitis. | 09-11-2014 |
20140256789 | COMPOSITION AND METHODS FOR MODULATING CELL PROLIFERATION AND CELL DEATH - Described herein are compositions and methods for modulation of p53-dependent cell death and cell proliferation. The compositions are microRNAs and associated nucleic acids. | 09-11-2014 |
20140256790 | Methods for Identifying and Compounds Useful for Increasing the Functional Activity and Cell Surface Expression of CF-Associated Mutant Cystic Fibrosis Transmembrance Conductance Regulator - The present invention relates to agents, and methods for identifying compounds, which agents and compounds result in the modulation of cellular trafficking of proteins in particular that of CF-associated mutant Cystic Fibrosis Transmembrane Conductance Regulator (CFTR). In addition, the invention relates to compositions and methods for the use thereof in treating conditions that are characterized by an ER-associated protein misfolding and abnormal cellular trafficking of disease-associated proteins, including cystic fibrosis (CF). | 09-11-2014 |
20140256791 | Compositions and Methods for Inhibiting Expression of XBP-1 Gene - The invention relates to a double-stranded ribonucleic acid (dsRNA) targeting X-Box Protein 1 (XBP-1), and methods of using the dsRNA to inhibit expression of XBP-1. | 09-11-2014 |
20140256792 | COMPOUNDS FOR THE TREATMENT OF ISCHEMIC INJURY - The present invention relates to microRNA (miRNA) compounds for use in the treatment of consequences of acute ischemia/reperfusion, a method for preparing miRNA compounds by using test ischemic-reperfusion, test preconditioning and test postconditioning of biological samples, use of the miRNA compounds in the preparation of pharmaceutical compositions having cytoprotective and/or anti-ischemic effect in ischemic cardiac diseases. | 09-11-2014 |
20140256793 | MEDICAMENT FOR DISEASES ASSOCIATED WITH AMYLOID beta AND SCREENING THEREOF - The present invention is directed to providing a medicament for treating or preventing a condition, disorder or disease associated with amyloid β. Provided is a method for screening a medicament for treating or preventing a disease associated with amyloid β, the method comprising: A) subjecting at least one of elements selected from the group consisting of 1) exosome; 2) neutral sphingomyelinase 2 (N-SMase2); and 3) sphingomyelin synthetic enzyme 2 (SMS2), and a candidate of the medicament in a condition in which they can interact with each other; and B) examining an influence by the candidate of the medicament to the element, wherein at least one of the elements is used as an index for determining as to whether or not the candidate is the medicament. | 09-11-2014 |
20140256794 | ACTIVATION OF FUNCTIONAL NUCLEIC ACID BY SPECIFIC MODIFICATION - This invention is intended to enhance and improve the resistance of a single- or double-stranded nucleic acid fragment comprising a base sequence of a functional nucleic acid to degradation by nucleolytic enzymes in a simple and cost-effective manner. The single- or double-stranded nucleic acid fragment comprises, ligated to at least one 3′ end thereof, a hairpin-shaped DNA comprising: (A) a nucleic acid region consisting of 2 to 5 arbitrary nucleotides; (B) a nucleic acid region consisting of a “gna” or “gnna” base sequence, wherein each “n” represents “g”, “t”, “a”, or “c”, a base analogue, or a modified base; and (C) a nucleic acid region consisting of a base sequence complementary to the nucleic acid region (A), sequentially ligated from the 5′ end toward the 3′ end, wherein at least one of two 3′ terminal nucleotides from at least one 3′ end of the single-stranded nucleic acid fragment or the double-stranded nucleic acid fragment is modified. | 09-11-2014 |
20140256795 | CO-ACTIVATION OF MTOR AND STAT3 PATHWAYS TO PROMOTE NEURONAL SURVIVAL AND REGENERATION - Disclosed herein is a method of promoting sustained survival, sustained regeneration, in a lesioned mature neuron, sustained compensatory outgrowth in a neuron, or combinations thereof. The method comprises contacting the lesioned mature neuron with an effective amount of an inhibitor of PTEN and an effective amount of an inhibitor of SOCS3 to thereby promote survival and/or regeneration and/or compensatory outgrowth of the neuron. Therapeutic methods of treatment of a subject with a neuronal lesion by administration of a therapeutically effective amount of an inhibitor of PTEN and a therapeutically effective amount of an inhibitor of SOCS3, are also disclosed, as are pharmaceutical compositions and devices for use in the methods. | 09-11-2014 |
20140275207 | ANTISENSE COMPOUNDS AND METHODS OF USE THEREOF - Disclosed herein are compounds, compositions and methods for modulating the expression of LMW-PTPase in a cell, tissue or animal. Also provided are methods of target validation. Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and disorders. Also provided are methods for the prevention, amelioration and/or treatment of diabetes, insulin resistance, insulin deficiency, hypercholesterolemia, hyperglycemia, dyslipidemia, hyperlipidemia, hypertriglyceridemia, and hyperfattyacidemia. In some embodiments, the diabetes is type II diabetes by administration of antisense compounds targeted to LMW-PTPase. | 09-18-2014 |
20140275208 | Compositions and Methods to Control Insect Pests - Methods and compositions are provided which employ a silencing element that, when ingested by a pest, such as a Coleopteran plant pest or a | 09-18-2014 |
20140275209 | WOUND HEALING COMPOSITIONS AND TREATMENTS - This invention concerns improved methods, uses, and kits for treating chronic wounds through the administration of anti-connexin agents, particularly anti-connexin 43 antisense polynucleotides. The methods, uses, and kits of the invention are based on the surprising and unexpected discovery that chronic wounds that do not increase or decrease in size by more than a pre-determined amount during a pre-treatment phase are more amenable to successful treatment than wounds whose size varies outside the target range during the pre-treatment phase. | 09-18-2014 |
20140275210 | Antisense Oligonucleotides Against Neutral Sphingomyelinase and Neutral Sphingomyelinase Inhibitor GW4869 for Degenerative Neurological Disorders - Alzheimer's disease (AD) is the most common human neurodegenerative disease of the CNS resulting in progressive neuronal death and memory loss. Despite intense investigations, no effective therapy is available to stop its onset or halt its progression. It was discovered that antisense oligonucleotide against neutral sphingomyelinase and GW4869, a chemical inhibitor of neutral sphingomyelinase, inhibit activation of glial cells and protect neurons in AD cell culture and animal models. These results suggest the following new treatment options for AD patients: Antisense oligonucleotide against neutral sphingomyelinase and GW4869. | 09-18-2014 |
20140275211 | ASSAYS AND METHODS FOR DETERMINING ACTIVITY OF A THERAPEUTIC AGENT IN A SUBJECT - The invention relates to methods and assays for determining the activity of a composition comprising a therapeutic gene administered to a subject. | 09-18-2014 |
20140275212 | MODULATION OF EXON RECOGNITION IN PRE-MRNA BY INTERFERING WITH THE SECONDARY RNA STRUCTURE - The invention relates to oligonucleotides for inducing skipping of exon 55 of the dystrophin gene. The invention also relates to methods of inducing exon 55 skipping using the oligonucleotides. | 09-18-2014 |
20140275213 | Methods and Compositions for Plant Pest Control - The present invention comprises methods and compositions for controlling nematode parasitism in host plant. The present invention comprises novel polynucleotides and polypeptides encoded by such polynucleotides comprising one or more nucleic acid sequences disclosed herein having a nucleotide sequence comprising any one of SEQ ID NOs: 1-142, a fragment or variant thereof, or a complement thereof, or a polypeptide sequence comprising any one of SEQ ID NOs: 143-159, a fragment or variant thereof. | 09-18-2014 |
20140275214 | CUSTIRSEN TREATMENT WITH REDUCED TOXICITY - The present invention provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of cancer, comprising administering an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′ deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19, to a human subject in need of treatment for the cancer, which human subject also receives at least one chemotherapeutic agent, hormone ablation therapy, or radiation therapy, wherein the anti-clusterin oligonucleotide is administered at least 3 times during a 5 to 9 day period, wherein at least 1 of the administrations is at a dose other than 640 mg. The present invention also provides a method for providing antisense therapy which reduces the expression of clusterin to provide therapeutic benefit in the treatment of myeloma. | 09-18-2014 |
20140275215 | ANTI-CLUSTERIN MONOTHERAPY FOR CANCER TREATMENT - The present invention provides a method of treating cancer in a subject afflicted with cancer comprising administering to the subject an anti-clusterin oligonucleotide as a monotherapy to treat the cancer. The present invention also provides compositions for treating cancer in a subject afflicted with cancer, comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1). Additionally, the present invention provides pharmaceutical compositions for treating cancer in a subject afflicted with cancer, the composition comprising an anti-clusterin oligonucleotide having the sequence CAGCAGCAGAGTCTTCATCAT (Seq. ID No.: 1), wherein the anti-clusterin oligonucleotide has a phosphorothioate backbone throughout, has sugar moieties of nucleotides 1-4 and 18-21 bearing 2′-O-methoxyethyl modifications, has nucleotides 5-17 which are 2′deoxynucleotides, and has 5-methylcytosines at nucleotides 1, 4, and 19. | 09-18-2014 |
20140275216 | ALTERATION OF NEURONAL GENE EXPRESSION BY SYNTHETIC piRNAs AND BY ALTERATION OF piRNA FUNCTION - Provided herein are compositions and methods for the alteration of neuronal methylation by synthetic piRNAs or by alteration of piRNA function. Such alterations find use in the regulation and control of neural gene expression and concomitant neural functions. Further provided herein are systems and methods for the identification of target sites for regulation by piRNAs. | 09-18-2014 |
20140275217 | COMPOSITIONS AND METHODS FOR TREATING CANCER - A method of treating a BORG expressing cancer includes administering a therapeutically effective amount of at least one BORG inhibiting agent to the BORG overexpressing cancer cells of the subject. | 09-18-2014 |
20140275218 | WOUND HEALING COMPOSITIONS AND TREATMENTS - This invention concerns improved methods, uses, and kits for treating chronic wounds through the administration of anti-connexin agents, particularly anti-connexin 43 antisense polynucleotides. The methods, uses, and kits of the invention are based on the surprising and unexpected discovery that chronic wounds that do not increase or decrease in size by more than a pre-determined amount during a pre-treatment phase are more amenable to successful treatment than wounds whose size varies outside the target range during the pre-treatment phase. | 09-18-2014 |
20140275219 | USES OF THE HUMAN ZFX GENE AND DRUGS ASSOCIATED WITH SAME - The present invention discloses uses of the human ZFX gene and drugs associated therewith. Also disclosed are uses of the human ZFX gene in tumor treatment, tumor diagnosis, and drug preparation. Further disclosed are small interfering RNA (siRNA), and nucleic acid and lentivirus encoding the siRNA to the human ZFX gene and uses thereof. The siRNA and nucleic acid and lentivirus encoding the siRNA provided by the present invention can specifically inhibit the expression of human ZFX gene. Lentiviruses in particular can efficiently infect target cells, inhibit ZFX expression in target cells, and inhibit the growth of tumor cells, thus promote tumor apoptosis and have great significance in tumor treatment. | 09-18-2014 |
20140275220 | THE miRNA-212/132 FAMILY AS A THERAPEUTIC TARGET - The present invention refers to inhibitors of microRNAs, particularly of microRNAs miR-212 and/or miR-132 for use in medicine, particularly in the diagnosis, treatment or prevention of cardiac disorders, e.g. cardiac hypertrophy-associated or autophagic disorders, and further refers to isolated nucleic acid molecules, particularly microRNAs miR-212 and/or miR-132 and related sequences, for use in medicine, particularly human medicine, more particularly in the diagnosis, treatment or prevention of disorders involving cardiac atrophy and/or dysfunctional autophagy, e.g. cardiac cachexia. | 09-18-2014 |
20140275221 | TARGETING OF MIRNA PRECURSORS - The present invention relates to a method of targeting mi RNA and/or premiRNA molecules in order to treat diseases that are linked with mi RNA expression, such as certain cancers. The present invention also provides modified sno RNA molecules for targeting mi RNA molecules for use in treating diseases that are linked with mi RNA expression, such as certain cancers. | 09-18-2014 |
20140275222 | ANTISENSE OLIGONUCLEOTIDE MODULATORS OF SEROTONIN RECEPTOR 2C AND USES THEREOF - The present invention provides, among other things, oligonucleotide modulators of human 5′-HT2C receptor (HTR2C) and improved methods and composition for treating HTR2C-related diseases, disorders or conditions based on such modulators. In particular, oligonucleotides modulators according to the invention target specific regions in the Exon V/Intron V junction of the human HTR2C pre-mRNA and drive expression of HTR2C Vb splice isoform, leading to increased generation of non-edited strong HTR2C receptor and enhanced serotonin receptor activity. | 09-18-2014 |
20140288146 | NOVEL TRIALKYL CATIONIC LIPIDS AND METHODS OF USE THEREOF - The present invention provides compositions and methods for the delivery of therapeutic agents to cells. In particular, these include novel cationic lipids and nucleic acid-lipid particles that provide efficient encapsulation of nucleic acids and efficient delivery of the encapsulated nucleic acid to cells in vivo. The compositions of the present invention are highly potent, thereby allowing effective knock-down of a specific target protein at relatively low doses. In addition, the compositions and methods of the present invention are less toxic and provide a greater therapeutic index compared to compositions and methods previously known in the art. | 09-25-2014 |
20140288147 | METHODS OF MANIPULATING THE FATE OF CELLS - A method of manipulating the fate of a cell which comprises contacting the cell with at least one of (a) a cell fate-determining untranslated/noncoding RNA species (cuR), (b) a modified cuR, or (c) a compound that modifies or affects cuR, under condition sufficient to cause a cell-changing or cell-maintaining fate that results in cell regeneration, cell differentiation or cell death, so that an increase of desirable cells or a decrease in undesirable cells can be obtained. Another aspect of the invention relates to a method of manipulating the fate of a cell by contacting the cell with a compound that affects a fate-determining mechanism involving homologous nucleic acid interactions of RNA:RNA or RNA:DNA or resolution of such interactions under conditions sufficient to cause a cell-changing or cell-maintaining fate that results in cell regeneration, cell differentiation or cell death, so that an increase of desirable cells or a decrease in undesirable cells can be obtained. The invention generates cell fate or cell maintenance in a subject, such as a human, so that an increase of desirable cells or a decrease in undesirable cells can be obtained in the subject. This feature can be applied to a therapeutic method of treating a condition in a subject. | 09-25-2014 |
20140288148 | RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING CHEMICALLY MODIFIED SHORT INTERFERING NUCLEIC ACID (siNA) - The present invention concerns methods and reagents useful in modulating gene expression in a variety of applications, including use in therapeutic, diagnostic, target validation, and genomic discovery applications. Specifically, the invention relates to synthetic chemically modified small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against target nucleic acid sequences. The small nucleic acid molecules are useful in the treatment of any disease or condition that responds to modulation of gene expression or activity in a cell, tissue, or organism. | 09-25-2014 |
20140288149 | MIR-142 AND ANTAGONISTS THEREOF FOR TREATING DISEASE - Methods of treating various conditions using miR-142, miR-142 mimics, and antagonists of miR-142 are provided. | 09-25-2014 |
20140288150 | DENDRONIZED POLYMERS FOR NUCLEIC ACID DELIVERY - The disclosure provides for dendronized polymers, and the use of the polymers as carriers for the intracellular delivery of nucleic acids. | 09-25-2014 |
20140288151 | PREVENTIVE OR THERAPEUTIC AGENT FOR FIBROSIS - Provided is siRNA effective for the treatment of fibrosis and a pharmaceutical containing the siRNA. | 09-25-2014 |
20140288152 | TREATMENT OF 'C TERMINUS OF HSP70-INTERACTING PROTEIN' (CHIP) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO CHIP - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of ‘C terminus of HSP70-Interacting Protein’ (CHIP), in particular, by targeting natural antisense polynucleotides of ‘C terminus of HSP70-Interacting Protein’ (CHIP). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of CHIP. | 09-25-2014 |
20140288153 | TREATMENT OF ANTIVIRAL GENE RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO AN ANTIVIRAL GENE - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of an Antiviral gene, in particular, by targeting natural antisense polynucleotides of an Antiviral gene. The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of Antiviral genes. | 09-25-2014 |
20140288154 | Lipid Formulated Compositions and Methods for Inhibiting Expression of Eg5 And VEGF Genes - This invention relates to compositions containing double-stranded ribonucleic acid (dsRNA) in a lipid formulation, and methods of using the compositions to inhibit the expression of the Human kinesin family member 11 (Eg5) and Vascular Endothelial Growth Factor (VEGF), and methods of using the compositions to treat pathological processes mediated by Eg5 and VEGF expression, such as cancer. | 09-25-2014 |
20140288155 | EXON SKIPPING THERAPY FOR DYSTROPHIC EPIDERMOLYSIS BULLOSA - The present invention also relates to an antisense oligonucleotide complementary to a nucleic acid sequence of COL7A1 gene that is necessary for correct splicing of one or more exons which encode amino acid sequence of type VII collagen implicated in dysfunction of a mutated type VII collagen wherein said exons are selected from the group consisting of exon 73, 74 or 80 of the COL7A1 gene. The present invention also relates to a method for the treatment of a patient suffering from Dystrophic Epidermolysis Bullosa caused by a dysfunction of a mutated type VII collagen, comprising the step of administering to said patient a least one antisense oligonucleotide according to the invention. | 09-25-2014 |
20140288156 | METHODS FOR THE TREATMENT AND DIAGNOSIS OF ATHEROSCLEROSIS - The present invention relates to the treatment and the diagnosis of atherosclerosis, in particular to a miRNA for use in the treatment and the diagnosis of atherosclerosis. | 09-25-2014 |
20140288157 | METHODS OF TREATING CANCER - A method of treating cancer is disclosed. The method comprises administering to the subject a therapeutically effective amount of a pharmaceutical composition comprising an agent which induces a dissociation of the 26S proteasomal complex into a 20S component and a 19S component to thereby inhibit 26S proteasomal activity, wherein the pharmaceutical agent is devoid of a chemotherapeutic agent. | 09-25-2014 |
20140288158 | MODIFIED RNAi AGENTS - One aspect of the present invention relates to double-stranded RNAi (dsRNA) duplex agent capable of inhibiting the expression of a target gene. The dsRNA duplex comprises one or more motifs of three identical modifications on three consecutive nucleotides in one or both strand, particularly at or near the cleavage site of the strand. Other aspects of the invention relates to pharmaceutical compositions comprising these dsRNA agents suitable for therapeutic use, and methods of inhibiting the expression of a target gene by administering these dsRNA agents, e.g., for the treatment of various disease conditions. | 09-25-2014 |
20140296318 | NOVEL TISSUE PROTECTIVE ERYTHROPOIETIN RECEPTOR (NEPOR) AND METHODS OF USE - Methods of determining whether a patient is suitable for erythropoietin (EPO) therapy, including (A) isolating a tissue sample from said patient; (B) determining the level of expression of EPH-B4 in said sample; and (C) correlating a presence of EPH-B4 expression to a negative physiological response to EPO therapy). In addition, methods of enhancing the effectiveness of EPO therapy in a patient by administering to said patient, in conjunction with EPO therapy, an siRNA specific for EPH-B4. | 10-02-2014 |
20140296319 | Composition For Promoting Apoptosis Or Inhibiting Cell Growth, Comprising Epstein-Barr Virus Microrna - Provided is a use of an miRNA of an Epstein-Barr virus (EBV), more specifically, EBV miR-BART4-5p, miR-BART4-3p, miR-BART1-5p, miR-BART15-3p, miR-BART5-5p, miR-BART5-3p, miR-BART16-5p, miR-BART16-3p, miR-BART17-3p, miR-BART21-3p, miR-BART18-5p, miR-BART7-5p, miR-BART9-5p, miR-BART22-5p, miR-BART20-3p, miR-BART13-5p, miR-BART13-3p, miR-BART2-3p, and mimics thereof for promoting apoptosis or inhibiting cell growth. | 10-02-2014 |
20140296320 | Use Of siRNA To Achieve Down Regulation Of An Endogenous Gene In Combination With The Use of A Sense Construct To Achieve Expression Of A Polynucleotide - The present invention relates to the combinatorial use of an siRNA targeted against an endogenous gene to knock out or knock down expression of the endogenous gene in a host and a delivery of a polynucleotide encoding the gene in a delivery vehicle/expression vector to the host to provide expression in the host of the protein encoded by the polynucleotide. | 10-02-2014 |
20140296321 | METHODS AND COMPOSITIONS FOR MANIPULATING TRANSLATION OF PROTEIN ISOFORMS FROM ALTERNATIVE INITIATION OF START SITES - Provided herein are antisense oligonucleotides, compositions comprising antisense oligonucleotides, and methods for the use of antisense oligonucleotides in manipulating translation. Expression of isoforms of proteins expressed from different start codons of the same transcript are inhibited by antisense oligonucleotides, which may also enhance expression of non-target isoforms. | 10-02-2014 |
20140296322 | CONJUGATES, PARTICLES, COMPOSITIONS, AND RELATED METHODS OF USE - Particles and conjugates for delivering nucleic acid agents. Compositions containing the particles, the conjugates, or both. Methods of using the particles, the conjugates, and the compositions. | 10-02-2014 |
20140296323 | TRICYCLO-PHOSPHOROTHIOATE DNA - The present invention relates to a nucleic acid molecule containing a sequence of tricyclo nucleosides joined by internucleoside phosphorothioate linkage. The invention also relates to synthetic antisense oligonucleotides and to methods employing the same. | 10-02-2014 |
20140303230 | PHARMACEUTICAL COMPOSITION COMPRISING NANOG SHRNA, AND METHOD OF USING NANOG SHRNA TO TREAT CANCER - The present description relates to an inhibitory RNA molecule, comprising an oligonucleotide that selectively knocks down expression of either Nanog or a Nanog pseudogene, a vector capable of encoding such inhibitory RNA molecule, pharmaceutical compositions comprising said vector, and methods of treating cancer by administration of said pharmaceutical composition. | 10-09-2014 |
20140303231 | METHODS AND COMPOSITIONS FOR TREATING OR PREVENTING PRURITIS - The invention features therapeutic compositions comprising agents useful for the treatment or prevention of pruritis, and methods useful for identifying such agents. | 10-09-2014 |
20140303232 | LIPIDS AND LIPID COMPOSITIONS FOR THE DELIVERY OF ACTIVE AGENTS - This invention provides for a compound of formula (I): | 10-09-2014 |
20140303233 | ANTISENSE OLIGONUCLEOTIDES AGAINST cPLA2, COMPOSITIONS AND USES THEREOF - Antisense oligonucleotides against cPLA | 10-09-2014 |
20140303234 | METHODS FOR THE MODULATION OF ANGIOGENESIS - The present invention relates to methods and compositions for promoting or inhibiting capillary endothelial (CE) cell migration, promoting or inhibiting the formation of CE networks and promoting or inhibiting angiogenesis. Some embodiments relate to methods and compositions for treating angiogenesis-related disorders characterized by loss or decreased angiogenesis. One aspect relates to the use of at least one pro-angiogenic agent selected from at least one of an p190RhoGAP inhibitor, a TFII-I inhibitor a GATA-2 activator for promoting the formation of CE networks and angiogenesis, and methods for treating angiogenesis-related disorders characterized by loss or decreased angiogenesis. Another aspect of the invention related to use of at least one anti-angiogenic agent selected from at least one of an p190RhoGAP activator, a TFII-I activator a GATA-2 inhibitor for inhibiting the formation of CE networks and inhibiting angiogenesis, and methods for treating angiogenesis-related disorders characterized by uncontrolled or elevated angiogenesis. | 10-09-2014 |
20140303235 | LINKAGE MODIFIED GAPPED OLIGOMERIC COMPOUNDS AND USES THEREOF - The present invention provides gapped oligomeric compounds. More particularly the gapped oligomeric compounds provided herein comprise at least one modified intemucleoside linkage in the gap region. Such gapped oligomeric compounds have one or more improved properties such as selectivity, potency, improved toxicity profile and or improved proinflammatory profile. Certain such oligomeric compounds are useful for hybridizing to a complementary nucleic acid, including but not limited, to nucleic acids in a cell. In certain embodiments, hybridization results in modulation of the amount activity or expression of the target nucleic acid in a cell. | 10-09-2014 |
20140303236 | CONTROL OF WHOLE BODY ENERGY HOMEOSTASIS BY MICRORNA REGULATION - The disclosure provides a method of regulating fatty acid or glucose metabolism in a cell by contacting the cell with a modulator of miR-208a and/or miR-208b activity or expression. The disclosure also provides a method of treating or preventing a metabolic disorder, such as obesity, diabetes, or metabolic syndrome, in a subject by administering to the subject an inhibitor of miR-208a and/or miR-208b activity or expression. Also provided is a method of enhancing or improving mitochondrial function and/or redox-homeostasis in a subject by administering to the subject an inhibitor of miR-208a and/or miR-208b activity or expression. | 10-09-2014 |
20140303237 | AUTO-RECOGNIZING THERAPEUTIC RNA/DNA CHIMERIC NANOPARTICLES (NP) - Auto-recognizing therapeutic R/DNA chimeric nanoparticles (R/DNA NP) are described that are pairs of DNA/RNA hybrids where the DNA molecules have complementary toehold sequences that promote the re-association of the R/DNA NPs when mixed resulting in the formation of RNA/RNA duplexes that act as siRNAs. | 10-09-2014 |
20140303238 | OLIGONUCLEOTIDES FOR TREATING EXPANDED REPEAT DISEASES - The invention provides for a method for selectively reducing the expression of a mutant mRNA and/or protein having an expanded nucleotide repeat relative to a wild-type mRNA, comprising contacting a cell with an antisense oligonucleotide of sufficient length and complementarity to the expanded nucleotide repeat. More particularly it relates to selectively reducing the expression of mutant Huntington protein associated with Huntington's disease. The antisense oligonucleotide comprising either a nucleotide or a repeated three nucleotide sequence as defined in the claims. | 10-09-2014 |
20140309276 | Pharmaceutical Composition Comprising a Mixture of Carboxylated Oligonucleotides - The invention describes a pharmaceutical composition, comprising a mixture of carboxylated oligonucleotides, obtained by hydrolysis of natural polynucleotides, that results in oligonucleotide mixture, and carboxylation of purine nucleotide bases in the oligonucleotide mixture. The oligonucleotide mixture (DNA, RNA, or a combination of the two) of plant, animal, or fungal origin is conducted through chemical or biochemical enzymatic procedures, and then, a chemical modification of the oligonucleotides is provided, with carboxylation of their purine nucleotide bases through alkylation with monochloroacetic acid, or acylation with succinic anhydride. The pharmaceutical composition may be used in humans and animals for cancer treatment, immunodeficiency, viral infection diseases, etc. | 10-16-2014 |
20140309277 | LIPIDS, LIPID COMPOSITIONS, AND METHODS OF USING THEM - Disclosed are formulation and optimization protocols for delivery of therapeutically effective amounts of biologically active agents to liver, tumors, and/or other cells or tissues. Also provided are compositions and uses for cationic lipid compounds of formula (I). | 10-16-2014 |
20140309278 | COMBINATION CANCER TREATMENTS UTILIZING MICRORNAS AND EGFR-TKI INHIBITORS - The disclosure provides methods and compositions for treating cancer cells, including cancer cells in a subject, whereby two or more therapeutic agents are used, one being an EGFR-TKI agent and the other being a microRNA. | 10-16-2014 |
20140309279 | GAPPED OLIGOMERIC COMPOUNDS COMPRISING 5'-MODIFIED DEOXYRIBONUCLEOSIDES IN THE GAP AND USES THEREOF - The present invention provides gapped oligomeric compounds comprising at least one 5′-substituted P-D-2′-deoxyribonucleoside in the gap region. Certain such gapped oligomeric compounds are useful for hybridizing to a complementary nucleic acid, including but not limited to, nucleic acids in a cell. The oligomeric compounds provided herein have improved properties such as selectivity, potency and improved proinflammatory profile. In certain embodiments, hybridization results in modulation of the amount of activity or expression of the target nucleic acid in a cell. | 10-16-2014 |
20140309280 | ASSAYS FOR MICRO-RNA-182 AS A BIOMARKER FOR MUSCLE ATROPHY AND THERAPEUTIC APPLICATIONS - In certain embodiments, this disclosure relates to assays for miR-182 and therapeutic applications. In certain embodiments, the disclosure relates to methods of evaluating a state of skeletal muscle atrophy comprising the steps of measuring miR-182 in a sample from a subject wherein decreased quantities of miR-182 indicates an increased state of muscle atrophy in the subject. | 10-16-2014 |
20140309281 | MULTI-CONJUGATE OF SIRNA AND PREPARING METHOD THEREOF - The present invention relates to a multi-conjugate of small interfering RNA (siRNA) and a preparing method of the same, more precisely a multi-conjugate of siRNA prepared by direct binding of double stranded sense/antisense siRNA monomers or indirect covalent bonding mediated by a cross-linking agent or a polymer, and a preparing method of the same. The preparing method of a siRNA multi-conjugate of the present invention is characterized by simple and efficient reaction and thereby the prepared siRNA multi-conjugate of the present invention has high molecular weight multiple times the conventional siRNA, so that it has high negative charge density, suggesting that it has excellent ionic interaction with a cationic gene carrier and high gene delivery efficiency. | 10-16-2014 |
20140309282 | COMPOSITIONS AND METHODS FOR MODULATION OF LMNA EXPRESSION - Disclosed herein are compounds, compositions and methods for modulating the expression of LMNA in a cell, tissue or animal. Also provided are methods of target validation. Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and disorders. Further provided are methods of identifying cis splicing regulatory elements of a selected mRNA using the disclosed compounds. | 10-16-2014 |
20140309283 | ANTISENSE OLIGONUCLEOTIDES FOR INDUCING EXON SKIPPING AND METHODS OF USE THEREOF - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202. | 10-16-2014 |
20140309284 | ANTISENSE OLIGONUCLEOTIDES FOR INDUCING EXON SKIPPING AND METHODS OF USE THEREOF - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202. | 10-16-2014 |
20140309285 | ANTISENSE OLIGONUCLEOTIDES FOR INDUCING EXON SKIPPING AND METHODS OF USE THEREOF - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202. | 10-16-2014 |
20140309286 | MODULATION OF TMPRSS6 EXPRESSION - Disclosed herein are antisense compounds and methods for modulating TMPRSS6 and modulating an iron accumulation disease, disorder and/or condition in an individual in need thereof. Iron accumulation diseases in an individual such as hemochromatosis or β-thalassemia can be ameliorated or prevented with the administration of antisense compounds targeted to TM-PRSS6. | 10-16-2014 |
20140315973 | PARP-1 INHIBITORS - We describe a nucleic acid comprising the sequence RNNWCAAA, in which R is independently G or A, N is independently T, C, G or A and W is independently T or A, suitable for the treatment or prevention of hepatitis B or cancer. N at position 3 may be C, A or T, preferably A or T, more preferably T; N at position 2 may be C; W at position 4 may be T; and R at position 1 may be A. The nucleic acid may have the sequence ACATCAAA or ACTTCAAA. | 10-23-2014 |
20140315974 | RNA INTERFERENCE IN SKIN INDICATIONS - The present invention relates to RNAi constructs with improved tissue and cellular uptake characteristics and methods of use of these compounds in dermal applications. | 10-23-2014 |
20140315975 | APOPTOSIS-INDUCING AGENT - This invention relates to: a novel use of GST-π and GST-π suppressing agents; an apoptosis-inducing agent containing as active components a drug that suppresses GST-π and a drug that suppresses autophagy; a medical composition containing said agent; and a method using said medical composition for treating diseases associated with abnormal apoptosis. | 10-23-2014 |
20140315976 | DELIVERING FUNCTIONAL NUCLEIC ACIDS TO MAMMALIAN CELLS VIA BACTERIALLY-DERIVED, INTACT MINICELLS - Intact bacterially derived minicells containing functional nucleic acids or plasmids encoding functional nucleic acids can reduce, in targeted mammalian cells, drug resistance, apoptosis resistance, and neoplasticity, respectively. Methodology that employs minicells to deliver functional nucleic acids, targeting the transcripts of proteins that contribute to drug resistance or apoptosis resistance, inter alia, can be combined with chemotherapy to increase the effectiveness of the chemotherapy. | 10-23-2014 |
20140315977 | EXON SKIPPING COMPOSITIONS FOR TREATING MUSCULAR DYSTROPHY - Antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon 53 skipping are described. | 10-23-2014 |
20140315978 | Compositions and Methods for Treatment of Prostate and Other Cancers - Therapeutic agents which target heat shock protein (hsp) 27 in vivo are used to provide treatment to individuals, particularly human individuals, suffering from prostate cancer and other cancers that overexpress hsp27. A therapeutic agent, for example an antisense oligonucleotide or RNAi nucleotide inhibitor with sequence specificity for hsp27 mRNA, for example human hsp27 mRNA, is administered to an individual suffering from prostate cancer or some other cancer expressing elevated levels of hsp 27 in a therapeutically effective amount. The therapeutic agent is suitably formulated into a pharmaceutical composition which includes a pharmaceutically acceptable carrier, and packaged in dosage unit form. A preferred dosage unit form is an injectable dosage unit form. | 10-23-2014 |
20140315979 | TETRAHYDROPYRAN NUCLEIC ACID ANALOGS - The present disclosure describes tetrahydropyran nucleoside analogs, oligomeric compounds prepared therefrom and methods of using the oligomeric compounds. More particularly, tetrahydropyran nucleoside analogs are provided, having one or more chiral substituents, that are useful for enhancing properties of oligomeric compounds including nuclease resistance and binding affinity. In some embodiments, the oligomeric compounds provided herein hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA. | 10-23-2014 |
20140315980 | THERAPEUTIC OR PROPHYLACTIC AGENT FOR GENERALIZED PAIN SYNDROME - The invention provides a method of treating chronic pain by administering an effective amount of a low-molecular weight compound that inhibits the enzyme activity of autotaxin to a subject in need thereof, thereby treating chronic pain in the subject. The chronic pain preferably is fibromyalgia, chronic fatigue syndrome, or hypersensitivity colitis. | 10-23-2014 |
20140315981 | STRATEGIES FOR PREVENTION AND/OR TREATMENT OF DISEASES BASED ON CD40 SILENCING - The present invention is related to methods for prevention and/or treatment of a number of diseases, such as lupus nephritis, ischemia/reperfusion injury and sepsis, based on the silencing of CD40 using different RNA silencing strategies. | 10-23-2014 |
20140315982 | DOUBLE-STRANDED NUCLEIC ACID MOLECULE FOR GENE EXPRESSION CONTROL - Provided are an improved double-stranded nucleic acid molecule involved in gene expression control mediated by a gene silencing mechanism, a method of producing the molecule, and a pharmaceutical composition comprising the double-stranded nucleic acid molecule. The double-stranded nucleic acid molecule for gene expression control comprises an antisense strand having a length of 18 to 28 nucleotides and a sense strand including a complementary moiety composed of a sequence sufficiently complementary to the antisense strand and a protruding single-stranded 5′-end moiety having a length of 2 to 100 nucleotides. The sense strand and the antisense strand form base pairs via the complementary moiety. The method produces such a double-stranded nucleic acid molecule, and the pharmaceutical composition contains such a double-stranded nucleic acid molecule as an active ingredient. | 10-23-2014 |
20140315983 | METHODS AND COMPOSITIONS FOR THE SPECIFIC INHIBITION OF MET BY DOUBLE STRANDED RNA - This invention relates to compounds, compositions, and methods useful for reducing MET target RNA and protein levels via use of dsRNAs, e.g., Dicer substrate siRNA (DsiRNA) agents. | 10-23-2014 |
20140323541 | Methods And Compositions For Prevention Or Treatment Of RSV Infection Using Modified Duplex RNA Molecules - Methods and compositions are provided for the prevention or treatment of RSV infection in a human. The methods include administering one or more doses of a composition comprising an siRNA. The dose can be formulated for topical or parenteral administration. Topical administration includes administration as a nasal spray, or by inhalation of respirable particles or droplets. The siRNA preferably comprises a sense strand and antisense strand with modified nucleotides. | 10-30-2014 |
20140323542 | TARGETING DOMAIN AND RELATED SIGNAL ACTIVATED MOLECULAR DELIVERY - Provided herein are signal activatable molecular constructs for enzyme-assisted delivery of molecules and related components, such as a sensor domain, compositions, methods and systems. | 10-30-2014 |
20140323543 | Treatment of Prostate Cancer with eIF4E Antisense Compounds - The present invention provides methods of sensitizing cancer cells to docetaxel and inhibiting the growth of various tumors by employing a modified eIF-4E antisense oligonucleotide and docetaxel in combination. | 10-30-2014 |
20140323544 | EXON SKIPPING COMPOSITIONS FOR TREATING MUSCULAR DYSTROPHY - Antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon 44 skipping are described. | 10-30-2014 |
20140323545 | NITRATED SPHINGOSINE 1-PHOSPHATE 3 RECEPTOR AS A PREDICTOR OF ACUTE LUNG INJURY-ASSOCIATED MORTALITY - The disclosure relates to a method of determining risk of mortality from Acute Lung Injury (ALI), sepsis, or a combination thereof in a patient, as well as a method of diagnosing ALI in a patient with sepsis based on the presence of tyrosine-nitrated sphingosine 1-phosphate 3 receptor (S1P3R) protein. The disclosure additionally relates to a method of treating an Acute Lung Injury (ALI) patient with sepsis based on the presence of tyrosine-nitrated S1P3R protein. | 10-30-2014 |
20140323546 | PME-1 AS A BIOMARKER TO PREDICT AND DIAGNOSE AN INCREASED RISK OF ENDOMETRIAL CANCER AND GENE SILENCING OF PME-1 TO INHIBIT EPITHELIAL TO MESENCHYMAL TRANSITION - Disclosed are methods of attenuating activity of the PME-1 gene. siRNAs or shRNAs are used to target against PME-1, thereby reducing the PME-1 mRNA. It is disclosed that the siRNAs or shRNAs targeted against PME-1 attenuate the epithelial to mesenchymal transition, thereby inhibit endometrial cancer development. A kit containing siRNA or shRNA reagents for attenuating the PME-1 gene expression is also disclosed. | 10-30-2014 |
20140323547 | FAT1 GENE IN CANCER AND INFLAMMATION - The present invention demonstrates for the first time that FAT1 plays an important role in modulating PDCD4 expression, which in turn regulates AP-1 dependent transcription, controls processes crucial for migration and invasion in cancer cells, controls induction of a pro-inflammatory micro environment in cancer cells. The study illustrates a link between inflammation and cancer in cells or in a subject. This work highlights the importance of FAT1 in the induction of the cellular pathways of migration and invasion, proteolysis of the ECM and the expression of pro-inflammatory molecules leading to a favorable micro environment for tumor and cancer progression. The present invention also provides the use of FAT1 in regulating neoplastic phenotypes and genotypes including invasiveness and inflammatory micro environment of the cancer cells by acting as a novel apical regulator of a signaling pathway by affecting the AP1 transcriptional activity, affecting the property of both cell migration and invasion and at the same time affecting the expression of inflammatory modulators. The present invention also identifies a novel regulatory pathway for inflammatory mediators and inflammatory cellular responses via PDCD4 and AP1. The invention describes a pathway for the upregulation of inflammatory processes as such, and hence a means of regulating inflammatory pathologies in general. | 10-30-2014 |
20140323548 | NOVEL AMINO ALCOHOL CATIONIC LIPIDS FOR OLIGONUCLEOTIDE DELIVERY - The instant invention provides for novel cationic lipids that can be used in combination with other lipid components such as cholesterol and PEG-lipids to form lipid nanoparticles with oligonucleotides. It is an object of the instant invention to provide a cationic lipid scaffold that is more efficacious than traditional cationic lipids. The present invention employs amino alcohols to enhance the efficiency of in vivo delivery of siRNA. | 10-30-2014 |
20140323549 | METHODS AND COMPOSITIONS FOR TREATING DISEASES, DISORDERS OR INJURY OF THE NERVOUS SYSTEM - Disclosed herein are compositions and methods of use thereof for treating diseases, disorders and injuries of the nervous system, comprising a combination of a RTP801 or RTP801L inhibitor, and a Casp2 inhibitor. | 10-30-2014 |
20140323550 | INTESTINAL FIBROSIS TREATMENT AGENT - The present invention relates to a carrier for delivering a substance to extracellular matrix-producing cells in the intestine, the carrier containing a retinoid as a targeting agent, and an agent for treating fibrosis of the intestine utilizing the carrier. | 10-30-2014 |
20140323551 | TARGETING MICRORNAS MIR-409-5P, MIR-379 AND MIR-154* TO TREAT PROSTATE CANCER BONE METASTASIS AND DRUG RESISTANT LUNG CANCER - The present invention describes methods of treating cancer, cancer metastasis, and drug resistant cancers using miRNA inhibitors; for example, inhibitors of miR-409-5p. Also described are methods of using the miRNA as biomarkers; for example, to predict responsiveness to a cancer drug, to detect a disease state of cancer. | 10-30-2014 |
20140323552 | NON-IONIC, LOW OSMOLAR CONTRAST AGENTS FOR DELIVERY OF ANTISENSE OLIGONUCLEOTIDES AND TREATMENT OF DISEASE - Disclosed are compositions comprising an antisense oligonucleotide and a non-ionic, low-osmolar contrast agent. Also disclosed are methods of delivering an antisense oligonucleotide to a target sire comprising incorporating the antisense oligonucleotide into a composition comprising a non-ionic, low-osmolar contrast agent. Also disclosed are methods of treating a neurodegenerative disease comprising administering one or more of the compositions disclosed herein. | 10-30-2014 |
20140323553 | Methods and Compositions Related to MiR-21 & MiR-29a, Exosome Inhibition, and Cancer Metastasis - The present invention provides materials and methods related to the discovery that tumor secreted miR-21 and miR-29a can function by binding as ligands to receptors of the Tolllike receptor family, murine TLR7 and human TLR8, in immune cells, triggering a TLR-mediated prometastatic inflammatory response, which leads to tumor growth and metastasis. Thus, by acting as paracrine agonists of TLRs, secreted miRNAs are key regulators of the tumor microenvironment. This mechanism of action of miRNAs is important in the tumor-immune system communication, in tumor growth and spread, and in cancer treatment. | 10-30-2014 |
20140329878 | OLIGONUCLEOTIDE MODULATORS OF THE TOLL-LIKE RECEPTOR PATHWAY - Disclosed herein are double stranded nucleic acid molecules and pharmaceutical compositions comprising same useful in the treatment of, inter alia, acute and chronic inflammation, neuropathic pain, primary graft dysfunction (PGD) after lung transplantation in a subject in need thereof. The compounds are preferably chemically synthesized and modified dsRNA compounds, which down regulate or inhibit expression of a Toll like receptor genes. | 11-06-2014 |
20140329879 | DIAGNOSIS AND TREATMENT OF TAXANE-RESISTANT CANCERS - Provided herein are methods and assays relating to the diagnosis and treatment of a taxane-resistant cancer. Such methods and assays comprise determining the level of expression of miR-135a in a biological sample from a subject having or suspected of having a taxane-resistant cancer or from a subject that was or is being treated with a taxane anti-cancer agent. Also provided herein are methods for treating such cancers by administering an inhibitor of the miR-135a pathway and a taxane to a subject in need thereof. | 11-06-2014 |
20140329880 | EXONUCLEASE RESISTANT POLYNUCLEOTIDE AND RELATED DUPLEX POLYNUCLEOTIDES, CONSTRUCTS, COMPOSITIONS, METHODS AND SYSTEMS - Provided herein are exonuclease resistant polynucleotides and related constructs, compositions, methods and systems. | 11-06-2014 |
20140329881 | EXON SKIPPING COMPOSITIONS FOR TREATING MUSCULAR DYSTROPHY - Antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon 44 skipping are described. | 11-06-2014 |
20140329882 | OLIGOMERIC COMPOUNDS AND COMPOSITIONS FOR USE IN MODULATION OF SMALL NON-CODING RNAS - Compounds, compositions and methods are provided for modulating the expression and function of small non-coding RNAs. The compositions comprise oligomeric compounds, targeted to small non-coding RNAs. Methods of using these compounds for modulation of small non-coding RNAs as well as downstream targets of these RNAs and for diagnosis and treatment of disease associated with small non-coding RNAs are also provided. | 11-06-2014 |
20140329883 | Pharmaceutical Composition Comprising Anti-miRNA Antisense Oligonucleotides - The invention provides pharmaceutical compositions comprising short single stranded oligonucleotides, of length of between 8 and 26 nucleobases which are complementary to human microRNAs selected from the group consisting of miR19b, miR21, miR122a, miR155 and miR375. The short oligonucleotides are particularly effective at alleviating miRNA repression in vivo. It is found that the incorporation of high affinity nucleotide analogues into the oligonucleotides results in highly effective anti-microRNA molecules which appear to function via the formation of almost irreversible duplexes with the miRNA target, rather than RNA cleavage based mechanisms, such as mechanisms associated with RNaseH or RISC. | 11-06-2014 |
20140329884 | 1,3,5-TRIAZINANE-2,4,6-TRIONE DERIVATIVES AND USES THEREOF - The present invention provides novel 1,3,5-triazinane-2,4,6-trione derivatives, such as compounds of any one of Formulae (I) and (II), and salts thereof, and methods of preparing the compounds. Also provided are compositions including a compound of the invention and an agent (e.g., an siRNA, mRNA, or plasmid DNA). The present invention also provides methods and kits using the compositions for delivering an agent to a subject (e.g., to the liver, spleen, or lung of the subject) or cell and for treating and/or preventing a range of diseases, such as genetic diseases, proliferative diseases, hematological diseases, neurological diseases, liver diseases, and lung diseases. | 11-06-2014 |
20140329885 | LIPIDS, LIPID COMPLEXES AND USE THEREOF - The present invention is related to uses of a composition comprising a pharmaceutically active component and a compound according to formula (I), | 11-06-2014 |
20140329886 | SINGLE-STRANDED NUCLEIC ACID MOLECULE HAVING AMINO ACID BACKBONE - The invention provides a single-stranded nucleic acid molecule containing an expression inhibitory sequence that inhibits expression of a target gene, region (X), linker region (Lx), and region (Xc), wherein the linker region (Lx) is linked between the region (Xc) and the region (Xc), the region (Xc) is complementary to the region (X), at least one of the region (X) and the region (Xc) contains the expression inhibitory sequence, and the linker region (Lx) contains an atomic group derived from an amino acid. The single-stranded nucleic acid molecule can inhibit expression of the target gene. | 11-06-2014 |
20140329887 | MICRORNA COMPOUNDS AND METHODS FOR MODULATING MIR-21 ACTIVITY - Described herein are compositions and methods for the inhibition of miR-21 activity. The compositions have certain nucleoside modification patterns that yield potent inhibitors of miR-21 activity. The compositions may be used to inhibit miR-21, and also to treat diseases associated with abnormal expression of miR-21, such as fibrosis and cancer. | 11-06-2014 |
20140336236 | NOVEL ALK AND NTRK1 FUSION MOLECULES AND USES THEREOF - Novel ALK and NTRK1 fusion molecules and uses are disclosed. | 11-13-2014 |
20140336237 | MODULATION OF SIGNAL TRANSDUCER AND ACTIVATOR OF TRANSCRIPTION 3 (STAT3) EXPRESSION - Disclosed herein are antisense compounds and methods for decreasing STAT3 mRNA and protein expression. Such methods, compounds, and compositions are useful to treat, prevent, or ameliorate hyperproliferative diseases. | 11-13-2014 |
20140336238 | ANTISENSE OLIGONUCLEOTIDES FOR THE TREATMENT OF LEBER CONGENITAL AMAUROSIS - The present invention relates to the fields of medicine and immunology. In particular, it relates to novel antisense oligonucleotides that may be used in the treatment, prevention and/or delay of Leber congenital amaurosis. | 11-13-2014 |
20140336239 | COMPOSITIONS AND METHODS FOR MODULATING MYELOID DERIVED SUPPRESSOR CELLS - Provided are methods and compositions for modulating the differentiation of a myeloid derived suppressor cell (MDSC). In particular, described herein are miR-142 polynucleotides and miR-223 polynucleotides that can be used to modulate differentiation of MDSCs. Increased differentiation of a MDSC population, or cells within an MDSC population, can be achieved by increasing the miR-142 and/or miR-223 polynucleotides in a MDSC. | 11-13-2014 |
20140336240 | METHOD OF TREATING HYPERLIPIDEMIA AND ATHEROSCLEROSIS WITH MIR-30C - This disclosure provides a novel role for microRNA (miR) regulation of lipid metabolism via the MTP pathway, leading to reductions in apoB secretion and blood lipid levels. MiR regulation of the MTP pathway is shown herein to reduce hyperlipidemia and atherosclerosis in vivo. Therefore, inhibition of MTP expression and activity by miR regulation is identified as a new therapeutic target for treatment of cardiovascular disease and conditions or diseases associated with cardiovascular disease such as hyperlipidemia, atherosclerosis, and metabolic syndrome. Treatment of cardiovascular disease and associated conditions or diseases with the novel MTP inhibitors of the invention, such as miR-30c homologs or miR-30c agonists, reduces MTP-associated lipid production without side effects that occur with other methods of MTP inhibition. | 11-13-2014 |
20140336241 | COMPOSITIONS AND METHODS FOR PROGNOSIS AND TREATMENT OF PROSTATE CANCER - Described herein are compositions and methods for prognosis and treatment of prostate cancer patients. Specifically the invention relates to microRNA molecules associated with the prognosis of prostate cancer, as well as various nucleic acid molecules relating thereto or derived therefrom. | 11-13-2014 |
20140336242 | Micro-RNA Scaffolds and Non-naturally Occurring Micro-RNAs - The present disclosure provides a non-naturally occurring miRNA having a stem-loop structure comprising a scaffold derived from a first endogenous miRNA (e.g., miR-196a-2 or miR-204), a mature strand derived from a second endogenous miRNA, and a star strand sequence that is at least partially complementary to the mature strand sequence. The present disclosure also provides a non-naturally occurring miRNA having a stem-loop structure comprising a scaffold derived from an endogenous miRNA (e.g., miR-196a-2 or miR-204), a mature strand designed to be at least partially complementary to a target RNA, and a star strand sequence that is at least partially complementary to the mature strand sequence. The methods and compositions of the disclosure may be used to mediate gene silencing via the RNAi pathway. | 11-13-2014 |
20140336243 | Lipid Formulated Compositions and Methods for Inhibiting Expression of Eg5 and VEGF Genes - This invention relates to compositions containing double-stranded ribonucleic acid (dsRNA) in a SNALP formulation, methods of using the compositions to inhibit the expression of the Eg5/KSP and VEGF, and methods of using the compositions to treat pathological processes mediated by Eg5/KSP and VEGF expression, such as cancer. | 11-13-2014 |
20140343120 | METHODS AND COMPOSITIONS FOR REDUCING ACTIVITY OF THE ATRIAL NATRIURETIC PEPTIDE RECEPTOR AND FOR TREATMENT OF DISEASES - Methods, compositions and devices are provided by the present invention for reducing activity of a natriuretic peptide receptor and other signals. Therapeutic treatments are provided by use of polynucleotides encoding a natriuretic peptide or by regulating the expression of natriuretic peptide receptor, such as NPRA and NPRC, or combinations of these therapies. Routes used for delivering polynucleotides encoding a natriuretic peptide, or, for example, siRNA that down regulates natriuretic peptide receptor include subcutaneous injection, oral gavage, transdermal and intranasal delivery routes. Compositions can include chitosan, chitosan derivatives, and chitosan derivative and a lipid. Transdermal delivery can use a transdermal cream. Intranasal delivery can use a dropper or an aspirator for delivery of a mist. Oral gavage delivers equivalent to oral delivery. Delivery permits cell and tissue specific targeting of gene therapies resulting in expression of a natriuretic peptide or down regulation of natriuretic peptide receptor. A variety of cancers, asthma and viral diseases can be treated therapeutically using the methods and compositions of the present invention. | 11-20-2014 |
20140343121 | COMPOSITIONS AND METHODS RELATING TO miR-31 - MicroRNA-31 (miR-31), targets of miR-31, the role of miR-31 in inhibiting tumor metastasis, and the role of miR-31 target genes in promoting tumor metastasis are disclosed. | 11-20-2014 |
20140343122 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF FACTOR VII GENE - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the Factor VII gene. | 11-20-2014 |
20140343123 | CONJUGATED ANTISENSE COMPOUNDS AND THEIR USE - Provided herein are oligomeric compounds with conjugate groups. In certain embodiments, the oligomeric compounds are conjugated to N-Acetylgalactosamine. | 11-20-2014 |
20140343124 | METHOD FOR REDUCING EXPRESSION OF DOWNREGULATED IN RENAL CELL CARCINOMA IN MALIGNANT GLIOMAS - The present invention relates to novel compositions and therapeutic methods for the treatment of cancer, in particular malignant glioma. The compositions include antisense oligonucleotides or RNAs or vectors encoding them which reduce expression of downregulated in renal cell carcinoma (DRR) in tumor cells, and inhibit malignant glioma cell invasion. | 11-20-2014 |
20140343125 | OLIGONUCLEOTIDES FOR RNA INTERFERENCE AND BIOLOGICAL APPLICATIONS THEREOF - The invention relates to compositions comprising double-stranded oligonucleotides of identical or different sequences and/or length, said oligonucleotides having sequences | 11-20-2014 |
20140343126 | RNA INTERFERENCE MEDIATED INHIBITION OF CATENIN (CADHERIN-ASSOCIATED PROTEIN), BETA 1 (CTNNB1) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (SINA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of CTNNB1 gene expression and/or activity, and/or modulate a beta-catenin gene expression pathway. Specifically, the invention relates to double-stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules that are capable of mediating or that mediate RNA interference (RNAi) against CTNNB1 gene expression. | 11-20-2014 |
20140343127 | COMPOUNDS FOR THE MODULATION OF SMN2 SPLICING - The present invention relates to oligomer compounds (oligomers) which target nucleic acids encoding human SMN2 in a cell, leading to modulation of SMN2 mRNA splicing which favors full length SMN2 mRNA rather than the poorly functional truncated transcript, SMN2 Δ7. Reduction of SMNA7 mRNA expression and/or increase in full length SMN2 mRNA expression are beneficial for the treatment of diseases or disorders associated with overexpression or undesirably high levels of aberrant forms of SMN2, particularly SMN2 Δ7, such as spinal muscular atrophy (SMA). | 11-20-2014 |
20140343128 | Combination of a phosphoinositide 3-kinase inhibitor and a modulator of the Janus Kinase 2 - Signal Transducer and Activator of Transcription 5 pathway - The invention relates to a pharmaceutical combination which comprises (a) a phosphoinositide 3-kinase inhibitor compound and (b) a compound which modulates the JAK2-STAT5 pathway for the treatment of a proliferative disease, especially a solid tumor disease; a pharmaceutical composition comprising such a combination; the use of such a combination for the preparation of a medicament for the treatment of a proliferative disease; a commercial package or product comprising such a combination as a combined preparation for simultaneous, separate or sequential use; and to a method of treatment of a warm-blooded animal, especially a human. | 11-20-2014 |
20140343129 | MODIFIED NUCLEIC ACIDS, AND ACUTE CARE USES THEREOF - The invention provides compositions and methods for effecting wound healing in a mammal, where the compositions include therapeutic mRNA which incorporate modified nucleosides and nucleotides. | 11-20-2014 |
20140343130 | Micro-RNA Scaffolds, Non-naturally Occurring Micro-RNAs, and Methods for Optimizing Non-naturally Occurring Micro-RNAs - The present disclosure provides non-naturally occurring miR-196a-2 miRNAs and non-naturally occurring miR-204 miRNAs. The non-naturally occurring miRNAs of the disclosure have mature strand sequences distinct from their endogenous counterparts. The disclosure also provides methods of selecting mature strand sequences that function optimally in non-naturally occurring miR-196a-2 miRNAs. The methods and compositions of the disclosure may be used to mediate gene silencing via the RNAi pathway. | 11-20-2014 |
20140343131 | COMPOSITIONS AND METHODS FOR THE SUPPRESSION OF TARGET POLYNUCLEOTIDES FROM LYGUS - Methods and compositions are provided which employ a silencing element that, when ingested by a pest, such as a pest from the | 11-20-2014 |
20140350066 | COMPOSITIONS AND THEIR USES FOR GENE THERAPY OF BONE CONDITIONS - In certain preferred embodiments, the present invention provides compositions and methods for the treatment of bone conditions associated with low bone density. In preferred embodiments, the present invention provides compositions and methods for the treatment of osteoprotegerin-responsive conditions. | 11-27-2014 |
20140350067 | ANTISENSE MOLECULES AND METHODS FOR TREATING PATHOLOGIES - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 59. | 11-27-2014 |
20140350068 | RTP801L SIRNA COMPOUNDS AND METHODS OF USE THEREOF - The invention provides chemically modified siRNA oligonucleotides that target RTP801L, compositions comprising same and to the use of such molecules to treat, inter alia, respiratory diseases including acute and chronic pulmonary disorders, eye diseases including glaucoma and ION, microvascular disorders, angiogenesis- and apoptosis-related conditions, and hearing impairments. | 11-27-2014 |
20140350069 | METHODS AND AGENTS TO INCREASE THERAPEUTIC DYSTROPHIN EXPRESSION IN MUSCLE - Agents and methods for increasing dystrophin protein expression in muscle through blocking of specific microRNAs and microRNA binding sites on the dystrophin 3′ untranslated region (miR-146a, miRNA-146b, miR-223, miR-320a, miR374a, and miR-382). Methods for increasing the amount of dystrophin useful for effective therapeutic intervention for Becker muscular dystrophy, Duchenne muscular dystrophy, and other disorders where loss of dystrophin from muscle causes pathology. | 11-27-2014 |
20140350070 | Combination Therapy for MDS - Disclosed are compositions and methods for the treatment of disorders such as myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). The disclosed methods include administering to an individual in need of such treatment a composition that may include an IRAK1/4 inhibitor. In other aspects, the method may include administration of a BLC2 inhibitor. | 11-27-2014 |
20140350071 | SERPINA1 iRNA COMPOSITIONS AND METHODS OF USE THEREOF - The invention relates to RNAi agents, e.g., double-stranded RNAi agents, targeting the Serpina1 gene, and methods of using such RNAi agents to inhibit expression of Serpina1 and methods of treating subjects having a Serpina1 associated disease, such as a liver disorder. | 11-27-2014 |
20140350072 | NOVEL REPRESSOR ON IFN-LAMBDA PROMOTER AND SIRNA AGAINST ZEB1 AND BLIMP-1 TO INCREASE IFN-LAMBDA GENE ACTIVITY - The present invention is directed to the identification of a novel repressor located between ˜1.2 kb to ˜1.6 kb from the translation start site of the IFN-λ1 promoter. The present invention provides a method of using siRNAs against ZEB1 (binds to the repressor region) and BLIMP-1 (binds outside the repressor region) and increases the promoter activity of IFN-λ1 (i.e., increases the production of IFN-λ1 protein). siRNAs against ZEB1 mRNA or BLIMP-1 mRNA increase IFN-λ1 gene activity. There is provided a therapeutic application of siRNAs against ZEB1 and BLIMP-1 mRNAs in treating a mammal (including a human) by increasing the production of IFN-λ1 protein that promotes an anti-viral response as well as treats asthma diseases. | 11-27-2014 |
20140350073 | DOUBLE-STRANDED NUCLEIC ACID MOLECULE, CANCER CELL PROLIFERATION INHIBITOR AND PHARMACEUTICAL AGENT SUITABLE FOR PREVENTION OR TREATMENT OF CANCER - A double-stranded nucleic acid molecule including (a) a sense strand which includes a nucleotide sequence corresponding to a target sequence indicated by any one of SEQ ID Nos.: 1 to 21, and (b) an antisense strand which includes a nucleotide sequence complementary to that of the sense strand specified in (a), wherein the double-stranded nucleic acid molecule is for suppressing the expression of at least one of APP and EBAG9 genes. | 11-27-2014 |
20140350074 | Extended Dicer Substrate Agents and Methods for the Specific Inhibition of Gene Expression - The invention provides compositions and methods for reducing expression of a target gene in a cell, involving contacting a cell with an isolated double stranded nucleic acid (dsNA) in an amount effective to reduce expression of a target gene in a cell. The dsNAs of the invention possess a pattern of deoxyribonucleotides (in most embodiments, the pattern comprises at least one deoxyribonucleotide-deoxyribonucleotide base pair) designed to direct the site of Dicer enzyme cleavage within the dsNA molecule. Deoxyribonucleotides of the dsNA molecules of the invention are located within a region of the dsNA that can be excised via Dicer cleavage to generate an active siRNA agent that no longer contains the deoxyribonucleotide pattern (e.g., deoxyribonucleotide-deoxyribonucleotide base pairs). Such DNA-extended Dicer-substrate siRNAs (DsiRNAs) were demonstrated to be more effective RNA inhibitory agents than corresponding double stranded RNA-extended DsiRNAs. DsiRNA agents were also found to tolerate guide strand mismatches. | 11-27-2014 |
20140350075 | Compositions and Methods for Inhibiting Expression of the PCSK9 Gene - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the PCSK9 gene (PCSK9 gene), comprising an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of the PCSK9 gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier and method for treating diseases caused by PCSK9 gene expression. | 11-27-2014 |
20140350076 | INDUCTION OF EXON SKIPPING IN EUKARYOTIC CELLS - The present invention provides a method for at least in part decreasing the production of an aberrant protein in a cell, the cell comprising pre-mRNA comprising exons coding for the protein, by inducing so-call exon skipping in the cell. Exon-skipping results in mature mRNA that does not contain the skipped exon, which leads to an altered product of the exon codes for amino acids. Exon skipping is performed by providing a cell with an agent capable of specifically inhibiting an exon inclusion signal, for instance, an exon recognition sequence, of the exon. The exon inclusion signal can be interfered with by a nucleic acid comprising complementarity to a part of the exon. The nucleic acid, which is also herewith provided, can be used for the preparation of a medicament, for instance, for the treatment of an inherited disease. | 11-27-2014 |
20140350077 | Amphipathic Co-Oligomers for the Delivery of SIRNA - Co-oligomer compounds, complexes of the same with polyanions, such as siRNAs, and methods for using the same are provided. the delivery of polynucleotides, into a cell. The subject co-oligomers include at least a liphopilic monomer and at least a hydrophilic monomer (e.g., a guanidinium containing monomer). In some embodiments, the co-oligomer compounds are capable of complexing a siRNA of interest, thereby increasing the cell permeability of the siRNA, prior to release of the siRNA into the cell. In some embodiments, the subject method is a method of delivery a siRNA into a cell. In some embodiments, the subject method is a method of reducing expression of a protein target of a siRNA of interest. The subject co-oligomer/siRNA complexes may be formulated and administered to a subject to treat a condition resulting from expression of a protein target of the siRNA of interest. | 11-27-2014 |
20140350078 | CONTROLLING REGULATORY T CELL FUNCTION - The present invention relates to a method of identifying candidate compounds useful as chemotherapeutics or anti-infective compounds or anti-inflammatory drugs. This method involves providing a plurality of test compounds. The plurality of test compounds are incubated with human Regulatory T (Treg) cells expressing Disc-Large Homo log 1 (Dlgh1) or in which Dlgh1 is suppressed, where the Treg cells have an immunological synapse (IS). Test compounds which inhibit Dlgh1 expression, recruitment to the IS, and/or activity in the Treg cells are identified as candidate compounds potentially useful as chemotherapeutics or anti-infective compounds. Test compounds which enhance Dlgh1 recruitment to the IS and/or activity in the Treg cells are identified as candidate compounds potentially useful as anti-inflammatory drugs. The present invention also relates to methods of treating inflammatory conditions, cancers, and infectious diseases in a subject, as well as methods of inhibiting Treg cell activity. | 11-27-2014 |
20140350079 | SMALL INTERFERENCE RNAS, USES THEREOF AND METHOD FOR INHIBITING THE EXPRESSION OF PLK1 GENE - The present invention provides siRNAs for inhibiting the expression of plk1 gene, and the method for inhibiting the expression of plk1 gene in mammalian cells. The siRNAs of the present invention have the double-stranded structure, and said double-stranded structure is composed of the first single strand and the second single strand that are fully complementary, wherein the sequence of said first single strand is the same as the target sequence within the sequence as shown in SEQ ID NO: 1, and the sequence of said second single strand is complementary to the target sequence within the sequence as shown in SEQ ID NO: 1. The siRNAs of the present invention can sequence specifically mediate the inhibition of plk1 gene expression, and have a good serum stability. By the introduction of the siRNAs of the present invention into the tumor cells, the expression of plk1 gene can be effectively inhibited, and the growth of tumor cells is inhibited and the apoptosis of tumor cells is promoted. | 11-27-2014 |
20140350080 | INHIBITION OF VIRAL GENE EXPRESSION - This invention relates to modified short interfering RNA (siRNA) nucleic acid molecules, particularly siRNA's which have been modified by the addition of a 2-0-guanidinopropyl (GP) modified nucleoside. In particular the invention relates to modified siRNAs which are capable of silencing target sequences, methods of treating and preventing infection by using the siRNAs, medicaments containing the siRNAs and use of the siRNAs. | 11-27-2014 |
20140350081 | INSECT G-COUPLED RECEPTORS USEFUL AS TARGETS FOR INSECTICIDES AND COMPOUNDS AND REAGENTS IDENTIFIED USING THE SAME - An approach to identify and evaluate potential insecticide targets using publicly available genome (DNA) sequence information for arthropod disease vector is provided. The utility of this approach is demonstrated by first determining the molecular and pharmacological properties of two different dopamine (neurotransmitter) receptors identified in the genome of the yellow fever- and dengue-transmitting mosquito, | 11-27-2014 |
20140350082 | PEPTIDE SEQUENCE DESIGN AND USE THEREOF FOR PEPTIDE-MEDIATED siRNA DELIVERY - The invention provides, in one aspect, peptides and a complex comprising one of the peptides and a cargo molecule, wherein the peptide and the cargo molecule are coupled by non-covalently. The peptides of the invention were found to facilitate the delivery of siRNA molecules into cells and to function in siRNA mediated silencing of cellular targets. | 11-27-2014 |
20140350083 | Genetic Inhibition by Double-Stranded RNA - A process is provided of introducing an RNA into a living cell to inhibit gene expression of a target gene in that cell. The process may be practiced ex vivo or in vivo. The RNA has a region with double-stranded structure. Inhibition is sequence-specific in that the nucleotide sequences of the duplex region of the RNA and of a portion of the target gene are identical. The present invention is distinguished from prior art interference in gene expression by antisense or triple-strand methods. | 11-27-2014 |
20140350084 | COMPOSITIONS AND METHODS FOR MODULATING ANGIOGENESIS - The invention generally features compositions and methods that are useful for modulating angiogenesis. | 11-27-2014 |
20140350085 | NOVEL SUGAR ALCOHOL-BASED COMPOSITIONS FOR DELIVERING NUCLEIC ACID-BASED DRUGS IN VIVO AND IN VITRO - This invention relates to a composition and its use for formulating nucleic acid-based drugs/vaccines with sugar alcohol compositions into complexes for both in-vitro and in-vivo delivery. Particularly, the present invention includes the ingredients and processes necessary for formulating therapeutic and pharmaceutical nucleic acid compositions, such as miRNA, microRNA precursors, shRNAs, siRNAs, ribozymes, antisense RNAs/DNAs, RNA-DNA hybrids and DNA vectors/vaccines, with glycylated sugar alcohols/sugars into delivery complexes, which can then be absorbed by cells in vivo and in vitro via active endocytosis. Also, the present invention discloses that chemical compounds containing sugar alcohol- and/or sugar-like structures can protect nucleic acids, in particular miRNAs, shRNAs, siRNAs and ribozymes, from degradation in vivo as well as in vitro. Therefore, the present invention is also a formula and method for preserving the structural integrity and functional efficacy of these nucleic acid-based drugs and/or vaccines in vivo and in vitro. | 11-27-2014 |
20140350086 | METHODS AND COMPOSITIONS INVOLVING MIRNA AND MIRNA INHIBITOR MOLECULES - The present invention concerns methods and compositions for introducing miRNA activity or function into cells using synthetic nucleic acid molecules. Moreover, the present invention concerns methods and compositions for identifying miRNAs with specific cellular functions that are relevant to therapeutic, diagnostic, and prognostic applications wherein synthetic miRNAs and/or miRNA inhibitors are used in library screening assays. | 11-27-2014 |
20140357692 | RNAi Inhibition of Serum Amyloid A For Treatment of Glaucoma - RNA interference is provided for inhibition of serum amyloid A mRNA expression in glaucomas involving SAA expression. | 12-04-2014 |
20140357693 | METABOLIC GENE MESENCHYMAL SIGNATURES AND USES THEREOF - Aspects of the invention relate to methods and compositions for characterizing or modulating the expression of metabolic mesenchymal genes. In some embodiments, methods for assessing the expression of metabolic mesenchymal genes and related gene signatures are provided that are useful for cancer classification, prognosis, diagnosis, or treatment selection. | 12-04-2014 |
20140357694 | RNAi-MEDIATED INHIBITION OF TUMOR NECROSIS FACTOR ALPHA-RELATED CONDITIONS - RNA interference is provided for inhibition of tumor necrosis factor α (TNFα) by silencing TNFα cell surface receptor TNF receptor-1 (TNFR1) mRNA expression, or by silencing TNFα converting enzyme (TACE/ADAM17) mRNA expression. Silencing such TNFα targets, in particular, is useful for treating patients having a TNFα-related condition or at risk of developing a TNFα-related condition such as the ocular conditions dry eye, allergic conjunctivitis, or ocular inflammation, or such as dermatitis, rhinitis, or asthma, for example. | 12-04-2014 |
20140357695 | RNAi-MEDIATED INHIBITION OF SPLEEN TYROSINE KINASE-RELATED INFLAMMATORY CONDITIONS - RNA interference is provided for inhibition of spleen tyrosine kinase (Syk) mRNA expression, in particular, for treating patients having a Syk-related inflammatory condition or at risk of developing a Syk-related inflammatory condition such as allergic conjunctivitis, ocular inflammation, dermatitis, rhinitis, asthma, allergy, or mast-cell disease. | 12-04-2014 |
20140357696 | RNAi-RELATED INHIBITION OF TNF alpha SIGNALING PATHWAY FOR TREATMENT OF OCULAR ANGIOGENESIS - RNA interference is provided for inhibition of tumor necrosis factor α (TNFα) by silencing TNFα cell surface receptor TNF receptor-1 (TNFR1) mRNA expression, or by silencing TNFα converting enzyme (TACE/ADAM17) mRNA expression. Silencing such TNFα targets, in particular, is useful for treating patients having a TNFα-related condition or at risk of developing a TNFα-related condition, such as ocular angiogenesis, retinal ischemia, and diabetic retinopathy. | 12-04-2014 |
20140357697 | Materials and Methods Related to Modulation of Mismatch Repair and Genomic Stability by miR-155 - The present invention provides materials and methods related to modulation of mismatch repair and genomic stability by miR-155. | 12-04-2014 |
20140357698 | MODULATION OF EXON RECOGNITION IN PRE-MRNA BY INTERFERING WITH THE SECONDARY RNA STRUCTURE - The invention relates to oligonucleotides for inducing skipping of exon 53 of the dystrophin gene. The invention also relates to methods of inducing exon 53 skipping using the oligonucleotides. | 12-04-2014 |
20140357699 | MEANS AND METHODS FOR COUNTERACTING, DELAYING AND/OR PREVENTING ADVERSE ENERGY METABOLISM SWITCHES IN HEART DISEASE - The invention relates to the fields of molecular biology and medicine, more specifically to treatment and prevention of heart disease. The invention provides alternative methods for counteracting, diminishing, treating, delaying and/or preventing heart disease. | 12-04-2014 |
20140357700 | METHODS AND COMPOSITIONS FOR THE SPECIFIC INHIBITION OF GENE EXPRESSION BY DOUBLE-STRANDED RNA - The invention is directed to compositions and methods for selectively reducing the expression of a gene product from a desired target gene in a cell, as well as for treating diseases caused by the expression of the gene. More particularly, the invention is directed to compositions that contain double stranded RNA (“dsRNA”), and methods for preparing them, that are capable of reducing the expression of target genes in eukaryotic cells. The dsRNA has a first oligonucleotide sequence that is between 25 and about 30 nucleotides in length and a second oligonucleotide sequence that anneals to the first sequence under biological conditions. In addition, a region of one of the sequences of the dsRNA having a sequence length of at least 19 nucleotides is sufficiently complementary to a nucleotide sequence of the RNA produced from the target gene to trigger the destruction of the target RNA by the RNAi machinery. | 12-04-2014 |
20140357701 | MODULATION OF HEPATITIS B VIRUS (HBV) EXPRESSION - Disclosed herein are antisense compounds and methods for decreasing HBV mRNA, DNA and protein expression. Such methods, compounds, and compositions are useful to treat, prevent, or ameliorate HBV-related diseases, disorders or conditions. | 12-04-2014 |
20140364480 | RNAi-MEDIATED INHIBITION OF IGF1R FOR TREATMENT OF OCULAR ANGIOGENESIS - RNA interference is provided for inhibition of IGF1R mRNA expression for treating patients with ocular angiogenesis, particularly for treating retinal edema, diabetic retinopathy, sequela associated with retinal ischemia, posterior segment neovascularization (PSNV), and neovascular glaucoma, and for treating patients at risk of developing such conditions. | 12-11-2014 |
20140364481 | RNA CHIMERAS IN HUMAN LEUKEMIA AND LYMPHOMA - Provided herein are kits, compositions and methods for cancer diagnosis, research and therapy, including but not limited to, cancer markers. In particular, the present invention relates to recurrent RNA fusions as diagnostic markers and clinical targets for leukemia. | 12-11-2014 |
20140364482 | REDUCED SIZE SELF-DELIVERING RNAI COMPOUNDS - The present invention relates to RNAi constructs with minimal double-stranded regions, and their use in gene silencing. RNAi constructs associated with the invention include a double stranded region of 8-14 nucleotides and a variety of chemical modifications, and are highly effective in gene silencing. | 12-11-2014 |
20140364483 | ALTERNATIVE SPLICING VARIANTS OF GENES ASSOCIATED WITH PROSTATE CANCER RISK AND SURVIVAL - Disclosed are novel splicing variants of the genes associated with prostate cancer risk and survival, particularly splicing variants of PIK3CD, FGFR3, TSC2, RASGRP2, ITGA4, MET, NF1 and BAK1. The disclosure also relates risk assessment, detection, diagnosis, or prognosis of prostate cancer. More specifically, this disclosure relates to the detection of certain splicing variants of PIK3CD, FGFR3, TSC2, RASGRP2, ITGA4, MET, NF1 and BAK1. | 12-11-2014 |
20140364484 | COMBINATION THERAPY FOR TREATING HEARING AND BALANCE DISORDERS - The present application relates to combinations of inhibitors directed at down-regulation of genes associated with hearing loss including HES1, HES5, HEY2, CDKN1B and NOTCH1, exhibiting a beneficial effect and useful in treating or attenuating hearing loss, treating balance impairment, promoting the replacement, regeneration, or protection of otic (sensory) hair cells of the inner ear, and or effecting hearing restoration/regeneration. | 12-11-2014 |
20140364485 | METHODS AND COMPOSITIONS FOR THE TREATMENT OF CANCER - Some embodiments of the present invention relate to agents and compositions for treating cancer. More embodiments include agents and compositions for modulating the activity of the Hedgehog pathway. | 12-11-2014 |
20140371292 | Method for the controlled intracellular delivery of nucleic acids - The present invention relates to a method for the controlled intracellular delivery of nucleic acid molecules into one or more target cells, in particular tumor cells, the method comprising: providing a polymeric complex formed between one or more nucleic acid molecules to be delivered and one or more cationic carrier molecules, wherein at least a part of the one or more carrier molecules in the polymeric complex are covalently attached to hydroxyalkyl starch, and wherein the hydroxyalkyl starch is shielding the polymeric complex; allowing the shielded polymeric complex to get into contact with the one or more target cells; deshielding the polymeric complex by removing the hydroxyalkyl starch; and allowing the deshielded polymeric complex to internalize into the one or more target cells. Removal of the hydroxyalkyl starch can be accomplished enzymatically by exposing the polymeric complex to amylase. The invention also concerns the use of such method for the prevention and/or treatment of a condition selected from the group consisting of cancer, immune diseases, cardiovascular diseases, neuronal diseases, infections, and inflammatory diseases. | 12-18-2014 |
20140371293 | Amine Cationic Lipids and Uses Thereof - The present invention relates to lipid compounds and uses thereof. In particular, the compounds include a class of cationic lipids having an amine moiety, such as an amino-amine or an amino-amide moiety. The lipid compounds are useful for in vivo or in vitro delivery of one or more agents (e.g., a polyanionic payload or an antisense payload, such as an RNAi agent). | 12-18-2014 |
20140371294 | COMPOSITIONS AND METHODS COMPRISING HISTIDYL-TRNA SYNTHETASE SPLICE VARIANTS HAVING NON-CANONICAL BIOLOGICAL ACTIVITIES - Isolated histidyl-tRNA synthetase splice variant polynucleotides and polypeptides having non-canonical biological activities are provided, as well as compositions and methods related thereto. | 12-18-2014 |
20140371295 | METHODS AND COMPOSITIONS TO PROTECT AQUATIC INVERTEBRATES FROM DISEASE - Compositions and methods of protecting aquatic invertebrates from disease is shown. In one embodiment, dsRNA or antisense RNA to a nucleic acid molecule of the disease-causing microorganism is prepared and delivered to the animal. In another embodiment, a nucleic acid molecule of the disease-causing microorganism is delivered to the animal. In another embodiment, the RNA or nucleic acid molecule is delivered to the animal by replicon particle. In a further embodiment, the protective molecule is delivered to the digestive tract of the animal. Protection from disease is obtained. | 12-18-2014 |
20140371296 | METHODS FOR MODULATING METASTASIS-ASSOCIATED-IN-LUNG-ADENOCARCINOMA-TRANSCRIPT-1 (MALAT-1) EXPRESSION - The present embodiments provide compounds and methods for reducing expression of Metastasis-Associated-in-Lung-Adenocarcinoma-Transcript-1 (MALAT-1) RNA and/or protein in an animal. Such methods are useful for treating cancer, such as colon cancer, intestinal cancer, lung cancer (e.g. non-small cell lung cancer), liver cancer, and/or prostate cancer. In various aspects, the cancer is a primary cancer. | 12-18-2014 |
20140371297 | ANTI-CONNEXIN COMPOUNDS TARGETED TO CONNEXINS AND METHODS OF USE THEREOF - Methods and compositions for modulating the activities of connexins are provided, including, for example, for use in post-surgical, trauma, or tissue engineering applications. These compounds and methods can be used therapeutically, for example, to reduce the severity of adverse effects associated diseases and disorders where localized disruption in direct cell-cell communication is desirable. | 12-18-2014 |
20140371298 | PREVENTION AND TREATMENT OF NOSEMA DISEASE IN BEES - Compositions and methods for reducing susceptibility and enhancing tolerance to | 12-18-2014 |
20140371299 | Use of Apoptosis-Specific elF-5A siRNA to Down Regulate Expression of Proinflammatory Cytokines to Treat Sepsis - The present invention relates to apoptosis specific eucaryotic initiation factor 5A (eIF-5A), referred to as apoptosis-specific eIF-5A or eIF5-A1, nucleic acids and polypeptides and methods for down regulating pro-inflammatory cytokines in a mammal by administering siRNA against eIF-5A1 to the mammal to treat/prevent sepsis and/or hemorrhagic shock. | 12-18-2014 |
20140371300 | PHARMACEUTICAL COMPOSITION FOR TREATING CANCER - The present invention provides a pharmaceutical composition for treating cancer, comprising at least one selected from deoxyribonucleic acids (DNA) for encoding small interfering RNA (siRNA) which complementarily binds to the base sequence of the transcript (mRNA transcript) of the FLJ25416 gene, represented by sequence number 3, sequence number 5, and sequence number 7 to inhibit the intracellular expression of the FLJ25416 gene, antisense RNA which inhibits expression of the FLJ25416 gene, and short hairpin RNA (shRNA) which inhibits expression of the FLJ25416 gene. As the siRNA, which is complementary to the base sequence of the transcript (mRNA transcript) of the FLJ25416 gene, the antisense RNA, and the shRNA, according to the present invention, inhibit expression of the FLJ25416 gene which is known to be expressed in cancer cells, and thus kill cancer cells, the composition of the present invention can be used as a novel anti-cancer agent. | 12-18-2014 |
20140371301 | TREATMENT OF TUMOR NECROSIS FACTOR RECEPTOR 2 (TNFR2) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO TNFR2 - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Tumor Necrosis Factor Receptor 2 (TNFR2), in particular, by targeting natural antisense polynucleotides of Tumor Necrosis Factor Receptor 2 (TNFR2). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of TNFR2. | 12-18-2014 |
20140378524 | METHODS AND COMPOSITIONS COMPRISING AKT INHIBITORS AND/OR PHOSPHOLIPASE D INHIBITORS - Disclosed are methods of treating viral infections or disorders of uncontrolled proliferation comprising, in one aspect, administering compounds that are phospholipase D inhibitors and/or Akt therapeutic agents. This abstract is intended as a scanning tool for purposes of searching in the particular art and is not intended to be limiting of the present invention. | 12-25-2014 |
20140378525 | MATERIALS AND METHODS FOR TREATING PTEN MUTATED OR DEFICIENT CANCER - The use of inhibitors of mitotic kinases, such as TTK protein kinase, is described for use in the treatment of cancers which are characterized as Phosphatase and Tensin Homolog (PTEN) mutated or deficient cancers. | 12-25-2014 |
20140378526 | DESIGN OF NUCLEIC ACID BINDING MOLECULES WITH NON-WATSON CRICK AND NON-CANONICAL PAIRING BASED ON ARTIFICIAL MUTATION CONSENSUS SEQUENCES TO COUNTER ESCAPE MUTATIONS - Universal nucleic acid binding molecules (e.g., antisense oligonucleotides or RNAi molecules) having an inhibitory or activating nucleic acid sequence which binds a receiving nucleic acid sequence (e.g., RNA or DNA) are provided. In some embodiments, the universal nucleic acid binding molecules bind the receiving nucleic acid sequence (e.g., RNA or DNA) via at least one non-Watson Crick or non-canonical paired base. | 12-25-2014 |
20140378527 | MODULATION OF EXON RECOGNITION IN PRE-MRNA BY INTERFERING WITH THE SECONDARY RNA STRUCTURE - The invention relates to oligonucleotides for inducing skipping of exon 55 of the dystrophin gene. The invention also relates to methods of inducing exon 55 skipping using the oligonucleotides. | 12-25-2014 |
20140378528 | BIOMARKERS OF MIR-34 ACTIVITY - This invention is based in part on the discovery that miR-34 is independent of p53. It has been discovered that miR-34 functions in a TP53-independent tumor suppression pathway. Specifically, miR-34-induced inhibition of cancer cell growth was found to be the same in p53-normal and p53-deficient cells. Thus, miR-34 has a more central role during tumor suppression that is uncoupled from p53. In the absence of p53, miR-34, unlike certain other miRNAs, is sufficient to induce an up-regulation of genes known to be regulated by p53, including but not limited to p21 | 12-25-2014 |
20140378529 | COLLATERAL GENE INACTIVATION BIOMARKERS AND TARGETS FOR CANCER THERAPY - Methods for treating a subject determined to have a cancer comprising a heterozygous inactivation of a housekeeping gene (or a homozygous deletion of a functionally redundant housekeeping gene) by treating the subject with an inhibitor of the gene. For example, a subject having a cancer with an ENO gene deletion can be treated with a glycolysis inhibitor, such as an enolase inhibitor. In some aspects, a subject having a cancer with an ARS gene deletion can be treated with an ARS inhibitor. | 12-25-2014 |
20140378530 | RETINALDEHYDE MIMETICS AND INHIBITORS OF RETINALDEHYDE DEHYDROGENASE I IN THE TREATMENT OF DISORDERS - The technology described herein is directed to methods of treating, e.g. obesity by administering retinaldehyde increasing agents. | 12-25-2014 |
20140378531 | INHIBITION OF PATTERN RECOGNITION RECEPTORS IN PANCREATIC CANCER TREATMENT USING TLR INHIBITORS - The disclosure herein relates to the novel finding that pattern recognition receptor activation is central to pancreatic cancer progression, and provides antagonists of pattern recognition receptors (PRRs), including the TLRs 4, 7, and 9, and the CLR dectin-1, for treatment and prevention of pancreatic cancer and pancreatic inflammation. The inventors have discovered that cancer development and progression can be prevented by pattern recognition receptor inhibition, a powerful finding with important clinical and therapeutic implications. | 12-25-2014 |
20140378532 | GLYCOGEN-BASED CATIONIC POLYMERS - The present invention relates to glycogen-based cationic polymers, to complexes of the said cationic polymers with anionic compounds, to pharmaceutical compositions comprising the said complexes, and to the use of the said complexes for delivering or transfecting the said anionic compounds to a specific pharmacological target, such as, for instance an organ, a tissue or a cell. | 12-25-2014 |
20140378533 | MODULATION OF RNA BY REPEAT TARGETING - Disclosed herein are antisense compounds, compositions and methods for modulating an RNA target by targeting a repetitive sequence in the RNA target and modulating an associated disease, disorder and/or condition related to such RNA target. Also disclosed herein are methods of identifying such compounds and compositions. | 12-25-2014 |
20140378534 | TREATMENT AND DIAGNOSIS OF COLON CANCER - The present invention discloses novel agents and methods for diagnosis and treatment of colon cancer. Also disclosed are related arrays, kits, and screening methods. | 12-25-2014 |
20140378535 | Breast Cancer Biomarker Signatures for Invasiveness and Prognosis - MicroRNA profiles transition from normal breast to ductal carcinoma in situ and transition to invasive ductal carcinoma (IDC) and methods of use thereof are described. Methods of diagnosis and prognosis using microRNA signatures to differentiate invasive from in situ carcinoma are described. Also described is the use of microRNA expression for predicting overall survival and time to metastasis. | 12-25-2014 |
20140378536 | TRANSCRIPTIONAL REPRESSION LEADING TO PARKINSON'S DISEASE - Parkinson's disease is caused by the preferential loss of substantia nigra dopamine neurons. A Parkin Interacting Substrate, PARIS (ZNF746) is identified. The levels of PARIS are regulated by the ubiquitin proteasome system via binding to and ubiquitination by the E3 ubiquitin ligase, parkin. PARIS is a KRAB and zinc finger protein that accumulates in models of parkin inactivation and in human brain Parkinson's disease patients. PARIS represses the expression of the transcriptional co-activator, PGC-1α and the PGC-1α target gene, NRF-1 by binding to insulin response sequences in the PGC-1α promoter. Conditional knockout of parkin in adult animals leads to progressive loss of dopamine (DA) neurons that is PARIS dependent. Overexpression of PARIS causes selective loss of DA neurons in the substantia nigra, which is reversed by either parkin or PGC-1α co-expression. The identification of PARIS provides a molecular mechanism for neurodegeneration due to parkin inactivation. | 12-25-2014 |
20150011605 | Single-Stranded Nucleic Acid Molecule for Controlling Gene Expression - Provided is a novel nucleic acid molecule that is a single-stranded nucleic acid molecule including an expression inhibitory sequence that inhibits expression of a target gene. The single-stranded nucleic acid molecule includes, in sequence from the 5′ side to the 3′ side: a 5′ side region (Xc); an inner region (Z); and a 3′ side region (Yc). The inner region (Z) is composed of an inner 5′ side region (X) and an inner 3′ side region (Y) that are linked to each other. The 5′ side region (Xc) is complementary to the inner 5′ side region (X). The 3′ side region (Yc) is complementary to the inner 3′ side region (Y). At least one of the inner region (Z), the 5′ side region (Xc), and the 3′ side region (Yc) includes the expression inhibitory sequence. | 01-08-2015 |
20150011606 | COMPOSITIONS AND METHODS TO PROMOTE ERYTHROPOIESIS - Described herein are compositions and methods for enhancing erythropoiesis in an individual in need thereof. Specifically agents that decrease the expression of Exosc8, Exosc9, Dis3, Dis3L or Exosc10, such as inhibitory nucleic acid molecules, produce an increase in red blood cell production in the individual. | 01-08-2015 |
20150011607 | METHODS AND COMPOSITIONS FOR THE SPECIFIC INHIBITION OF ALPHA-1 ANTITRYPSIN BY DOUBLE-STRANDED RNA - This invention relates to compounds, compositions, and methods useful for reducing α-1 antitrypsin target RNA and protein levels via use of dsRNAs, e.g., Dicer substrate siRNA (DsiRNA) agents. | 01-08-2015 |
20150011608 | iRNA Agents Targeting VEGF - The features of the present invention relate to compounds, compositions and methods useful for modulating the expression of vascular endothelial growth factor (VEGF), such as by the mechanism of RNA interference (RNAi). The compounds and compositions include iRNA agents that can be unmodified or chemically-modified. | 01-08-2015 |
20150011609 | MICRORNAS FOR CARDIAC REGENERATION THROUGH INDUCTION OF CARDIAC MYOCYTE PROLIFERATION - The present invention discloses a set of human microRNAs, or a primary transcript for such microRNAs, or a precursor of such microRNAs, or a mimic of such microRNAs or a combination thereof, and their use as medicaments for inducing proliferation of cardiomyocytes for the prevention and treatment of heart diseases associated with a loss of cardiomyocytes. The invention also relates to a method for screening microRNAs and biological and therapeutically active compounds for their ability to increase proliferation of cardiomyocytes. | 01-08-2015 |
20150011610 | METHOD FOR ENHANCING REMYELINATION USING GLI1 INHIBITORS - The invention provides a method of treatment of multiple sclerosis and other neurological disorders characterized by myelin loss or myelin deficiency by inhibiting Gli1 transcription factor. In a related aspect, the invention provides a method for enhancing neuroprotection of a central nervous system (CNS) or peripheral nervous system (PNS) neuron in a subject in need thereof comprising administering to said subject an effective amount of a Gli1 inhibitor. In one embodiment, the subject has a neurological disorder characterized by myelin loss or myelin deficiency. | 01-08-2015 |
20150011611 | INHIBITION OF THE GLYCINE CLEAVAGE SYSTEM FOR TREATMENT OF CANCER - In some aspects, methods of inhibiting survival or proliferation of a tumor cell are provided, the methods comprising inhibiting the glycine cleavage system (GCS) of the tumor cell. In some aspects, methods of treating a subject in need of treatment for a tumor, the method comprising inhibiting the GCS in the tumor. In some embodiments, the methods comprise contacting a tumor cell or tumor with a GCS inhibitor. In some embodiments, the tumor cell or tumor has elevated expression of serine hydroxymethyltransferase 2 (SH1VIT2). In some aspects, methods of identifying a tumor cell or tumor that is sensitive to inhibiting the GCS are provided, the methods comprising determining whether the tumor cell or tumor overexpresses SHMT2. In some aspects, methods of identifying a candidate anti-cancer agent are provided, the methods comprising identifying or modifying a GCS inhibitor. | 01-08-2015 |
20150011612 | RNAi MODULATION OF RSV AND THERAPEUTIC USES THEREOF - The present invention is based on the in vivo demonstration that RSV can be inhibited through intranasal administration of iRNA agents as well as by parenteral administration of such agents. Further, it is shown that effective viral reduction can be achieved with more than one virus being treated concurrently. Based on these findings, the present invention provides general and specific compositions and methods that are useful in reducing RSV mRNA levels, RSV protein levels and viral titers in a subject, e.g., a mammal, such as a human. These findings can be applied to other respiratory viruses. | 01-08-2015 |
20150011613 | METHODS AND COMPOSITIONS FOR PANIC DISORDERS - Methods and compositions that down regulate the activity of orexins to treat panic disorder and panic-like responses associated with hypercapnic conditions are disclosed. | 01-08-2015 |
20150011614 | METHODS AND COMPOSITIONS FOR TREATING INSECTS - Provided herein are methods and compositions for modulating gene expression in insects by administering a composition comprising an RNA effector molecule and a delivery agent. Methods are provided for controlling pest populations by inhibiting insect growth, development, survival, reproduction and/or viability. Also provided herein are methods for treating or preventing disease in an insect caused by a pathogen or by external factors (e.g., pollution, environment, stress, weather, etc.). | 01-08-2015 |
20150018404 | DOUBLE-STRANDED OLIGONUCLEOTIDE COMPOUNDS FOR TREATING HEARING AND BALANCE DISORDERS - The present application relates to double stranded nucleic acid compounds, compositions comprising same and methods of use thereof for the treatment of hearing loss in a subject in need thereof. The compounds are preferably chemically synthesized and modified dsRNA molecules which inhibit expression of a gene expressed selected from the group consisting of HES1, HES5, HEY1, HEY2, ID1, ID2, ID3, CDKN1B, and NOTCH1. | 01-15-2015 |
20150018405 | TREATMENT OF DISEASE BY MODULATION OF SIRT6 - An aspect of an embodiment of the invention relates to providing treatment of disease, in particular age-related disease, through increasing or decreasing the activity of SIRT6 protein. This may be accomplished through upregulation and downregulation of expression of SIRT6 in mammals. It has been found by the inventors that mice over-expressing SIRT6 have a longer lifespan in comparison to control mice, indicating that increasing SIRT6 expression can lengthen lifespan of mammals. Agents which modulate SIRT6 expression through, for example binding to 3′UTR region of human mRNA encoding SIRT6 or by blocking binding of agents to 3′UTR region of human mRNA encoding SIRT6, have been identified. | 01-15-2015 |
20150018406 | MODULATION OF BREAST CANCER GROWTH BY MODULATION OF XBP1 ACTIVITY - Described herein is a previously unknown function of XBP1 in triple-negative breast cancer (TNBC). It is shown that XBP1 is preferentially spliced and activated in TNBC, and that deletion of XBP1 significantly blocks triple negative breast tumor growth. Strikingly, XBP1 is required for the self-renewal of breast tumor initiating cells (TICs). Genome-wide mapping of the XBP1 transcriptional regulatory network identified a fundamental role for XBP1 in regulating the response to hypoxia via the transcription factor hypoxia-inducible factor 1a (HIF1a). Importantly, activation of this pathway appears to carry prognostic implications, as expression of the XBP1-dependent signature is associated with shorter survival times in human TNBC. | 01-15-2015 |
20150018407 | METHOD FOR PROMOTING ANGIOGENESIS, VASCULARIZATION OR VESSEL REPAIR OR FOR INHIBITING TUMOR ANGIOGENESIS - The invention relates to a method for influencing the miR-92 expression in a cell, comprising the following steps: (a) providing a cell; and (b1) reducing the miR-92 expression in the cell in order to promote the vascularization or vessel repair by introducing an antisense molecule against miR-92 into the cell, or (b2) increasing the miR-92 expression in the cell for an inhibition of the tumor angiogenesis by introducing a construct into the cell, wherein said construct includes an expressible miR-92 sequence. Furthermore, the invention relates to a pharmaceutical composition, comprising an agent for reducing the miR-92 activity or expression in a cell in the form of an antisense molecule against miR-92, or an agent for increasing the miR-92 expression in a cell in the form of a construct for expressing miR-92. | 01-15-2015 |
20150025122 | Methods and Compositions for Modulating Gene Expression Using Oligonucleotide Based Drugs Administered in vivo or in vitro - Compositions and methods for down modulating target gene expression with RNA interference, as well as methods for administering said compositions are disclosed. The method comprises administering a first strand to a cell, incubating the cell for a time period suitable for uptake of the first oligo prior to administering a second strand, wherein the first strand and said second strand form an intracellular duplex which is effective to catalyze degradation of gene target mRNA or inhibit translation of said mRNA. | 01-22-2015 |
20150025123 | P2X7, Inhibition Of Epithelial Cancers And Papillomas - The present invention demonstrates that P2X7 receptor induced apoptosis may be specific for cancerous cells. Treatment with the P2X7 ligand BzATP, increased cellular apoptosis with no associated inflammatory changes or abnormal skin or systemic effects. In mice treated with DMBA/TPA, BzATP decreased papilloma skin formation. BzATP also induced involution of developed papillomas and stimulated apoptosis in keratinocytes outgrowing at the base of developed papillomas. These data show that (a) P2X7 regulates apoptosis of epidermal cells; (b) in vivo, local administration of a drug that activates the P2X7 receptor can inhibit development and progression of epidermal premalignant lesions. | 01-22-2015 |
20150025124 | Compositions and Methods for the Suppression of Target Polynucleotides from Lepidoptera - Methods and compositions are provided which employ a silencing element that, when ingested by a pest, such as a pest from the Lepidoptera order, they are capable of decreasing the expression of a target sequence in the pest. In specific embodiments, the decrease in expression of the target sequence controls the pest and thereby the methods and compositions are capable of limiting damage to a plant. The present invention provides target polynucleotides encoding polypeptides from specific protein families and various target polynucleotides set forth in SEQ ID NOS: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or 50 or active variants and fragments thereof, wherein a decrease in expression of one or more the sequences in the target pest controls the pest (i.e., has insecticidal activity). Further provided are silencing elements which when ingested by the pest decrease the level of the target polypeptide and thereby control the pest. In specific embodiment, the pest is | 01-22-2015 |
20150031742 | TREATMENT OF UTERINE LEIOMYOMATA - Embodiments herein provide a therapy for uterine leiomyomata (UL) in women using a fatty acid synthase (FAS) inhibitor. Additionally, an analysis method for evaluating the likelihood of women developing UL during their lifetime is provided. | 01-29-2015 |
20150031743 | CELL TRANSFECTING FORMULATIONS OF SMALL INTERFERING RNA, RELATED COMPOSITIONS AND METHODS OF MAKING AND USE - Compositions incorporating small interfering ribonucleic acid (siRNA) and certain lipid-conjugated polyamide compound-based delivery vehicles that are particularly useful in the delivery siRNA and other polynucleotides to cells. Also, methods of making and using the compositions. | 01-29-2015 |
20150031744 | METHOD FOR PREDICTING AND DETECTING TUMOR METASTASIS - The invention provides a method of determining the prognosis of cancer in a subject. The method comprises (a) obtaining a sample from the subject, (b) analyzing the sample for the expression level of a carboxypeptidase E (CPE) splice variant, and (c) correlating the expression level in the sample with the prognosis of cancer in the subject. The invention further provides a method of diagnosing cancer, methods of treatment, kits for detecting mRNA expression of a CPE-ΔN, and inhibitors of CPE-ΔN and compositions thereof. | 01-29-2015 |
20150031745 | NANOCONJUGATES ABLE TO CROSS THE BLOOD-BRAIN BARRIER - The present disclosure is directed to nanoconjugates that cross the blood-brain barrier and methods of their therapeutic use. | 01-29-2015 |
20150031746 | METHODS AND COMPOSITIONS FOR NEUROPROTECTION - Disclosed herein are methods and kits useful for providing neuroprotection to neurons in the inner ear and to methods of treating inner ear diseases and disorders, including tinnitus and Mnire's disease. | 01-29-2015 |
20150031747 | METHODS AND COMPOSITIONS FOR MODULATING FACTOR VII EXPRESSION - Disclosed herein are antisense compounds and methods for decreasing Factor VII and treating, preventing, or slowing progression of thromboembolic complications, hyperproliferative disorders, or inflammatory conditions in an individual in need thereof. | 01-29-2015 |
20150031748 | MODULATING THE INTERACTION BETWEEN ZO-2/TJP2 AND A SNAIL ZINC FINGER TRANSCRIPTION FACTOR FAMILY MEMBER - There is provided a method of identifying candidate agents capable of modulating interaction between a first polypeptide and a second polypeptide, wherein the first polypeptide is ZO-2/TJP2 or a functional variant thereof and the second polypeptide is a Snail zinc finger transcription factor family member or a functional variant thereof. | 01-29-2015 |
20150031749 | BIOMARKER, USES THEREOF AND THERAPY - A method of determining the Crohn's disease status of a subject comprising the steps of determining the level of miR-29 in a sample from said subject; and comparing the level of miR-29 determined in step (a) with one or more reference values. | 01-29-2015 |
20150031750 | TREATMENT OF BRAIN DERIVED NEUROTROPHIC FACTOR (BDNF) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO BDNF - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Brain derived neurotrophic factor (BDNF), in particular, by targeting natural antisense polynucleotides of Brain derived neurotrophic factor (BDNF). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of BDNF. | 01-29-2015 |
20150031751 | COMPOSITIONS AND METHODS FOR TREATMENT OF OVARIAN CANCER - The disclosure provides compositions and methods for treating an ovarian cancer in a subject. More specifically, the disclosure provides microRNA (miRNA) inhibitor molecules that target to different miRNAs for treating different types of ovarian cancers in a subject. Furthermore, different modifications of miRNA inhibitor molecules as well as different derivatives of miRNA inhibitor molecules are also described. | 01-29-2015 |
20150031752 | COATED LIPID COMPLEXES AND THEIR USE - The present invention is related to a lipid composition comprising at least a first lipid component, at least a first helper lipid, and a shielding compound which is removable from the lipid composition under in vivo conditions. | 01-29-2015 |
20150038548 | OLIGONUCLEOTIDE INHIBITORS OF DNA METHYLTRANSFERASES AND THEIR USE IN TREATING DISEASES - Modified oligonucleotides comprising CpG sites, wherein the cytosine is replaced by cytosine analogs are provided as well as methods of making the oligonucleotides and their use in treating cancer, tumorigenesis and hyper-proliferative disorders. | 02-05-2015 |
20150038549 | Methods and Compositions for Modulating Gene Expression Using Components That Self Assemble in Cells and Produce RNAi Activity - Compositions and methods for downmodulating expression of target nucleic acids are disclosed. | 02-05-2015 |
20150038550 | Targeting MicroRNAs for Metabolic Disorders - Provided herein are methods and compositions for the treatment of metabolic disorders. Also provided herein are methods and compositions for the reduction of blood glucose level, the reduction of gluceoneogenesis, the improvement of insulin resistance and the reduction of plasma cholesterol level. In certain embodiments, the methods comprise inhibiting the activity of miR-103. In certain embodiments, the methods comprise inhibiting the activity of miR-107. In certain embodiments, the activity of both miR-103 and miR-107 is inhibited. In certain embodiments, such methods comprise administering a compound comprising an oligonucleotide targeted to a microRNA. | 02-05-2015 |
20150038551 | Pharmaceutical Composition for Preventing or Treating Diabetes Containing TENC1 Expression or Activity Suppressor - The present invention relates to a pharmaceutical composition for preventing or treating diabetes or a complication of diabetes, which includes a TENC1 (tensin like C1 domain-containing phosphatase) expression or activity suppressor, and, more specifically, relates to a pharmaceutical composition for preventing or treating diabetes or a complication of diabetes, which either suppresses the degradation of IRS-1 (insulin receptor substrate-1) or suppresses the phosphorylation of IRS-1 due to the PTPase activity of TENC1. The pharmaceutical composition according to the present invention, which is for preventing or treating diabetes or a complication of diabetes and comprises the TENC1 expression or activity suppressor as an active ingredient, can be expected to be widely usable in preventing and treating diabetes or a complication of diabetes since the pharmaceutical composition can effectively prevent the muscular dystrophy and reduction in sugar adsorption that occur due to reduction in IRS-1 by suppressing degradation of IRS-1 caused by TENC1. | 02-05-2015 |
20150038552 | ESOPHAGEAL MICRORNA EXPRESSION PROFILES IN EOSINOPHILIC ESOPHAGITIS - Methods and compositions disclosed herein generally relate to methods of treating eosinophilic esophagitis (EE) and eosinophilic disorders by providing or enhancing a diagnosis of EE and eosinophilic disorders. In particular, the invention relates to obtaining a sample from a patient, then quantifying from the sample an amount of one or more microRNAs (miRNAs) associated with EE, wherein an altered level of the miRNA correlates with a positive diagnosis of EE. An EE diagnosis can then be provided or enhanced, based upon the quantifying step, and an appropriate treatment can be administered to the patient. The invention further relates to diagnostic kits, tests, and/or arrays that can be used to quantify the one or more miRNAs associated with EE, as well as treatments developed to up-regulate or down-regulate one or more miRNAs and/or their downstream pathways relevant to EE or asthma. The invention further relates to the use of IGF1 and IGF1R inhibitors for the treatment of EE and eosinophilic disorders. | 02-05-2015 |
20150038553 | TREATMENT OF ATONAL HOMOLOG 1 (ATOH1) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO ATOH1 - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Atonal homolog 1 (ATOH1), in particular, by targeting natural antisense polynucleotides of Atonal homolog 1 (ATOH1). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of ATOH1. | 02-05-2015 |
20150038554 | Extended Dicer Substrate Agents and Methods for the Specific Inhibition of Gene Expression - The invention provides compositions and methods for reducing expression of a target gene in a cell, involving contacting a cell with an isolated double stranded nucleic acid (dsNA) in an amount effective to reduce expression of a target gene in a cell. The dsNAs of the invention possess a single stranded extension (in most embodiments, the single stranded extension comprises at least one modified nucleotide and/or phosphate back bone modification). Such single stranded extended Dicer-substrate siRNAs (DsiRNAs) were demonstrated to be effective RNA inhibitory agents compared to corresponding double stranded DsiRNAs. | 02-05-2015 |
20150038555 | Extended Dicer Substrate Agents and Methods for the Specific Inhibition of Gene Expression - The invention provides compositions and methods for reducing expression of a target gene in a cell, involving contacting a cell with an isolated double stranded nucleic acid (dsNA) in an amount effective to reduce expression of a target gene in a cell. The dsNAs of the invention possess a single stranded extension (in most embodiments, the single stranded extension comprises at least one modified nucleotide and/or phosphate back bone modification). Such single stranded extended Dicer-substrate siRNAs (DsiRNAs) were demonstrated to be effective RNA inhibitory agents compared to corresponding double stranded DsiRNAs. | 02-05-2015 |
20150045410 | METHOD OF REGULATING CFTR EXPRESSION AND PROCESSING - The present invention relates to therapeutic agents comprising miR-138, a miR-138 mimic, a SIN3A RNAi molecule, or a an anti-SIN3A RNAi molecule, and/or an anti-SIN3A antisense oligonucleotide (ASO) or other agent that suppresses SIN3A expression, a small molecule drug that interferes with SIN3A activity or whose actions mimic the biological effects of SIN3A suppression and methods of use of these therapeutic agents to treat cystic fibrosis. | 02-12-2015 |
20150045411 | PAIN TREATMENT - The disclosure relates to an RNA interference (RNAi) agent and the use of that RNAi agent to treat chronic pain in individuals, as well as pharmaceutical compositions containing the RNAi agents of the invention. The DNA-directed RNA interference (ddRNAi) agent for inhibiting expression of one or more target sequences in a pain associated gene comprises, one or more effector sequence sequences and effector complement sequences of at least 17 nucleotides in length, wherein the effector sequence is substantially complementary to the predicted transcript of a target sequence within a pain associated gene. | 02-12-2015 |
20150045412 | USE OF THE CHROMOSOME 19 MICRORNA CLUSTER (C19MC) FOR TREATING MICROBIAL DISEASE AND PROMOTING AUTHOPHAGY - It is disclosed herein that cultured primary placental human trophoblast (PHT) cells are highly resistant to infection by a number of disparate viruses, and confer this resistance to non-placental recipient cells by exosome-mediated delivery of microRNAs (miRs). PHT cells express high levels of unique, primate-specific miRNAs, expressed from the chromosome 19 miRNA cluster (C19MC). It is further disclosed herein that C19MC miRNAs are packaged within PHT-derived exosomes and attenuate viral replication in recipient cells by inducing autophagy. Thus, provided herein are methods of inhibiting, treating or preventing microbial infections by administering one or more miRs of the C19MC. Also provided are methods of inducing autophagy in a cell by contacting the cell with one or more miRs of the C19MC. | 02-12-2015 |
20150045413 | RNA Modulating Oligonucleotides with Improved Characteristics for the Treatment of Duchenne and Becker Muscular Dystrophy - The current invention provides an improved oligonucleotide and its use for treating, ameliorating, preventing and/or delaying DMD or BMD. | 02-12-2015 |
20150045414 | TRANS-ACTING RNA SWITCHES - Disclosed are RNA constructs which function to activate or inactivate a biological process, e.g., may be designed for attachment to a polypeptide coding region. Such RNA constructs modulate translation of a polypeptide from the coding region in response to the presence of a target polynucleotide in an expression environment. Such RNA constructs include a weakened stem-loop structure which, when bound to the target polynucleotide, assumes stem-loop secondary structure and associates with an RNA binding protein. Association with the RNA binding protein modulates translation of the polypeptide coding region. Such RNA constructs also have three-way junction joining regions 3′ and 5′ of the stem-loop structure. | 02-12-2015 |
20150045415 | Oligomers - Certain disclosed oligomers induce exon skipping during processing of myostatin pre-mRNA. The oligomers may be in a vector or encoded by the vector. The vector is used for inducing exon skipping during processing of myostatin pre-mRNA. A therapeutically effective amount of the oligomer may be administered to a subject patient such that exon skipping during processing of myostatin pre-mRNA is induced. The administration to a subject may be used in order to increase or maintain muscle mass, or slowing degeneration of muscle mass in the subject. The administration to a subject may ameliorate muscle wasting conditions, such as muscular dystrophy. Examples of such muscular dystrophies which may be so treated include Becker's muscular dystrophy, congenital muscular dystrophy, Duchenne muscular dystrophy, distal muscular dystrophy, Emery-Dreifuss muscular dystrophy, facioscapulohumeral muscular dystrophy (FSHD), limb-girdle muscular dystrophy, myotonic muscular dystrophy, and oculopharyngeal muscular dystrophy | 02-12-2015 |
20150051263 | IDENTIFICATION OF A JAK2 MUTATION IN POLYCYTHEMIA VERA - The present invention concerns the V617F variant of the protein-tyrosine kinase JAK2, said variant being responsible for Vaquez Polyglobulia. The invention also relates to a first intention diagnostic method for erythrocytosis and thrombocytosis allowing their association with myeloproliferative disorders, or to the detection of the JAK2 V617F variant in myeloproliferative disorders allowing their reclassification in a new nosological group. | 02-19-2015 |
20150051264 | INHIBITORS OF NOX4 EXPRESSION AND /OR NOX4 FUNCTION AND THEIR USE IN THE PREVENTION AND TREATMENT OF NERVE INJURY AND/OR NEUROPATHIC PAIN - The present invention relates to modulators, in particular inhibitors, of the expression and/or the function of NADPH Oxidase 4 (Nox4) for use in the prevention and/or treatment of nerve injury, in particular pain, more particularly neuropathic pain. Further disclosed is a method for the identification of Nox4 modulators, a pharmaceutical composition comprising a Nox4 inhibitor and a method for preventing and treating pain, in particular neuropathic pain, in a subject in need of such a treatment. Also, the invention relates to modulators, in particular inhibitors, of the expression and/or the function of NADPH Oxidase 4 (Nox4) for use in the prevention and/or treatment of nerve injury associated with dysmyelination and methods for preventing and treating dysmyelination and diseases associated with dysmyelination. | 02-19-2015 |
20150051265 | Dually Derivatized Chitosan Nanoparticles and Methods of Making and Using the Same - Provided herein is chitosan dually derivatized with arginine and gluconic acid; and methods of making and using the same, e.g., for gene delivery in vivo. | 02-19-2015 |
20150057329 | COMPOUNDS AND METHODS FOR MODULATING EXPRESSION APOB - The present disclosure describes short antisense compounds, including such compounds comprising chemically-modified high-affinity monomers 8-16 monomers in length. Certain such short antisense compound are useful for the reduction of target nucleic acids and/or proteins in cells, tissues, and animals with increased potency and improved therapeutic index. Thus, provided herein are short antisense compounds comprising high-affinity nucleotide modifications useful for reducing a target RNA in vivo. Such short antisense compounds are effective at lower doses than previously described antisense compounds, allowing for a reduction in toxicity and cost of treatment. In addition, the described short antisense compounds have greater potential for oral dosing. | 02-26-2015 |
20150057330 | ANTISENSE OLIGONUCLEOTIDES FOR INDUCING EXON SKIPPING AND METHODS OF USE THEREOF - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202. | 02-26-2015 |
20150057331 | NOVEL CELLULAR TARGETS FOR HIV INFECTION - Methods and compositions are provided for treating HIV infection and for inhibiting HIV infection, and for identifying purinergic receptor antagonists or Panx 1 hemi-channel blockers useful therefor. The invention provides a method of treating a mammalian subject having an HIV infection, or suspected of having been exposed to HIV, comprising administering to the mammalian subject an amount of (i) an antagonist of a Panx 1 hemichannel, or (ii) of an inhibitor of a purinergic receptor, effective to inhibit (a) HIV fusion with a target cell, or (b) HIV replication, or (c) HIV entry into a target cell, or two or more of (a), (b) and (c). | 02-26-2015 |
20150057332 | Methods for the Treatment of Nonalcoholic Steatohepatitis - The present invention relates to the treatment of nonalcoholic steatohepatitis (NASH), in particular to a compound that inhibits miR-21 expression for use in the treatment of nonalcoholic steatohepatitis. | 02-26-2015 |
20150057333 | DOUBLE-STRANDED OLIGONUCLEOTIDES - Antisense sequences, including duplex RNAi compositions, which possess improved properties over those taught in the prior art are disclosed. The invention provides optimized antisense oligomer compositions and method for making and using the both in in vitro systems and therapeutically. The invention also provides methods of making and using the improved antisense oligomer compositions. | 02-26-2015 |
20150057334 | USE OF INHIBITORS OF ZDHHC2 ACTIVITY FOR MODULATION OF ADIPOGENESIS - The present invention concerns Zdhhc2, a new target involved in adipogenesis modulation. Using a siRNA approach, the inventors demonstrated that decrease in Zdhhc2 activity in adipose tissue induces a decrease in adipogenesis. Thus, the present invention relates to modulators of Zdhhc2 activity as well as screening test for identification of modulators of the activity of this target, and their use, especially in pharmaceutical composition, to modulate adipogenesis and thus treat obesity and related disorders. | 02-26-2015 |
20150057335 | NOVEL FUSION GENES IDENTIFIED IN LUNG CANCER - [PROBLEMS] To identify mutations that can serve as indicators for predicting the effectiveness of drug treatments in cancers such as lung cancer; to provide a means for detecting said mutations; and to provide a means for identifying, based on said mutations, patients with cancer or subjects with a risk of cancer, in which drugs targeting genes having said mutations or proteins encoded by said genes show a therapeutic effect. | 02-26-2015 |
20150057336 | RNAi-RELATED INHIBITION OF TNF alpha SIGNALING PATHWAY FOR TREATMENT OF GLAUCOMA - RNA interference is provided for inhibition of tumor necrosis factor α (TNFα) by silencing TNFα cell surface receptor TNF receptor-1 (TNFR1) mRNA expression, or by silencing TNFα converting enzyme (TACE/ADAM17) mRNA expression. Silencing such TNFα targets, in particular, is useful for treating patients having a TNFα-related condition or at risk of developing a TNFα-related condition such as the ocular conditions associated with elevated intraocular pressure (TOP), including glaucoma and ocular hypertension. | 02-26-2015 |
20150057337 | METHODS AND COMPOSITIONS FOR THE SPECIFIC INHIBITION OF KRAS BY ASYMMETRIC DOUBLE-STRANDED RNA - This invention relates to compounds, compositions, and methods useful for reducing KRAS target RNA and protein levels via use of Dicer substrate siRNA (DsiRNA) agents possessing asymmetric end structures. | 02-26-2015 |
20150057338 | TREATMENT OF PANCREATIC DEVELOPMENTAL GENE RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO A PANCREATIC DEVELOPMENTAL GENE - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of a Pancreatic Developmental gene, in particular, by targeting natural antisense polynucleotides of a Pancreatic Developmental gene. The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of Pancreatic Developmental genes. | 02-26-2015 |
20150065554 | NEUROFIBROMATOSES THERAPEUTIC AGENTS AND SCREENING FOR SAME - Disclosed herein are methods of treating a patient at risk of developing or having a neurofibromatosis or a sporadic schwannoma. In exemplary embodiments, the method involves administering to a subject in need an effective amount of a modulator of a target related to neurofibromatosis. Also disclosed are screening assays involving the implementation of Merlin-null Schwann cells, and to compounds identified using same. | 03-05-2015 |
20150065555 | METHODS AND COMPOSITIONS FOR THE SPECIFIC INHIBITION OF MCL1 BY DOUBLE-STRANDED RNA - This invention relates to compounds, compositions, and methods useful for reducing MCL1 target RNA and protein levels via use of dsRNAs, e.g., Dicer substrate siRNA (DsiRNA) agents. | 03-05-2015 |
20150065556 | THERAPEUTIC TARGETS FOR MITOCHONDRIAL DISORDERS - In some aspects, compositions and methods for identifying therapeutic targets for treatment of mitochondrial disorders are provided. In some aspects compositions and methods for identifying therapeutic agents for treatment of mitochondrial disorders. In some aspects, the disclosure identifies ATPIF1 as a therapeutic target for mitochondrial disorders. | 03-05-2015 |
20150065557 | METHODS FOR CONTROLLING PESTS USING RNAi - The present invention relates to methods for controlling pest infestation using double stranded RNA molecules. The invention provides methods for producing transgenic cells expressing the double stranded RNA molecules, as well as compositions and commodity products containing or treated with such molecules. | 03-05-2015 |
20150065558 | Glycoconjugates of RNA Interference Agents - The present invention relates to agents, compositions and methods for inhibiting the expression of a target gene, comprising an RNAi agent bearing at least one galactosyl moiety. These are useful for delivering the gene expression inhibiting activity to cells, particularly hepatocytes, and more particularly in therapeutic applications. | 03-05-2015 |
20150065559 | METHODS FOR DELIVERY OF siRNA TO THE SPINAL CORD AND THERAPIES ARISING THEREFROM - The present application relates at least in part to methods for the administration of small interfering RNAs (siRNAs) to the spinal cord of a human or animal patient and also to a method of treatment for spinal cord injury and other diseases and disorders of the CNS. In particular, the application discloses methods to deliver an siRNA compound locally, directly and without the need for transduction vehicles and formulations in effective doses to the injured spinal cord to promote recovery of CNS function and or attenuation of allodynia. | 03-05-2015 |
20150073033 | BIOMARKERS FOR CANCER CHARACTERIZATION AND TREATMENT - Composition and methods for characterizing cancer cells by determining a marker of PKM2 activity. For example, methods are provided for predicting a patient response to a NF-κB, PKCε, PKM2, MEK/ERK, Pin1 or Src inhibitor therapy. Methods for treating patients with such therapies are likewise provided. Phosphorylation selective β-catenin, MLC2, histone H3, Bub3, and PKM2-binding antibodies are also provided. | 03-12-2015 |
20150073034 | METHODS AND PHARMACEUTICAL COMPOSITIONS FOR THE TREATMENT OF HYPERTENSION - The present invention relates to an inhibitor of Neutrophil Gelatinase-Associated Lipocalin (NGAL) activity or expression for use in a method for treating or preventing hypertension in a subject in need thereof. | 03-12-2015 |
20150073035 | BIOMARKERS AND USES THEREOF IN PROGNOSIS AND TREATMENT STRATEGIES FOR RIGHT-SIDE COLON CANCER DISEASE AND LEFT-SIDE COLON CANCER DISEASE - Genetic biomarkers for left side colon cancer (LCC) (such as expression levels of an RNA transcript or expression product of NOX4, MMP3, or a combination) and right side colon cancer (RCC) (such as expression levels of an RNA transcript or expression product of CDCX2, FAM69A, or a combination), are disclosed. Methods for using the biomarkers in providing a prognosis of relapse-free survival probability in patients having LCC or RCC are also presented. Prognostic panels using gene expression values of the biomarkers are also presented. Computer implemented methods employing the biomarkers, and as well as for determining relapse-free survival probability in a patient having RCC or LCC are provided. A genetic method for classifying a colon cancer tissue as a RCC or as a LCC is also disclosed. | 03-12-2015 |
20150073036 | NOVEL NTRK1 FUSION MOLECULES AND USES THEREOF - Novel NTRK1 fusion molecules, detection reagents, and uses and kits for evaluating, identifying, assessing and/or treating a subject having a cancer are disclosed. | 03-12-2015 |
20150073037 | METHODS AND MEANS FOR EFFICIENT SKIPPING OF EXON 45 IN DUCHENNE MUSCULAR DYSTROPHY PRE-mRNA - The invention relates to a method for inducing or promoting skipping of exon 45 of DMD pre-mRNA in a Duchenne Muscular Dystrophy patient, preferably in an isolated (muscle) cell, the method comprising providing an isolate muscle cell with a molecule that binds to a continuous stretch of at least 21 nucleotides within said exon. The invention further relates to such molecule used in the method. | 03-12-2015 |
20150073038 | DELIVERY MOLECULES FOR THERAPEUTICS - Activity-generating delivery molecules comprising the structure R | 03-12-2015 |
20150073039 | PREVENTING OR TREATING VIRAL INFECTION USING AN INHIBITOR OF THELSD1 PROTEIN, A MAO INHIBITOR OR AN INHIBITOR OF LSD1 AND A MAOINHIBITOR - An embodiment of the invention provides a method of preventing or treating a viral infection of a host, comprising administering to the host an effective amount of an inhibitor of the protein LSD1 and/or a monoamine oxidase inhibitor. Another embodiment of the invention provides a method of preventing or treating reactivation of a virus after latency in a host, comprising administering to the host an effective amount of an inhibitor of the protein LSD1 and/or a monoamine oxidase inhibitor. Another embodiment of the invention provides a method of preventing or treating a viral infection in a mammal that has undergone, is undergoing, or will undergo an organ or tissue transplant, comprising administering to the mammal an effective amount of an inhibitor of the protein LSD1 and/or a monoamine oxidase inhibitor before, during, and/or after the organ or tissue transplant. The viral infection may be due to a herpesvirus, such as herpes simplex virus type 1 (HSV-1) or type 2 (HSV-2), varicella zoster virus (VZV), or cytomegalovirus (CMV). The viral infection may also be due to an adenovirus, including types 1-5. | 03-12-2015 |
20150073040 | TREATMENT OF DOWN SYNDROME GENE RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO A DOWN SYNDROME GENE - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of a Down Syndrome Gene, in particular, by targeting natural antisense polynucleotides of a Down Syndrome Gene. The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of Down Syndrome Genes. | 03-12-2015 |
20150073041 | FORMULATIONS FOR TARGETED RELEASE OF AGENTS TO LOW PH TISSUE ENVIRONMENTS OR CELLULAR COMPARTMENTS AND METHODS OF USE THEREOF - Polyamine-co-ester-co-ortho ester) polymers, methods of forming active agent-load nanoparticles therefrom, and methods of using the nanoparticles for drug delivery are disclosed. The nanoparticles can be coated with an agent that reduces surface charge, an agent that increases cell-specific targeting, or a combination thereof. Typically, the loaded nanoparticles are less toxic, more efficient at drug delivery, or a combination thereof compared to a control or other transfection reagents. | 03-12-2015 |
20150080452 | Compositions and Methods Related to Protein Displacement Therapy for Myotonic Distrophy - Disclosed are compositions and methods related to the interaction of polyCUG and polyCCUG repeat RNA and proteins that bind to these repetitive RNA sequences. Also disclosed are methods of treating DM1 or DM2 comprising inhibiting the interaction of poly(CUG) | 03-19-2015 |
20150080453 | TARGETING MICRORNAS FOR THE TREATMENT OF FIBROSIS - Provided herein are compositions and methods for the modulation of miR-214 for the treatment and/or prevention of fibrosis and fibroproliferative conditions. | 03-19-2015 |
20150080454 | UNIT STRUCTURE-TYPE PHARMACEUTICAL COMPOSITION FOR NUCLEIC ACID DELIVERY - A unit structure-type pharmaceutical composition includes at least one nucleic acid, such as siRNA, electrostatically bound to at least one block copolymer having a cationic polyamino acid segment and a hydrophilic polymer chain segment. The negative charge(s) of the nucleic acid are counterbalanced, at least substantially, by the positive charge(s) of the cationic polyamino acid segment such that the pharmaceutical composition is electrically neutral or nearly electrically neutral. Further, the nucleic acid is covered with the hydrophilic polymer chain segment(s). The at least one block copolymer thereby improves the blood retention capability of the nucleic acid(s). | 03-19-2015 |
20150080455 | TREATMENT OF TRANSCRIPTION FACTOR E3 (TFE3) AND INSULIN RECEPTOR SUBSTRATE 2 (IRS2) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO TFE3 - The present invention relate to antisense oligonucleotides that modulate the expression of and/or function of Transcription factor E3 (TFE3) and/or Insulin Receptor Substrate 2 (IRS2) polynucleotides, in particular, by targeting natural antisense polynucleotides of Transcription factor E3 (TFE3) and/or Insulin Receptor Substrate 2 (IRS2). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of TFE3 and/or IRS2. | 03-19-2015 |
20150080456 | TREATMENT OF NUCLEAR RESPIRATORY FACTOR 1 (NRF1) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO NRF1 - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Nuclear Respiratory Factor 1 (NRF1), in particular, by targeting natural antisense polynucleotides of Nuclear Respiratory Factor 1 (NRF1). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of NRF1. | 03-19-2015 |
20150080457 | 5' PHOSPHATE MIMICS - The present invention provides nucleosides and oligonucleotides comprising a 5′ phosphate mimics of formula (IVc) or (Vc), | 03-19-2015 |
20150087689 | COMPOSITIONS AND METHODS FOR EFFICACIOUS AND SAFE DELIVERY OF siRNA USING SPECIFIC CHITOSAN-BASED NANOCOMPLEXES - There is disclosed a composition and a method for the efficient delivery of a therapeutic RNAi-inducing nucleic acid to cells both in vitro and in vivo through specific formulations of a non viral delivery system using chitosans. Particularly, the composition contains a nucleic acid and a specific chitosan that has the following physico-chemical properties: a number-average molecular weight between 5 kDa and 200 kDa, a degree of deacetylation between 80% and 95% and a chitosan amine to nucleic acid phosphate ratio below 20. | 03-26-2015 |
20150087690 | G PROTEIN-COUPLED PURINERGIC RECEPTOR Gpr17 MEDIATES OREXIGENIC EFFECTS OF FOXO1 IN AGRP NEURONS - G protein-coupled receptor (GPCR) Gpr17 expressed in hypothalamic Agouti-related peptide-expressing (AgRP) neurons increases appetite and glucose tolerance and insulin sensitivity. By contrast, increasing Gpr17 reduced glucose tolerance and increased appetite. Gpr17-agonists had no effect on FoxO1-deficient mice, indicating, together with other data, that Gpr17 is a Fox-O1 target. Certain embodiments are directed to methods for reducing appetite, increasing glucose tolerance and insulin sensitivity and treating diabetes by administering Gpr17 antagonists or inhibitory oligonucleotides. Appetite can be increased by administering Gpr17 agonists. | 03-26-2015 |
20150087691 | METHODS AND COMPOSITIONS FOR MODULATING ALPHA-1-ANTITRYPSIN EXPRESSION - Disclosed herein are methods for decreasing AIAT mRNA and protein expression and treating, ameliorating, preventing, slowing progression, or stopping progression of fibrosis. Disclosed herein are methods for decreasing AIAT mRNA and protein expression and treating, ameliorating, preventing, slowing progression, or stopping progression of liver disease, such as, AIATD associated liver disease, and pulmonary disease, such as, AIATD associated pulmonary disease in an individual in need thereof. Methods for inhibiting AIAT mRNA and protein expression can also be used as a prophylactic treatment to prevent individuals at risk for developing a liver disease, such as, AIATD associated liver disease and pulmonary disease, such as, AIATD associated pulmonary disease. | 03-26-2015 |
20150087692 | MORPHOLINO-MEDIATED INCREASE IN SOLUBLE FLT-1 EXPRESSION RESULTS IN DECREASED OCULAR AND TUMOR NEOVASCULARIZATION - Methods of inhibiting lymphangiogenesis and/or angiogenesis in a subject are provided. In one aspect, for example, a method of inhibiting angiogenesis in a subject can include binding an antisense morpholino to an mRNA splicing site of VEGFR1 selected from exon13_intron13 junction, intron13_exon14 junction, or a combination thereof. In another aspect, the morpholino includes a member selected from VEGFR1_MOe13, VEGFR1_MOi13, or a combination thereof. | 03-26-2015 |
20150087693 | MICRO-RNAS INVOLVED IN MACULAR DEGENERATION - The present invention relates to the involvement of miR function in the development of age-related macular degeneration (AMD). It is shown that miR-23, miR-24 and/or miR-27 are involved in pathologic neovascularization in AMD, and that agonism (miR-24) and inhibition (miR23/27) of the function of these molecules blocks events contributing to development and progression of disease. | 03-26-2015 |
20150087694 | MICRORNA-BASED METHODS AND COMPOSITIONS FOR THE DIAGNOSIS, PROGNOSIS AND TREATMENT OF TUMOR INVOLVING CHROMOSOMAL REARRANGEMENTS - Provided are novel methods and compositions for the diagnosis, prognosis and treatment of tumor involving a chromosomal rearrangement, in particular a tumor or neoplasia of the thyroid gland. In addition, methods of identifying anti-tumor agents are described. | 03-26-2015 |
20150087695 | TREATMENT OF ERYTHROPOIETIN (EPO) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO EPO - Oligonucleotide compounds modulate expression and/or function of Erythropoietin (EPO) polynucleotides and encoded products thereof. Methods for treating diseases associated with Erythropoietin (EPO) comprise administering one or more oligonucleotide compounds designed to inhibit the EPO natural antisense transcript to patients. | 03-26-2015 |
20150087696 | METHOD OF CONTROLLING INITIAL DRUG RELEASE OF siRNA FROM SUSTAINED-RELEASE IMPLANTS - The present invention provides an intraocular implant comprising siRNA combined with a excipient effective to retard the initial release of the siRNA from an implant, wherein said siRNA and excipient is associated with a biocompatible polymer (e.g., a polymeric matrix), configured to release said siRNA into the eye of a patient at therapeutic levels for a time sufficient to treat an ocular condition or disease. | 03-26-2015 |
20150094354 | METHOD FOR TREATING CELL PROLIFERATIVE DISORDER BY INHIBITING C1GALT1 EXPRESSION - A method for treating a cell proliferative disorder in a subject is provided. The method for treating a cell proliferative disorder has a step of: administering a C1GALT1 inhibition substance to the subject for inhibiting C1GALT1 expression or activity in the subject, so as to treat the cell proliferative disorder in the subject. | 04-02-2015 |
20150094355 | MODULATION OF NLGn4 EXPRESSION, NK CELL ACTIVITY IN NON-ALCOHOLIC FATTY LIVER DISEASE (NAFLD) - The present invention provides a method of treating, attenuating or preventing a liver disorder by inhibiting NLGn4 expression and thereby modulating the activity of NK cells. The present invention further relates to diagnosing a liver disorder by evaluating NLGn4 expression in NK cells. | 04-02-2015 |
20150094356 | TREATMENT OF DYSTROPHIN FAMILY RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO DMD FAMILY - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Dystrophin family, in particular, by targeting natural antisense polynucleotides of Dystrophin family. The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of DMD family. | 04-02-2015 |
20150094357 | Methods for Differentiating Pancreatic Cancer from Normal Pancreatic Function and/or Chronic Pancreatitis - There is provided herein methods and compositions for the diagnosis, prognosis and treatment of pancreatic cancer, along with methods of identifying anti-pancreatic cancer agents. | 04-02-2015 |
20150094358 | TREATMENT OF HEPATOCYTE GROWTH FACTOR (HGF) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO HGF - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Hepatocyte Growth Factor (HGF), in particular, by targeting natural antisense polynucleotides of Hepatocyte Growth Factor (HGF). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of HGF. | 04-02-2015 |
20150099790 | COMPOSITIONS AND METHODS FOR MODULATING MITOCHONDRIAL PYRUVATE CARRIER ACTIVITY - Disclosed herein are methods and compositions for the diagnosis and treatment of conditions associated with aberrant pyruvate metabolism, and symptoms thereof, in a subject. Disclosed herein are methods of detecting an aberrant pyruvate metabolism-associated condition, and symptoms thereof, in a subject, by the expression level of MPC1 or MPC2. Disclosed herein are methods of detecting an aberrant pyruvate metabolism-associated condition, and symptoms thereof, in a subject, by the activity level of MPC1 or MPC2. Disclosed herein are methods of determining responsiveness to a treatment for an aberrant pyruvate metabolism associated condition, and symptoms thereof, in a subject. | 04-09-2015 |
20150099791 | COMPOSITIONS AND METHODS FOR MODULATING UTRN EXPRESSION - Aspects of the invention provide single stranded oligonucleotides for activating or enhancing expression of UTRN. Further aspects provide compositions and kits comprising single stranded oligonucleotides for activating or enhancing expression of UTRN. Methods for modulating expression of UTRN using the single stranded oligonucleotides are also provided. Further aspects of the invention provide methods for selecting a candidate oligonucleotide for activating or enhancing expression of UTRN. | 04-09-2015 |
20150099792 | ANTISENSE MODULATION OF GCGR EXPRESSION - Provided herein are methods, compounds, and compositions for reducing expression of GCGR mRNA and protein in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate metabolic disease, for example, diabetes, or a symptom thereof. | 04-09-2015 |
20150099793 | RATIONAL DESIGN OF microRNA-siRNA CHIMERAS FOR MULTI-FUNCTIONAL TARGET SUPPRESSION - The present disclosure encompasses methods for rational design of microRNA and small interfering RNA chimeras and compositions and methods of use thereof. | 04-09-2015 |
20150099794 | GNAQ TARGETED dsRNA COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION - The invention relates to a double-stranded ribonucleic acid (dsRNA) targeting a G-alpha q subunit (GNAQ) of a heterotrimeric G gene, and methods of using the dsRNA to inhibit expression of GNAQ. | 04-09-2015 |
20150099795 | THERAPEUTIC AGENT FOR TREATING TRYPANOSOMA-ASSOCIATED DISEASE, METHOD FOR KILLING TRYPANOSOMA PARASITES, AND USE THEREOF - A therapeutic agent for treating a | 04-09-2015 |
20150099796 | Compositions and Methods for Gene Silencing - Compositions and methods for modulating the expression of a protein of interest are provided. | 04-09-2015 |
20150099797 | OLIGONUCLEOTIDE COMPOSITIONS WITH ENHANCED EFFICIENCY - The oligonucleotide compositions of the present invention make use of combinations of oligonucleotides. In one aspect, the invention features an oligonucleotide composition including at least 2 different oligonucleotides targeted to a target gene. This invention also provides methods of inhibiting protein synthesis in a cell and methods of identifying oligonucleotide compositions that inhibit synthesis of a protein in a cell. | 04-09-2015 |
20150105440 | ANTISENSE MODULATION OF APOLIPOPROTEIN B EXPRESSION - Antisense compounds, compositions and methods are provided for modulating the expression of apolipoprotein B. The compositions comprise antisense compounds, particularly antisense oligonucleotides, targeted to nucleic acids encoding apolipoprotein B. Methods of using these compounds for modulation of apolipoprotein B expression and for treatment of diseases associated with expression of apolipoprotein B are provided. | 04-16-2015 |
20150105441 | LIM KINASEMODULATING AGENTS FOR NEUROFIBROMATOSES THERAPY AND METHODS FOR SCREENING FOR SAME - Disclosed herein are methods of treating a patient at risk of developing or having a neurofibromatosis or a sporadic schwannoma. In exemplary embodiments, the method involves administering to a subject in need an effective amount of a LIMK modulating agent. Also disclosed are compounds newly identified to be inhibitors of Merlin-null Schwann cell proliferation and/or survival. | 04-16-2015 |
20150105442 | Nucleic Acid Molecule Capable of Inhibiting Expression of Periostin Gene, method for Inhibiting Expression of Periostin Gene, and Use of Said Nucleic Acid Molecule - Provided is a novel molecule that inhibits the expression of the periostin gene. Also provided are methods of inhibiting the expression of the periostin gene or treating an eye disease using the same. | 04-16-2015 |
20150105443 | SINGLE-STRANDED NUCLEIC ACID MOLECULE FOR REGULATING EXPRESSION OF GENE HAVING DELIVERING FUNCTION - The invention provides a single-stranded nucleic acid capable of inhibiting expression of a target gene having a delivery function. The nucleic acid contains, from the 5′-side to the 3′-side, a 5′-side region (Xc), a linker region (Lx), an inner region (Z), a linker region (Ly) and a 3′-side region (Yc) in this order, wherein the inner region (Z) is constituted by linkage of the inner 5′-side region (X) and the inner 3′-side region (Y), the 5′-side region (Xc) is complementary to the inner 5′-side region (X), the 3′-side region (Yc) is complementary to the inner 3′-side region (Y), at least one of the inner region (Z), the 5′-side region (Xc) and the 3′-side region (Yc) comprises an expression inhibitory sequence that inhibits expression of a target gene, and at least one of the 5′-terminus, the 3′-terminus, the linker region (Lx) and the linker region (Ly) is bound to a bio-related substance. | 04-16-2015 |
20150105444 | ANTISENSE COMPOUNDS TARGETING GENES ASSOCIATED WITH FIBRONECTIN - The present invention provides compounds comprising oligonucleotides complementary to a fibronectin transcript. Certain such compounds are useful for hybridizing to a fibronectin transcript, including but not limited to a fibronectin transcript in a cell. In certain embodiments, such hybridization results in modulation of splicing of the fibronectin transcript. In certain embodiments, such compounds are used to treat one or more symptoms associated with fibrosis. In certain embodiments, such compounds are used to treat one or more symptoms associated with renal fibrosis. | 04-16-2015 |
20150105445 | RNA INTERFERENCE MEDIATED INHIBITION OF GENE EXPRESSION USING CHEMICALLY MODIFIED SHORT INTERFERING NUCLEIC ACID (siNA) - The present invention concerns methods and reagents useful in modulating gene expression in a variety of applications, including use in therapeutic, diagnostic, target validation, and genomic discovery applications. Specifically, the invention relates to synthetic chemically modified small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules capable of mediating RNA interference (RNAi) against target nucleic acid sequences. The small nucleic acid molecules are useful in the treatment of any disease or condition that responds to modulation of gene expression or activity in a cell, tissue, or organism. | 04-16-2015 |
20150105446 | Novel Activation and Transfer Cascade for Ubiquitin - A novel activating enzyme for ubiquitin, Uba6, is provided. Compositions and methods for inhibiting ubiquitin via the Uba6 pathway are provided. Methods of identifying novel inhibitors of ubiquitination are also provided. Novel RNAi molecules are also provided. | 04-16-2015 |
20150105447 | FIDGETIN-LIKE 2 AS A TARGET TO ENHANCE WOUND HEALING - Methods of treating a wound in a subject are provided comprising administering to the subject an amount of an inhibitor of Fidgetin-like 2. Compositions and pharmaceutical compositions comprising an amount of an inhibitor of Fidgetin-like 2 are also provided. Methods are also provided for identifying an inhibitor of Fidgetin-like 2. | 04-16-2015 |
20150105448 | MEANS AND METHODS FOR THE SPECIFIC MODULATION OF TARGET GENES IN THE CNS AND THE EYE AND METHODS FOR THEIR IDENTIFICATION - Provided are methods for the treatment of disorders of the central nervous system (CNS) and the eye. In particular, use of compositions comprising a compound capable of modulating a target gene or gene product is described for the preparation of a pharmaceutical composition for the treatment of disorders of the CNS and/or the eye, wherein the composition is designed to be administered outside the blood-CNS and the blood-retina barriers. Furthermore, methods are provided for identifying and obtaining nucleic acid molecules encoding polypeptides involved in CNS disorders or of the eye, methods for diagnosing said disorders as well as transgenic animal deficient in the expression of target genes identified in accordance with the described method. In addition, methods of identifying and isolating drugs that are particularly useful for the treatment of disorders related to the CNS and/or the eye are disclosed. | 04-16-2015 |
20150105449 | MICRORNA COMPOUNDS AND METHODS FOR MODULATING MIR-122 - Described herein are compositions and methods for the inhibition of miR-122 activity. The compositions have certain nucleoside modifications that yield potent inhibitors of miR-122 activity. The compounds may comprise conjugates to facilitate delivery to the liver. The compositions may be administered to subjects infected with hepatitis C virus, as a treatment for hepatitis C virus and related conditions. | 04-16-2015 |
20150105450 | MULTI-TARGETING SHORT INTERFERING RNAs - The present invention relates to novel short interfering RNA (siRNA) molecules that are multi-targeted. More specifically, the present invention relates to siRNA molecules that target two or more sequences. In one embodiment, multi-targeting siRNA molecules are designed to incorporate features of siRNA molecules and features of micro-RNA (miRNA) molecules. In another embodiment, multi-targeting siRNA molecules are designed so that each strand is directed to separate targets. | 04-16-2015 |
20150105451 | TREATMENT OF PARAOXONASE 1 (PON1) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO PON1 - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Paraoxonase 1 (PON1), in particular, by targeting natural antisense polynucleotides of Paraoxonase (PON1). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of PON1. | 04-16-2015 |
20150111945 | COMPOSITIONS AND METHODS FOR SILENCING EBOLA VIRUS GENE EXPRESSION - The present invention provides compositions comprising therapeutic nucleic acids (e.g., interfering RNA such as siRNA) that target Ebola virus (EBOV) gene expression and methods of using such compositions to silence EBOV gene expression. More particularly, the invention provides unmodified and chemically modified interfering RNA which silence EBOV gene expression and methods of use thereof, e.g., for preventing or treating EBOV infections caused by one or more EBOV species such as Zaire EBOV. The invention also provides serum-stable nucleic acid-lipid particles comprising one or more interfering RNA molecules, a cationic lipid, and a non-cationic lipid, which can further comprise a conjugated lipid that inhibits aggregation of particles. Methods of silencing EBOV gene expression by administering one or more interfering RNA molecules to a mammalian subject are also provided. | 04-23-2015 |
20150111946 | METHODS FOR DELIVERY TO THE CENTRAL NERVOUS SYSTEM OF NUCLEIC ACID NANOPARTICLES TO TREAT CENTRAL NERVOUS SYSTEM DISORDERS - Disclosed herein are methods and compositions for the treatment of diseases of the CNS with nucleic acid nanoparticles. Compositions are also disclosed herein that utilize nucleic acid nanoparticles to treat conditions such as Parkinson's Disease. Furthermore, methods of intranasally administering the compacted nucleic acid nanoparticles for therapeutic purposes in the brain are disclosed. | 04-23-2015 |
20150111947 | COMPOSITIONS AND METHODS FOR DECREASING LEUKOCYTE EXTRAVASATION AND VESSEL FLUID LEAKAGE - Provided herein are methods of decreasing leukocyte extravasation from a lymph or blood vessel into a tissue in a mammal, methods of decreasing fluid leakage from a lymph or blood vessel in a mammal in need thereof, methods of decreasing formation of atherosclerotic plaques in a mammal in need thereof, and methods of treating atherosclerosis in a mammal that include administering to the mammal an oligonucleotide that decreases Mitogen-activated protein kinase kinase kinase kinase 4 (Map4k4) mRNA expression in an endothelial cell. Also provided are methods of identifying a candidate agent useful for decreasing leukocyte extravasation or decreasing fluid leakage from a lymph or blood vessel in a mammal, and compositions containing an oligonucleotide that decreases Map4k4 mRNA expression in an endothelial cell and additional therapeutic agents. | 04-23-2015 |
20150111948 | RNA-INTERFERENCE-INDUCING NUCLEIC ACID MOLECULE ABLE TO PENETRATE INTO CELLS, AND USE THEREFOR - The present invention relates to a novel, RNAi-inducing nucleic acid molecule having cell penetrating ability and the use thereof, and more particularly, to a novel, RNAi-inducing double-stranded nucleic acid molecule, which has a replacement of the phosphate backbone of at least one nucleotide with phosphorothioate or phosphorodithioate, and has a lipophilic compound conjugated thereto, and thus has high target gene-silencing efficiency while having the ability to penetrate cells without needing a separate intracellular delivery vehicle, and to a method of silencing a target gene using the nucleic acid molecule. The nucleic acid structure according to the present invention has both cholesterol modification and phosphorothioate modification introduced therein, and thus has high gene silencing efficiency while having the ability to penetrate cells without needing a separate intracellular delivery vehicle. Thus, it can be delivered into an actual target area in an amount sufficient for induction of RNAi, and thus can overcome the in vivo delivery problem occurring in the prior art. Therefore, the nucleic acid molecule according to the invention can effectively substitute for conventional siRNA molecules to treat cancer or viral infections. | 04-23-2015 |
20150111949 | TREATMENT OF CANCERS WITH MICRO-RNA INHIBITORS - The invention relates to the treatment and prevention of cancers, including blood-based cancers and breast cancers, by administering agents that inhibit the activity of microRNAs, including miR-22. Inhibitors can include oligonucleotides that are at least partially complementary to these miRNAs. In some embodiments, these inhibitors are chemically modified oligonucleotides, including locked nucleic acids (LNAs). | 04-23-2015 |
20150111950 | INHIBITION OF DNA2 IN FANCONI ANEMIA - Inhibition of DNA2 in Fanconi anemia (FA) cells remedies the over-resection of DNA, thereby stabilizing the FA cells. Inhibition of DNA2 in FA cells allows for safe treatment of cancers in FA patients, a decrease in the lethality of FA cells, a decrease in bone marrow failure of FA patients, and a means for decreasing the incidence of cancer for FA patients. | 04-23-2015 |
20150111951 | METHODS FOR THE TREATMENT OF LEBER CONGENITAL AMAUROSIS - The present invention relates to a method for treating a Leber congenital amaurosis in a patient harbouring the mutation c.2991+1655 A>G in the CEP290 gene, comprising the step of administering to said patient at least one antisense oligonucleotide complementary to nucleic acid sequence that is necessary for preventing splicing of the cryptic exon inserted into the mutant c.2291+1655 A>G CEP290 mRNA | 04-23-2015 |
20150111952 | METHOD FOR TREATING GLIOMA USING TARBP2 EXPRESSION INHIBITOR - A method of preventing or treating glioma by inhibiting expression of Tarbp2, which is a novel transcription factor inducing Notch signal activation, and a pharmaceutical composition for treating glioma using shRNA or siRNA as a Tarbp2 expression inhibitor, as well as a method of treating glioma using the same and use thereof, are provided. | 04-23-2015 |
20150111953 | Modulator Compounds of Drug Resistance in Epithelial Tumor Cells - The described invention provides a method of treating a patient with an epithelial cancer comprising administering a composition comprising a therapeutic amount of an inhibitor of a BTK protein and one or more chemotherapeutic agent(s) selected from the group consisting of an antimetabolite, a platinum coordination compound, an alkylating agent and a combination thereof, wherein the composition is effective to reduce one or more of tumor cell growth, tumor cell clonogenicity, tumor cell proliferation, tumor cell viability and tumor volume and the therapeutic amount of the inhibitor of a BTK protein and the one or more chemotherapeutic agent(s) exerts a synergistic effect. The described invention also provides methods of treating a chemotherapy drug-resistant cancer and sensitizing a cancer patient to chemotherapy. | 04-23-2015 |
20150119443 | METHOD OF THERAPY AND DIAGNOSIS OF ENDOTHELIAL DYSFUNCTION - The invention discloses a method of therapy of endothelial dysfunction, by administering microRNA let-7g to a subject in need, wherein the microRNA let-7g inhibits SMAD2 transcription factor from activation and translocation into nucleus, thereby decreasing monocyte cell adhesion, inflammation and thrombosis and increasing angiogenesis. | 04-30-2015 |
20150119444 | Carbohydrate Conjugates as Delivery Agents for Oligonucleotides - The present invention provides iRNA agents comprising at least one subunit of the formula (I): | 04-30-2015 |
20150119445 | Carbohydrate Conjugates as Delivery Agents for Oligonucleotides - The present invention provides iRNA agents comprising at least one subunit of the formula (I): | 04-30-2015 |
20150119446 | CUL4B AS PREDICTIVE BIOMARKER FOR CANCER TREATMENT - The current disclosure describes materials and methods for identifying subjects that would benefit from treatment with a DNA topoisomerase 1 inhibitor, based on the levels of cullin 4B gene, RNA and protein levels in the subject. The disclosure identifies CUL4B as a predictive biomarker for cancer diagnosis and the subsequent treatment with directed therapeutic agents. The current disclosure also identifies novel therapeutic agents that modulate the level of CUL4B expression, and sensitize a subject to treatment with a second therapeutic agent. | 04-30-2015 |
20150119447 | CLUSTERED SINGLE NUCLEOTIDE POLYMORPHISMS IN THE HUMAN ACETYLCHOLINESTERASE GENE AND USES THEREOF IN DIAGNOSIS AND THERAPY - The present invention relates to diagnostic and prognostic methods and kits for determining genetic predisposition for at least one AChE-associated disorder, as well for diagnosing, prognosing and monitoring said disorders. The methods of the invention are based on detection of specific SNPs that modulate the interaction of different miRNAs to AChE 3′-UTR. | 04-30-2015 |
20150119448 | RNA PRODUCTS AND USES THEREOF - The present invention relates to small RNAs, inhibitors thereof, inhibitors of enzymes producing thereof, and their use to modulate the response of a cell to a DNA damaging event. The invention concerns also a method to detect the presence or quantify DNA damage. | 04-30-2015 |
20150119449 | Methods and Compositions for Modulating MIR-204 Activity - The present invention provides compositions and methods for regulating insulin production. | 04-30-2015 |
20150119450 | COMPOSITIONS FOR USE IN TREATING OR DIAGNOSING BONE DISORDERS AND/OR CARDIOVASCULAR DISORDERS - Compositions of an inhibitor of a polynucleotide for use in treating or preventing bone disorders such as osteoporosis, osteopenia, bone fracture, bone cancer, as well as impaired bone homeostasis. Preferred compounds to be used in these medical interventions are antagonistic compounds, like nucleic acid molecules, directed against miR-31 and derivatives thereof. Also, methods for diagnosing and compositions for use in diagnosing bone disorders. Compounds to be employed in these diagnostic methods and uses include compounds such as miR-31. | 04-30-2015 |
20150119451 | TREATMENT OF INTERFERON REGULATORY FACTOR 8 (IRF8) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO IRF8 - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Interferon Regulatory Factor 8 (IRF8), in particular, by targeting natural antisense polynucleotides of Interferon Regulatory Factor 8 (IRF8). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of IRF8. | 04-30-2015 |
20150126578 | Modified Small Activating RNA Molecules and Methods of Use - Methods, compositions and kits are provided for increasing the expression of a gene product in a cell by contacting the cell with a modified small activating RNA (saRNA) molecule, which provides for an increase in gene expression that is improved over the increase in expression provided by traditional saRNAs. These methods and compositions find use in any application in which an increase in gene expression in a cell is desired. | 05-07-2015 |
20150126579 | MICRO-RNA INHIBITORS AND THEIR USES IN DISEASE - The invention relates to the treatment and prevention of cancer by administering agents that inhibit the activity of microRNAs that modulate tumor suppressor genes, which can include PTEN, p53, and INPP4B, among others. Inhibitors can include oligonucleotides that are at least partially complementary to these miRNAs. In some embodiments, these inhibitors are chemically modified oliognucleotides, including locked nucleic acids (LNAs). | 05-07-2015 |
20150126580 | METHODS FOR DIAGNOSING AND TREATING ONCOGENIC KRAS-ASSOCIATED CANCER - Methods for diagnosing and treating cancer associated with an oncogenic Kras mutation in a subject are provided. | 05-07-2015 |
20150126581 | MicroRNAs and Uses Thereof - Provided herein are methods for inhibiting expression of DOHH in a cell, and for inhibiting hypusination of eIF5A in a cell, the methods comprising contacting a cell with a miRNA or a nucleic acid molecule encoding the miRNA, wherein the miRNA binds to the 3′UTR of the DOHH mRNA and wherein binding results in a reduction in DOHH expression. Also provided are methods for reducing cellular proliferation and for treating diseases associated with abnormal cellular proliferation. | 05-07-2015 |
20150126582 | Combination Treatment of Multiple Myeloma - The present invention relates to the treatment of multiple myeloma in a human subject comprising administering lenadlidomide in combination with a vector which expresses a human eIF-SAI which is unable to be hypusinated and an siRNA which targets eIF-SAI. In some embodiments, the lenalidomide is administered simultaneously with the vector and the siRNA while in some embodiments the lenalidomide is administered at a time that is different from when the vector and the siRNA are administered. In some embodiments, the lenalidomide is administered orally and the vector and the siRNA are administered intraveneously. | 05-07-2015 |
20150126583 | REDUCING GALECTIN-12 ACTIVITY TO INFLUENCE THE CELL FUNCTION OF HUMAN SEBOCYTES - Methods for the treatment of a disorder characterized by excessive proliferation and/or lipid content of sebocytes are disclosed. In one embodiment of the invention, the method comprises administering to a subject in need thereof a therapeutically effective amount of a pharmaceutical composition comprising a small molecule inhibitor targeted to galectin-12 or a nucleic acid-based inhibitor targeted to galectin-12 and a pharmaceutically acceptable carrier, wherein said inhibitor is a non-naturally occurring molecule and administration of said inhibitor produces a decrease in the proliferation and/or lipid content of the sebocytes. Methods for decreasing sebaceous gland size, inhibiting sebocyte proliferation, and/or inhibiting sebocyte lipid content are also disclosed. | 05-07-2015 |
20150126584 | Treatment of Pulmonary and Pleural Fibrosis Using HSP27 Inhibitors - Reduction of HSP27 expression is in beneficial in the treatment of pleural and pulmonary fibrosis and in particular subpleural fibrosis and IPF. Pharmaceutical compositions for this purpose contain an inhibitor of HSP27 and a pharmaceutically acceptable carrier. | 05-07-2015 |
20150126585 | Materials and Methods Related to MicroRNA-21, Mismatch Repair, and Colorectal Cancer - Described herein is the discovery that miR-21 targets and down-regulates the core mismatch repair (MMR) recognition protein complex hMSH2 and hMSH6. Anti-sense miR-21 is therefore proven as therapeutic herein. Therefore, compositions, kits, therapies and other methods, including methods of treatment/amelioration of symptoms, are disclosed herein. | 05-07-2015 |
20150126586 | COMBINATION THERAPY FOR TREATING HEARING AND BALANCE DISORDERS - The present application relates to combinations of inhibitors directed at down-regulation of genes associated with hearing loss including HES1, HES5, HEY2, CDKN1B and NOTCH1, exhibiting a beneficial effect and useful in treating or attenuating hearing loss, treating balance impairment, promoting the replacement, regeneration, or protection of otic (sensory) hair cells of the inner ear, and or effecting hearing restoration/regeneration. | 05-07-2015 |
20150126587 | TREATMENT OF TUMOR PROTEIN 63 (P63) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO P63 - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Tumor Protein 63 (p63), in particular, by targeting natural antisense polynucleotides of Tumor Protein 63 (p63). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of p63. | 05-07-2015 |
20150133519 | NOVEL DIESTER AND TRIESTER BASED LOW MOLECULAR WEIGHT, BIODEGRADEABLE CATIONIC LIPIDS FOR OLIGONUCLEOTIDE DELIVERY - The instant invention provides for novel cationic lipids of Formula A that can be used in combination with other lipid components such as cholesterol and PEG-lipids to form lipid nanoparticles with oligonucleotides. It is an object of the instant invention to provide a cationic lipid scaffold that demonstrates enhanced efficacy along with lower liver toxicity as a result of lower lipid levels in the liver. The present invention employs low molecular weight cationic lipids with one short lipid chain coupled with inclusion of hydrolysable functionality in the lipid chains to enhance the efficiency and tolerability of in vivo delivery of siRNA. | 05-14-2015 |
20150133520 | COMPOSITIONS AND METHODS FOR INDUCING MYOBLAST DIFFERENTIATION AND MYOTUBE FORMATION - Provided herein are methods of inducing differentiation of a mammalian myoblast into a mammalian myocyte that include contacting a mammalian myoblast with an oligonucleotide that decreases Mitogen-activated protein kinase kinase kinase kinase 4 (Map4k4) mRNA expression in a mammalian myoblast or myocyte. Also provided are methods of inducing mammalian myoblasts or myocytes to form a myotube that include contacting two or more mammalian myoblasts or two or more mammalian myocytes with an oligonucleotide that decreases Map4k4 mRNA expression in a mammalian myoblast or myocyte. Also provided are methods of identifying a candidate agent useful for inducing muscle formation, and compositions containing an oligonucleotide that decreases Map4k4 mRNA expression in mammalian myoblast or myocyte and one or more additional muscle therapeutic agents and/or muscle-building neutraceuticals. | 05-14-2015 |
20150133521 | INHIBITORS OF MICRORNAs THAT REGULATE PRODUCTION OF ATRIAL NATRIURETIC PEPTIDE (ANP) AS THERAPEUTICS AND USES THEREOF - The present invention relates to methods, kits and compositions to treat hypertension and other cardiovascular diseases in a subject, in particular, a method of treating or preventing a cardiovascular disease in a subject comprising administering to a subject at least one anti-miR agent to miRNA-425. In some embodiments, an anti-miR agent is a small molecule or an oligonucleotide complementary to at least part of the miR-425 of SEQ ID NO: 1, or an anti-miR complementary to at least part of the miRNA seed sequence AUGACA (SEQ ID NO: 2). Another aspect of the present invention relates to methods, kits and compositions to treat low blood pressure in a subject comprising administering a composition comprising a miR-425 agent to decrease ANP levels in the subject. Other aspects of the present invention relates to assays, methods and systems to identify a subject at risk of hypertension, or identifying a subject suitable to administration of an anti-miR-425 agent for treatment of hypertension, the assay comprising assessing if a subject is homozygous or heterozygous for the major (A) allele of rs5068 SNP, and/or assaying for levels of miR-425 and/or assaying for levels of NT-proANP and/or levels of ANP in the plasma of a subject. | 05-14-2015 |
20150133522 | MANIPULATING MICRORNA FOR THE MANAGEMENT OF NEUROLOGICAL DISEASES OR CONDITIONS AND COMPOSITIONS RELATED THERETO - This disclosure relates to manipulating microRNA for the management of neurological disorders and compositions related thereto. In certain embodiments, the disclosure contemplates inhibition of miR324 or miR324-5p, e.g., the use of nucleobase polymers for antisense disruptions or RNA interference of miR-324 expression or for miR324-5p binding in order to increase Kv4.2 expression. In certain embodiments, the disclosure relates to methods of treating or preventing a neurological disease or condition comprising administering an effective amount of an inhibitor to a subject in need thereto. | 05-14-2015 |
20150133523 | METHOD FOR DOWN-REGULATING GENE EXPRESSION IN FUNGI - The present invention concerns methods for controlling fungus infestation via dsRNA mediated gene silencing, whereby the intact fungus cell(s) are contacted with a double-stranded RNA from outside the fungal cell(s) and whereby the double-stranded RNA is taken up by the intact fungal cell(s). In one particular embodiment, the methods of the invention are used to alleviate plants from fungus pests. Alternatively, the methods are used for treating and/or preventing fungal infestation on a substrate or a subject in need of such treatment and/or prevention. Suitable fungal target genes and fragments thereof, dsRNA constructs, recombinant constructs and compositions are disclosed. | 05-14-2015 |
20150133524 | PYRUVATE DEHYROGENASE KINASES AS THERAEUTIC TARGETS FOR CANCER AND ISCHEMIC DISEASES - The invention provides therapeutic and prophylactic compounds and methods for altering the activity of pyruvate dehydrogenase kinase (e.g. PDK1, PDK2, PDK3, PDK4). Such therapies are useful for the treatment of neoplasia. The invention further provides therapeutic and prophylactic compounds and methods of altering pyruvate dehydrogenase activity to treat or prevent cell death related to ischemia. | 05-14-2015 |
20150133525 | TREATMENT OF RNASE H1 RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO RNASE H1 - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of RNase H1, in particular, by targeting natural antisense polynucleotieds of RNase H1. The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of RNASE H1. | 05-14-2015 |
20150133526 | TREATMENT OF DISCS LARGE HOMOLOG (DLG) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO DLG - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Discs large homolog (DLG), in particular, by targeting natural antisense polynucleotides of Discs large homolog (DLG). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorder associated with the expression of DLG. | 05-14-2015 |
20150141484 | Methods, Compositions and Drug Delivery Systems for Intraocular Delivery of siRNA Molecules - Biocompatible intraocular drug delivery systems in the form of an implant for intraocular administration of siRNA molecules. The drug delivery systems may be placed in an eye to treat or reduce the occurrence of one or more ocular conditions, such as retinal damage, including glaucoma and proliferative vitreoretinopathy among others. | 05-21-2015 |
20150141485 | PROGNOSIS AND TREATMENT OF LUNG CANCER USING miRNA-135b - The present invention provides a method for the prognosis of lung cancer patient based on the expression levels of miRNA-135b, LZTS1, LATS2 and nuclear TAZ. The invention also provides a method for treatment of lung cancer. | 05-21-2015 |
20150141486 | COMPOSITION COMPRISING miRNA FOR ENHANCING RADIATION SENSITIVITY - Provided are a method of enhancing radiation sensitivity by using miR-499b-5p and a method of treating a radiation resistant cancer including administering miR-499b-5p. | 05-21-2015 |
20150141487 | OLIGORIBONUCLEOTIDES AND METHODS OF USE THEREOF FOR TREATMENT OF ALOPECIA, ACUTE RENAL FAILURE AND OTHER DISEASES - The invention relates to a double-stranded compound, preferably an oligoribonucleotide, which down-regulates the expression of a human p53 gene. The invention also relates to a pharmaceutical composition comprising the compound, or a vector capable of expressing the oligoribonucleotide compound, and a pharmaceutically acceptable carrier. The present invention also contemplates a method of treating a patient suffering from alopecia or acute renal failure or other diseases comprising administering to the patient the pharmaceutical composition in a therapeutically effective dose so as to thereby treat the patient. The alopecia may be induced by chemotherapy or radiotherapy, and the patient may be suffering from cancer, in particular breast cancer. | 05-21-2015 |
20150141488 | SMALL MOLECULE INHIBITORS OF RNA BINDING MOTIF (RBM) PROTEINS FOR THE TREATMENT OF ACUTE CELLULAR INJURY - A method of treating a cellular injury in a subject comprising administering to a subject in need thereof, a therapeutically effective amount of a compound of formula I: | 05-21-2015 |
20150141489 | METHODS OF TREATING AND DIAGNOSING DISEASES USING AGENTS THAT REGULATE THE ALTERNATIVE SPLICING PATHWAY - A method of determining a treatment for an inflammatory disorder in a subject, is disclosed. The method comprises determining an amount of SRSF6 in a sample from the subject, wherein an amount of the SRSF6 is indicative of the treatment. Methods of diagnosing inflammatory disorders and treating same are also disclosed. | 05-21-2015 |
20150141490 | PYRAZOLOTRIAZOLYL NUCLEOSIDE ANALOGUES AND OLIGONUCLEOTIDES COMPRISING THEM - The present invention relates to pyrazolotriazolyl nucleoside analogues, oligonucleotide comprising them, and uses thereof. Further the invention relates to a method for reducing gene expression in a cell comprising transfecting the cell with such an oligonucleotide. It has been found, in accordance with the present invention, that certain pyrazolotriazolyl-based nucleoside analogues such as 8-[3′-(2-cyanoethyl)-(N,Ndiisopropyl)]-phosphoramidite-(2′-deoxy-5′-dimethoxytrity 1-13-D-ribofuranozyl)-4-{N-benzoylamino)-pyrazolo[1,5a]-1,3,5-triazine, can be incorporated into oligonucleotides, substituting natural purine nucleosides and imparting acid stability and nuclease stability to the oligonucleotide. Furthermore, oligonucleotides comprising one or more such nucleoside analogues are capable of hybridizing with oligonucleotides having complementary sequences thereto in which no such analogues are incorporated. | 05-21-2015 |
20150141491 | Therapeutic Targets for Alzheimer's Disease - The present invention relates to novel methods for the prevention, treatment and diagnosis of Alzheimer's disease. In addition, the invention relates to methods for assessing an individual's susceptibility or pre-disposition to Alzheimer's disease. The methods of the present invention involve the use of therapeutic targets and diagnostic and/or predictive markers within the mTOR signalling pathway. The methods also involve screening subjects for genetic polymorphisms associated with rapamycin-sensitive genes. | 05-21-2015 |
20150141492 | RNA INTERFERENCE MEDIATING SMALL RNA MOLECULES - Double-stranded RNA (dsRNA) induces sequence-specific post-transcriptional gene silencing in many organisms by a process known as RNA interference (RNAi). Using a | 05-21-2015 |
20150141493 | ANTISENSE MODULATION OF GCCR EXPRESSION - Provided herein are methods, compounds, and compositions for reducing expression of GCCR mRNA and protein in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate metabolic disease, for example, diabetes, or a symptom thereof. | 05-21-2015 |
20150141494 | TREATEMENT OF VASCULAR ENDOTHELIAL GROWTH FACTOR (VEGF) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO VEGF - Oligonucleotide compounds modulate expression and/or function of Vascular Endothelial Growth Factor (VEGF) polynucleotides and encoded products thereof. Methods for treating diseases associated with Vascular Endothelial Growth Factor (VEGF) comprise administering one or more Oligonucleotide compounds designed to inhibit the VEGF natural antisense transcript to patients. | 05-21-2015 |
20150141495 | DIFFERENTIAL EXPRESSION OF MICRORNAS IN NONFAILING VERSUS FAILING HUMAN HEARTS - The present invention discloses specific miRNAs as novel biomarkers and therapeutic targets in the treatment of heart failure. Methods of treating or preventing heart failure in a subject by administering mimics or inhibitors of these particular miRNAs are disclosed. A method of diagnosing or prognosing heart failure in a subject by determining the level of expression of one or more miRNAs is also described. | 05-21-2015 |
20150148401 | METHODS AND COMPOSITIONS FOR INHIBITING THE GROWTH AND/OR PROLIFERATION OF MYC-DRIVEN TUMOR CELLS - The invention generally relates to methods for identifying and using anticancer therapeutic agents and, more particularly, to methods for identifying and using inhibitors of genes for inhibiting the growth and/or proliferation of MYC-driven tumor cells relative to normal cells. | 05-28-2015 |
20150148402 | MODIFIED SMALL INTERFERING RNA MOLECULES AND METHODS OF USE - The present invention provides double-stranded RNA molecules that mediate RNA interference in target cells, preferably hepatic cells. The invention also provides double-stranded RNA (dsRNA) molecules that are modified to be resistant to nuclease degradation, which inactivates a virus, and more specifically, hepatitis C virus (HCV). The invention also provides a method of using these modified RNA molecules to inactivate virus in mammalian cells and a method of making modified small interfering RNAs (siRNAs) using human Dicer. The invention provides modified RNA molecules that are modified to include a dsRNA or siRNA wherein one or more of the pyrimidines in the RNA molecule are modified to include 2′-Fluorine. The invention also provides dsRNA or siRNA in which all pyrimidines are modified to include a 2′-Fluorine. The invention provides that the 2′-Fluorine dsRNA or siRNA molecule is further modified to include a two base deoxynucleotide “TT” sequence at the 3′ end of the molecule. | 05-28-2015 |
20150148403 | USP37 INACTIVATION AS A TREATMENT FOR PLZF/RARA-ASSOCIATED ACUTE PROMYELOCYTIC LEUKEMIA - Method of regulating the stability and/or the level of the fusion protein PLZF/RARA are disclosed. Also disclosed are methods for identifying an agent as a regulator of the stability and/or the level of the fusion protein PLZF/RARA. Methods for identifying a therapeutic agent for treating PLZF/RARA-associated acute promyelocytic leukemia (APL) is also disclosed. | 05-28-2015 |
20150148404 | RNA Modulating Oligonucleotides with Improved Characteristics for the Treatment of Neuromuscular Disorders - The current invention provides an improved oligonucleotide and its use for treating, ameliorating, preventing, delaying and/or treating a human cis-element repeat instability associated genetic neuromuscular or neurodegenerative disorder. | 05-28-2015 |
20150290238 | SUGAR CHAIN-RELATED GENE AND USE THEREOF - As a result of dedicated studies, the present inventors succeeded in discovering, for the first time, that fibrogenesis could be suppressed at the physiological tissue level by inhibiting sulfation at position 4 or 6 of GalNAc, which is a sugar that constitutes sugar chains. Furthermore, the present inventors conducted studies using various disease model animals, and as a result, successfully demonstrated that inhibitors of sulfation at position 4 or 6 of GalNAc had therapeutic effects on diseases caused by tissue fibrogenesis (tissue fibrogenic disorders). | 10-15-2015 |
20150290343 | EXOSOME TRANSFER OF NUCLEIC ACIDS TO CELLS - Methods for introducing nucleic acids to cells via exosomes for use in gene modulation and therapy, such as for gene silencing and to introduce genetic material into cells to compensate for abnormal genes or to induce or repress a process in the recipient cell. | 10-15-2015 |
20150291954 | ORGANIC COMPOSITIONS TO TREAT BETA-CATENIN-RELATED DISEASES - The present disclosure relates to RNAi agents useful in methods of treating Beta-Catenin-related diseases such as adenomatous polyposis of the colon, colorectal cancer, basal cell carcinoma, breast cancer, kidney cancer, Wilms tumors, medulloblastoma, ovarian cancer, adrenocortical tumors, gastric cancer, liver cancer, melanoma, pancreatic cancers, prostate cancer, renal cancer, ectopic teeth and taste papillae, skin cancer, pilomatrixoma, anaplastic thyroid carcinoma, and uterine carcinosarcoma, oligodontia, osteoporosis, ageing, degenerative diseases, bedsores, chronic wounds and impaired wound healing, and similar and related diseases, using a therapeutically effective amount of a RNAi agent to Beta-Catenin. | 10-15-2015 |
20150291955 | ANTISENSE COMPOUNDS TARGETING GENES ASSOCIATED WITH FIBRONECTIN - Provided are compounds comprising oligonucleotides complementary to a fibronectin transcript. Certain such compounds are useful for hybridizing to a fibronectin transcript, including but not limited to a fibronectin transcript in a cell. Such hybridization results in modulation of splicing of the fibronectin transcript. Such compounds are used to treat one or more symptoms associated with fibrosis. Such compounds are used to treat one or more symptoms associated with renal fibrosis. | 10-15-2015 |
20150291957 | METHODS AND COMPOSITIONS TO PRODUCE ss-RNAi ACTIVITY WITH ENHANCED POTENCY - Compositions and methods for down modulating expression of target nucleic acids are disclosed. This invention relates to the fields of medicine, drug development and modulation of target nucleic acid expression. More specifically, the invention provides compositions and methods of use thereof that facilitate the modulation of target nucleic acid expression using novel oligonucleotide based drugs that act through an inhibitory RNA (RNAi) mechanism of action. | 10-15-2015 |
20150291958 | ANTI APOB ANTISENSE CONJUGATE COMPOUNDS - The present invention relates to conjugates of LNA antisense oligonucleotides (oligomers) that target ApoB. | 10-15-2015 |
20150291959 | Diagnosis and Treatment of Endometriosis - The invention discloses a diagnosis of endometriosis, by determining a level of miR-199a-5p as a biomarker to diagnose endometriosis. The invention also discloses a treatment of endometriosis. | 10-15-2015 |
20150291960 | MODULATION OF CD40 EXPRESSION - Disclosed herein are antisense compounds and methods for decreasing CD40. Examples of disease conditions that can be ameliorated with the administration of antisense compounds targeted to CD40 include hyperproliferative disorders, graft versus host disease (GVHD), graft rejection, asthma, airway hyperresponsiveness, chronic obstructive pulmonary disease (COPD), multiple sclerosis (MS), systemic lupus erythematosus (SLE), and certain forms of arthritis. | 10-15-2015 |
20150291962 | EXTRACTION, PREPARATION, AND APPLICATION OF PLANT MICRO-RIBONUCLEIC ACID - An isolated plant-functional microRNA or an extract containing said plant-functional microRNA, a preparation method therefor, and an application thereof are provided. The plant-functional microRNA originates from the endogenous microRNA of a plant, is present in a water-soluble and/or fat-soluble extract of said plant, and is capable of regulating non-plant target-genes. | 10-15-2015 |
20150293124 | METHOD TO DETERMINE TREATMENT OF ACUTE HEART FAILURE - A method is described for treating a subject having acute heart failure (AHF) by measuring PERLECAN levels in the subject. The PERLECAN level in the subject is used to determine risk of mortality within one year for the subject. Treatment is selected on the basis of the outcome of the assay. | 10-15-2015 |
20150297597 | METHODS OF TREATMENT OF SKIN ULCERS - Methods for treating and/or preventing skin ulcers are provided featuring administration of pharmaceutical compositions comprising inhibitors of activity or expression of Lp-PLA | 10-22-2015 |
20150297626 | Combination for use in treating diseases or conditions associated with melanoma, or treating diseases or conditions associated with activated B-raf pathway - The invention relates to the therapeutic use of a combination in a disease and condition associated with melanoma or a disease or a condition associated with activated BRAF pathway. | 10-22-2015 |
20150297628 | METHODS FOR THE TREATMENT AND DIAGNOSIS OF ATHEROSCLEROSIS - The present invention relates to the treatment and the diagnosis of atherosclerosis, in particular to a miRNA for use in the treatment and the diagnosis of atherosclerosis. | 10-22-2015 |
20150297629 | MODULATION OF RENIN-ANGIOTENSIN SYSTEM (RAS) RELATED DISEASES BY ANGIOTENSINOGEN - Disclosed herein are antisense compounds and methods for modulating AGT and modulating a RAS pathway related disease, disorder or condition in an individual in need thereof. RAS related diseases in an individual such as hypertension or organ damage can be treated, ameliorated or prevented with the administration of antisense compounds targeted to AGT. | 10-22-2015 |
20150299692 | IN VITRO PRODUCTION OF DNA MINICIRCLES COMPRISING LESS THAN 250 BASE PAIRS - A method for the in vitro production of DNA minicircles includes steps of: a) providing nicked double-stranded oligodeoxynucleotides bunt-ended substrates having at least one phosphorylated 5′ end, b) performing a ligase-mediated circularization on a reaction mixture including the nicked double-stranded oligodeoxynucleotides substrates and a DNA bending protein, and c) obtaining DNA minicircles. | 10-22-2015 |
20150299695 | MULTIMERIC OLIGONUCLEOTIDES COMPOUNDS - The disclosure provides multimeric oligonucleotide compounds, comprising two or more target-specific oligonucleotides (e.g., antisense oligonucleotides (ASOs)), each being resistant to cleavage, and linked together by a cleavable linker. In particular, two or more linked target-specific oligonucleotides, each to a different target, allows concomitant inhibition of multiple genes' expression levels, while exhibiting favorable pharmacokinetic and pharmacodynamic properties. Methods of making and uses of the described compounds are also provided. | 10-22-2015 |
20150299696 | SHORT INTERFERING NUCLEIC ACID (siNA) COMPOSITIONS - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of gene expression and/or activity, and/or modulate a gene expression pathway. Specifically, the invention relates to double-stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA) molecules that are capable of mediating or that mediate RNA interference (RNAi) against target gene expression. | 10-22-2015 |
20150299697 | COMPOSITIONS AND METHODS FOR INHIBITING HYPOXIA INDUCED DAMAGE - Provided are compositions and methods for inhibiting hypoxia-induced damage. The compositions and methods involve the use of one or more agents that can inhibit one or any combination of the genes BCL2L14, BLOC1S2, C20RF42, CPT1A, FBP1, GCNT3, RHOB, SCIN, TACR1 and TNFAIP6. Polynucleotide and non-polynucleotide agents which can be used for inhibiting one or more of the genes are included. The method involves introducing one or more gene inhibiting agents to a cell, tissue, organ, or individual such that formation of hypoxia related damage is inhibited. Kits which contain the agents and printed information about using them for inhibiting hypoxia induced damage are also included. | 10-22-2015 |
20150299699 | MICROMIRs - The present invention relates to very short heavily modified oligonucleotides which target and inhibit microRNAs in vivo, and their use in medicaments and pharmaceutical compositions. | 10-22-2015 |
20150299701 | TREATMENT OF REPROGRAMMING FACTOR RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO A REPROGRAMMING FACTOR - The personal invention relates to antisense oligonucleotides that modulate the expression of and/or function of a Reprogramming factor, in particular, by targeting natural antisense polynucleotides of a Reprogramming factor. The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of Reprogramming factors. | 10-22-2015 |
20150299702 | CIRCULAR RNA FOR INHIBITION OF MICRORNA - The present invention relates to inhibition of microRNAs (miRNA), other types of RNA and RNA-binding proteins. In particular the present invention relates to nucleic acid sequences that are circular and allow inhibition of the interactions between microRNAs and their RNA target and being resistant to degradation by exonucleases. Also, the present invention relates to nucleic acid sequence that are circular and acts as an RNA blocker or protein decoy. | 10-22-2015 |
20150299703 | IN VIVO GENE SILENCING BY CHEMICALLY MODIFIED AND STABLE siRNA - The present invention provides compositions for RNA interference and methods of use thereof. In particular, the invention provides small interfering RNAs (siRNAs) having modification that enhance the stability of the siRNA without a concomitant loss in the ability of the siRNA to participate in RNA interference (RNAi). The invention also provides siRNAs having modification that increase targeting efficiency. Modifications include chemical crosslinking between the two complementary strands of an siRNA and chemical modification of a 3′ terminus of a strand of an siRNA. Preferred modifications are internal modifications, for example, sugar modification, nucleobase modification and/or backbone modifications. Such modifications are also useful, e.g., to improve uptake of the siRNA by a cell. Functional and genomic and proteomic methods are featured. Therapeutic methods are also featured. | 10-22-2015 |
20150299704 | METHODS FOR TREATMENT OF ALPORT SYNDROME - Provided herein are methods for the treatment of Alport Syndrome, using modified oligonucleotides targeted to miR-21. In certain embodiments, a modified oligonucleotide targeted to miR-21 improves kidney function and/or reduces fibrosis in subjects having Alport Syndrome. In certain embodiments, administration of a modified oligonucleotide targeted to miR-21 delays the onset of end-stage renal disease in a subject having Alport Syndrome. In certain embodiments, a modified oligonucleotide targeted to miR-21 delays the need for dialysis or kidney transplant in a subject having Alport Syndrome. | 10-22-2015 |
20150299705 | METHODS AND COMPOSITIONS INVOLVING MIRNA AND MIRNA INHIBITOR MOLECULES - The present invention concerns methods and compositions for introducing miRNA activity or function into cells using synthetic nucleic acid molecules. Moreover, the present invention concerns methods and compositions for identifying miRNAs with specific cellular functions that are relevant to therapeutic, diagnostic, and prognostic applications wherein synthetic miRNAs and/or miRNA inhibitors are used in library screening assays. | 10-22-2015 |
20150299706 | THERAPEUTIC APPLICATIONS OF P53 ISOFORMS IN REGENERATIVE MEDICINE, AGING AND CANCER - The present invention provides methods and compositions for modulating cell senescence and cell proliferation using isoforms of the p53 tumor suppressor protein. The methods and compositions of the invention find use in inhibiting cancer cell growth or in generating populations of cells for tissue regeneration through the modulation of cell senescence and proliferation. | 10-22-2015 |
20150299711 | COMPOSITION FOR TREATING CANCER ASSOCIATED WITH HPV INFECTION - The present invention relates to a composition for preventing or treating diseases associated with human papillomavirus (HPV), and more specifically, cancer associated with HPV, and even more specifically, cervical cancer. The nucleotide sequence of the present invention, the sequence in which the base thereof is modified, and a specific combination thereof can be useful in a composition for effectively treating diseases associated with HPV infection by greatly inhibiting the expression of the E6/E7 gene of HPV type 16 or 18. | 10-22-2015 |
20150299712 | Modulation of Hematopoietic Stem Cell Differentiation - The invention provides means of manipulating hematopoietic stem cell differentiation by modulation of levels of NR2F6 (EAR2). Provided are compositions of matter, protocols and methods of use by which inhibiting expression of NR2F6 or activity thereof promotes differentiation of selective hematopoietic lineages, or conversely overexpression of NR2F6 or activity thereof inhibits differentiation. In one embodiment inhibition of differentiation is performed in other cell lineages besides hematopoietic. | 10-22-2015 |
20150299789 | COMPETITIVE MODULATION OF MICRORNAS - The present invention provides compounds and methods for competitive modulation of microRNAs. Such compounds and methods have profound effects on cells. MicroRNAs (microRNAs), are small (approximately 18-24 nucleotides in length), non-coding RNA molecules encoded in the genomes of plants and animals. In certain instances, microRNAs regulate the expression of genes by binding to the 3′-untranslated regions (3′-UTR) of specific mRNAs. More than 1000 different microRNAs have been identified in plants and animals. | 10-22-2015 |
20150305341 | COMPOSITIONS AND METHODS TO CONTROL INSECT PESTS - Methods and compositions are provided which employ a silencing element that, when ingested by a pest, such as a Coleopteran plant pest or a Diabrotica plant pest, decrease the expression of a target sequence in the pest. In specific embodiments, the decrease in expression of the target sequence controls the pest and thereby the methods and compositions are capable of limiting damage to a plant. The present invention provides various target polynucleotides set forth in any one of SEQ ID NOS: 1-236 or active variants and fragments thereof, wherein a decrease in expression of one or more the sequences in the target pest controls the pest (i.e., has insecticidal activity). Further provided are silencing elements which when ingested by the pest decrease the level of the target polypeptide and thereby control the pest. In specific embodiment, the pest is | 10-29-2015 |
20150306066 | TREATMENT OF HUMAN CYTOMEGALOVIRUS BY MODULATING WNT - The present invention relates to the field of virology. More specifically, the present invention provides methods and compositions useful for treating human cytomegalovirus using Wnt pathway modulators. In a specific embodiment, a method for treating human cytomegalovirus (HCMV) in a patient in need thereof comprises administering an effective amount of Wnt pathway modulator. | 10-29-2015 |
20150306127 | MIRNAS AS NOVEL THERAPEUTIC ADJUVANTS AND BIOMARKERS FOR THE PROGNOSIS AND TREATMENT OF DRUG RESISTANT BREAST CANCERS - Disclosed are methods and compositions for using microRNA (miRNA) for treating cancer. The methods and compositions include hsa-miR-204 and homologs of hsa-miR-204. | 10-29-2015 |
20150307877 | COMPOSITIONS AND THEIR USES DIRECTED TO HUNTINGTIN - Disclosed herein are compounds, compositions and methods for modulating the expression of huntingtin in a cell, tissue or animal. Further provided are methods of slowing or preventing Huntington's Disease (HD) progression using an antisense compound targeted to huntingtin. Additionally provided are methods of delaying or preventing the onset of Huntington's Disease (HD) in an individual susceptible to Huntington's Disease (HD). Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and disorders. | 10-29-2015 |
20150307882 | RNAI-MEDIATRED INHIBITION OF FRIZZLED RELATED PROTEIN-1 FOR TREATMENT OF GLAUCOMA - RNA interference is provided for inhibition of Frizzled Related Protein-1 mRNA expression, in particular, for treating patients having glaucoma or at risk of developing glaucoma. | 10-29-2015 |
20150307885 | MULTIPLE TARGETED RNAI FOR THE TREATMENT OF CANCERS - The present invention includes compositions and methods for making and using a RNAi capable of reducing expression of two or more genes, comprising: a first RNAi molecule that reduces the expression of a first target gene; a second RNAi molecule that reduces the expression of the first or a second target gene; and optionally a third RNAi molecule that reduces the expression of the first, the second, or a third target gene, wherein the RNAi molecules reduce the expression level of, e.g., mutated KRAS, SRC-3, EGFR, PIK3, NCOA3, or ERalpha1, and can be, e.g., miRNAs, shRNAs, or bifunctional shRNAs. | 10-29-2015 |
20150307886 | COMPOSITIONS AND METHODS FOR MODULATION OF FGFR3 EXPRESSION - Disclosed are oligonucleotides which target and hybridize to nucleic acid molecules encoding FGFR3, leading to reduced expression of FGFR3. Reduction in the aberrant expression of FGFR3 is beneficial for the treatment of certain medical disorders, such as achondroplasia. | 10-29-2015 |
20150309031 | COMPOSITIONS AND METHODS FOR PROGNOSIS AND TREATMENT OF CANCER - A method of diagnosing and/or treating a patient diagnosed with breast cancer includes the steps of: (a) identifying a patient as having a triple negative breast cancer; (b) obtaining a sample from the triple negative breast cancer patient comprising breast cancer cells; and (c) determining whether the cells in the sample express an elevated level of nuclear HSET, wherein an elevated level indicates a poorer prognosis. The method may further include the step of determining whether the cells in the sample express elevated level(s) of one or more products upregulated with HSET, elevated levels of phosphorylated histone-H3 and/or exhibit enhanced Cdk1 activity. In certain embodiments, the method further includes the step of administering one or more therapeutic agents, such as HSET inhibitors, centrosome declustering agents, PARP inhibitors, Ras/MAPK pathway inhibitors, PI3K/AKT/mTOR pathway inhibitors or a combination thereof. | 10-29-2015 |
20150309037 | TREATMENT-INDUCED DAMAGE TO THE TUMOR MICRO-ENVIRONMENT PROMOTES CANCER THERAPY RESISTANCE THROUGH EXTRACELLULAR PROTEINS - The present disclosure provides methods for determining the effectiveness of a cancer therapy, as well as methods for increasing the effectiveness of that therapy and determining a prognosis for a patient receiving that therapy. | 10-29-2015 |
20150313878 | METHODS FOR DIAGNOSING AND TREATING PROSTATE CANCER - The invention is directed to a method of inhibiting prostate cancer cell proliferation using a substance that inhibits the activity of a soluble adenylyl cyclase (sAC) protein. The invention also is directed to methods of diagnosing and prognosticating prostate cancer in a subject by evaluating sAC gene or protein expression in the subject. | 11-05-2015 |
20150313893 | Nutlin-3A For Treatment of Proliferative Vitreoretinopathy - The invention provides compositions and methods for treatment of proliferative vitreoretinopathy. | 11-05-2015 |
20150313932 | COMPOSITION AND METHOD FOR TREATING A HEMATOLOGICAL MALIGNANCY - Provided are compositions and methods for treating hematological malignancies, such as multiple myeloma, in a subject by increasing levels or activity of miR-30 RNA in plasma cells of the subject. | 11-05-2015 |
20150315573 | METHODS OF TREATING DIABETES AND/OR PROMOTING SURVIVAL OF PANCREATIC ISLETS AFTER TRANSPLANTATION - Disclosed herein are methods for treating/and or preventing diabetes using a specific inhibitor of SMAD7 expression or function. Also disclosed are methods of promoting organ and/or cell, e.g., pancreatic islet cell, survival after transplantation using a specific inhibitor of SMAD7 expression or function. | 11-05-2015 |
20150315577 | A METHOD FOR INHIBITING CALCIFICATION OF A MACROPHAGE-DERIVED MATRIX VESICLE - The invention relates to methods for decreasing, inhibiting, preventing, or reducing matrix vesicle induced calcification by inhibiting the amount or formation of a complex comprising phosphatidylserine (PS), annexin II, annexin V or VI, and S100A9 or S100A12 in a macrophage. | 11-05-2015 |
20150315578 | IDENTIFICATION OF NOVEL GENES CODING FOR SMALL TEMPORAL RNAS | 11-05-2015 |
20150315580 | COMPOUNDS AND METHODS FOR IMPROVING CELLULAR UPTAKE OF OLIGOMERIC COMPOUNDS - The present invention provides method of optimizing the efficacy and potency of antisense drugs. In certain embodiments, the invention provides assays useful for determining favorable oligonucleotide characteristics and excipeints for improved cellular uptake. | 11-05-2015 |
20150315581 | SIGNAL ACTIVATABLE CONSTRUCTS AND RELATED COMPONENTS COMPOSITIONS METHODS AND SYSTEMS - Provided herein are signal activatable molecular constructs for delivery of molecules and related components, compositions, methods, and systems, having a 17 to 30 by targeting domain duplex RNA, at least one protection strand having a protection segment and linker segment and a sensor strand having a displacement segment and a toehold segment, in which in an inactive conformation the protection segment and the displacement segment form a sensor domain duplex polynucleotide covalently attached to the targeting domain and presenting the toehold segment for binding to a signal molecule. In an active conformation the sensor strand is bound to the signal molecule and is detached from the at least one protection strand and from the targeting domain; and the targeting domain attaches the at least one protection strand in a configuration allowing processing by Dicer and/or an Argonaute enzyme. | 11-05-2015 |
20150315582 | DEEP INTRONIC TARGET FOR SPLICING CORRECTION ON SPINAL MUSCULAR ATROPHY GENE - The present invention is directed to methods and compositions for blocking the effect of the intronic inhibitory splicing region of intron 7 of the SMN2 gene. The compositions and methods of the instant invention include short oligonucleotide reagents (e.g., oligoribonucleotides) that effectively target sites in the SMN2 pre-mRNA, thereby modulating the splicing of SMN2 pre-mRNA to include exon 7 in the processed transcript. The target regions include a unique RNA structure and a 6-nucleotide long sequence that is essential for initiating a long distance steric inhibitory interaction. The identified region provides a novel target deep within SMN2 intron 7. Intronic targets are highly desirable as annealing of an ASO to an intron does not interfere with translation and transport of mRNA. The invention also provides opportunity to employ a short antisense oligonucleotide or a small compound against the unique RNA structure responsible of SMN2 exon 7 skipping in SMA. | 11-05-2015 |
20150315584 | COMPOSITIONS AND METHODS FOR SILENCING APOLIPOPROTEIN C-III EXPRESSION - The present invention provides compositions comprising therapeutic nucleic acids such as interfering RNA that target apolipoprotein C-III (APOC3) gene expression, lipid particles comprising one or more (e.g., a cocktail) of the therapeutic nucleic acids, methods of making the lipid particles, and methods of delivering and/or administering the lipid particles (e.g., for the treatment of lipid diseases or disorders such as atherosclerosis or a dyslipidemia such as hypertriglyceridemia or hypercholesterolemia). | 11-05-2015 |
20150315589 | METHODS OF INHIBITING CANCER STEM CELLS WITH HMGA1 INHIBITORS - The presently disclosed subject matter relates to methods of inhibiting cancer stem cells and growth of aggressive and/or poorly differentiated metastatic tumors comprising the cancer stem cells with HMGA1 inhibitors. The presently disclosed subject matter also provides methods of selecting and treating a subject with aggressive and/or poorly differentiated metastatic cancer using HMGA1 inhibitors. | 11-05-2015 |
20150315595 | Compositions and Methods for Modulation of ATXN3 Expression - Disclosed are oligonucleotides which target and hybridize to nucleic acid molecules encoding A TXNJ, leading to reduced expression of ATXN3. Reduction in the expression of aberrant ATXN3 is beneficial for the treatment of certain medical disorders, such as spinocerebellar ataxia 3. In particular embodiments, modulating the expression of an aberrant A TXN3 allele or transcript, for example, restores normal function of, for example, Purkinje cells or spinal cord neurons. The oligonucleotides of the present invention and the methods of using such oligonucleotides to modulate the expression of aberrant or expanded A TXN3 provide a means of improving the survival and morbidity associated with, or even curing, expression of an aberrant A TXN3 allele or transcript such as, for example, spinocerebellar ataxia-type 3 (SCA3). | 11-05-2015 |
20150315596 | ANTISENSE MODULATION OF PTP1B EXPRESSION - Provided herein are methods, compounds, and compositions for reducing expression of PTP1B mRNA and protein in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate metabolic disease, for example, diabetes, or a symptom thereof. | 11-05-2015 |
20150315598 | IMPAIRED WOUND HEALING COMPOSITIONS AND TREATMENTS - Connexin modulation for the treatment of wounds that do not heal at expected rates, including delayed healing wounds, incompletely healing wounds, and chronic wounds, and associated methods, compositions and articles. | 11-05-2015 |
20150320697 | Methods For Bone Treatment By Modulating An Arachidonic Acid Metabolic or Signaling Pathway - Methods for promoting osteogenesis to accelerate or enhance bone fracture healing, treat bone defects, and enhance bone formation are disclosed. The methods modulate an arachidonic acid metabolic or signaling pathway in general, and, in particular, utilize 5-lipoxygenase inhibitors. These molecules can be delivered alone or in combination with one or more agents that inhibit bone resorption, regulate calcium resorption from bone, enhance bone accumulation, enhance bone formation, induce bone formation, impair growth of microorganisms, reduce inflammation, and/or reduce pain. | 11-12-2015 |
20150320786 | COMPOUNDS SUITED AS NANOCARRIERS FOR ACTIVE AGENTS AND THEIR USE - The invention relates to a compound suited as entity carrier, having the general formula (I) | 11-12-2015 |
20150322427 | Cancer Treatment and Immune System Regulation Through FAT10 Pathway Inhibition - Described herein are methods of inhibiting mitosis, treating cancer and/or treating immune disorders through the use of agents that inhibit FAT 10 and/or the FAT 10 pathway. | 11-12-2015 |
20150322429 | SNPs OF APOLIPOPROTEIN B AND MODULATION OF THEIR EXPRESSION - Compounds, compositions and methods are provided for modulating the expression of apolipoprotein B. The compositions comprise oligonucleotides, targeted to nucleic acid encoding apolipoprotein B. Methods of using these compounds for modulation of apolipoprotein B expression and for diagnosis and treatment of diseases and conditions associated with expression of apolipoprotein B are provided. | 11-12-2015 |
20150322431 | Methods and Compositions of Improved Modified siRNA - Chemically modified small interfering RNAs (siRNAs) that include both phosphorodithioate modifications (PS2-RNA) and 2′-O-methyl modifications (MePS2) provide improved RNA silencing. Specific chemically modified siRNA that show enhanced silencing of RNAs involved in resistance to chemotherapeutic agents are provided. | 11-12-2015 |
20150322432 | COMPOSITIONS AND METHODS FOR FUNCTIONAL NUCLEIC ACID DELIVERY - Provided are derivatized therapeutic, prophylactic, or diagnostic agents, such as nucleic acids, that can be effectively delivered to cells and tissues. Also provided are methods of affecting a biological process by administering a therapeutic, prophylactic, or diagnostic agent, such as functional nucleic acid, to a cell or a subject, where the therapeutic, prophylactic, or diagnostic agent, such as functional nucleic acid, is derivatized therapeutic, prophylactic, or diagnostic agent, such as nucleic acid. | 11-12-2015 |
20150322433 | POST-SYNTHETIC ORTHOGANAL AMIDATION PLUS METAL CATALYZED AZIDE-ALKYNE CYCLOADDITION CLICK CHEMISTRY ON siRNA - This invention relates to the post-synthetic chemical modifications of RNA at the 2′-position on the ribose rings via orthogonal chemistry involving amidation reactions plus metal catalyzed alkyne-azide cycloaddition (click) reactions. | 11-12-2015 |
20150322434 | INDUCTION OF EXON SKIPPING IN EUKARYOTIC CELLS - The present invention provides a method for at least in part decreasing the production of an aberrant protein in a cell, the cell comprising pre-mRNA comprising exons coding for the protein, by inducing so-call exon skipping in the cell. Exon-skipping results in mature mRNA that does not contain the skipped exon, which leads to an altered product of the exon codes for amino acids. Exon skipping is performed by providing a cell with an agent capable of specifically inhibiting an exon inclusion signal, for instance, an exon recognition sequence, of the exon. The exon inclusion signal can be interfered with by a nucleic acid comprising complementarity to a part of the exon. The nucleic acid, which is also herewith provided, can be used for the preparation of a medicament, for instance, for the treatment of an inherited disease. | 11-12-2015 |
20150322436 | OLIGOMERIC COMPOUNDS AND COMPOSITIONS FOR THE USE IN MODULATION OF MICRORNAS - Compounds, compositions and methods are provided for modulating the levels expression, processing and function of miRNAs. The compositions comprise oligomeric compounds targeted to small non-coding RNAs and miRNAs. The oligomeric compounds possess potent miRNA inhibitory activity, and further exhibit improved therapeutic index. Further provided are methods for selectively modulating miRNA activating in a cell. | 11-12-2015 |
20150322438 | Modified Oligonucleotides for Telomerase Inhibition - Compounds comprising an oligonucleotide moiety covalently linked to a lipid moiety are disclosed. The oligonucleotide moiety comprises a sequence that is complementary to the RNA component of human telomerase. The compounds inhibit telomerase activity in cells with a high potency and have superior cellular uptake characteristics. | 11-12-2015 |
20150323538 | SYSTEMS AND METHODS FOR DIAGNOSING AND TREATING CANCER - Embodiments of the invention provide a method detecting and treating cancer, such as lung cancer. In some aspects, the method may include detecting cancer in a subject, which may comprise assessing the expression of a marker in a sample from the subject. For example, the marker may comprise c-Met and/or Fn14. In some embodiments, if the subject is diagnosed as having cancer, the method may further provide administering a therapeutically effective amount of a substance that reduces the expression level of Fn14 to the subject to reduce the invasive and migratory capabilities of the cancer. | 11-12-2015 |
20150328197 | METHOD AND PHARMACEUTICAL COMPOSITION FOR INHIBITING PI3K/AKT/MTOR SIGNALING PATHWAY - The present invention relates to a pharmaceutical composition of PRCP antagonist, PREP antagonist, or PRCP-PREP dual antagonist. The present invention also relates to a pharmaceutical composition jointly using PRCP antagonist and mTOR antagonist, or jointly using PREP antagonist and mTOR antagonist, or jointly using PRCP-PREP dual antagonist and mTOR antagonist. In addition, the present invention also relates to a method for utilizing the pharmaceutical compositions to treat and prevent cancers and diseases related to insulin receptor substrate protein and PI3K/AKT/mTOR signal pathway. | 11-19-2015 |
20150328248 | APOPTOSIS-INDUCING AGENT - The purpose of the present invention is to provide a composition for effectively inducing apoptosis and/or proliferation inhibition in a cell, and a method using the same. An agent for inducing apoptosis that comprises as active ingredients a drug inhibiting GST-π and a drug inhibiting Akt; a medicinal composition comprising the same; a method for treating a disease caused by abnormality in apoptosis using the same, etc. | 11-19-2015 |
20150329857 | RNA INTERFERENCE TO ACTIVATE STEM CELLS - The present invention relates to the use of interferent RNAs that silence PW1 expression in order to activate adult stem cells in vitro or in vivo, in particular in the context of regenerative medicine. | 11-19-2015 |
20150329858 | LONG NON-CODING RNA USED FOR ANTICANCER THERAPY - The present invention provides a novel long non-coding RNA (lncRNA), which is induced by β-catenin and highly expressed in cancer, a nucleic acid that suppresses expression of the lncRNA, a means for promoting or suppressing cell growth by using the lncRNA or the nucleic acid, and the like. | 11-19-2015 |
20150329859 | SELECTIVE REDUCTION OF ALLELIC VARIANTS - Disclosed herein are antisense compounds and methods for selectively reducing expression of an allelic variant of a gene containing a single nucleotide polymorphism (SNP). Such methods, compounds, and composition are useful to treat, prevent, or ameliorate diseases, including neurodegenerative diseases, such as Huntington's Disease (HD). | 11-19-2015 |
20150329861 | MIRNA MODULATORS OF THERMOGENESIS - Provided are novel methods and compositions for the modulation of thermogenesis. Such methods are particularly advantageous in that they allow for the reduction of body fat in a subject without the subject having to adjust their caloric intake through dieting, modify their physical activity or undergo bariatric surgery. Accordingly, the methods of the invention are particularly useful for treating or preventing obesity. Also provided are methods of screening for novel agents that modulate the activity of thermogenic regulators. | 11-19-2015 |
20150329862 | Gene Silencing by Single-Stranded Polynucleotides - The present invention relates to compositions and methods for concurrently activating antisense and double-stranded RNase (dsRNase) mechanisms for inhibiting expression of a targeted gene, by delivering a single stranded bifunctional chimeric DNA/RNA oligonucleotide optimized for siRNA activity as well as antisense activity, into the nucleus of a target cell. | 11-19-2015 |
20150329863 | APTAMERS INHIBITING THE ENZYMATIC ACTIVITY OF TYROSINASE - The invention relates to a DNA aptamer that can inhibit the enzymatic activity of tyrosinase for the conversion of tyrosine into L-DOPA and dopaquinone, and to the dermatological and cosmetic uses thereof. | 11-19-2015 |
20150329864 | DESIGN OF OLIGONUCLEOTIDE ANALOGS AS THERAPEUTIC AGENTS - The invention relates to design of short oligonucleotides and analogs thereof (such as, di-, and trinucleotide compounds) useful for various therapeutic applications. It is believed that the compounds of the invention can be used as antiviral agents, anticancer agents and so on. In certain embodiments, the compounds of the invention can modulate immune-stimulatory pathways and non-TLR pathways. The invention also relates to design modified oligonucleotides for therapeutic applications, by excluding nucleotide segments having off-target effects from the modified oligonucleotides. In another aspect, the invention provides pharmaceutical compositions including one or more compounds of the invention. | 11-19-2015 |
20150329865 | COMPOSITION FOR TREATING EPSTEIN-BARR VIRUS INFECTION, COMPRISING EPSTEIN-BARR VIRUS MICRO RNA INHIBITOR - Provided is a composition comprising an Epstein-Barr virus microRNA inhibitor for treating Epstein-Barr virus infection, and a method using Epstein-Barr virus microRNA for screening a therapeutic agent for treating Epstein-Barr virus infection. The provided composition enables one to induce the lytic cycle of EBV such that EBV-infected cells are destroyed by a host immune system. Therefore, the composition can be effectively used for the prevention or treatment of diseases, including various cancers, caused by EBV infection. Moreover, the provided method enables one to screen a therapeutic agent having excellent antiviral effect for treating Epstein-Barr virus infection by inducing Epstein-Barr virus lytic cycle. | 11-19-2015 |
20150329866 | NOVEL siRNAS AND METHODS OF USE THEREOF - The invention relates to compounds, in particular siRNAs, which inhibit the expression of specific human genes. The invention also relates to pharmaceutical compositions comprising such compounds and a pharmaceutically acceptable carrier. The present invention also provides a method of treating and/or preventing the incidence or severity of various diseases or conditions associated with the genes and/or symptoms associated with such diseases or conditions comprising administering to a subject in need of treatment for such disease or condition and/or symptom the compound or the pharmaceutical composition in a therapeutically effective dose so as to thereby treat the subject. The invention also provides antibodies which inhibit specified human polypeptides and pharmaceutical compositions comprising one or more such antibodies. | 11-19-2015 |
20150329867 | Pharmaceutical Compositions and Diagnostic Methods for Inflammatory Skin Diseases, Disorders or Conditions - The invention relates to the treatment or prevention of an inflammatory skin disease, disorder or condition, by modulating a protein that is normally regulated by caspase-8 in the skin or by increasing caspase-8 activity or level in the skin. Another aspect of the invention relates to methods for diagnosing an inflammatory skin disease, disorder or condition or a predisposition to develop said disease disorder or condition in an individual. Further aspects of the invention relate to methods for identifying target proteins involved in the course or pathology of an inflammatory skin disease, disorder or condition and to methods of screening a candidate compound for treating said disease, disorder or condition. In particular, the invention relates to inflammatory skin diseases such as atopic dermatitis and psoriasis. | 11-19-2015 |
20150329907 | BIOMARKERS AND TREATMENTS FOR HEART FAILURE - The invention features methods to predict the response to a cardiac therapy in a patient suffering from a cardiac disease, e.g., heart failure. The invention features measurement expression of biomarkers that help in this prediction. The invention also features methods for treatment of cardiac diseases. These methods include cardiac resynchronization therapy and miRNA based therapeutics. | 11-19-2015 |
20150335674 | LDH INHIBITORS AS TREATMENT FOR FIBROSIS AND FIBROTIC-RELATED DISORDERS - One aspect of the disclosure relates to methods of treating a fibrotic condition in an individual. The methods include administering to an individual having a fibrotic condition an effective amount of a lactic dehydrogenase (LDH) inhibitor, wherein the fibrotic condition involves an internal organ or tissue, or ocular tissue, and said administering is effective to treat the fibrotic condition. Methods of administration and pharmaceutical compositions and systems for practicing such methods are also disclosed. | 11-26-2015 |
20150337301 | AN ICAM-1 ANTISENSE FOR THE TREATMENT OF INFLAMMATION AND PAIN IN A RECTAL STUMP - This invention relates to a composition comprising an antisense oligonucleotide that down-regulates intracellular adhesion molecule-1(ICAM-1) for use in treating inflammation, pain and/or discharge in a rectal stump. | 11-26-2015 |
20150337302 | BIOLOGICAL CONTROL OF COLEOPTERAN PESTS - Disclosed are double stranded RNA molecules that are toxic to coleopteran insects. In particular, dsRNA molecules that capable of interfering with pest IAP genes and that are toxic to the target pest are provided. Further, methods of making and using the interfering RNA, for example in transgenic plants to confer protection from insect damage are disclosed. | 11-26-2015 |
20150337303 | METHODS AND COMPOSITIONS FOR MODULATING APOLIPOPROTEIN (A) EXPRESSION - Disclosed herein are antisense compounds and methods for decreasing apo(a) to treat, prevent, or ameliorate diseases, disorders or conditions related to apo(a) or Lp(a). Certain diseases, disorders or conditions related to apo(a) or Lp(a) include inflammatory, cardiovascular and/or metabolic diseases, disorders or conditions. The antisense compounds disclosed herein can be used to treat such diseases, disorders or conditions in an individual in need thereof. | 11-26-2015 |
20150337305 | OLIGOMERIC COMPOUNDS AND COMPOSITIONS FOR USE IN MODULATION OF SMALL NON-CODING RNAS - Compounds, compositions and methods are provided for modulating the expression and function of small non-coding RNAs. The compositions comprise oligomeric compounds, targeted to small non-coding RNAs. Methods of using these compounds for modulation of small non-coding RNAs as well as downstream targets of these RNAs and for diagnosis and treatment of disease associated with small non-coding RNAs are also provided. | 11-26-2015 |
20150337306 | METHODS AND COMPOSITIONS FOR THE PRODUCTION OF SIRNAS - The technology described herein relates to siRNAs, e.g., methods and compositions relating to the production of siRNAs in bacterial cells. | 11-26-2015 |
20150337307 | TREATMENT OF ANTIVIRAL GENE RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO AN ANTIVIRAL GENE - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of an Antiviral gene, in particular, by targeting natural antisense polynucleotides of an Antiviral gene. The invention also relates to the identification of these antisense oligonucleotides and their use in treating disease and disorders associated with the expression of Antiviral genes. | 11-26-2015 |
20150337311 | Methods And Compositions For Prevention Or Treatment Of RSV Infection Using Modified Duplex RNA Molecules - Methods and compositions are provided for the prevention or treatment of RSV infection in a human. The methods include administering one or more doses of a composition comprising an siRNA. The dose can be formulated for topical or parenteral administration. Topical administration includes administration as a nasal spray, or by inhalation of respirable particles or droplets. The siRNA preferably comprises a sense strand and antisense strand with modified nucleotides. | 11-26-2015 |
20150337312 | Antisense Oligonucleotides (ODN) Against SMAD7 and Uses Thereof in Medical Field - The invention relates to antisense oligonucleotidic sequences (ODN) against Smad7 suitably modified, and their uses in medical field as therapeutic biological agents, in particular in the treatment of chronic inflammatory bowel disease, such as Crohn's disease and ulcerative colitis. | 11-26-2015 |
20150337314 | Oligonucleotide Compositions and Methods of Making the Same - The present disclosure provides a solid phase method of making oligonucleotides via sequential coupling cycles including at least one coupling of a dinucleotide dimer subunit to a free 3′-terminal group of a growing chain. The oligonucleotides include at least two nucleoside subunits joined by a N3′→P5′ phosphoramidate linkage. The method may include the steps of (a) deprotecting the protected 3′ amino group of a terminal nucleoside attached to a solid phase support, said deprotecting forming a free 3′ amino group; (b) contacting the free 3′ amino group with a 3′-protected amino-dinucleotide-5′-phosphoramidite dimer in the presence of a nucleophilic catalyst to form an internucleoside N3′→P5′ phosphoramidite linkage; and (c) oxidizing (e.g., sulfurizing) the linkage. The compositions produced by the subject methods may include a reduced amount of one or more (N−x) oligonucleotide products. Also provided are pharmaceutical compositions including the subject oligonucleotide compositions. | 11-26-2015 |
20150337316 | PHOSPHORIBOSYL PYROPHOSPHATE SYNTHETASE 2 (PRPS2) AS A THERAPEUTIC TARGET IN CANCER TREATMENT - The present invention provides methods of selectively killing a cell, comprising contacting the cell with an agent that inhibits phospho-ribosyl pyrophophosphate synthetase 2 (PRPS2). The present invention also provides methods of identifying a candidate agent that selectively kills neoplastic cells that are Myc-hyperactivated via inhibition of PRPS2. | 11-26-2015 |
20150337317 | dsRNA For Treating Viral Infection - The invention relates to double-stranded ribonucleic acids (dsRNAs) targeting gene expression of phosphatidylinositol 4-kinase (PI4K), in particular human phosphatidylinositol 4-kinase, catalytic, beta polypeptide (PIK4CB) or human phosphatidylinositol 4-kinase, catalytic, alpha polypeptide (PIK4CA), and their use for treating infection by positive stranded RNA viruses such as hepatitis C virus (HCV). Each dsRNA comprises an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of the PIK4CB or PIK4CA target mRNA. A plurality of such dsRNA may be employed to provide therapeutic benefit. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier, and including a delivery modality such as fully encapsulated liposomes or lipid complexes. The invention further includes methods for treating diseases caused by positive stranded RNA virus infection using the pharmaceutical compositions; and methods for inhibiting the propogation of positive stranded RNA viruses in and between cells. | 11-26-2015 |
20150337318 | RNA TARGETED TO C-MET - A double stranded RNA (dsRNA) molecule targeted to MET includes a duplex region having a sense region and an antisense region at least substantially complementary to the sense region. The sense region and the antisense region each have between 18 and 30 nucleotides. The antisense region includes a nucleotide sequence that is fully complementary to at least 15 contiguous nucleotides of any one of SEQ ID NOs: 1-26. | 11-26-2015 |
20150337382 | FURTHER USE OF PROTEIN KINASE N BETA - The present invention is related to use of protein kinase N beta or a fragment or derivative thereof as a downstream target of the PI 3-kinase pathway, preferably as a downstream drug target of the PI 3-kinase pathway. | 11-26-2015 |
20150342981 | METHODS AND COMPOSITIONS INVOLVING MIRNA AND MIRNA INHIBITOR MOLECULES - The present invention concerns methods and compositions for introducing miRNA activity or function into cells using synthetic nucleic acid molecules. Moreover, the present invention concerns methods and compositions for identifying miRNAs with specific cellular functions that are relevant to therapeutic, diagnostic, and prognostic applications wherein synthetic miRNAs and/or miRNA inhibitors are used in library screening assays. | 12-03-2015 |
20150342982 | Use of Telomerase Inhibitors for the Treatment of Myeloproliferative Disorders and Myeloproliferative Neoplasms - Provided herein are methods for reducing neoplastic progenitor cell proliferation and alleviating symptoms associated in individuals diagnosed with or thought to have myeloproliferative disorders, such as Essential Thrombocythemia (ET). Also provided herein are methods for using telomerase inhibitors for maintaining blood platelet counts at relatively normal ranges in the blood of individuals diagnosed with or suspected of having myeloproliferative disorders, such as ET. | 12-03-2015 |
20150343062 | CATIONIC LIPID - The present invention provides a cationic lipid, which allow nucleic acids to be easily introduced into cells, represented by formula (I)
| 12-03-2015 |
20150344877 | METHODS FOR TREATING VIRAL INFECTIONS - The present invention relates to compounds that modulate ribosomal frameshifting and nucleic acid constructs for use in methods for identifying or validation such compounds. In particular, the present invention relates to the use of nucleic acid constructs to identify or validate compounds capable of modulating the efficiency of programmed ribosomal frameshifting and the use of said compounds to inhibit the replication or infectivity of viruses that employ programmed ribosomal frameshifting. | 12-03-2015 |
20150344878 | Compositions and Methods for Treatment of Mitochondrial Diseases and for Differentiation of Cells to Neurons - Methods and compositions are provided for the treatment of a mitochondrial disease in an individual with the mitochondrial disease. Aspects of the methods include administering an inhibitor of a Pumilio-like protein and/or an inhibitor of a serine/arginine-rich family of pre-mRNA splicing factor (SR) protein to a subject. Also provided are methods, compositions, systems and kits for transdifferentiating target cells to neurons, which find use in producing neurons for the development of new therapies, for experimental evaluation, as a source of lineage- and cell-specific products, and the like, for example, for use in treating human disorders of the CNS. | 12-03-2015 |
20150344880 | COMPOSITIONS AND METHODS RELATED TO MIRNA MODULATION OF NEOVASCULARIZATION OR ANGIOGENESIS - The present invention concerns methods and compositions for diagnosing and/or treating vascular diseases including cancer, cardiac diseases, vascular diseases of the eye, and inflammatory diseases. The methods involve measuring the levels of one or multiple miRNAs in patient samples and using the test results to diagnose and/or predict an optimal treatment regimen for the patient. Compositions described in the invention include nucleic acids that function as miRNAs or miRNA inhibitors that can be introduced to a patient to reduce or increase vascularization as needed. | 12-03-2015 |
20150344881 | METHODS AND COMPOSITIONS INVOLVING MIRNA AND MIRNA INHIBITOR MOLECULES - The present invention concerns methods and compositions for introducing miRNA activity or function into cells using synthetic nucleic acid molecules. Moreover, the present invention concerns methods and compositions for identifying miRNAs with specific cellular functions that are relevant to therapeutic, diagnostic, and prognostic applications wherein synthetic miRNAs and/or miRNA inhibitors are used in library screening assays. | 12-03-2015 |
20150344883 | METHODS AND COMPOSITIONS INVOLVING MIRNA AND MIRNA INHIBITOR MOLECULES - The present invention concerns methods and compositions for introducing miRNA activity or function into cells using synthetic nucleic acid molecules. Moreover, the present invention concerns methods and compositions for identifying miRNAs with specific cellular functions that are relevant to therapeutic, diagnostic, and prognostic applications wherein synthetic miRNAs and/or miRNA inhibitors are used in library screening assays. | 12-03-2015 |
20150344885 | HBV TREATMENT - RNA interference (RNAi) agents and the use of the RNAi agents for treating hepatitis B infection in individuals, as well as pharmaceutical compositions containing the RNAi agents are provided. The RNAi agents, or constructs for expressing them are utilized to inhibit expression of at least one Hepatitis B virus (HBV) gene, wherein each agent comprises an effector sequence complementary to or substantially complementary to a predicted sequence transcribed from a target region. In some embodiments of the present invention, the agents have more than one effector sequence; wherein the multiple effectors may target the same region of an HBV gene, different (possibly overlapping) regions of the same gene and/or different HBV genes. | 12-03-2015 |
20150344889 | Methods and Compositions for Inducing Deregulation of EPHA7 and ERK Phosphorylation in Human Acute Leukemias - Methods for assessing a pathological condition in a subject include measuring one or more markers where a difference is indicative of acute lymphoblastic leukemia (ALL) or a predisposition to ALL, uses and compositions are disclosed. | 12-03-2015 |
20150344890 | Modulation of Insulin Like Growth Factor I Receptor Expression in Cancer - Provided herein are methods, compounds, and compositions for reducing expression of an IGF-IR mRNA and protein in an animal. Also provided herein are methods, compounds, and compositions that inhibit expression of IGF-IR in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate the tumor or cancer, or a symptom thereof. | 12-03-2015 |
20150344963 | DIAGNOSTIC MARKERS FOR TREATING CELL PROLIFERATIVE DISORDERS WITH TELOMERASE INHIBITORS - Provided herein are methods for identifying individuals diagnosed with a cell proliferative disorder that will benefit from treatment with a telomerase inhibitor compound. Also provided herein are methods for treating these individuals with telomerase inhibitor compounds. The methods comprise identifying individuals who will benefit from said treatment based on the average relative length of telomeres in cancer cells from said individuals. | 12-03-2015 |
20150352064 | METHOD OF TREATING DELAYED HEALING OF A WOUND ASSOCIATED WITH DIABETES - The method of treating delayed healing of a wound associated with diabetes includes administering to the wound a composition comprising an anti-senescence compound and a pharmaceutically acceptable carrier. The anti-senescence compound may be 18α-Glycyrrhetinic acid, a Caveolin-1 (Cav-1) inhibitory compound, or a Polymerase I Transcript Release Factor (PTRF-1) inhibitory compound. The anti-senescence compound may be effective in preventing and/or reversing premature cellular senescence. The anti-senescence compound may be effective in promoting healing of a wound, e.g., delayed or incompletely healed wound. The anti-senescence compound may be effective in promoting healing of a delayed healing wound or chronic wound of a diabetic patient, such as a diabetic ulcer or venous ulcer. | 12-10-2015 |
20150352215 | PLANTS AS FUNCTIONAL MICRORNA AND/OR FUNCTIONAL SIRNA CARRIERS, PREPARATION METHODS AND USES THEREOF - The invention relates to plants as functional microRNA and/or functional siRNA vehicles, the preparation methods and uses thereof. In particular, disclosed in the present invention are plants or edible portions or extracts thereof as functional microRNA and/or functional siRNA vehicles and uses thereof. Also disclosed is a method for carrying the functional microRNA and/or functional siRNA, comprising the step of orally administering the plants or edible portions or extracts thereof to a subject in need thereof, wherein the plants or edible portions thereof express and carry the functional microRNA and/or functional siRNA vehicles, and the extracts contain the functional microRNA and/or functional siRNA. | 12-10-2015 |
20150353934 | Lipid Formulated Compositions and Methods for Inhibiting Expression of a Gene from the Ebola Virus - The invention relates to lipid formulated double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a gene from the Ebola virus. | 12-10-2015 |
20150353936 | ANTIGENE OLIGOMERS INHIBIT TRANSCRIPTION - Transcription of a gene in a mammalian cell is methylase-independently inhibited by contacting the cell with a nucleic acid oligomer of 12-28 bases complementary to a partially single-stranded target genomic sequence of the gene. | 12-10-2015 |
20150354007 | SIALYLTRANSFERASE ST3GAL6 AS A MARKER FOR MULTIPLE MYELOMA - The present invention relates to the sialyltransferase ST3GAL6 for use as a biomarker for multiple myeloma, and especially as a marker for myelomas with inferior survival rates. The inventors have shown that glycosylation gene expression is dysregulated in Multiple Myeloma and that overexpression of the sialyltransferase ST3GAL6 is associated with inferior survival rates in patients. | 12-10-2015 |
20150355166 | Modulators of the Interaction of Astrin and Raptor, and Uses Thereof in Cancer Therapy - The present invention relates to modulators of the interaction of astrin and raptor, and their uses in the treatment of mTOR related diseases, such as cancer. | 12-10-2015 |
20150359815 | PAK1 INHIBITION FOR TREATMENT OF ACUTE MYELOID LEUKEMIA AND MYELODYSPLASTIC SYNDROMES - Methods are disclosed for treating acute myeloid leukemia (AML) and myelodysplastic syndromes (MDS) using inhibition of p21 protein (Cdc42/Rac)-activated kinase (PAK1). | 12-17-2015 |
20150361425 | ANTISENSE ANTIBACTERIAL COMPOUNDS AND METHODS - Provided are antisense morpholino oligomers targeted against bacterial virulence factors such as genes that contribute to antibiotic resistance or biofilm formation, or genes associated with fatty acid biosynthesis, and related compositions and methods of using the oligomers and compositions, for instance, in the treatment of an infected mammalian subject. | 12-17-2015 |
20150361426 | ROTATIONALLY SEQUESTERED TRANSLATORS - Provided are nucleic acid translators capable of carrying out logic operations with improved efficiency, maximized output and reduced off-target effects, in particular in a biological system. Methods of using these translators to transduce signal are also provided. | 12-17-2015 |
20150361427 | Compositions and Methods for Inhibiting Gene Expression of Alpha-1 AntiTrypsin - The invention relates to a RNA interference triggers for inhibiting the expression of an AAT gene through the mechanism of RNA interference. The invention also relates to a pharmaceutical composition comprising the AAT RNAi trigger together with an excipient capable of improving delivery of the RNAi trigger to a liver cell in vivo. Delivery of the AAT RNAi trigger to liver cells in vivo provides for inhibition of AAT gene expression and treatment of alpha 1-antitrypsin deficiency and associated diseases. | 12-17-2015 |
20150361428 | EXON SKIPPING COMPOSITIONS FOR TREATING MUSCULAR DYSTROPHY - Antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon 53 skipping are described. | 12-17-2015 |
20150361429 | METHODS AND COMPOSITIONS FOR TARGETING IMMUNOGLOBULINS - The present invention relates to compositions and methods for targeting immunoglobulins and immunoglobulin-producing plasma cells. In particular, the present invention provides nucleic acid based compounds for targeting immunoglobulins for research, screening, and therapeutic applications. | 12-17-2015 |
20150361432 | MODIFIED SMALL INTERFERING RNA MOLECULES AND METHODS OF USE - The present invention provides double-stranded RNA molecules that mediate RNA interference in target cells, preferably hepatic cells. The invention also provides double-stranded RNA (dsRNA) molecules that are modified to be resistant to nuclease degradation, which inactivates a virus, and more specifically, hepatitis C virus (HCV). The invention also provides a method of using these modified RNA molecules to inactivate virus in mammalian cells and a method of making modified small interfering RNAs (siRNAs) using human Dicer. The invention provides modified RNA molecules that are modified to include a dsRNA or siRNA wherein one or more of the pyrimidines in the RNA molecule are modified to include 2′-Fluorine. The invention also provides dsRNA or siRNA in which all pyrimidines are modified to include a 2′-Fluorine. The invention provides that the 2′-Fluorine dsRNA or siRNA molecule is further modified to include a two base deoxynucleotide “TT” sequence at the 3′ end of the molecule. | 12-17-2015 |
20150361433 | INHIBITORS OF MIRNAS 221 AND 222 FOR ANTI-TUMOR ACTIVITY IN MULTIPLE MYELOMA - Inhibitors of miRNAs 221 and 222, and their use as medicaments in the treatment of multiple myeloma. The inhibitors inhibit miRNAs 221 and 222 of the type of LNA-miRNAs and have the formula +C*A*G*+A*+C*A*+A*T*+G*T*+A*+G*C, and formula C*+A*+G*+A*T*+G*T*+A*+G*C wherein letters with symbol “+” indicate the positions of LNA and symbol “*” indicates phosphorothioate bonds. | 12-17-2015 |
20150361434 | NOVEL LOW MOLECULAR WEIGHT CYCLIC AMINE CONTAINING CATIONIC LIPIDS FOR OLIGONUCLEOTIDE DELIVERY - The instant invention provides for novel cationic lipids that can be used in combination with other lipid components such as cholesterol and PEG-lipids to form lipid nanoparticles with oligonucleotides. It is an object of the instant invention to provide a cationic lipid scaffold that demonstrates enhanced efficacy along with lower liver toxicity as a result of lower lipid levels in the liver. The present invention employs low molecular weight cationic lipids comprising at least one short lipid chain to enhance the efficiency and tolerability of in vivo delivery of siRNA. | 12-17-2015 |
20150361450 | VECTOR FOR THERAPY OF MITOCHONDRIAL DISEASE - The present invention relates to mitochondrial RNA vectors with which a nucleic acid of interest may be imported into human mitochondria, in particular to suppress negative effects of mutations in mtDNA by affecting the level of heteroplasmy. | 12-17-2015 |
20150366894 | 2'-METHOXY SUBSTITUTED OLIGOMERIC COMPOUNDS AND COMPOSITIONS FOR USE IN GENE MODULATIONS - Compositions comprising first and second oligomers are provided wherein at least a portion of the first oligomer is capable of hybridizing with at least a portion of the second oligomer, at least a portion of the first oligomer is complementary to and capable of hybridizing to a selected target nucleic acid, and at least one of the first or second oligomers includes a modified sugar and/or backbone modification. In some embodiments the modification is a 2′-OCH | 12-24-2015 |
20150366895 | CANCER THERAPY USING miRNAs - The present invention relates generally to methods and compositions for the treatment of cancers expressing the type 1 insulin-like growth factor receptor (IGF1R) or a constituent of an IGF1R signaling pathway, in particular melanoma, using the microRNA miR-7-5p. Also provided are methods for increasing the sensitivity of such cancers to therapeutic agents. | 12-24-2015 |
20150366897 | STEM CELL MICROPARTICLES AND miRNA - This invention relates to stem cell microparticles and miRNA isolated from these microparticles, their use and production, in particular neural stem cell microparticles and their use in therapy. The stem cell microparticle is typically an exosome or microvesicle and may be derived from a neural stem cell line. The neural stem cell line may be a conditionally-immortalised stem cell line such as CTX0E03 (deposited at the ECACC with Accession No. 04091601). Identified miRNAs include hsa-miR-1246, hsa-miR-4492, hsa-miR-4488 and hsa-miR-4532. | 12-24-2015 |
20150366979 | POSITIVELY CHARGED POLYSACCHARIDES FOR RNA TRANSFECTION - A complex includes RNA and a positively charged modified polysaccharide selected from starch, amylose, amylopectin, galactan, chitosan, or dextrin. The complex can be formed into a pharmaceutical composition. The complex can be used in methods for RNA transfection, gene therapy and treatment of a disease, disorder or condition. The positively charged modified polysaccharide can be used in connection with RNA transfection into cells. | 12-24-2015 |
20150368642 | LNA OLIGONUCLEOTIDE CARBOHYDRATE CONJUGATES - The invention provides LNA therapeutics oligonucleotide carbohydrate conjugates with considerably enhanced potency, extended therapeutic index and reduced toxicity. | 12-24-2015 |
20150368644 | TREATMENT OF INTERFERON-RELATED DEVELOPMENTAL REGULATOR 1 (IFRD1) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO IFRD1 - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Interferon-related tested developmental regulator 1 (IFRD1), in particular, by targeting natural antisense polynucleotides of interferon-related developmental regulator 1 (IFRD1). The invention also relates to the identification of these antisense oligonucleotides and their use in framing diseases and disorders associated with the expression of IFRD1. | 12-24-2015 |
20150368645 | CELL-TYPE SPECIFIC APTAMER-siRNA DELIVERY SYSTEM FOR HIV-1 THERAPY - The present invention relates to compositions and methods for delivery of siRNA to specific cells or tissue. More particularly, the present invention relates to compositions and methods for cell type-specific delivery of anti-HIV siRNAs via fusion to an anti-gp120 aptamer. | 12-24-2015 |
20150368646 | COMPOSITIONS AND METHODS FOR TREATING PANCREATIC CANCER - The present disclosure provides compositions and methods for treating or reducing the risk of pancreatic cancer by administering compounds capable of inhibiting the expression or activity of RUNX3. | 12-24-2015 |
20150368647 | DIAGNOSIS AND TREATMENT OF CANCERS WITH MICRORNA LOCATED IN OR NEAR CANCER-ASSOCIATED CHROMOSOMAL FEATURES - MicroRNA genes are highly associated with chromosomal features involved in the etiology of different cancers. The perturbations in the genomic structure or chromosomal architecture of a cell caused by these cancer-associated chromosomal features can affect the expression of the miR gene(s) located in close proximity to that chromosomal feature. Evaluation of miR gene expression can therefore be used to indicate the presence of a cancer-causing chromosomal lesion in a subject. As the change in miR gene expression level caused by a cancer-associated chromosomal feature may also contribute to cancerigenesis, a given cancer can be treated by restoring the level of miR gene expression to normal. microRNA expression profiling can be used to diagnose cancer and predict whether a particular cancer is associated with an adverse prognosis. The identification of specific mutations associated with genomic regions that harbor miR genes in CLL patients provides a means for diagnosing CLL and possibly other cancers. | 12-24-2015 |
20150368648 | COMPOSITIONS AND METHODS OF INHIBITING GENE EXPRESSION IN A LUNG - The present invention provides compositions and methods for delivery to a lung tissue comprising a small interfering RNA (siRNA) capable of inhibiting expression of a gene, and a surfactant. In one aspect, a non-polymeric methods composition comprising a small interfering RNA (siRNA) capable of inhibiting expression of a gene, and a surfactant is disclosed. In other aspects, a method of inhibiting gene expression in a lung of a subject in need thereof and treating bronchopulmonary dysplasia in a lung of a subject also disclosed. The methods comprise administering a therapeutically effective amount of a non-polymeric composition to the lung of the subject, wherein the non-polymeric composition comprises a small interfering RNA (siRNA) capable of inhibiting expression of a gene, and a surfactant. | 12-24-2015 |
20150368650 | USE OF VEGFR1 AS A BIOMARKER - The present invention is related to the use of VEGFR1 or of a nucleic acid coding for VEGFR1 as a biomarker in a method for the treatment of a subject, wherein the method for the treatment comprises administering to the subject a PKN3 inhibitor. | 12-24-2015 |
20150368652 | TREATMENT OF NEUROPATHIC PAIN - The present invention relates to the field of neurology. More specifically, the present invention provides methods and composition useful for treating neuropathic pain. In a specific embodiment, the present invention provides a recombinant Kcna2 sense fragment. In another embodiment, the present invention provides a method of treating neuropathic pain comprising the step of administering a composition comprising a recombinant Kcna2 sense fragment. | 12-24-2015 |
20150368653 | ANTISENSE MODULATION OF NUCLEAR HORMONE RECEPTORS - Provided are antisense oligonucleotides and other agents that target and modulate nuclear hormone receptors (NHRs) such as the glucocorticoid receptor (GR), compositions that comprise the same, and methods of use thereof. | 12-24-2015 |
20150374738 | COMPOSITIONS AND METHODS FOR REGULATING CELL GROWTH AND DEVELOPMENT - The invention relates to the field of basic biology, practical regenerative medicine, veterinary, cell biology and can be used to treat and prevent diseases, disorders or conditions associated with the violation of proliferation and differentiation of cells of different organs and tissues to activate the regeneration potential of human and animal organs and tissues at age-related changes and after extreme impacts, as well as for biomedical research. The present invention can be widely applied in the field of blood transfusion, organ transplantation, as well as serve as a general approach to the development of reliable methods to correct age-related changes in the elderly. The invention may also be used in the cosmetic industry for producing active ingredients for enhancing regeneration and improving the scalp, face and body, in particular for the manufacture of active additives to combat deep wrinkles, removal of skin defects, stimulation and acceleration of hair growth, controlling hirsutism, etc. | 12-31-2015 |
20150374834 | NOVEL LIPID FORMULATIONS FOR DELIVERY OF THERAPEUTIC AGENTS TO SOLID TUMORS - The present invention provides novel, serum-stable lipid particles comprising one or more active agents or therapeutic agents, methods of making the lipid particles, and methods of delivering and/or administering the lipid particles. More particularly, the present invention provides serum-stable nucleic acid-lipid particles (SNALP) comprising a nucleic acid (e.g., one or more interfering RNA molecules), methods of making the SNALP, and methods of delivering and/or administering the SNALP (e.g., for the treatment of cancer). In particular embodiments, the present invention provides tumor-directed lipid particles that preferentially target solid tumors. The tumor-directed formulations of the present invention are capable of preferentially delivering a payload such as a nucleic acid to cells of solid tumors compared to non-cancerous cells. | 12-31-2015 |
20150376612 | CCCTC-Binding Factor (CTCF) RNA Interactome - This invention relates to methods and compositions for selectively reactivating or downregulating certain genes, e.g., genes regulated by zinc-finger protein CCCTC-binding factor (CTCF) on autosomes (e.g., imprinted genes, tumor suppressors, cancer) and the inactive X chromosome (Xi), e.g., genes associated with X-linked diseases, e.g., Rett Syndrome, Factor VIII or IX deficiency, Fragile X Syndrome, Duchenne muscular dystrophy, and PNH, in heterozygous females carrying a mutated allele, in addition to a functional wildtype or hypomorphic allele. | 12-31-2015 |
20150376613 | SEGMENTED MICRO RNA MIMETICS - This invention relates generally to segmented oligonucleotides capable of modulating gene expression. Specifically, the instant invention relates to segmented microRNA (miRNA) oligonucleotides, including segmented miRNA precursors and segmented pre-microRNAs. The invention also relates to compositions comprising such segmented oligonucleotides, as well as to methods of making and using such oligonucleotides for diagnosis and treatment of diseases associated or causally linked to aberrant levels or activities of gene expression, including aberrant levels of coding and/or non-coding RNA. | 12-31-2015 |
20150376615 | ANTISENSE OLIGONUCLEOTIDES FOR INDUCING EXON SKIPPING AND METHODS OF USE THEREOF - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202. | 12-31-2015 |
20150376616 | ANTISENSE OLIGONUCLEOTIDES FOR INDUCING EXON SKIPPING AND METHODS OF USE THEREOF - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202. | 12-31-2015 |
20150376617 | MULTIPLE EXON SKIPPING COMPOSITIONS FOR DMD - Provided are antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon skipping, and methods of use thereof to treat muscular dystrophy. | 12-31-2015 |
20150376618 | MULTIPLE EXON SKIPPING COMPOSITIONS FOR DMD - Provided are antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon skipping, and methods of use thereof to treat muscular dystrophy. | 12-31-2015 |
20150376621 | MODIFIED SMALL INTERFERING RNA MOLECULES AND METHODS OF USE - The present invention provides double-stranded RNA molecules that mediate RNA interference in target cells, preferably hepatic cells. The invention also provides double-stranded RNA (dsRNA) molecules that are modified to be resistant to nuclease degradation, which inactivates a virus, and more specifically, hepatitis C virus (HCV). The invention also provides a method of using these modified RNA molecules to inactivate virus in mammalian cells and a method of making modified small interfering RNAs (siRNAs) using human Dicer. The invention provides modified RNA molecules that are modified to include a dsRNA or siRNA wherein one or more of the pyrimidines in the RNA molecule are modified to include 2′-Fluorine. The invention also provides dsRNA or siRNA in which all pyrimidines are modified to include a 2′-Fluorine. The invention provides that the 2′-Fluorine dsRNA or siRNA molecule is further modified to include a two base deoxynucleotide “TT” sequence at the 3′ end of the molecule. | 12-31-2015 |
20150376622 | INFLUENZA-ACTIVATED CONSTRUCTS AND METHODS OF USE THEREOF - The presently disclosed subject matter provides a novel approach for the treatment, prevention, and diagnosis of Cap-Snatching virus infections, particularly all classes of human influenza, including pandemic influenza. The methods involve the use of constructs for RNA-interference (RNAi). | 12-31-2015 |
20150376623 | ANTISENSE OLIGONUCLEOTIDES DIRECTED AGAINST CONNECTIVE TISSUE GROWTH FACTOR AND USES THEREOF - This invention provides compounds which comprise modified oligonucleotides capable of inhibitory expression of connective tissue factor and composition containing same as well as methods of treating hyperprolific disorders and fibrotic diseases, and of reducing scarring resulting from wound healing using such compounds. | 12-31-2015 |
20150376625 | SELECTIVE ANTISENSE COMPOUNDS AND USES THEREOF - The present disclosure provides oligomeric compounds. Certain such oligomeric compounds are useful for hybridizing to a complementary nucleic acid, including but not limited, to nucleic acids in a cell. In certain embodiments, hybridization results in modulation of the amount activity or expression of the target nucleic acid in a cell. In certain embodiments, certain oligomeric compounds selectively reduce the expression of a target nucleic acid transcript relative to a non-target nucleic acid transcript. | 12-31-2015 |
20160000819 | Compositions and Methods for Inhibiting Expression of Eg5 and VEGF Genes - This invention relates to compositions containing double-stranded ribonucleic acid (dsRNA) in a SNALP formulation, and methods of using the compositions to inhibit the expression of the Eg5 and Vascular Endothelial Growth Factor (VEGF), and methods of using the compositions to treat pathological processes mediated by Eg5 and VEGF expression, such as cancer. | 01-07-2016 |
20160000821 | MICRO-RNAS AND COMPOSITIONS COMPRISING SAME FOR THE TREATMENT AND DIAGNOSIS OF SEROTONIN-, ADRENALIN-, NORADRENALIN-, GLUTAMATE-, AND CORTICOTROPIN-RELEASING HORMONE- ASSOCIATED MEDICAL CONDITIONS - microRNAs and compositions comprising same for the treatment and diagnosis of serotonin-, adrenalin-, noradrenalin-, glutamate-, and corticotropin-releasing hormone-associated medical conditions are provided. | 01-07-2016 |
20160002624 | ANTISENSE OLIGONUCLEOTIDE COMPOSITIONS - The present disclosure provides compositions comprising an antisense oligonucleotide and one or more excipients that modulates viscosity, turbidity or both viscosity and turbidity. In certain embodiments, compositions comprising an antisense oligonucleotide and one or more excipients having low viscosity are provided. In certain embodiments, compositions comprising an antisense oligonucleotide and one or more excipients having low turbidity are provided. In certain embodiments, pharmaceutical compositions comprising an antisense oligonucleotide and one or more excipients having low viscosity and turbidity are provided. | 01-07-2016 |
20160002625 | CANCER TREATMENT - In certain embodiments, methods, compounds, and compositions for treating B-cell lymphoma or hepatocellular carcinoma by inhibiting expression of ST AT3 mRNA or protein in an animal are provided herein. Such methods, compounds, and compositions are useful to treat, prevent, or ameliorate B-cell lymphoma or hepatocellular carcinoma. The STAT (signal transducers and activators of transcription) family of proteins are DNA-binding proteins that play a dual role in signal transduction and activation of transcription. | 01-07-2016 |
20160002629 | DIAGNOSTIC AND TREATMENT FOR CHRONIC AND ACUTE PHASE MYELOID LEUKEMIA - Disclosed are methods of predicting responsiveness of a cancer cell to a tyrosine kinase inhibitor, and methods of predicting the risk of progression of a cancer cell to a more aggressive form. Also provided are methods of reducing proliferation or promoting differentiation of a cancer cell having reduced level of Numb or increased level of Msi. Further disclosed are methods of treating a mammalian subject having cancer and methods of assessing an agent for chemotherapeutic potential. | 01-07-2016 |
20160002630 | Bispecific Antisense Oligonucleotides that Inhibit IGFBP-2 and IGFBP-5 and Methods of Using Same - Bispecific antisense oligonucleotides which consist essentially of a sequence of bases that is complementary to portions of both the gene encoding human IGFBP-2 and the gene encoding human IGFBP-5 are useful in as antisense therapeutics in the treatment of endocrine-regulated cancers. | 01-07-2016 |
20160002631 | ANTISENSE OLIGONUCLEOTIDES FOR INDUCING EXON SKIPPING AND METHODS OF USE THEREOF - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202. | 01-07-2016 |
20160002632 | ANTISENSE OLIGONUCLEOTIDES FOR INDUCING EXON SKIPPING AND METHODS OF USE THEREOF - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202. | 01-07-2016 |
20160002633 | MULTIPLE EXON SKIPPING COMPOSITIONS FOR DMD - Provided are antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon skipping, and methods of use thereof to treat muscular dystrophy. | 01-07-2016 |
20160002634 | MULTIPLE EXON SKIPPING COMPOSITIONS FOR DMD - Provided are antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon skipping, and methods of use thereof to treat muscular dystrophy. | 01-07-2016 |
20160002635 | ANTISENSE OLIGONUCLEOTIDES FOR INDUCING EXON SKIPPING AND METHODS OF USE THEREOF - An antisense molecule capable of binding to a selected target site to induce exon skipping in the dystrophin gene, as set forth in SEQ ID NO: 1 to 202. | 01-07-2016 |
20160002637 | MULTIPLE EXON SKIPPING COMPOSITIONS FOR DMD - Provided are antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon skipping, and methods of use thereof to treat muscular dystrophy. | 01-07-2016 |
20160002638 | RNAi-MEDIATED INHIBITION OF CONNEXIN 43 FOR TREATMENT OF IOP-RELATED CONDITIONS - RNA interference is provided for inhibition of connexin 43 (Cx43) in intraocular pressure-related conditions, including ocular hypertension and glaucoma such as normal tension glaucoma and open angle glaucoma. | 01-07-2016 |
20160002639 | NUCLEIC ACIDS INVOLVED IN VIRAL INFECTION - The invention provides isolated viral and human nucleic acids associated with viral infection and various nucleic acid molecules relating thereto or derived therefrom. The nucleic acids are useful for prevention, treatment and diagnosis of viral infections. | 01-07-2016 |
20160002640 | TREATMENT OF MEMBRANE BOUND TRANSCRIPTION FACTOR PEPTIDASE, SITE 1 (MBTPS1) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO MBTPS1 - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Membrane Bound Transcription Factor Peptidase, site 1 (MBTPS1), in particular, by targeting natural antisense polynucleotides of Membrane Bound Transcription Factor Peptidase, site 1 (MBTPS1). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of MBTPS1. | 01-07-2016 |
20160002669 | Nanotubes as Carriers of Nucleic Acids into Cells - The present invention is directed to transfection complexes of rosette nanotubes and one or more nucleic acids. | 01-07-2016 |
20160003803 | A SCREENING METHOD, A KIT, A METHOD OF TREATMENT AND A COMPOUND FOR USE IN A METHOD OF TREATMENT - A method of screening for a candidate compound for the treatment of a condition involving dysregulation of metabolism in a mammal, said method comprising bringing a compound into contact with at least one population of cells, comprising cells that express mTOR and Akt and that are capable of activating mTORC2 and Akt; determining mTORC2 activity and Akt activity in cells brought into contact with the compound, and identifying the candidate compound based on the determined mTORC2 activity and Akt activity. A kit for use in such a method of. A compound for use in a method of treatment of a condition involving dysregulation of metabolism in a mammal, and a method of treatment of such a condition. | 01-07-2016 |
20160003837 | BIOMARKERS FOR THE PREDICTION OF PRETERM BIRTH - The present disclosure provides biomarkers useful for determining the risk of, prognosis of, and/or diagnosis of conditions such as preterm birth in a subject. | 01-07-2016 |
20160008390 | METHODS OF TREATING CANCER | 01-14-2016 |
20160010061 | METHODS OF PRESERVING AND PROTECTING PANCREATIC BETA CELLS AND TREATING OR PREVENTING DIABETES BY INHIBITING NOX-1 | 01-14-2016 |
20160010086 | OLIGOMERIC COMPOUNDS AND EXCIPIENTS | 01-14-2016 |
20160010089 | ORGANIC COMPOSITIONS TO TREAT EPASI-RELATED DISEASES | 01-14-2016 |
20160010092 | TREATMENT OF TRISTETRAPROLINE (TTP) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO TTP | 01-14-2016 |
20160017321 | METHOD FOR EXPRESSING, SECRETING AND TRANSFERRING FUNCTIONAL MICRORNAS/SIRNAS AND APPLICATION THEREOF - The present invention relates to a microparticle comprising a functional microRNA/siRNA and application thereof. Specifically, disclosed is a use of a functional microRNA and/or siRNA, which is used to prepare a composition applied to a mammal. After the composition is applied, the microparticle is formed in a first part in an animal, and transported to a second part, which thereby improves physiological status of the second part or heals a disease of the second part. The second part is different from the first part. The use is beneficial for optimizing a dosing manner of the functional microRNA and/or siRNA. | 01-21-2016 |
20160017322 | REDUCING INTRON RETENTION - Disclosed herein are methods, compositions, polynucleic acid polymers, assays, and kits for inducing processing of a partially processed mRNA transcript to remove a retained intron to produce a fully processed mRNA transcript that encodes a full-length functional form of a protein. Also described herein are methods and compositions for treating a disease or condition characterized by impaired production of a full-length functional form of a protein or for treating a disease or condition characterized by a defective splicing in a subject. | 01-21-2016 |
20160017324 | CHIMERIC OLIGOMERIC COMPOUNDS AND THEIR USE IN GENE MODULATION - Oligomer compositions comprising first and second oligomers are provided wherein at least a portion of the first oligomer is capable of hybridizing with at least a portion of the second oligomer, at least a portion of the first oligomer is complementary to and capable of hybridizing to a selected target nucleic acid, and at least one of the first or second oligomers includes at least one nucleotide comprising a chimeric organic composition. Oligomer/protein compositions are also provided comprising an oligomer complementary to and capable of hybridizing to a selected target nucleic acid and at least one protein comprising at least a portion of an RNA-induced silencing complex (RISC), wherein at least one nucleotide comprising a chimeric organic composition. | 01-21-2016 |
20160017325 | LIPOHILLIC OLIGONUCLEOTIDE ANALOGS - Lipophilic oligonucleotide comprising a phosphate glycerol unit containing at least one aliphatic unsaturated carbon bond according to formula (I), with Oligonucleotide an unmodified or modified nucleic acid of 2-1000 nucleotides in length R=a bond or a linker unit Y═OH, SH or NHR3 X and Z=independently O, S or NR3 R3=hydrogen or branched or unbranched and/or substituted or unsubstituted alkyl, aryl and/or alkyl aryl residue with 10 to 30 carbon atoms R1, R2 branched or unbranched and/or substituted or unsubstituted alkyl, aryl and/or alkylaryl residue with 10 to 30 carbon atoms, with the provisio that at least one of the residues R1 or R2 comprises at least one aliphatic carbon-carbon double bond Use of lipophilic oligonucleotide according to Formula I for drug discovery or for transfection of cells. | 01-21-2016 |
20160017327 | PHOSPHORODIAMIDATE MORPHOLINO OLIGOMERS (PMOS) AND THEIR USE IN SUPPRESSION OF MUTANT HUNTINGTIN EXPRESSION AND ATTENUATION OF NEUROTOXICITY - The present invention provides antisense phosphorodiamidate morpholino oligomers which are useful for the suppression or inhibition of the HTT gene involved in Huntington's disease. The oligomers can selectively suppress mutant forms of the HTT protein while allowing the normal protein to be expressed in sufficient quantity to retain its function in the cell. Methods for treatment of Huntington's disease are also provided. | 01-21-2016 |
20160017328 | DOUBLE STRAND COMPOSITIONS COMPRISING DIFFERENTIALLY MODIFIED STRANDS FOR USE IN GENE MODULATION - The present invention provides double stranded compositions wherein each strand is modified to have a motif defined by positioning of β-D-ribonucleosides and sugar modified nucleosides. More particularly, the present compositions comprise one strand having an alternating motif and another strand having a hemimer motif, a blockmer motif, a fully modified motif or a positionally modified motif. At least one of the strands has complementarity to a nucleic acid target. The compositions are useful for targeting selected nucleic acid molecules and modulating the expression of one or more genes. In preferred embodiments the compositions of the present invention hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA. The present invention also provides methods for modulating gene expression. | 01-21-2016 |
20160017329 | OLIGOMERIC COMPOUNDS AND COMPOSITIONS FOR USE IN MODULATION OF SMALL NON-CODING RNAS - Compounds, compositions and methods are provided for modulating the expression and function of small non-coding RNAs. The compositions comprise oligomeric compounds, targeted to small non-coding RNAs. Methods of using these compounds for modulation of small non-coding RNAs as well as downstream targets of these RNAs and for diagnosis and treatment of disease associated with small non-coding RNAs are also provided. | 01-21-2016 |
20160017330 | SERPINC1 iRNA COMPOSITIONS AND METHODS OF USE THEREOF - The invention relates to iRNA, e.g., double-stranded ribonucleic acid (dsRNA), compositions targeting the Serpinc1 gene, and methods of using such iRNA, e.g., dsRNA, compositions to inhibit expression of Serpinc1 and methods of treating subjects having a bleeding disorder, such as a hemophilia. | 01-21-2016 |
20160017331 | TARGETING MICRORNAS MIR-409-5P, MIR-409-3P AND MIR-154* TO TREAT PROSTATE CANCER BONE METASTASIS AND DRUG RESISTANT LUNG CANCER - The present invention describes methods of treating cancer, cancer metastasis, and drug resistant cancers using miRNA inhibitors; for example, inhibitors of miR-409-5p, miR-409-3p, miR-154*. Also described are methods of using the miRNA as biomarkers; for example, to predict responsiveness to a cancer drug, to detect a disease state of cancer. | 01-21-2016 |
20160017336 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF FACTOR VII GENE - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the Factor VII gene. | 01-21-2016 |
20160017337 | Compositions and Methods for Inhibiting Expression of Eg5 Gene - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of the Eg5 gene (Eg5 gene), comprising an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of the Eg5 gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by Eg5 expression and the expression of the Eg5 gene using the pharmaceutical composition; and methods for inhibiting the expression of the Eg5 gene in a cell. | 01-21-2016 |
20160017338 | MiRNA molecule defined by its source and its diagnostic and therapeutic uses in diseases or conditions associated with EMT - The invention relates to the diagnostic and therapeutic uses of a miRNA molecule or an equivalent thereof wherein a source of said miRNA molecule or equivalent thereof comprises at least 80 nucleotides and comprises a motif having at least 98% identity with the motif represented by SEQ ID NO:1 or a source thereof in a disease and condition associated with EMT (Epithelial to Mesenchymal Transition). | 01-21-2016 |
20160022821 | BIODEGRADABLE POLY (BETA-AMINO ESTERS) AND USES THEREOF - Poly(β-amino esters) prepared from the conjugate addition of bis(secondary amines) or primary amines to a bis(acrylate ester) are described. Methods of preparing these polymers from commercially available starting materials are also provided. These tertiary amine-containing polymers are preferably biodegradable and biocompatible and may be used in a variety of drug delivery systems. Given the poly(amine) nature of these polymers, they are particularly suited for the delivery of polynucleotides. Nanoparticles containing polymer/polynucleotide complexes have been prepared. The inventive polymers may also be used to encapsulate other agents to be delivered. They are particularly useful in delivering labile agents given their ability to buffer the pH of their surroundings. | 01-28-2016 |
20160024495 | LNA ANTISENSE OLIGONUCLEOTIDES FOR THE MODULATION OF MYC EXPRESSION - The disclosure relates to oligonucleotide compounds (oligomers) that target Myc mRNA in a cell, leading to reduced expression of Myc. Reduction of Myc expression is beneficial for the treatment of certain disorders, such as hyperproliferative disorders (e.g., cancer). The disclosure provides therapeutic compositions comprising oligomers and methods for modulating the expression of Myc using said oligomers, including methods of treatment. | 01-28-2016 |
20160024496 | METHODS FOR MONITORING C9ORF72 EXPRESSION - Disclosed herein are methods for monitoring expression of C9ORF72 mRNA and protein in an animal with C9ORF72 specific inhibitors. Such C9ORF72 specific inhibitors include antisense compounds. | 01-28-2016 |
20160024497 | Compositions And Methods For Inhibiting Expression Of GSK-3 Genes - The invention relates to a double-stranded ribonucleic acid (dsRNA) targeting Glycogen Synthase Kinase-3 (GSK-3), and methods of using the dsRNA to inhibit expression of GSK-3. | 01-28-2016 |
20160024499 | Compositions and Methods for Inhibition of Expression of Protein C (PROC) Genes - The invention relates to double-stranded ribonucleic acid (dsRNA) targeting a PROC gene, and methods of using the dsRNA to inhibit expression of PROC. | 01-28-2016 |
20160024500 | OLIGOMERS - Molecules are provided for inducing or facilitating exon skipping in forming spliced mRNA products from pre-mRNA molecules in cells. The molecules may be provided directly as oligonucleotides or expression products of vectors that are administered to a subject. High rates of skipping can be achieved. High rates of skipping reduce the severity of a disease like Duchene Muscular Dystrophy so that the disease is more like Becker Muscular Dystrophy. This is a severe reduction in symptom severity and mortality. | 01-28-2016 |
20160024504 | TREATING TH2-MEDIATED DISEASES BY INHIBITION OF BROMODOMAINS - The invention provides methods for treating Th2 cytokine-mediated diseases by inhibiting bromodomain function. | 01-28-2016 |
20160024505 | TREATMENT OF LIPID TRANSPORT AND METABOLISM GENE RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO A LIPID TRANSPORT AND METABOLISM GENE - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of a Lipid transport and metabolism gene, in particular, by targeting natural antisense polynucleotides of a Lipid transport and metabolism gene. The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of a Lipid transport and metabolism genes. | 01-28-2016 |
20160024506 | TREATMENT OF LIPID TRANSPORT AND METABOLISM GENE RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO A LIPID TRANSPORT AND METABOLISM GENE - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of a Lipid transport and metabolism gene, in particular, by targeting natural antisense polynucleotides of a Lipid transport and metabolism gene. The invention also relates to the identification of the antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of a Lipid transport and metabolism genes. | 01-28-2016 |
20160030461 | MICRORNAS AND USES THEREOF - The present invention provides novel microRNAs and their uses. | 02-04-2016 |
20160032284 | ORGANIC COMPOSITIONS TO TREAT HSF1-RELATED DISEASES - The present disclosure relates to methods of treating heat shock factor 1 (HSF1)-related diseases such as cancer, autoimmune and viral diseases, using a therapeutically effective amount of a RNAi agent to HSF. | 02-04-2016 |
20160032285 | COMPOSITIONS AND METHODS FOR MODULATING TAU EXPRESSION - Disclosed are methods for modulating splicing of Tau mRNA in an animal with Tau antisense compounds. Also disclosed herein are methods for reducing expression of Tau mRNA and protein in an animal with Tau antisense compounds. Such compounds and methods are useful to treat, prevent, or ameliorate neurodegenerative diseases in an individual in need thereof. Examples of neurodegenerative diseases that can be treated, prevented, and ameliorated with the administration Tau antisense oligonucleotides include Alzheimer's Disease, Fronto-temporal Dementia (FTD), FTDP-17, Progressive Supranuclear Palsy, Chronic Traumatic Encephalopathy, Epilepsy, and Dravet's Syndrome. | 02-04-2016 |
20160032286 | INHIBITORS OF MYH7B AND USES THEREOF - The present invention provides nucleic acid inhibitors of MYH7B and compositions thereof. The present invention also provides methods of treating or preventing a cardiac disorder such as cardiac hypertrophy, myocardial infarction, or heart failure in a subject by administering to the subject an inhibitor of MYH7B. The present invention further provides methods of modulating the activity or expression of β-MHC in cardiac cells of a subject by administering to the subject an inhibitor of MYH7B. | 02-04-2016 |
20160032287 | METHOD OF DERIVING MATURE HEPATOCYTES FROM HUMAN EMBRYONIC STEM CELLS - A method for producing mature hepatocytes having functional hepatic enzyme activity from human pluripotent cells is disclosed. The method includes the step of transferring an external vector comprising the DNA sequence coding for a microRNA having the seed sequence of the microRNA miR-122, the DNA sequence coding for a microRNA having the seed sequence of the microRNA miR-let-7c, a microRNA having the seed sequence of the microRNA miR-122, a microRNA having the seed sequence of the microRNA miR-let-7c, or a combination thereof into one or more fetal hepatocytes. The resulting cells differentiate into mature hepatocytes that exhibit functional hepatic enzyme activity, and can be used in drug metabolism and toxicity testing, in the study of viruses that target hepatic tissue, and as therapeutics. | 02-04-2016 |
20160032289 | Oral Delivery of Therapeutically Effective LNA Oligonucleotides - The invention provides for LNA oligomers, for the treatment of a metabolic or liver disorder, wherein the LNA oligomer is administered orally in a unit dose of less than 50 mgs/kg, wherein the LNA oligomer is administered in the presence of a penetration (permeation) enhancer. | 02-04-2016 |
20160032290 | PHARMACEUTICAL COMPOSITION COMPRISING NANOG SHRNA, AND METHOD OF USING NANOG SHRNA TO TREAT CANCER - The present description relates to an inhibitory RNA molecule, comprising an oligonucleotide that selectively knocks down expression a Nanog pseudogene expressed in many human cancers, a replicating viral vector capable of encoding such inhibitory RNA molecule, pharmaceutical compositions comprising said vector, and methods of treating cancer by administration of said pharmaceutical composition. | 02-04-2016 |
20160032292 | Aptamer-Guided Gene Targeting - Compositions and methods for modifying genetic material are provided. One embodiment provides aptamers capable of binding to a site-specific DNA binding moiety to facilitate the exchange of homologous genetic information between a donor molecule and the desired target locus (aptamer-guided gene targeting or AGT). One embodiment provides an oligonucleotide containing a aptamer, preferably a DNA aptamer at the 5′ end. The oligonucleotide also contains a region of homology, also referred to as donor DNA, to a desired nucleic acid, locus, or gene. The DNA binding moiety can be a nucleic acid, a protein, or a complex of proteins. In a preferred embodiment the DNA binding moiety is a homing endonuclease that cuts DNA to facilitate the modification of the DNA by the donor DNA. | 02-04-2016 |
20160032320 | NON-LIPOSOMAL SYSTEMS FOR NUCLEIC ACID DELIVERY - The present invention provides novel, stable lipid particles having a non-lamellar structure and comprising one or more active agents or therapeutic agents, methods of making such lipid particles, and methods of delivering and/or administering such lipid particles. More particularly, the present invention provides stable nucleic acid-lipid particles (SNALP) that have a non-lamellar structure and that comprise a nucleic acid (such as one or more interfering RNA), methods of making the SNALP, and methods of delivering and/or administering the SNALP. | 02-04-2016 |
20160032383 | PANEL OF microRNA BIOMARKERS IN HEALTHY AGING - Methods are provided for determining if a subject is likely to develop an age-related disease based on miRNA signatures. Related methods of treatment are also provided. | 02-04-2016 |
20160032402 | BIOMARKERS ASSOCIATED WITH BRM INHIBITION - The invention provides methods of detecting cancer biomarkers, such as one or more SWI/SNF complex mutations, in order to determine a cancer subject's amenability to therapeutic treatment with a BRM inhibitor. Kits, methods of screening for candidate BRM inhibitors, and associated methods of treatment are also provided. | 02-04-2016 |
20160038590 | COMPOSITIONS AND METHODS FOR DELIVERING THERAPEUTIC AND IMAGING AGENTS TO THE SINUSES AND MIDDLE EAR - The present invention features compositions and methods for targeted delivery of a therapeutic or imaging agent to a site accessible through the nose or mouth that may be difficult to effectively and efficiently treat otherwise (e.g., the middle ear, sinuses, or lung). The therapeutic or imaging agent is deposited onto a magnetic nanoparticle that is drawn through a passage or tissue that leads away from the nose or mouth by a magnetic field applied over the targeted site (e.g., by magnets within the ear canal or surrounding the ear). | 02-11-2016 |
20160038598 | Modified Poly(Beta-Amino Ester)s for Drug Delivery - Disclosed are polymers that are poly(beta-amino ester)s (PBAEs) modified with at least one oligopeptide. The polymers may be used in any field where polymers have been found useful including in medical fields, particularly in drug delivery. The polymers are particularly useful in delivering a polynucleotide such as DNA, RNA and siRNA, a small molecule or a protein. Also disclosed are compositions comprising said polymers and an active agent, methods of encapsulating an agent in a matrix of said polymers, and said polymers and compositions for use in medicine. | 02-11-2016 |
20160038601 | POLYMERIC ANTIBIOTICS - The disclosure provides, inter alia, polymeric antibiotic compounds such as modified chitosans and methods of use thereof. | 02-11-2016 |
20160040160 | MODULATION OF RNA ACTIVITY AND VASCULAR PERMEABILITY - The present invention provides oligonucleotides that inhibit the binding of miR-27a to VE-cadherin mRNA, particularly in the form of blockmirs. The invention also provides compositions comprising such oligonucleotides and methods of use of such oligonucleotides to modulate the activity of VE-cadherin, inhibit or reduce vascular permeability, treat or prevent a vascular permeability-associated disease or condition, inhibit tumour growth, treat ischaemic injury, enhance recovery from ischaemic injury, treat surgical wounds and/or promotes post-operative recovery, and promote or induce angiogenesis. | 02-11-2016 |
20160040161 | In Vivo Delivery of Oligonucleotides - This invention provides a method for the in vivo delivery of oligonucleotides. The invention utilizes the presence of one or plurality of HES linked to an oligonucleotide to deliver a nucleic acid sequence of interest into the cytoplasm of cells and tissues of live organisms. The delivery vehicle is nontoxic to cells and organisms. Since delivery is sequence-independent and crosses membranes in a receptor-independent manner, the delivered oligonucleotide can target complementary sequences in the cytoplasm as well as in the nucleus of live cells. Sequences of bacterial or viral origin can also be targeted. The method can be used for delivery of genes coding for expression of specific proteins, antisense oligonucleotides, siRNAs, shRNAs, Dicer substrates, miRNAs, anti-miRNAs or any nucleic acid sequence in a living organism. The latter include mammals, plants, and microorganisms such as bacteria, protozoa, and viruses. | 02-11-2016 |
20160040162 | EXON SKIPPING COMPOSITIONS FOR TREATING MUSCULAR DYSTROPHY - Antisense molecules capable of binding to a selected target site in the human dystrophin gene to induce exon 53 skipping are described. | 02-11-2016 |
20160040167 | MODIFIED TGF-BETA OLIGONUCLEOTIDE FOR USE IN A METHOD OF PREVENTING AND/OR TREATING AN OPHTHALMIC DISEASE - The invention refers to an oligonucleotide consisting of 10 to 20 nucleotides of selected regions of the TGF-beta1, TGF-beta2 or TGF-beta3 nucleic acid sequence, which comprises modified nucleotides such as LNA, ENA, polyalkylene oxide-, 2′-fluoro, 2′-O-methoxy and/or 2′-O-methyl modified nucleotides. The invention further relates to pharmaceutical compositions comprising such oligonucleotide, wherein the composition or the oligonucleotide is used in a method for the prevention and/or treatment of glaucoma, posterior capsular opacification, dry eye, Marfan or Loeys-Dietz syndrome, riboblastoma, choroidcarcinoma, macular degeneration, such as age-related macular degeneration, diabetic macular endma, or cataract. | 02-11-2016 |
20160040168 | Composition for Treatment or Metastasis Suppression of Cancers Which Includes P34 Expression Inhibitor or Activity Inhibitor as Active Ingredient - The present invention relates to a composition for treatment or metastasis suppression of cancers which includes a p34 expression inhibitor or activity inhibitor as an active ingredient. According to the present invention, the p34 protein knock-down causes monoubiquitination of PTEN and accordingly nuclear localization of PTEN is induced, as a result, an Akt pathway which is related to survival, proliferation, invasive properties and metastatic properties of tumors is inhibited, and thus there is an effect of significantly reducing clonogenic potential and tumor forming potential of various cancer cells which simultaneously express PTEN and NEDD4-1. Consequently, the p34 gene expression inhibitor or p34 protein activity inhibitor according to the present invention can be effectively used as a treatment agent or a metastasis suppression agent for cancers. | 02-11-2016 |
20160040169 | MORPHOLINOS, MORPHOLINO UPREGULATING, AND ASSOCIATED METHODS - Various methods and compositions relating to vascular endothelial growth factor receptor 2 (VEGFR2) are provided. In one aspect, a method of increasing expression of the soluble form of VEGFR2 (sVEGFR2) in a subject can include binding an antisense morphoiino to an exon13-intron13 splicing site of VEGFR2 mRNA such that the VEGFR2 niRNA is spliced into a sVEGFR2 isoform, | 02-11-2016 |
20160040170 | Long interfering nucleic acid duplexes targeting multiple RNA targets - Long interfering nucleic acid (iNA) duplexes, which are at least 30 nucleotides in length, which have at least one nick or nucleotide gap in the antisense or the sense strands or in both the sense and antisense strands. These long iNA duplexes do not induce an interferon response when transfected into mammalian cells. The antisense strands can target two separate mRNAs or two segments of one mRNA. | 02-11-2016 |
20160045482 | UREIDO-PYRAZOLE DERIVATIVES - The disclosure relates to compounds of formula (I) for use in the treatment or prophylaxis of rhinovirus infection, methods of treating or preventing rhinovirus infection employing said compounds or pharmaceutical composition comprising the same. The disclosure also relates to compounds of formula (I) for use in the treatment or prophylaxis of exacerbation of respiratory disorders (such as asthma, COPD, bronchitis and/or cystic fibrosis) by rhinovirus infection. | 02-18-2016 |
20160046931 | METHODS FOR ENHANCING UTROPHIN PRODUCTION VIA INHIBITION OF MICRORNA - This invention provides a method for enhancing utrophin protein production in a cell by inhibiting an utrophin microRNA molecule. Moreover, the invention provides that methods for enhancing utrophin protein production in a muscle cell are used for treating a muscular dystrophy and/or other myopathies. | 02-18-2016 |
20160046933 | MODULATORS OF ALPHA-SYNUCLEIN TOXICITY - Disclosed are genes that, when overexpressed in cells expressing alpha-synuclein, either suppress or enhance alpha-synuclein mediated cellular toxicity. Compounds that modulate expression of these genes or activity of the encoded proteins can be used to inhibit alpha-synuclein mediated toxicity and used to treat or prevent synucleinopathies such as Parkinson's disease. Also disclosed are methods of identifying inhibitors of alpha-synuclein mediated toxicity. | 02-18-2016 |
20160046934 | SIGNAL ACTIVATED RNA INTERFERENCE - The invention provides compositions and methods for signal activated RNA interference (saRNAi), preferably in vivo. The invention provides polynucleotides that switches between an inactive form and an active form upon covalent or non-covalent interaction with one or more specific chemical signals, such as disease-specific mRNA, miRNA, or other cellular RNA products with sequences that characterize diseased states of the cell. The interaction between the subject polynucleotides and the signals is preferably mediated by hybridization, which exposes, facilitates the formation, and/or allows the formation of a substrate that can be processed by proteins of the RNAi pathway (such as Dicer). The input and output of multiple different polynucleotides of the invention can form an in vivo signaling network. In addition, the multiple input signals can be integrated to modulate the activity of the subject polynucleotides. | 02-18-2016 |
20160046935 | Micrornas And Uses Thereof - Described herein are novel polynucleotides associated with prostate and lung cancer. The polynucleotides are miRNAs and miRNA precursors. Related methods and compositions that can be used for diagnosis, prognosis, and treatment of those medical conditions are disclosed. Also described herein are methods that can be used to identify modulators of prostate and lung cancer. | 02-18-2016 |
20160046939 | 5' MODIFIED NUCLEOSIDES AND OLIGOMERIC COMPOUNDS PREPARED THEREFROM - The present invention provides 5′ modified nucleosides and oligomeric compounds prepared therefrom. More particularly, the present invention provides modified nucleosides having at least one 5′-substituent and an optional 2′ substituent, oligomeric compounds comprising at least one of these modified nucleosides and methods of using the oligomeric compounds. In some embodiments, the oligomeric compounds provided herein are expected to hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA. | 02-18-2016 |
20160046941 | TARGETING MICRORNAS FOR THE TREATMENT OF LIVER CANCER - Provided herein are methods for the treatment of liver cancer. These methods encompass the administration of a compound comprising a modified oligonucleotide, wherein the modified oligonucleotide is targeted to a miRNA. Also provided herein are compositions for the treatment of liver cancer. Such compositions include compounds comprising a modified oligonucleotide, wherein the modified oligonucleotide is targeted to a miRNA. Certain miRNAs have been identified as overexpressed in liver cancer, such as, for example, hepatocellular carcinoma, and are thus selected for targeting by modified oligonucleotides. Further, certain miRNAs have been identified as overexpressed in hepatocellular carcinoma cells exposed to dioxin, and are thus selected for targeting by modified oligonucleotides. Antisense inhibition of certain of these miRNAs has been found to inhibit cell proliferation and induce apoptosis. | 02-18-2016 |
20160046945 | MODULATION OF HEPATITIS B VIRUS (HBV) EXPRESSION - Disclosed herein are antisense compounds and methods for decreasing HBV mRNA, DNA and protein expression. Such methods, compounds, and compositions are useful to treat, prevent, or ameliorate HBV-related diseases, disorders or conditions. | 02-18-2016 |
20160046947 | Materials and Methods Useful For Affecting Tumor Cell Growth, Migration and Invasion - It is disclosed herein that miR-221 and miR-222 down-regulate PTEN and TIMP3 tumor suppressors, resulting in TRAIL resistance. The present invention provides research, diagnostic, and therapeutic tools and methods related to this discovery. Diagnostics, prognostics and treatments for human hepatocellular cancer and non-small cell lung carcinoma having a TRAIL resistance are particularly described herein. | 02-18-2016 |
20160046958 | Transcriptome Transfer Produces Cellular Phenotype Conversion - The present invention includes methods for effecting phenotype conversion in a cell by transfecting the cell with phenotype-converting nucleic acid. Expression of the nucleic acids results in a phenotype conversion in the transfected cell. Preferably the phenotype-converting nucleic acid is a transcriptome, and more preferably an mRNA transcriptome. | 02-18-2016 |
20160047004 | VIRAL AND VIRAL ASSOCIATED MIRNAS AND USES THEREOF - Described herein are novel polynucleotides associated with viral infections. The polynucleotides are miRNAs and miRNA precursors. Related methods and compositions that can be used for diagnosis, prognosis, and treatment of those medical conditions are disclosed. Also described herein are methods that can be used to identify modulators of viral infections. | 02-18-2016 |
20160051691 | CARBOHYDRATE CONJUGATES AS DELIVERY AGENTS FOR OLIGONUCLEOTIDES - The present invention provides iRNA agents comprising at least one subunit of the formula (I): | 02-25-2016 |
20160053256 | COMPOSITIONS AND THEIR USES DIRECTED TO HUNTINGTIN - Disclosed herein are compounds, compositions and methods for modulating the expression of huntingtin in a cell, tissue or animal. Further provided are methods of slowing or preventing Huntington's disease progression using an antisense compound targeted to huntingtin. Additionally provided are methods of delaying or preventing the onset of Huntingtin's disease in an individual susceptible to Huntingtin's Disease. Also provided are uses of disclosed compounds and compositions in the manufacture of a medicament for treatment of diseases and disorders. | 02-25-2016 |
20160053261 | COMPOSITIONS COMPRISING ALTERNATING 2'-MODIFIED NUCLEOSIDES FOR USE IN GENE MODULATION - The present invention provides compositions comprising at least one oligomeric compound comprising an alternating motif and further include a region that is complementary to a nucleic acid target. The compositions are useful for targeting selected nucleic acid molecules and modulating the expression of one or more genes. In preferred embodiments the compositions of the present invention hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA. The present invention also provides methods for modulating gene expression. | 02-25-2016 |
20160053262 | METHOD FOR EFFICIENT EXON (44) SKIPPING IN DUCHENNE MUSCULAR DYSTROPHY AND ASSOCIATED MEANS - The invention relates to a nucleic acid molecule that binds and/or is complementary to the nucleotide molecule having sequence 5′-GUGGCUAACAGAAGCU (SEQ ID NO 1) and to its use in a method for inducing skipping of exon 44 of the DMD gene in a DMD patient. | 02-25-2016 |
20160053264 | SYNTHETIC MIMICS OF MIR-34 - Embodiments concern methods and compositions involving miR-34 mimics, including miR-34a and miR-34c mimics. In some embodiments, there are double-stranded RNA molecules with modified nucleotides having an active strand with a miR-34a sequence and a complementary passenger strand. In additional embodiments, there are double-stranded RNA molecules with modified nucleotides having an active strand with a miR-34c sequence and a complementary passenger strand. | 02-25-2016 |
20160053267 | MULTI-TARGETS INTERFERING RNA MOLECULES AND THEIR APPLICATIONS - This invention relates to interfering RNA (iRNA) molecules and their applications, especially multi-targets iRNA molecules and their applications. The said multi-targets iRNA molecules comprised of a sense strand annealed onto at least one antisense strand, each strand is at least 30 nucleotides in length, the sense or antisense strand has at least two segments, which can target at least two RNAs of different genes, or can target at least two portions of an RNA, and wherein the iRNA does not induce an interferon-response when transfected into a cell. The iRNA molecule can interfere with the translation procedure post-transcription, and the target gene is inhibited or blocked, the iRNA does not induce an interferon-response in vivo. The RNA molecules are the active ingredient in preparation of the drug which can regulate one or many genes function. | 02-25-2016 |
20160053270 | RNAi-MEDIATED INHIBITION OF HISTAMINE RECEPTOR H1-RELATED CONDITIONS - RNA interference is provided for inhibition of histamine receptor H1 mRNA expression, in particular, for treating patients having an HRH1-related condition or at risk of developing an HRH1-related condition such as allergic conjunctivitis, ocular inflammation, dermatitis, rhinitis, asthma, or allergy. | 02-25-2016 |
20160053319 | MICRO-RNAS MODULATING IMMUNITY AND INFLAMMATION - MicroRNAs are shown to be up- and/or down-regulated in inflammation and immune cells using a mouse model of asthma and regulatory T cells as source of RNA, respectively. Modulating the expression of these microRNAs can be effective in redirecting inflammation and immunity and hence, can be beneficial as biomarkers or as therapeutic agents against diverse human immunologic and inflammatory diseases. | 02-25-2016 |
20160058703 | PARTICULATE PHARMACEUTICAL COMPOSITION - The present invention provides a particulate pharmaceutical composition which has improved drug encapsulation stability and is suitable for a drug delivery system. The particulate pharmaceutical composition | 03-03-2016 |
20160058870 | LIPOPEPTIDES FOR DELIVERY OF NUCLEIC ACIDS - Lipopeptide compounds having a central peptide and a lipophilic group attached to at least one terminus of the peptide, or to at least one amino acid residue of the peptide, and salts and uses thereof. The lipophilic group may be attached to the N-terminus, C-terminus or both termini of the peptide. The lipophilic group may be attached to at least one interal amino acid residue. The lipophilic group may be attached to either termini or both and at least one internal amino acid residue. | 03-03-2016 |
20160060623 | METHOD OF REGULATING NFATC2 ACTIVITY IN LYMPHOCYTES - A method of decreasing NFATc2 activity in a lymphocyte includes administering to the lymphocyte an amount of an NFATc2 mRNA antagonist that binds to a binding site on the 3′UTR of NFATc2 mRNA effective to decrease the activity of NFATc2 mRNA in the lymphocyte. | 03-03-2016 |
20160060624 | HUNTINGTON'S DISEASE THERAPEUTIC COMPOUNDS - The present invention is directed to RNA interference (RNAi) molecules targeted against a Huntington's disease nucleic acid sequence, and methods of using these RNAi molecules to treat Huntington's disease. | 03-03-2016 |
20160060625 | MODULATION OF APOLIPOPROTEIN CIII (APOCIII) EXPRESSION - Provided herein are methods, compounds, and compositions for reducing expression of ApoCIII mRNA and protein in an animal. Also provided herein are methods, compounds, and compositions for increasing HDL levels and/or improving the ratio of TG to HDL and reducing plasma lipids and plasma glucose in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate any one or more of cardiovascular disease or metabolic disorder, or a symptom thereof. | 03-03-2016 |
20160060626 | MODULATION OF ANGIOPOIETIN-LIKE 3 EXPRESSION - Provided herein are methods, compounds, and compositions for reducing expression of an ANGPTL3 mRNA and protein in an animal. Also provided herein are methods, compounds, and compositions for reducing plasma lipids, plasma glucose and atherosclerotic plaques in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate any one or more of cardiovascular disease or metabolic disease, or a symptom thereof. | 03-03-2016 |
20160060627 | Pharmaceutical Composition for Inhibition of Disease-inducing microRNAs - The invention provides pharmaceutical compositions comprising short single stranded oligonucleotides, of length of between 8 and 17 nucleobases which are complementary to human microRNAs. The short oligonucleotides are particularly effective at alleviating miRNA repression in vivo. It is found that the incorporation of high affinity nucleotide analogues into the oligonucleotides results in highly effective anti-microRNA molecules which appear to function via the formation of almost irreversible duplexes with the miRNA target, rather than RNA cleavage based mechanisms, such as mechanisms associated with RNaseH or RISC. | 03-03-2016 |
20160060629 | SYNTHETIC MIMICS OF MIR-124 - Embodiments concern methods and compositions involving miR-124 mimics. In some embodiments, there are double-stranded RNA molecules with modified nucleotides having an active strand with a miR-124 sequence and a complementary passenger strand. | 03-03-2016 |
20160060632 | MODIFIED TGF-BETA2 OLIGONUCLEOTIDES - The invention refers to an oligonucleotide consisting of 10 to 18 nucleotides of selected regions of the TGF-beta2 nucleic acid sequence, which comprises modified nucleotides such as LNA, ENA, polyalkylene oxide-, 2′-fluoro, 2′-O-methoxy and/or 2′-O-methyl modified nucleotides. The invention further relates to pharmaceutical compositions comprising such oligonuc-leotide, wherein the composition or the oligonucleotide is used in the prevention and/or treatment of a malignant and/or benign tumor, an immunologic disease, fibrosis, or an ophthalmic disease such as dry eye, glaucoma or posterior capsular opacification (PCO). | 03-03-2016 |
20160060634 | Method For Treating Breast Cancer By Targeting Breast Cancer Stem Cell - The present invention relates to a composition for inhibiting growth of cancer stem cells, which includes an EXT1, LDHB, CD109, EFEMP2, RASIP1 or SERPINE1 gene expression inhibitor as an active ingredient, and a method of treating cancer using the same. The composition has targeted therapeutic activities against cancer stem cells important for resistance, metastasis and recurrence of breast cancer, and thus can be useful in fundamentally treating, preventing or alleviating cancer such as breast cancer by directly inhibiting expression of EXT1, LDHB, CD109, EFEMP2, RASIP1 or SERPINE1 which are very important for growth of the cancer stem cells. | 03-03-2016 |
20160060697 | Compositions and Methods for Evaluating Heart Failure - The present invention provides compositions and kits comprising miRNAs useful for the monitoring or diagnosis of heart disease in an individual. In particular, the compositions of the invention can be used for the prognosis of patients towards the development of left ventricular remodeling having suffered from an acute myocardial infarction. In addition, the present invention provides pharmaceutical compositions for the treatment of left ventricular remodeling. | 03-03-2016 |
20160068836 | POLYNUCLEOTIDES AND POLYPEPTIDE SEQUENCES INVOLVED IN THE PROCESS OF BONE REMODELLING - This invention relates, in part, to unique and newly identified genetic polynucleotides involved in the process of bone remodeling, variants and derivatives of the polynucleotides and corresponding polypeptides, uses of the polynucleotides, polypeptides, variants and derivatives, and methods and compositions for the amelioration of symptoms caused by bone remodeling disorders. Disclosed in particular are the isolation and identification of polynucleotides polypeptides variants and derivatives involved in osteoclast activity, validation of the identified polynucleotides for their potential as therapeutic targets and use of the polynucleotides, polypeptides, variants and derivatives for the amelioration of disease states and research purposes. | 03-10-2016 |
20160068837 | SHORT INTERFERING NUCLEIC ACID (siNA) MOLECULES CONTAINING A 2' INTERNUCLEOSIDE LINKAGE - The present invention relates to RNAi molecules, and compositions thereof, comprising a 2′ internucleoside linkage connecting the nucleotide at position 1 and the nucleotide at position 2 at the 5′ end of the antisense strand. Specifically, the invention relates to single- and double-stranded short interfering nucleic acid (siNA) molecules that are capable of mediating RNA interference comprising 5′ modified nucleotides that comprise, among other potential modifications, a 2′ internucleoside linkage. The invention further relates to 5′ modified nucleotides used as reagents to generate the RNAi molecules of the invention and methods of using the disclosed RNAi molecules. | 03-10-2016 |
20160068838 | SMN2 Element 1 Antisense Compositions and Methods and Uses Thereof - The invention provides methods and compositions for treatment of spinal muscular atrophy (SMA). In one aspect of the invention, a series of compositions comprising an antisense oligonucleotide targeting the Element 1 site on the SMN2 pre-mRNA and a Morpholino backbone is disclosed. In another aspect of the invention, a method of treating SMA patients by modulating the splicing of SMN2 pre-mRNA to increase the amount of full-length SMN is disclosed. Certain embodiments of the inventive method comprise administering an E1-targeting antisense oligonucleotide, such as Morpholino based antisense oligonucleotide, to a SMA subject. | 03-10-2016 |
20160068839 | METAL-LIGAND COORDINATION POLYMER NANOPARTICLES AND METHODS FOR MAKING - Disclosed herein are metal-ligand complexes containing polynucleotides, compounds for making the same, and methods of using the same. | 03-10-2016 |
20160068840 | RNAI MODULATION OF SCAP AND THERAPEUTIC USES THEREOF - The invention relates to a double-stranded ribonucleic acid (dsRNA) for inhibiting the expression of a SCAP gene (Human SCAP gene), comprising an antisense strand having a nucleotide sequence which is less that 30 nucleotides in length, generally 19-25 nucleotides in length, and which is substantially complementary to at least a part of a SCAP gene. The invention also relates to a pharmaceutical composition comprising the dsRNA together with a pharmaceutically acceptable carrier; methods for treating diseases caused by Human SCAP expression and the expression of a SCAP gene using the pharmaceutical composition; and methods for inhibiting the expression of a SCAP gene in a cell. | 03-10-2016 |
20160068841 | CANCER TREATMENT METHODS USING REMOTE CONDITIONING - Cancer treatment methods comprising a step of applying remote conditioning to the cancer subject, for example remote ischemic conditioning via several episodes of short-term limb occlusion. Upregulation and release of remote conditioning substances such as microRNA 144/451 cluster endogenously caused by remote conditioning may be beneficial in reducing the growth and proliferation of malignant cells. Remote conditioning may also be beneficial when combined with chemotherapy or radiation therapy as it may improve survival of healthy surrounding tissues and minimize side effects of these known cancer treatments. Remote conditioning may be non-invasively applied by a medical professional or self-applied by the cancer subject at home using an automatic device. The novel cancer treatment methods may be used for lung cancers, liver cancers, colorectal cancers, digestive cancers and other cancers. | 03-10-2016 |
20160068842 | miR-29 Mimics and Uses Thereof - The present invention relates to synthetic oligonucleotide mimetics of miRNAs. In particular, the present invention provides double-stranded, chemically-modified oligonucleotide mimetics of miR-29. Pharmaceutical compositions comprising the mimetics and their use in treating or preventing conditions associated with dysregulation of extracellular matrix genes, such as tissue fibrotic conditions, are also described. | 03-10-2016 |
20160068843 | Compositions and Methods for "Resistance-Proof" SiRNA Therapeutics for Influenza - The present invention relates to compositions and methods for development of resistance-proof siRNA therapeutics for prevention and treatment of influenza viral infections. The compositions include a pharmaceutical composition comprising siRNA molecules that target conserved regions of an influenza virus gene and a pharmaceutically acceptable polymeric carrier. In one embodiment, the polymeric carrier condenses the molecules to form a nanoparticle. | 03-10-2016 |
20160068845 | MODULATION OF DYSTROPHIA MYOTONICA-PROTEIN KINASE (DMPK) EXPRESSION - Provided herein are methods, compounds, and compositions for reducing expression of a DMPK mRNA and protein in an animal. Also provided herein are methods, compounds, and compositions for preferentially reducing CUGexp DMPK RNA, reducing myotonia or reducing spliceopathy in an animal. Such methods, compounds, and compositions are useful to treat, prevent, delay, or ameliorate type 1 myotonic dystrophy, or a symptom thereof. | 03-10-2016 |
20160068846 | MODULATION OF ANDROGEN RECEPTOR EXPRESSION - Certain embodiments are directed to compounds and compositions targeted to human androgen receptor (AR) for inhibiting androgen receptor levels in a cell, which can be useful for methods of treating cancer and inhibiting cancer cell growth or proliferation. | 03-10-2016 |
20160074428 | COMPOSITIONS AND METHODS FOR THE TREATMENT OF HUMAN IMMUNODEFICIENCY VIRUS INFECTION - In accordance with the present invention, a method for inhibiting HIV infection and/or latency in a patient in need thereof is provided. An exemplary method entails administration of an effective amount of an agent which inhibits CD163 receptor activity in a target cells, wherein inhibition of CD163 activity is effective to impede HIV uptake into target monocytes. In another aspect of the invention, a screening method for identifying agents useful for the treatment of HIV infection is disclosed. An exemplary method entails incubating a population of monocytes expressing CD163 in the presence and absence of said test agent, b) contacting said monocytes with a compound that detectably labels said CD163, thereby determining CD163 expression levels in the presence or absence of said agent, agents which inhibit expression of CD163 in treated cells relative to untreated cells being useful for inhibiting HIV infection in said cell. | 03-17-2016 |
20160076026 | DIAGNOSTIC AND THERAPEUTIC METHODS RELATING TO MICRORNA-144 - The invention provides methods based on the use of miRNA-144 as a predictive factor (e.g., as a companion diagnostic) and/or as a prophylactic or therapeutic agent. | 03-17-2016 |
20160076027 | COMPOSITIONS AND METHODS FOR MODULATION NUCLEIC ACIDS THROUGH NONSENSE MEDIATED DECAY - Disclosed herein are compounds, compositions and methods for modulating the amount or activity of a target nucleic acid. In certain embodiments, the amount or activity of a target nucleic acid is modulated through nonsense mediated decay. | 03-17-2016 |
20160076029 | siRNA Therapy for Transthyretin (TTR) Related Ocular Amyloidosis - The invention relates to a method of treating ocular amyloidosis by reducing TTR expression in a subject by administering a double-stranded ribonucleic acid (dsRNA) that targets a TTR gene to the retinal pigment epithelium of the subject. | 03-17-2016 |
20160076031 | PHOSPHOROUS-LINKED OLIGOMERIC COMPOUNDS AND THEIR USE IN GENE MODULATION - Oligonucleotide compositions comprising first and second oligonucleotides are provided wherein at least a portion of the first oligonucleotide is capable of hybridizing with at least a portion of the second oligonucleotide, at least a portion of the first oligonucleotide is complementary to and capable of hybridizing to a selected target nucleic acid, and at least one of the first or second oligonucleotides includes at least one nucleotide having a modified phosphorous-containing internucleoside linkage. Oligonucleotide/protein compositions are also provided comprising an oligonucleotide complementary to and capable of hybridizing to a selected target nucleic acid and at least one protein comprising at least a portion of an RNA-induced silencing complex (RISC), wherein at least one nucleotide of the oligonucleotide has a modified phosphorous-containing internucleoside linkage. | 03-17-2016 |
20160076032 | COMPOSITIONS AND METHODS - Provided herein are oligomeric compounds with conjugate groups. In certain embodiments, the oligomeric compounds are conjugated to N-Acetylgalactosamine. | 03-17-2016 |
20160076034 | RNA INTERFERENCE MEDIATED INHIBITION OF HEPATITIS B VIRUS (HBV) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (SINA) - The present invention relates to compounds, compositions, and methods for the study, diagnosis, and treatment of traits, diseases and conditions that respond to the modulation of HBV gene expression and/or activity, and/or modulate a HBV gene expression pathway. Specifically, the invention relates to double-stranded nucleic acid molecules including small nucleic acid molecules, such as short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA), and short hairpin RNA (shRNA) molecules that are capable of mediating or that mediate RNA interference (RNAi) against HBV gene expression. | 03-17-2016 |
20160076035 | COMPOSITIONS AND METHODS FOR SILENCING MARBURG VIRUS GENE EXPRESSION - The present invention provides compositions comprising siRNA molecules that target Marburg virus (MARV) gene expression, lipid particles comprising one or more (e.g., a combination) of the siRNA molecules, and methods of delivering and/or administering the lipid particles, for the purposes of treating MARV infection. | 03-17-2016 |
20160076036 | RNA APTAMERS AGAINST BAFF-R AS CELL-TYPE SPECIFIC DELIVERY AGENTS AND METHODS FOR THEIR USE - In one embodiment, a B cell specific aptamer-siRNA chimera is provided. The B cell specific aptamer-siRNA chimera may include an RNA aptamer that binds BAFF-R and an siRNA molecule conjugated to the RNA aptamer via a nucleotide linker. In another embodiment, a B cell specific RNA aptamer is provided. The RNA aptamer may be a molecule that binds to BAFF-R that has the sequence SEQ ID NO:37, SEQ ID NO:38 or SEQ ID NO:39. In some embodiments, the RNA aptamer is conjugated, via a nucleotide linker, to an siRNA molecule that suppresses expression of one or more target oncogenes in one or more B cells. In one aspect, the one or more target oncogenes are selected from Bcl6, Bcl2, STAT3, Cyclin D1, Cyclin E2 and c-myc. In another embodiment, methods for treating a B cell malignancy in a cancer patient are provided. Such methods may include administering a therapeutically effective amount of a therapeutic composition, the therapeutic composition comprising a B cell specific RNA aptamer that binds BAFF-R. | 03-17-2016 |
20160076037 | MODIFIED TGF-BETA OLIGONUCLEOTIDES - The invention refers to an oligonucleotide consisting of 10 to 20 nucleotides of selected regions of the TGF-beta1, TGF-beta2 or TGF-beta3 nucleic acid sequence, which comprises modified nucleotides such as LNA, ENA, polyalkylene oxide-, 2′-fluoro, 2′-O-methoxy and/or 2′-O-methyl modified nucleotides. The selected regions are preferably the region of nucleic acid no. 1380 to 1510, no. 1660 to 1680, no. 2390 to 2410, or no. 2740 to 2810 of the TGF-beta2 nucleic acid sequence of SEQ ID NO. 1, specific regions of the TGF-beta1 nucleic acid sequence of SEQ ID NO. 149, or specific regions of the TGF-beta3 nucleic acid sequence of SEQ ID No. 267. The invention further relates to pharmaceutical compositions comprising such oligonucleotide, wherein the composition or the oligonucleotide is used in the prevention and/or treatment of a malignant and/or benign tumor, an immunologic disease, fibrosis, glaucoma, etc. | 03-17-2016 |
20160076104 | METHODS AND COMPOSITIONS FOR ASSESSMENT OF PULMONARY FUNCTION AND DISORDERS - The present invention provides methods for the assessment of risk of developing chronic obstructive pulmonary disease (COPD), emphysema or both COPD and emphysema in smokers and non-smokers using analysis of genetic polymorphisms. | 03-17-2016 |
20160082015 | METHODS, COMPOSITIONS AND KITS FOR PROMOTING MOTOR NEURON SURVIVAL AND TREATING AND DIAGNOSING NEURODEGENERATIVE DISORDERS - Methods, compositions, and kits for promoting motor neuron survival and for treatment and diagnosis of neurodegenerative disorders such as Amyotrophic lateral sclerosis (ALS) and Spinal muscular atrophy (SMA) are described herein. | 03-24-2016 |
20160082020 | METHODS AND COMPOSITIONS FOR STIMULATING REEPITHELIALISATION DURING WOUND HEALING - The present invention relates to methods and compositions for stimulating reepithelialisation during wound healing. More particularly, the present invention relates to a mineralocorticoid receptor antagonist or an inhibitor of mineralocorticoid receptor gene expression for use in a method for stimulating reepithelialisation of the skin or of the cornea during wound healing. | 03-24-2016 |
20160082034 | SiRNA TARGETING ETS1 AND ELK1 AND METHOD OF USING SAME IN THE INHIBITION OF CIP2A GENE IN CANCER TREATMENT - Disclosed are methods of attenuating activity of the gene promoter of CIP2A. siRNAs are used to target against Ets1 and Elk1 transcriptional factors, thereby blocking the binding of Ets1 and Elk1 to the CIP2A gene promoter. It is disclosed that the siRNAs targeted against Ets1 and Elk1 attenuate the gene expression of CIP2A. A kit containing siRNA reagents for attenuating the CIP2A gene expression is also disclosed. | 03-24-2016 |
20160083726 | Compositions and Methods for the Treatment of Parkinson Disease by the Selective Delivery of Oligonucleotide Molecules to Specific Neuron Types - The invention provides a conjugate comprising (i) a selectivity agent which binds specifically to one or more neurotransmitter transporters selected from the group consisting of a dopamine transporter (DAT), serotonin transporter (SERT) or a norepinephrine transporter (NET) and (ii) a nucleic acid capable of specifically binding to a target molecule which is expressed in the same cell as the neurotransmitter transporter wherein said target molecule is α-synuclein or the mRNA encoding α-synuclein. The conjugates of the present invention are useful for the delivery of the nucleic acid to a cell of interest and thus, for the treatment of diseases which require a down-regulation of the protein encoded by the target nucleic acid as well as for the delivery of imaging agents to the cells for diagnostic purposes. | 03-24-2016 |
20160083727 | MIRNA FOR REGULATING FABP6 GENE AND METHOD OF USING THE SAME - A molecular marker miRNA for sheep breeding. The target gene of the miRNA is FABP6, and the miRNA inhibits the expression of the gene FABP6 in the adipose tissue of sheep. | 03-24-2016 |
20160083731 | APTAMER-RNAi THERAPEUTIC COMPOSITIONS - A recombinant nucleic acid comprising an aptamer that binds CD4 and an RNAi sequence that silences the expression of RORγ2 is described herein. Pharmaceutical compositions comprising the recombinant nucleic acid, particularly topical compositions are also described. Methods of treating inflammatory disease using the pharmaceutical composition are also described. | 03-24-2016 |
20160083732 | SYNTHETIC LETHALITY IN CANCER - There is described herein compounds, compositions and methods for inducing synthetic lethality in a cancer cell(s). | 03-24-2016 |
20160089390 | Use of MicroRNA or Inhibitors Thereof in Regulation of Lipid Metabolism - The present invention relates to use of a microRNA or an inhibitor thereof, and specifically, the present invention relates to use of a microRNA or an inhibitor thereof in preparing a medicament for regulating lipid metabolism or preparing a medicament for preventing or treating a disease related to lipid metabolism. The microRNA is one or more of the following: miRNA-96, miRNA-185, and miRNA-223. The present invention also relates to use of the microRNA or the inhibitor thereof in regulating the expression level of a protein related to lipid metabolism. The present invention also relates to a composition comprising the microRNA or the inhibitor thereof. The microRNA or the inhibitor thereof in the present invention can be used as a pharmaceutical component, and can be applied in preventing or treating a disease caused by lipid metabolism disorders such as hyperlipidemia, atherosclerosis, coronary heart disease or other diseases. | 03-31-2016 |
20160090593 | Lipid Formulated Compositions And Methods For Inhibiting Expression Of Transthyretin (TTR) - The invention relates to lipid formulated double-stranded ribonucleic acid (dsRNA) targeting a transthyretin (TTR) gene, and methods of using the dsRNA to inhibit expression of TTR. | 03-31-2016 |
20160090594 | COMPOSITION AND METHOD FOR INNER EAR SENSORY HAIR CELL REGENERATION AND REPLACEMENT - A composition and method for replacement and regeneration of hair cells of the inner ear is provided. The composition comprises an active agent in an amount effective to decrease Hes1 gene expression in a tissue of the inner ear. The active agent can be short interfering RNA (siRNA) molecules encapsulated in a biodegradable nanoparticle. The method involves administering a solution to the inner ear where the solution contains an active agent in an amount effective to decrease Hes1 gene expression. | 03-31-2016 |
20160090595 | COMPOSITIONS AND METHODS FOR MODULATING APOLIPOPROTEIN C-III EXPRESSION - Provided herein are oligomeric compounds with conjugate groups targeting apoplipoprotein C-III (ApoCIII). In certain embodiments, the ApoCIII targeting oligomeric compounds are conjugated to N-Acetylgalactosamine Also disclosed herein are conjugated oligomeric compounds targeting ApoCIII for use in decreasing ApoCIII to treat, prevent, or ameliorate diseases, disorders or conditions related to ApoCIII. Certain diseases, disorders or conditions related to ApoCIII include inflammatory, cardiovascular and/or metabolic diseases, disorders or conditions. The conjugated oligomeric compounds disclosed herein can be used to treat such diseases, disorders or conditions in an individual in need thereof. | 03-31-2016 |
20160090596 | COMPOSITIONS AND METHODS FOR MODULATING APOLIPOPROTEIN (a) EXPRESSION - Provided herein are oligomeric compounds with conjugate groups targeting apoplipoprotein (a) [apo(a)]. In certain embodiments, the apo(a) targeting oligomeric compounds are conjugated to N-Acetylgalactosamine. Also disclosed herein are conjugated oligomeric compounds targeting apo(a) for use in decreasing apo(a) to treat, prevent, or ameliorate diseases, disorders or conditions related to apo(a) and/or Lp(a). Certain diseases, disorders or conditions related to apo(a) and/or Lp(a) include inflammatory, cardiovascular and/or metabolic diseases, disorders or conditions. The conjugated oligomeric compounds disclosed herein can be used to treat such diseases, disorders or conditions in an individual in need thereof. | 03-31-2016 |
20160090599 | TREATMENT OF DELTA-LIKE 1 HOMOLOG (DLK1) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO DLK1 - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Delta-like (1) homolog (DLK1), in particular, by targeting natural antisense polynucleotides of Delta-like (1) homolog (DLK1). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression (DLK1). | 03-31-2016 |
20160090638 | METHODS OF PROGNOSTICALLY CLASSIFYING AND TREATING GLANDULAR CANCERS - This disclosure includes the identification of molecular markers, including ASPM, ATP9A, ACOX3, CD-C45L, SLC40A1, AGR2, and those found in TABLE 2, that are associated with the differentiation and the clinical prognosis of pancreatic cancer. More specifically, the disclosure includes the identification of sets of gene markers whose expression levels can be used to distinguish pancreatic cancers with higher degrees of differentiation from those with lower degrees of differentiation. These markers can be used to predict clinical prognosis of pancreatic cancer, including disease progression, recurrence or death of the hosts. The disclosure also provides methods of treating glandular cancers and kits for assaying glandular cancers, such as pancreatic cancer, breast cancer, and prostate cancer, by inhibiting the expression of ASPM or its ability to activate or maintain the Wnt signaling activity and/or the cancer stem cell populations of said glandular cancers. | 03-31-2016 |
20160095929 | PROMOTION OF WOUND HEALING - The present invention provides compositions and methods that promote wound healing in a subject with a cutaneous injury. In particular, the present invention provides systemic and/or local administration of one or more compositions that cause ganglioside depletion (e.g., glucosylceramide synthase (GCS) inhibitors) for the treatment of cutaneous wounds. | 04-07-2016 |
20160096871 | Methods and Reagents for Treatment of Age-Related Macular Degeneration - The invention relates to Factor H gene polymorphisms and haplotypes associated with an elevated or a reduced risk of AMD. The invention provides methods and reagents for diagnosis and treatment of AMD. | 04-07-2016 |
20160101070 | COMPOSITION COMPRISING ASM INHIBITOR AS ACTIVE INGREDIENT FOR PREVENTING OR TREATING DEGENERATIVE NEUROLOGICAL DISORDERS - The present invention relates to a composition comprising an ASM inhibitor as an active ingredient for preventing or treating degenerative neurological diseases. According to the present invention, when ASM is partially removed in an Alzheimer's disease model mouse, that is when ASM is inhibited therein, such when as an Alzheimer's disease model mouse with a partial removal of ASM is in a parabionic union with an Alzheimer's disease model mouse, or when an Alzheimer's disease model mouse is injected with the serum of an Alzheimer's disease model mouse from which ASM gene has been removed, the deposition of β-amyloid in the brain tissue is inhibited and the ability to learn and remember are improved, and the present invention confirms such superb effects. Accordingly, ASM inhibitor can be effectively used to prevent or treat degenerative neurological diseases. | 04-14-2016 |
20160101189 | MONOMERS AND OLIGONUCLEOTIDES COMPRISING CYCLOADDITION ADDUCT(S) - The invention features compounds of formula V or XII: | 04-14-2016 |
20160102311 | Protection Against Ionizing Radiation and Chemotherapy Toxicity via Latexin Regulation - The present invention relates to methods for protecting against damage caused by radiation and/or chemotherapy, and methods for treating bone marrow damage by reducing/inhibiting Latexin expression and/or Latexin activity. The methods comprise administering to a subject in need thereof a pharmaceutical composition comprising an antagonist that reduces expression and/or activity of latexin, wherein latexin is a latexin polynucleotide variant and/or a latexin polypeptide variant that binds to the antagonist. | 04-14-2016 |
20160102313 | DOUBLE STRANDED RNA COMPOUNDS TO RHOA AND USE THEREOF - The present invention relates to compounds, pharmaceutical compositions comprising same, methods of use thereof and kits for the down-regulation of RhoA gene. The compounds, compositions, methods and kits are useful in the treatment of subjects suffering from diseases or conditions and or symptoms associated with diseases or conditions in which RhoA expression has adverse consequences and for conferring neuroprotection. | 04-14-2016 |
20160103121 | CANCER EXAMINATION METHOD AND EXAMINATION KIT - An object of the present invention is to elucidate a molecular mechanism of ligand-independent activation of EphA2 in cancer cells, make EphA2 a more useful target in the treatment of cancer, and provide a cancer testing method and the like using the mechanism. The present invention provides, for example, a cancer testing method including a step of measuring an amount of an EphA2 protein fragment having a molecular weight of from 30 kDa to 80 kDa in a sample derived from a subject. | 04-14-2016 |
20160106842 | LIPIDS AND LIPID COMPOSITIONS FOR THE DELIVERY OF ACTIVE AGENTS - This invention provides for a compound of formula (I): or a pharmaceutically acceptable salt thereof, wherein R | 04-21-2016 |
20160108395 | CHIMERIC SINGLE-STRANDED ANTISENSE POLYNUCLEOTIDES AND DOUBLE-STRANDED ANTISENSE AGENT - Chimeric single-stranded polynucleotides and double-stranded antisense agents useful for modifying the expression of a target gene by means of an antisense effect are disclosed. The chimeric single-stranded antisense polynucleotide and double-stranded antisense agents comprise a central nucleotide region flanked by a first 5′-wing region and a first 3′-wing region of modified nucleotides, which are themselves flanked by a second 5′-wing region and/or a second 3′-wing region of nucleotides that have a low affinity for proteins and/or that have higher resistance to DNase or RNase than a natural DNA or RNA and are missing in a cell when the chimeric polynucleotide delivered. The double-stranded antisense agent further comprises a complementary strand annealed to the antisense strand. The polynucleotide can be used to modify RNA transcription levels, miRNA activity, or protein levels in cells. | 04-21-2016 |
20160108396 | OLIGOMERS TARGETING HEXANUCLEOTIDE REPEAT EXPANSION IN HUMAN C9ORF72 GENE - The disclosure relates to oligomers capable of targeting RNA expressed from the human C9ORF72 gene containing a pathogenic hexanucleotide repeat expansion. Such oligomers are useful for, among other things, reducing or eliminating C9ORF72 RNA and/or proteins translated therefrom, and treating or preventing diseases or disorders caused by, or associated with, hexanucleotide repeat expansion, including familial frontotemporal dementia (FTD) and familial amyotrophic lateral sclerosis (ALS). | 04-21-2016 |
20160108398 | Hydrophobically Modified Antisense Oligonucleotides Comprising a Ketal Group - The present invention concerns an oligonucleotide modified by substitution at the 3′ or the 5′ end by a moiety comprising at least one ketal functional group, wherein the ketal carbon of said ketal functional group bears two saturated or unsaturated, linear or branched, hydrocarbon chains comprising from 1 to 22 carbon atoms, and the use therefore as a medicament, in particular for use for treating cancer. | 04-21-2016 |
20160108399 | MODULATION OF HSP47 EXPRESSION - Provided herein are compositions, methods and kits for modulating expression of target genes, particularly heat shock protein 47 (hsp47). The compositions, methods and kits may include nucleic acid molecules (for example, short interfering nucleic acid (siNA), short interfering RNA (siRNA), double-stranded RNA (dsRNA), micro-RNA (miRNA) or short hairpin RNA (shRNA)) that modulate a gene encoding hsp47, for example, the gene encoding human hsp47. The composition and methods disclosed herein may also be used in treating conditions and disorders associated with hsp47 such as liver fibrosis, pulmonary fibrosis, peritoneal fibrosis and kidney fibrosis. | 04-21-2016 |
20160108400 | Single-Stranded Nucleic Acid Molecule for Controlling Gene Expression - Provided is a novel nucleic acid molecule that is a single-stranded nucleic acid molecule including an expression inhibitory sequence that inhibits expression of a target gene. The single-stranded nucleic acid molecule includes, in sequence from the 5′ side to the 3′ side: a 5′ side region (Xc); an inner region (Z); and a 3′ side region (Yc). The inner region (Z) is composed of an inner 5′ side region (X) and an inner 3′ side region (Y) that are linked to each other. The 5′ side region (Xc) is complementary to the inner 5′ side region (X). The 3′ side region (Yc) is complementary to the inner 3′ side region (Y). At least one of the inner region (Z), the 5′ side region (Xc), and the 3′ side region (Yc) includes the expression inhibitory sequence. | 04-21-2016 |
20160108401 | COMPLEMENT COMPONENT C5 iRNA COMPOSITIONS AND METHODS OF USE THEREOF - The invention relates to iRNA, e.g., double-stranded ribonucleic acid (dsRNA), compositions targeting the complement component C5 gene, and methods of using such iRNA, e.g., dsRNA, compositions to inhibit expression of C5 and to treat subjects having a complement component C5-associated disease, e.g., paroxysmal nocturnal hemoglobinuria. | 04-21-2016 |
20160108402 | METHODS FOR DIAGNOSING AND TREATING LEARNING OR MENTAL DISORDERS - The present invention embraces methods for the diagnosis and treatment of learning or mental disorders such as schizophrenia using miR-25, miR-98, or miR-185. | 04-21-2016 |
20160108404 | Method for Inhibiting HIV Replication in Mammal and Human Cells - The present invention describes a method to inhibit replication of the human immunodeficiency virus (HIV) by negatively modulating or altering the cytoskeleton, more precisely the proteins forming the intermediate cytoskeletal filaments, wherein the said proteins are vimentin and/or keratin-10. The replication of the virus is inhibited in human cells by intervening in the structure of these proteins. The present invention is also related to the use of agents, which comprise peptides and/or interfering RNA and/or lipidic compounds, said agents producing a negative modulation or alteration of the cytoskeleton to prevent or to treat the HIV infection. The invention provides means and methods for altering the cytoskeleton/filament structure of cells, as a result of which the infection of human cells by HIV is disturbed and can even be completely inhibited. The cytoskeleton is altered by reducing the amount of vimentin and/or keratin (e.g. by transcriptional control using interfering RNA) or by using peptides that disrupt the cytoskeleton. | 04-21-2016 |
20160108405 | LUNG CANCER DIAGNOSTICS AND THERAPEUTICS WITH MIR-660 - Provided are methods of treating lung cancer in a patient in need thereof. The method includes administration to the patient a composition comprising a therapeutically effective amount of a compound that reduces the expression level of E3 ubiquitin-protein ligase MDM2. The compound in certain instances is a miR-660 miRNA, or a functional variant thereof. The patient in need of treatment in certain instances expresses miR-660 in a lung tissue sample or biological fluid sample at a level lower as compared to a control level derived from a subject or plurality of subjects that do not have lung cancer, or as compared to a control level derived from a lung cancer patient or plurality thereof, that have been given a favorable prognosis; expresses MDM2 at a higher level in a lung tissue sample or biological fluid sample as compared to a control level derived from a subject or plurality of subjects that do not have lung cancer, or as compared to a control level derived from a lung cancer patient or plurality thereof that have been given a favorable prognosis; and/or expresses p53 in a lung tissue sample or a biological fluid sample below a control level derived from a lung tumor tissue sample, or plurality thereof, or a biological fluid sample, or plurality thereof, obtained from a patient that has a favorable lung cancer prognosis; or a control level derived from a healthy subject. | 04-21-2016 |
20160108406 | METHOD OF REGULATING CFTR EXPRESSION AND PROCESSING - The present invention relates to methods of reducing ΔF508-CFTR ubiquitination or degradation, or increasing ΔF508-CFTR processing or function in a CF cell comprising contacting the cell with a therapeutic agent that inhibits NEDD8, FBXO2, and/or SYVN1 expression in the cell. | 04-21-2016 |
20160108425 | COMPOSITIONS AND METHODS FOR INSECTICIDAL CONTROL OF STINKBUGS - Methods and compositions are provided which employ a silencing element that, when ingested by a pest, such as a Pentatomidae plant pest, decrease the expression of a target sequence in the pest. The present invention provides various target polynucleotides set forth in any one of SEQ ID NOS: 6-12, 18-40 or active variants and fragments thereof, wherein a decrease in expression of one or more the sequences in the target pest controls the pest (i.e., has insecticidal activity). Plants, plant part, bacteria and other host cells comprising the silencing elements or an active variant or fragment thereof of the invention are also provided. | 04-21-2016 |
20160108431 | PREVENTION AND TREATMENT OF ATRIAL FIBRILLATION - There is provided a nucleic acid that inhibits miR-31 in an atrial myocyte, for use in the prevention or treatment of atrial fibrillation in a subject. Also provided is a method for diagnosing or predicting the risk of atrial fibrillation in a subject, said method comprising: (i) determining the amount of miR-31 in a sample from the subject; (ii) comparing the amount of miR-31 in the sample with a reference standard; and (iii) identifying a difference in the amount of miR-31 in the sample relative to the reference standard; wherein an increase in the amount of miR-31 in the sample compared to the reference standard correlates with the presence of or an increased risk of atrial fibrillation in the subject; and wherein a decrease, or no difference in the amount of miR-31 in the sample compared to the reference standard correlates with the absence of an increased risk of atrial fibrillation in the subject. | 04-21-2016 |
20160113874 | NOVEL CATATONIC LIPIDS WITH VARIOUS HEAD GROUPS FOR OLIGONUCLEOTIDE DELIVERY - The instant invention provides for novel cationic lipids that can be used in combination with other lipid components such as cholesterol and PEG-lipids to form lipid nanoparticles with siRNA, to facilitate the cellular uptake and endosomal escape, and to knockdown target mRNA both in vitro and in vivo. | 04-28-2016 |
20160113957 | HYDROPHOBICALLY MODIFIED ANTISENSE OLIGONUCLEOTIDES COMPRISING A TRIPLE ALKYL CHAIN - The present invention concerns an oligonucleotide modified by substitution at the 3′ or the 5′ end by a moiety comprising at least three saturated or unsaturated, linear or branched hydrocarbon chains comprising from 2 to 30 carbon atoms, and the use therefore as a medicament, in particular for use for treating cancer. | 04-28-2016 |
20160114042 | AMINE-CONTAINING LIPIDOIDS AND USES THEREOF - Provided herein are lipidoids that may be prepared from the conjugate addition of alkylamines to acrylates. In some embodiments, provided lipidoids are biodegradable and may be used in a variety of drug delivery systems. Given the amino moiety of the lipidoids, they are well-suited for the delivery of polynucleotides, in addition to other agents. Nanoparticles containing the inventive lipidoids and polynucleotides have been prepared and have been shown to be effective in delivering siRNA. | 04-28-2016 |
20160115475 | Treatment of Insulin Resistance Through Inhibitors of Transcription Factor TSC22D4 - The present invention relates to modulators, in particular inhibitors, of TSC22D4 activity or expression and their uses for the prevention, treatment, and/or regulation of insulin resistance, metabolic syndrome and/or diabetes and/or for improving insulin sensitivity in mammal. The present invention further relates to screening methods in order to identify these modulators, the use of modulators as identified in the diagnosis of these diseases, as well as kits, comprising materials for performing the methods according to the present invention. | 04-28-2016 |
20160115476 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF THE ALAS1 GENE - The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the ALAS1 gene, and methods of using such dsRNA compositions to alter (e.g., inhibit) expression of ALAS1. | 04-28-2016 |
20160115478 | DERMATOLOGICAL, PHARMACEUTICAL COMPOSITION SUITABLE FOR OLIGONUCLEOTIDES - The invention relates to a cosmetic and/or dermatological and/or pharmaceutical composition for the topical use and application of oligonucleotides, in particular antisense-oligonucleotides such as DNAzyme, siRNSs, asDNAs or ribozymes for use as an agent against inflammatory diseases by means of emulsions having a dispersed, internal, discontinous aqueous phase. | 04-28-2016 |
20160115480 | METHODS AND COMPOSITIONS FOR THE TREATMENT OF CANCER - Some embodiments of the present invention relate to methods and compositions for treating cancer. More embodiments include methods and compositions for modulating the activity of the Hedgehog pathway. | 04-28-2016 |
20160115481 | PROSTATE CANCER-SPECIFIC ALTERATIONS IN ERG GENE EXPRESSION AND DETECTION AND TREATMENT METHODS BASED ON THOSE ALTERATIONS - Alterations in ERG gene expression can be observed in patients with prostate cancer. Specific ERG isoforms are associated with, or involved in, prostate cancer. Compositions comprising these isoforms provide therapeutic benefit and can be used in methods of detecting, diagnosing, prognosing, and treating prostate cancer. These compositions provide biomarkers for detecting the expression of combinations of the PSA/KLK3, PMEPA1, NKX3.1, ODC1, AMD1 and ERG genes. | 04-28-2016 |
20160115482 | RNA INTERFERENCE IN OCULAR INDICATIONS - The present invention relates to ocular administration of sd-rxRNA and rxRNAori molecules. | 04-28-2016 |
20160115483 | SILENCING OF POLO-LIKE KINASE EXPRESSION USING INTERFERING RNA - The present invention provides compositions comprising interfering RNA (e.g., siRNA, aiRNA, miRNA) that target polo-like kinase 1 (PLK-1) expression and methods of using such compositions to silence PLK-1 expression. More particularly, the present invention provides unmodified and chemically modified interfering RNA molecules which silence PLK-1 expression and methods of use thereof. The present invention also provides serum-stable nucleic acid-lipid particles (e.g., SNALP) comprising an interfering RNA molecule described herein, a cationic lipid, and a non-cationic lipid, which can further comprise a conjugated lipid that inhibits aggregation of particles. The present invention further provides methods of silencing PLK-1 gene expression by administering an interfering RNA molecule described herein to a mammalian subject. The present invention additionally provides methods of identifying and/or modifying PLK-1 interfering RNA having immunostimulatory properties. Methods for sensitizing a cell such as a cancer cell to the effects of a chemotherapy drug comprising sequentially delivering PLK-1 interfering RNA followed by the chemotherapy drug are also provided. | 04-28-2016 |
20160115484 | INHIBITION OF MAP4K4 THROUGH RNAI - RNAi constructs directed to MAP4K4 that demonstrate unexpectedly high gene silencing activities, and uses thereof are disclosed. The blunt-ended constructs have a double-stranded region of 19-49 nucleotides. The constructs have selective minimal modifications to confer an optimal balance of biological activity, toxicity, stability, and target gene specificity. For example, the strands may be modified (e.g., one or both ends of the sense strand is modified by 2′-O-methyl groups), such that the construct is not cleaved by Dicer or other RNAse III, the antisense strand may also be modified by a 2′-O-methyl group at the penultimate 5′-end nucleotide to greatly reduce off-target silencing. | 04-28-2016 |
20160115485 | MODULATION OF NLGn4 EXPRESSION, NK CELL ACTIVITY IN NON-ALCOHOLIC FATTY LIVER DISEASE (NAFLD) - The present invention provides a method of treating, attenuating or preventing a liver disorder by inhibiting NGn4 expression and thereby modulating the activity of NK cells. The present invention further relates to diagnosing a liver disorder by evaluating NLGn4 expression in NK cells. | 04-28-2016 |
20160115550 | cgb2 And cgb1 Genes; Diagnosis, Monitoring And Treatment Of Cancer - The present invention relates to methods for screening human tissue or fluid samples for changes in the expression of genes, in particular CGB2 and CBG1, characteristic of poor prognosis in cancer such as bladder cancer. The methods have application for the screening, diagnosis or monitoring of other common epithelial cancers including those of the bladder, breast, cervix, colon, endometrium, kidney, lung (including small cell lung carcinoma—SCLC), nasal/pharynx, oro/facial, ovary, prostate, pancreas, vagina and vulva. Methods of treating cancers by reducing the level of expression of CGB2 and CGB1 or products thereof are also disclosed. | 04-28-2016 |
20160116474 | COMPOSITIONS AND METHODS FOR DETECTING AND TREATING GLIOBLASTOMA - The present invention provides compositions and methods for the diagnosis and treatment of glioblastoma, particularly tumor propagating cells within the glioblastoma. | 04-28-2016 |
20160120996 | COMPOUNDS AND METHODS FOR TRANS-MEMBRANE DELIVERY OF MOLECULES - A novel delivery system for drugs, and especially macromolecules such as proteins or oligonucleotides through biological membranes is provided, and specifically delivery of siRNA. The delivery system comprises conjugation of the macromolecule drug to a moiety that enables effective passage through the membranes. Respectively, novel compounds and pharmaceutical compositions are provided, utilizing said delivery system. In one aspect of the invention, the compounds may be utilized in medical practice, for example, in delivery of siRNA or antisense oligonucleotides across biological membranes for the treatment of medical disorders. | 05-05-2016 |
20160122757 | siRNA TARGETING HSR1 - The invention provides siRNA molecules and LNA antisense oligonucleotides, which target Heat Shock RNA (HSR1) and effectively inhibit stress response in a cell, and their use for treatment of various diseases. | 05-05-2016 |
20160122758 | AGENTS FOR DOWNREGULATION OF THE ACTIVITY AND/OR AMOUNT OF BCL-XL AND/OR BCL-W - A method of treating an inflammatory or fibrotic disease in a subject is disclosed. The method comprises administering to the subject a therapeutically effective amount of an agent which down-regulates an activity and/or an amount of Bcl-xL and/or Bcl-w and/or p21, with the proviso that the inflammatory disease is not cancer. | 05-05-2016 |
20160122760 | COMPOSITIONS AND METHODS FOR MODULATING FOXP3 EXPRESSION - Aspects of the invention provide single stranded oligonucleotides for activating or enhancing expression of FOXP3. Further aspects provide compositions and kits comprising single stranded oligonucleotides for activating or enhancing expression of FOXP3. Methods for modulating expression of FOXP3 using the single stranded oligonucleotides are also provided. Further aspects of the invention provide methods for selecting a candidate oligonucleotide for activating or enhancing expression of FOXP3. | 05-05-2016 |
20160122761 | COMPOSITIONS AND METHODS FOR MODULATION OF TARGET NUCLEIC ACIDS - The present disclosure pertains generally to chemically-modified oligonucleotides for use in research, diagnostics, and/or therapeutics. In certain embodiments, the present disclosure describes compounds and methods for the modulation of a target nucleic acid. In certain embodiments, the present disclosure describes compounds and methods for the modulation of Apoliprotein C-III expression. | 05-05-2016 |
20160122762 | METHODS OF TREATING ATHEROSCLEROSIS - Certain embodiments of the invention provide a method of treating endothelial dysfunction, cardiovascular disease and/or atherosclerosis in a mammal, comprising administering an effective amount of a micro-RNA-204-5p inhibitor to the mammal. | 05-05-2016 |
20160122764 | RESPIRATORY DISEASE-RELATED GENE SPECIFIC SIRNA, DOUBLE-HELICAL OLIGO RNA STRUCTURE CONTAINING SIRNA, COMPOSITON CONTAINING SAME FOR PREVENTING OR TREATING RESPIRATORY DISEASE - The present invention relates to a gene specific siRNA related with respiratory diseases, particularly, to a gene specific siRNA related with idiopathic pulmonary fibrosis and chronic obstructive pulmonary disease (COPD), and a highly efficient double-helical oligo RNA structure containing the same, wherein the double-helical oligo RNA structure has a structure in which hydrophilic and hydrophobic materials are bonded at the both ends of the double-helical RNA (siRNA) using a simple covalent bond or a linker-mediated covalent bond to be effectively transferred into a cell, and may be converted into nanoparticles by the hydrophobic interaction of the double-helical oligo RNA structure in a solution. It is desirable that the siRNA contained in the double-helical oligo RNA structure is a siRNA specific to a CTGF, Cyr61, or Plekho1, which are genes related with respiratory diseases, particularly idiopathic pulmonary fibrosis and COPD. In addition, the present invention relates to a method for producing the double-helical oligo RNA structure and a pharmaceutical composition containing the double-helical oligo RNA structure for preventing or treating respiratory diseases, particularly idiopathic pulmonary fibrosis and COPD. | 05-05-2016 |
20160122765 | QSOX1 AS AN ANTI-NEOPLASTIC DRUG TARGET - The present invention provides methods for tumor treatment by administering an inhibitor of quiescin sulfhydryl oxidase 1 (QSOX1), compositions comprising such inhibitors, and methods for identifying such inhibitors. | 05-05-2016 |
20160122767 | METHODS AND PHARMACEUTICAL COMPOSITIONS FOR THE TREATMENT OF ERYTHROPOIETIC PROTOPORPHYRIA - The present invention relates to methods and pharmaceutical compositions for the treatment of Erythropoietic Protoporphyria. In particular, the present invention relates to a method for increasing the amount of functional FECH in a erythroid cell carrying the hypomorphic allele IVS3 48C/T (rs2272783) in trans to a deleterious mutation in the FECH gene comprising the step of consisting of bringing the erythroid cell into contact with at least one antisense oligonucleotide (ASO) comprising the sequence as set forth by SEQ ID NO: 2 (5′ gcagcctgagaaatgtttt 3′) to prevent splicing of the cryptic exon inserted into the mutant IVS3 48C/T (rs2272783) FECH mRNA. | 05-05-2016 |
20160122769 | METHOD OF SCREENING FOR CHAPERONIN MODULATOR - The present invention relates to a method of screening for modulator of chaperonin that is involved in protein aggregation inducing neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease and Huntington's disease, use of the chaperonin modulator screened by the method for prevention and treatment of neurodegenerative diseases. According to the present invention, novel negative chaperonin modulator is provided, and chaperonin modulator may be more rapidly and conveniently screened with the negative modulator as a target. Furthermore, by using the screened material, neurodegenerative diseases such as Alzheimer's disease, Parkinson's disease and Huntington's disease may be effectively prevented or treated without concern for cell death due to autophagy, which is the existing method of removing protein aggregate. | 05-05-2016 |
20160122829 | Compositions and Methods for Identification, Assessment, Prevention, and Treatment of Cancer Using PD-L1 Isoforms - The present invention relates to methods for identifying, assessing, preventing, and treating cancer (e.g., head, neck, and/or lung cancers in humans). A variety of PD-L1 isoforni biomarkers are provided, wherein alterations in the copy number of one or more of the biomarkers and/or alterations in the amount, structure, and/or activity of one or more of the biomarkers is associated with cancer status and indicates amenability to treatment or prevention by modulating PD-1 and/or PD-L! levels. | 05-05-2016 |
20160128329 | Double-stranded ribonucleic acid as control against insects - A composition for use in formulations for controlling insect populations, including populations of mosquito and flies. The composition comprises one or more double-stranded constructs inhibitory to RNA transcription of ribosomal proteins. The invention also relates to method of using the compositions in formulations to inhibit insect populations. | 05-12-2016 |
20160129017 | SHIP INHIBITION TO COMBAT OBESITY - The present invention relates to the use of SHIP1 inhibitors and pan-SHIP1/2 inhibitors in various methods, including, without limitation: (i) a method to treat obesity or reduce body fat of an obese subject; (ii) a method to limit bone development in a subject suffering from an osteopetrotic or sclerotic disease; (iii) a method to treat or prevent diabetes; (iv) a method to reduce glucose intolerance or insulin resistance; and (v) a method to lower cholesterol. | 05-12-2016 |
20160130577 | NUCLEOTIDE SEQUENCE MOTIFS DIRECTING NUCLEIC ACID LOCATION TO EXTRACELLULAR VESICLES - The present invention discloses the use of isolated short sequence motifs capable of directing or packaging regulatory nucleic acids, preferably RNAs, into extracellular vesicles, preferably exosomes. This mechanism is enhanced by the binding of hnRNP family proteins, which are sumoylated, to such nucleic acid. In this sense, sumoylated hnRNPs directs the loading of nucleic acids into EVs through recognition of specific short motifs disclosed in the present invention. Additionally, the present invention discloses recombinant nucleic acids comprising such sequence motifs, EVs in turn comprising these recombinant nucleic acids, as well as the compositions, preferably pharmaceutical compositions comprising either the recombinant nucleic acids or the EVs of the invention. The identification of such motifs is a useful tool for use in genetic engineering and gene therapy. | 05-12-2016 |
20160130578 | REDUCED SIZE SELF-DELIVERING RNAI COMPOUNDS - The present invention relates to methods for in vivo administration of sd-rxRNA molecules. | 05-12-2016 |
20160130580 | RNA AMIDATES AND THIOAMIDATES FOR RNAI - The present disclosure relates to RNA amidates and thioamidates useful for RNA interference applications. The RNA amidates and thioamidates contain at least one internucleoside linkage chosen from ribo-N3′→P5′ phosphoramidate (NP) and ribo-N3′→P5′ thiophosphoramidate (NPS) linkages, and optionally further containing at least one covalently conjugated lipid moiety. Compositions comprising the amidates and thioamidates are disclosed, as are methods for their use in modulating gene expression. | 05-12-2016 |
20160130581 | TARGETING DOMAIN AND RELATED SIGNAL ACTIVATED MOLECULAR DELIVERY - Provided herein are signal activatable molecular constructs for enzyme-assisted delivery of molecules and related components, such as a sensor domain, compositions, methods and systems. | 05-12-2016 |
20160130582 | OLIGONUCLEOTIDE MODULATORS OF B-CELL CLL/LYMPHOMA 11A (BCL11A) AND USES THEREOF - The present invention provides, among other things, oligonucleotide modulators (e.g., inhibitors) of B cell lymphoma/leukemia 11A (BCL11A) and improved methods and composition for treating BCL11A-related diseases, disorders or conditions based on such modulators. | 05-12-2016 |
20160130584 | TREATMENT OF ALPHA-L-IDURONIDASE (IDUA) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO IDUA - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Alpha-L-Iduronidase (IDUA), in particular, by targeting natural antisense polynucleotides of Alpha-L-Iduronidase (IDUA). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of IDUA. | 05-12-2016 |
20160130586 | PREVENTIVE OR THERAPEUTIC AGENT FOR FIBROSIS - Provided is siRNA effective for the treatment of fibrosis and a pharmaceutical containing the siRNA. | 05-12-2016 |
20160130663 | METHOD FOR PREDICTING RESPONSE TO CANCER TREATMENT - It has been found that BRG1 and BRM have a synthetic-lethal relationship, and that a treatment for inhibiting BRM is a promising approach for treating a BRG1-deficient cancer having no mutation in known therapeutic target genes. Moreover, it has also been revealed that, in this therapeutic strategy, a BRM inhibitor may be administered to a cancer patient after the selection based on BRG1 function suppression, thus enabling an efficient treatment based on the companion diagnosis. | 05-12-2016 |
20160136195 | USE OF HGMA-TARGETED PHOSPHOROTHIOATE DNA APTAMERS TO SUPPRESS CARCINOGENIC ACTIVITY AND INCREASE SENSITIVITY TO CHEMOTHERAPY AGENTS IN HUMAN CANCER CELLS - Elevated high mobility group A (HMGA) protein expression in human cancer cells, and especially human pancreatic cancer cells, is correlated with resistance to the chemotherapy agent gemcitabine. The present invention uses HMGA-targeted AT-rich phosphorothioate DNA (AT-sDNA) aptamers to suppress HMGA carcinogenic activity. Cell growth of human pancreatic cancer cells (AsPC-1 and Miapaca-2) transfected with AT-sDNA were monitored after treatment with gemcitabine. Significant increases in cell death in AT-sDNA transfected cells compared to non AT-rich sDNA treated cells were observed in both cell lines. The data indicates the potential use of HMGA targeted DNA aptamers to enhance chemotherapy efficacy in human cancer treatment, and in particular human pancreatic cancer treatment. | 05-19-2016 |
20160138015 | ANTISENSE OLIGONUCLTEOTIDES FOR TREATMENT OF CANCER STEM CELLS - The invention provides oligonucleotides complementary to a non-coding chimeric mitochondrial RNA as well as compositions and kits comprising the same, and their use in treating and preventing metastasis or relapse of a cancer in an individual previously treated for cancer with a therapy. The invention also provides oligonucleotides complementary to a non-coding chimeric mitochondrial RNA as well as compositions and kits comprising the same, and their use in treating a refractory cancer (e.g., a refractory HPV-associated cancer). | 05-19-2016 |
20160138016 | MICRORNA COMPOUNDS AND METHODS FOR MODULATING MIR-21 ACTIVITY - Described herein are compositions and methods for the inhibition of miR-21 activity. The compositions have certain nucleoside modification patterns that yield potent inhibitors of miR-21 activity. The compositions may be used to inhibit miR-21, and also to treat diseases associated with abnormal expression of miR-21, such as fibrosis and cancer. | 05-19-2016 |
20160138017 | MICRORNA AND USES IN BROWN FAT DIFFERENTIATION - This invention reveals a novel miRNA and a novel miRNA-regulated signaling network which controls brown adipogenesis and thermogenic programs, thereby providing a powerful approach for the treatment of obesity and related metabolic diseases. In this regard, the present invention is also directed towards methods of treatment of obesity and excess weight (overweight) and metabolic disorders caused by or aggravated by a subject being overweight or obese. | 05-19-2016 |
20160138018 | ANTI-miR-27b AND ANTI-miR-148a OLIGONUCLEOTIDES AS THERAPEUTIC TOOLS FOR TREATING DYSLIPIDEMIAS AND CARDIOVASCULAR DISEASES - The present invention relates to anti-miR-27b and anti-miR-148a oligonucleotides that are capable of decreasing the level and/or activity of miR-27b and miR-148a, respectively. In conjunction with the oligonucleotide molecules of the present invention, the invention also provides a method for decreasing the level and/or activity of miR-27b and/or miR-148a in a cell. In a further embodiment, the invention provides a method for treating a disease, especially dyslipidemias and cardiovascular diseases. | 05-19-2016 |
20160138023 | TREATMENT OF BRAIN DERIVED NEUROTROPHIC FACTOR (BDNF) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO BDNF - The present invention relates to antisense oligonucleotides that modulate the expression of and/or function of Brain derived neurotrophic factor (BDNP), in particular, by targeting natural antisense polynucleotides of Brain derived neurotrophic factor (BDNF). The invention also relates to the identification of these antisense oligonucleotides and their use in treating diseases and disorders associated with the expression of BDNF. | 05-19-2016 |
20160138025 | OLIGONUCLEOTIDE CONJUGATES - The present invention relates to oligomeric compounds and conjugates thereof that target Proprotein Convertase Subtilisin/Kexin type 9 (PCSK9) PCSK9 mRNA in a cell, leading to reduced expression of PCSK9. Reduction of PCSK9 expression is beneficial for a range of medical disorders, such as hypercholesterolemia and related disorders. | 05-19-2016 |
20160138026 | COMPOSITIONS AND METHODS FOR THE TREATMENT OF VprBP-RELATED CANCERS - This disclosure provides methods and compositions to inhibit or suppress tumor growth or to treat cancer by inhibiting VprBP kinase activity. Also provided are methods of determining the effectiveness of the methods and compositions to inhibit or suppress tumor growth or to treat cancer by inhibiting VprBP kinase activity, methods for detecting a cancer, and methods for screening potential agents that inhibit VprBP kinase activity. | 05-19-2016 |
20160138029 | ANTISENSE-OLIGONUCLEOTIDES AS INHIBITORS OF TGF-R SIGNALING - The present invention relates to antisense-oligonucleotides having a length of at least 10 nucleotides, wherein at least two of the nucleotides are LNAs, their use as inhibitors of TGF-R signaling, pharmaceutical compositions containing such antisense-oligonucleotides and the use for prophylaxis and treatment of neurological, neurodegenerative, fibrotic and hyperproliferative diseases. | 05-19-2016 |
20160138109 | METHODS FOR DETECTING AND TREATING MULTIPLE MYELOMA - The invention provides methods for using the expression levels and subcellular localization of non-coding mitochondrial RNAs to select individuals or subpopulation of individuals for treatment with an anticancer therapy for multiple myeloma. Additional methods provided herein are useful for determining whether an individual in remission for multiple myeloma following successful treatment will be likely to suffer a relapse as well as to identify individuals who have suffered a relapse of multiple myeloma. | 05-19-2016 |
20160139127 | ONCOGENE ASSOCIATED WITH HUMAN CANCERS AND METHODS OF USE THEREOF - The present invention provides methods of treating cancer by inhibiting MECP2 and identifying cancers that will respond to therapy using MECP2 as a biomarker. | 05-19-2016 |
20160139149 | CHI3L1 FOR THE DETECTION AND TREATMENT OF NONALCOHOLIC STEATOHEPATITIS - Disclosed herein are compositions and methods for detecting nonalcoholic steatohepatitis (NASH) measuring CHI3L1 levels. In some embodiments, the methods described herein can distinguish NASH from nonalcoholic fatty liver disease. CHI3L1 levels can also be used to monitor treatment progress in patients having NASH. Also disclosed herein are compositions and methods for treating NASH by targeting CHI3L1. | 05-19-2016 |
20160143917 | COMPOSITIONS AND METHODS FOR MODULATING HIV ACTIVATION - A pharmaceutical composition for inducing reactivation of latent provirus in an HIV infected cell includes an ESR-1 antagonist or an ESR-1 coactivator antagonist and a pharmaceutically acceptable carrier. | 05-26-2016 |
20160143938 | Methods and compositions for modulating cancer stem cells - Disclosed are compositions and methods that use lysine demethylase inhibitors for inhibiting the growth of cancer stem cells or tumor initiating cells, for enhancing the biological effects of chemotherapeutic drugs or irradiation on cancer cells and/or for preventing cancer recurrence. | 05-26-2016 |
20160143939 | COMPOSITIONS, KITS AND METHODS FOR TREATMENT OF CARDIOVASCULAR,IMMUNOLOGICAL AND INFLAMMATORY DISEASES - Compositions, kits, cells and methods for treating cardiovascular (e.g., myocardial ischemia and heart failure), immunological, and inflammatory diseases or disorders involve the use of the mature and precursor sequences of microRNAs 142-5p, 142-3p, 17-5p, 17-3p, 374, and 20a, and of antisense molecules complementary to these sequences, to manipulate processes relevant to, for example, the cardiac response to stress, including survival signaling, angiogenesis, stem cell differentiation along muscle or vascular lineages, and repression or promotion of cardiac myocyte growth. Also described are methods to treat cardiovascular, immunological and inflammatory diseases by engineering cells containing specific micro-RNAs or antagomirs against specific mRNAs. The engineered cells can then be used to treat patients with such diseases by autologous stem cell therapy. | 05-26-2016 |
20160145607 | MICRO-RNA FAMILY THAT MODULATES FIBROSIS AND USES THEREOF - The present invention relates to the identification of a microRNA family, designated miR-29a-c, that is a key regulator of fibrosis in cardiac tissue. The inventors show that members of the miR-29 family are down-regulated in the heart tissue in response to stress, and are up-regulated in heart tissue of mice that are resistant to both stress and fibrosis. Also provided are methods of modulating expression and activity of the miR-29 family of miRNAs as a treatment for fibrotic disease, including cardiac hypertrophy, skeletal muscle fibrosis other fibrosis related diseases and collagen loss-related disease. | 05-26-2016 |
20160145611 | AGE-RELATED MACULAR DEGENERATION TREATMENT - This invention is directed to an RNA interference (RNAi) agent and the use of that RNAi agent to treat Age-related Macular Degeneration, as well as pharmaceutical compositions containing the RNAi agents of the invention. The RNAi agent is a DNA-directed RNA interference (ddRNAi) agent (being an RNA molecule), together with an expression cassette or construct to express that agent in a cell (including in vivo), for inhibiting, preventing or reducing expression of an AMD associated gene. Preferably that AMD associated gene is one that is associated with wet AMD. | 05-26-2016 |
20160145612 | DIAGNOSIS AND TREATMENT OF METABOLIC DISORDERS - A method or assay for determining whether an individual is a HNF1A-MODY carrier is described and comprising a step of assaying a biological sample from the individual to detect increased abundance of a micro RNA molecule selected from miR103, miR551b, or miR224, or detect decreased abundance of a micro RNA molecule selected from miR503, and miR539. Increased abundance of one or more of miR103, miR551b, or miR224 or decreased abundance of one or more of miR503 and miR539, indicates that the individual is a HNF1A-MODY carrier. A method for treating metabolic disorders, especially diabetes mellitus, is also described. | 05-26-2016 |
20160145613 | OLIGONUCLEOTIDE DUPLEXES COMPRISING DNA-LIKE AND RNA-LIKE NUCLEOTIDES AND USES THEREOF - Novel oligonucleotide pairs which can form a duplex comprising one or more DNA-like nucleotides (e.g., 2′-substituted arabinonucleotides (ANA)); in combination with one or more RNA-like nucleotides (e.g., 2′-substituted ribonucleotides (RNA) and/or locked nucleic acid nucleotides (LNA)), are disclosed. The use of such oligonucleotide duplexes, such as for silencing the expression of a nucleic acid or gene of interest using small interfering RNA (siRNA) technologies, is also disclosed. | 05-26-2016 |
20160145614 | DOUBLE-STRANDED AGENTS FOR DELIVERING THERAPEUTIC OLIGONUCLEOTIDES - Disclosed are double-stranded nucleic acid agents that can deliver a therapeutic oligonucleotide within a biological sample, and methods for using the same. In one embodiment, the double-stranded nucleic acid agent comprises a first strand comprising a first RNA region, and a second strand comprising a first DNA region, wherein said first RNA region and said first DNA region are hybridized as a RNA/DNA heteroduplex. Said first strand further comprises a nucleic acid therapeutic oligonucleotide region that is capable of being cleaved from at least one nucleotide in said first RNA region. Methods for using the double-stranded nucleic acid agents include methods for delivering the therapeutic oligonucleotide as a single strand by cleaving it from at least a portion of the first RNA region. The methods further include delivering the double-stranded nucleic acid agent and thus the therapeutic oligonucleotide to a target site within the body of a treatment subject. | 05-26-2016 |
20160145615 | AGONISTS OF DDAH1 FOR TREATING ENDOTHELIAL DYSFUNCTION - The present invention derives from the finding that expression of DDAH1 is heavily post-transcriptionally regulated by microRNAs. By preventing or blocking the interaction between such microRNAs and the DDAH1 mRNA, the production of DDAH1 protein can be increased. This has utility in the prevention or treatment of diseases and disorders that are associated with reduced DDAH1 levels or increased ADMA levels, such as diseases or disorders that are characterised by endothelial dysfunction. | 05-26-2016 |
20160145616 | INHIBITION OF MICRORNA FOR TREATMENT OF SEPSIS - A method of treating sepsis comprises administering an agent that inhibits the activity of an miRNA that is upregulated in sepsis. | 05-26-2016 |
20160145617 | COMPOSITIONS FOR MODULATING TAU EXPRESSION - Disclosed herein are antisense compounds and methods for decreasing Tau mRNA and protein expression. Such methods, compounds, and compositions are useful to treat, prevent, or ameliorate Tau-associated diseases, disorders, and conditions. | 05-26-2016 |
20160145618 | ALBUMIN PRODUCTION AND CELL PROLIFERATION - The present invention provides short activating RNA molecules which up-regulate albumin production. The present invention also provides methods of up-regulating albumin production, such methods involving the use of short activating RNA molecules capable of increasing the expression of albumin. The present invention also provides the use of the short activating RNA molecules in therapy, such as treating or preventing a hyperproliferative disorder and/or a disorder characterised by hypoalbuminemia. | 05-26-2016 |
20160145621 | RNAi Agent for Inhibition of Chikungunya Virus - Provided herein are RNAi agents for inhibition of Chikungunya virus. The present disclosure provides RNAi agents for inhibition of Chikungunya virus, particularly by targeting the E2 gene and nsP1 gene or both of the Chikungunya virus; the RNAi agents comprising of the entire nucleotide sequence set forth is SEQ ID 1 or SEQ ID 5 or combination thereof; or comprising of 15 or more contiguous nucleotides as set forth is SEQ ID 1 or SEQ ID 5 or combination thereof along with the addition nucleotides from the contiguous region of the E2 and nsP1 target gene. The invention further provides a RNAi composition for reducing the E2 protein and nsP1 protein level of Chikungunya virus and inhibition of Chikungunya virus replication. The combination of RNAi agents provides an excellent therapeutic composition for treatment of Chikungunya virus infection. | 05-26-2016 |
20160145622 | DENGUE VIRUS-SPECIFIC SIRNA, DOUBLE HELIX OLIGO-RNA STRUCTURE COMPRISING SIRNA, AND COMPOSITION FOR SUPPRESSING PROLIFERATION OF DENGUE VIRUS COMPRISING RNA STRUCTURE - The present invention relates to a dengue virus-specific siRNA, a double-stranded oligo RNA structure comprising the siRNA, and a composition for inhibiting dengue virus replication, which comprises the same, in which the double-stranded oligo RNA structure comprises a hydrophilic compound and hydrophobic compound conjugated to both ends of the double-stranded RNA (siRNA) by a single covalent bond or a linker-mediated covalent bond so that they will be efficiently delivered into cells, and can be converted into nanoparticles by hydrophobic interactions between the double-stranded oligo RNA structures in an aqueous solution. The siRNA included in the double-stranded oligo RNA structure acts specifically on all dengue virus serotypes. The present invention also relates to a method for preparing the double-stranded oligo RNA structure, and a pharmaceutical composition for preventing or treating dengue virus infection, which comprises the double-stranded oligo RNA structure. | 05-26-2016 |
20160145623 | METHOD FOR THE TARGETED KILLING OF CELLS BY NUCLEOTIDE MOLECULES THAT ARE DIRECTED TO mRNA BINDING, AND ALSO NUCLEOTIDE MOLECULES AND APPLICATION KIT FOR SUCH USE - Nucleotide molecules are used for the targeted killing of cells, which bind with a nucleotide sequence to a single region of the mRNA which, according to sequencing analyses, is statistically very rarely subject to a mutation and, thus, also in case of increased mutation rates in the whole genome, reliably kills the cell without further mRNA binding or other influence on the cell being necessary. | 05-26-2016 |
20160145624 | LIVER CANCER RELATED GENES-SPECIFIC siRNA, DOUBLE-STRANDED OLIGO RNA MOLECULES COMPRISING THE siRNA, AND COMPOSITION FOR PREVENTING OR TREATING CANCER COMPRISING THE SAME - There is provided a liver cancer related specific siRNA and high efficiency double-stranded oligo RNA molecules containing the same. The double-stranded oligo RNA molecules have a structure in which hydrophilic and hydrophobic compounds are conjugated to both ends of the double-stranded oligo RNA molecules by a simple covalent bond or a linker-mediated covalent bond in order to be efficiently delivered into cells and may be converted into nanoparticles in an aqueous solution by hydrophobic interactions of the double-stranded oligo RNA molecules. The siRNA contained in the double-stranded oligo RNA molecules may be liver cancer related genes, particularly ZBTB7A, YAP1 or CHD1L specific siRNA. | 05-26-2016 |
20160145626 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF TMPRSS6 GENE - The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the TMPRSS6 gene, and methods of using such dsRNA compositions to inhibit expression of TMPRSS6. | 05-26-2016 |
20160145628 | NANOCARRIER SYSTEM FOR MICRORNAS AND USES THEREOF - Described herein are novel polyglycerol-amine polymeric nanocarriers in complex with microRNAs and their uses in the treatment of cancer, in particular glioblastoma. Delivery of the polymeric nanocarriers in complex with microRNAs in cell lines and in vivo inhibited cell proliferation, cell cycle progression, cell migration and tumor growth. | 05-26-2016 |
20160145629 | TMPRSS6 iRNA COMPOSITIONS AND METHODS OF USE THEREOF - The invention relates to RNAi agents, e.g., double-stranded RNAi agents, targeting the TMPRSS6 gene, and methods of using such RNAi agents to inhibit expression of TMPRSS6 and methods of treating subjects having a TMPRSS6 associated disorder, e.g., an iron overload associated disorder, such as β-thalassemia or hemochromatosis. | 05-26-2016 |
20160151407 | Compositions and Methods for Treating Alzheimer's Disease and Other Tauopathies | 06-02-2016 |
20160152973 | CHEMICALLY MODIFIED SHORT INTERFERING NUCLEIC ACID MOLECULES THAT MEDIATE RNA INTERFERENCE | 06-02-2016 |
20160152974 | COMPOUNDS AND METHODS FOR MODULATING APOLIPOPROTEIN C-III EXPRESSION FOR IMPROVING A DIABETIC PROFILE | 06-02-2016 |
20160152976 | COMPOUND ADMINISTRATION PRECURSOR AND MEDICAMENT CARRIER PREPARATION | 06-02-2016 |
20160152978 | SELECTIVE REDUCTION OF THE DELETERIOUS ACTIVITY OF EXTENDED TRI-NUCLEOTIDE REPEAT CONTAINING GENES | 06-02-2016 |
20160152981 | APTAMERS AND USE OF THE APTAMERS IN THE DIAGNOSIS AND TREATMENT OF CANCER | 06-02-2016 |
20160152985 | COMPOSITIONS AND METHODS FOR TREATING CANCER | 06-02-2016 |
20160152986 | METHODS AND MATERIALS FOR TREATING CANCER | 06-02-2016 |
20160153041 | DETECTION AND TREATMENT OF IRRITABLE BOWEL SYNDROME | 06-02-2016 |
20160158210 | CORNEAL ENDOTHELIUM ECM THERAPEUTIC MEDICAMENTS - The present invention provides medicaments for treating or preventing a disease, disorder, or condition associated with extracellular matrix (ECM) abnormality in a corneal endothelium, wherein the medicaments comprise a TGF-beta signal inhibiting agent. More specifically, this disease, disorder, or condition is a disorder associated with Fuchs' endothelial corneal dystrophy. Such a disorder includes photophobia, blurred vision, vision disorder, eye pain, lacrimation, hyperemia, pain, bullous keratopathy, ophthalmic unpleasantness, a decrease in contrast, glare, edema in corneal stroma, bullous keratopathy, corneal opacity, and the like. A preferable TGF-beta signal inhibiting agent includes 4-[4-(1,3-benzodioxol-5-yl)-5-(2-pyridinyl)-1H-imidazol-2-yl]benzamide. | 06-09-2016 |
20160158363 | MULTI-TAILED LIPIDS AND USES THEREOF - The present invention provides multi-tailed lipid compounds, and salts and stereoisomers thereof, and methods of preparing the compounds. Also provided are compositions including a compound of the invention and an agent (e.g., an siRNA, mRNA, plasmid DNA, small molecule, protein, peptide). The present invention also provides methods, and kits using the compositions for delivering an agent to a subject (e.g., to the liver, spleen, or lung of the subject) or cell and for treating and/or preventing a range of diseases, such as genetic diseases, proliferative diseases, hematological diseases, neurological diseases, immunological diseases, gastrointestinal diseases (e.g., liver diseases), respiratory diseases (e.g., lung diseases), painful conditions, psychiatric disorders, metabolic disorders, and spleen diseases. | 06-09-2016 |
20160160181 | PROCESSES FOR PRODUCING EXOSOMES IN REDUCED OXYGEN CULTURE CONDITIONS - The invention encompasses methods for generating exosomes comprising culturing cells in less than 20% oxygen for at least 2 days and harvesting exosomes from the cells. The invention further encompasses exosome preparations generated from cells cultured in less than 20% oxygen for at least 2 days. | 06-09-2016 |
20160160213 | METHODS OF TREATING CANCER AND PREVENTING CANCER DRUG RESISTANCE - Provided herein are methods of treating and/or preventing cancer drug resistance using modulators of chromatin modifiers (e.g., antagonists of chromatin modifiers) described herein. | 06-09-2016 |
20160160214 | FORMULATIONS COMPRISING ANTISENSE NUCLEOTIDES TO CONNEXINS - A therapeutic and/or cosmetic formulation comprising at least one anti-sense polynucleotide to a connexin protein together with a pharmaceutically acceptable carrier or vehicle is useful in site specific down regulation of connexin protein expression, particularly in reduction of neuronal cells death, wound healing, reduction of inflammation, decrease of scar formation and skin rejuvenation and thickening. | 06-09-2016 |
20160160215 | POLYNUCLEOTIDES FOR MULTIVALENT RNA INTERFERENCE, COMPOSITIONS AND METHODS OF USE THEREOF - The present invention includes bivalent or multivalent nucleic acid molecules or complexes of nucleic acid molecules having two or more target-specific regions, in which the target-specific regions are complementary to a single target gene at more than one distinct nucleotide site, and/or in which the target regions are complementary to more than one target gene or target sequence. Also included are compositions comprising such nucleic acid molecules and methods of using the same for multivalent RNA interference and the treatment of a variety of diseases and infections. | 06-09-2016 |
20160160216 | TTV MIRNA SEQUENCES AS AN EARLY MARKER FOR THE FUTURE DEVELOPMENT OF CANCER AND AS A TARGET FOR CANCER TREATMENT AND PREVENTION - Described are TTV miRNAs and probes and primers comprising part of said TTV miRNA polynucleic acid. The use of said compounds for diagnosis of cancer or predisposition of cancer is also described. | 06-09-2016 |
20160160217 | COMPOSITIONS AND METHODS FOR CHARACTERIZING AND TREATING MUSCULAR DYSTROPHY - Compositions and methods for identifying new treatments for Facioscapulohumeral muscular dystrophy (FSHD), and uses thereof. | 06-09-2016 |
20160166532 | CARNITINE PALMITOYLTRANSFERASE 1 INHIBITORS FOR INHIBITION OF PATHOLOGICAL ANGIOGENESIS | 06-16-2016 |
20160168565 | MOLECULAR TARGETS FOR THE PREVENTION AND/OR TREATMENT OF FIBROSIS, HYPERTROPHIC SCARS OR KELOIDS | 06-16-2016 |
20160168566 | Methods and Compositions using miR-3151 in the Diagnosis and Treatment of Thyroid Cancer | 06-16-2016 |
20160168568 | TREATMENT OF ADIPONECTIN (ADIPOQ) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO AN ADIPONECTIN (ADIPOQ) | 06-16-2016 |
20160168572 | DELIVERY OF THERAPEUTIC AGENT | 06-16-2016 |
20160168573 | LIVER CANCER RELATED GENES-SPECIFIC siRNA, DOUBLE-STRANDED OLIGO RNA MOLECULES COMPRISING THE siRNA, AND COMPOSITION FOR PREVENTING OR TREATING CANCER COMPRISING THE SAME | 06-16-2016 |
20160168574 | TREATMENT OF INSULIN GENE (INS) RELATED DISEASES BY INHIBITION OF NATURAL ANTISENSE TRANSCRIPT TO AN INSULIN GENE (INS) | 06-16-2016 |
20160168587 | Methods and Compositions for Plant Pest Control | 06-16-2016 |
20160175452 | SPHINGOLIPID-POLYALKYLAMINE-OLIGONUCLEOTIDE COMPOUNDS | 06-23-2016 |
20160175456 | Peptide Sequence Design and Use Thereof For Peptide-Mediated siRNA Delivery | 06-23-2016 |
20160176903 | SYSTEM FOR DELIVERING THERAPEUTIC AGENTS INTO LIVING CELLS AND CELLS NUCLEI | 06-23-2016 |
20160177301 | ANTISENSE MOLECULES AND METHODS FOR TREATING PATHOLOGIES | 06-23-2016 |
20160177302 | MICRORNA (miRNA) AND DOWNSTREAM TARGETS FOR DIAGNOSTIC AND THERAPEUTIC PURPOSES | 06-23-2016 |
20160177303 | METHODS AND COMPOSITIONS FOR THE SPECIFIC INHIBITION OF HIF-1a BY DOUBLE-STRANDED RNA | 06-23-2016 |
20160177305 | Methods of Inhibiting Tumorigenesis in Colon Adenocarcinoma and Compositions Therefor | 06-23-2016 |
20160177306 | Antisense Oligonucleotides (ODN) Against SMAD7 and Uses Thereof in Medical Field | 06-23-2016 |
20160177310 | CONSERVED HBV AND HCV SEQUENCES USEFUL FOR GENE SILENCING | 06-23-2016 |
20160177311 | Methods and Compositions for the Treatment of Prostate Related Disorders using miR-106b | 06-23-2016 |
20160177312 | Methods and Compositions for the Treatment of Prostate Related Disorders using miR-32 | 06-23-2016 |
20160177313 | COMPOSITIONS AND METHODS FOR INCREASING ERYTHROPOIETIN (EPO) PRODUCTION | 06-23-2016 |
20160177314 | ORGANIC SMALL HAIRPIN RNAS | 06-23-2016 |
20160177315 | FIDGETIN-LIKE 2 AS A TARGET TO ENHANCE WOULD HEALING | 06-23-2016 |
20160177316 | Methods and Compositions for Increasing the Efficacy of Doxorubicin Treatment in the Treatmentof Prostate Related Disorders using miR-106b-25 Cluster | 06-23-2016 |
20160186171 | AGENTS AND METHODS FOR INHIBITING MIR-148A FOR THE MODULATION OF CHOLESTEROL LEVELS - Elevated blood levels of low-density lipoprotein-cholesterol (LDL-C, or “bad” cholesterol) are strongly linked to circulatory disorders, e.g. cardiovascular disease such as atherosclerosis, angina, coronary heart disease, heart attack, stroke, etc. The LDL receptor (LDLR) mediates uptake of LDL-C (low density lipoprotein-cholesterol) by, e.g. hepatic cells. As described herein, miR-148a regulates LDLR expression in human hepatic cells. Accordingly, described herein are methods and compositions relating to, e.g. regulating cholesterol levels by modulating the level of miR-148a. | 06-30-2016 |
20160186172 | Compositions and methods for inhibiting hepcidin antimicrobial peptide (HAMP) or HAMP-related gene expression - The invention relates to lipid formulated double-stranded ribonucleic acid (dsRNA) targeting a hepcidin antimicrobial peptide (HAMP) and/or HAMP-related gene, and methods of using the dsRNA to inhibit expression of HAMP and/or HAMP-related genes. | 06-30-2016 |
20160186173 | C-MYC ANTISENSE OLIGONUCLEOTIDES AND METHODS FOR USING THE SAME TO TREAT CELL-PROLIFERATIVE DISORDERS - Provided herein are antisense oligonucleotides that can effectively prevent or decrease c-myc protein expression as well as decrease overall rates of cell proliferation in in vitro and mammalian in vivo models of cell proliferative disorders as well as methods for using the same. | 06-30-2016 |
20160186176 | METHODS AND COMPOSITIONS FOR THE SPECIFIC INHIBITION OF BETA-CATENIN BY DOUBLE-STRANDED RNA - This invention relates to compounds, compositions, and methods useful for reducing β-catenin target RNA and protein levels via use of dsRNAs, e.g., Dicer substrate siRNA (DsiRNA) agents. | 06-30-2016 |
20160186177 | Methods for Diagnosing Lung Cancer Using MicroRNAs - Described herein are methods and compositions for the diagnosis and treatment of lung cancers. Methods of identifying inhibitors of tumorigenesis are also provided. | 06-30-2016 |
20160186180 | ANGIOPOIETIN-LIKE 3 (ANGPTL3) iRNA COMPOSITIONS AND METHODS OF USE THEREOF - The invention relates to double-stranded ribonucleic acid (dsRNA) compositions targeting the ANGPTL3 gene, as well as methods of inhibiting expression of ANGPTL3 and methods of treating subjects having a disorder of lipid metabolism, such as hyperlipidemia or hypertriglyceridemia, using such dsRNA compositions. | 06-30-2016 |
20160186181 | COMPOSITION FOR REDUCING SENESCENCE OF CELL OR SUBJECT COMPRISING SMURF2 INHIBITOR AND USE THEREOF - A composition for reducing a level of senescence of a cell or subject, a method of reducing a level of senescence in a cell or subject by using the composition, and a method of preventing and treating symptoms or diseases related to or caused by senescence of a cell or subject. | 06-30-2016 |
20160186183 | METHODS AND COMPOSITIONS FOR TREATING MALIGNANT TUMORS ASSOCIATED WITH KRAS MUTATION - This invention provides methods and compositions for preventing, treating or ameliorating one or more symptoms of a malignant tumor associated with KRAS mutation in a mammal in need thereof, by identifying a tumor cell in the mammal, the tumor cell comprising at least one of: (i) a mutation of the KRAS gene, and (ii) an aberrant expression level of KRAS protein; and administering to the mammal a therapeutically effective amount of a composition comprising one or more RNAi molecules that are active in reducing expression of GST-π. | 06-30-2016 |
20160186184 | Methods and Compositions for the Treatment of Prostate Related Disorders using miR-1 - Methods and compositions for the treatment of prostate associated disorders are disclosed. | 06-30-2016 |
20160186185 | MODIFIED NUCLEOSIDES, ANALOGS THEREOF AND OLIGOMERIC COMPOUNDS PREPARED THEREFROM - The present invention provides modified nucleosides, analogs thereof and oligomeric compounds prepared therefrom. More particularly, the present invention provides modified nucleosides and analogs thereof that are useful for incorporation at the terminus of an oligomeric compound. Such oligomeric compounds can also be included in a double stranded composition. In some embodiments, the oligomeric compounds provided herein are expected to hybridize to a portion of a target RNA resulting in loss of normal function of the target RNA. | 06-30-2016 |
20160187319 | CELL DEATH-INDUCING AGENT, CELL GROWTH-INHIBITING AGENT, AND PHARMACEUTICAL COMPOSITION FOR TREATMENT OF DISEASE CAUSED BY ABNORMAL CELL GROWTH - An agent for inducing cell death and/or inhibiting cell growth for cancer cells. The agents of the present invention comprise, as active ingredients, a drug inhibiting GST-π and a drug inhibiting a homeostasis-related protein that exhibits synthetic lethality when inhibited together with GST-π. The homeostasis-related protein can be a cell cycle-regulating protein or an anti-apoptosis-related protein. | 06-30-2016 |
20160193242 | Methods and Compositions for Selecting siRNA of Improved Functionality | 07-07-2016 |
20160193354 | ANTISENSE OLIGONUCLEOTIDES WITH IMPROVED PHARMACOKINETIC PROPERTIES | 07-07-2016 |
20160194613 | COMPOSITIONS AND METHODS FOR INHIBITING GENE EXPRESSIONS | 07-07-2016 |
20160194630 | REDUCING NONSENSE-MEDIATED MRNA DECAY | 07-07-2016 |
20160194632 | TARGETING NON-CODING RNA FOR RNA INTERFERENCE | 07-07-2016 |
20160194633 | Lipid Formulated Compositions and Methods for Inhibiting Expression of Serum Amyloid A Gene | 07-07-2016 |
20160194634 | Methods for treating and/or limiting development of diabetes | 07-07-2016 |
20160194635 | METHOD OF ENHANCING MIR-185 EXPRESSION TO REDUCE LOW DENSITY LIPOPROTEIN/CHOLESTEROL ACCUMULATION IN A CELL | 07-07-2016 |
20160194636 | MODULATION OF EXON RECOGNITION IN PRE-MRNA BY INTERFERING WITH THE SECONDARY RNA STRUCTURE | 07-07-2016 |
20160194637 | COMPOUNDS AND METHODS FOR MODULATING TARGET NUCLEAR AND SUB-NUCLEAR NUCLEIC ACID MOLECULES IN CELLS AND ANIMALS | 07-07-2016 |
20160194638 | COMPOUNDS AND METHODS FOR MODULATING TARGET NUCLEAR AND SUB-NUCLEAR NUCLEIC ACID MOLECULES IN CELLS AND ANIMALS | 07-07-2016 |
20160194639 | INHIBITING CANCER METASTASIS | 07-07-2016 |
20160194643 | Methods of Identifying and Treating Poor Prognosis Cancers | 07-07-2016 |
20160194645 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF MUTANT EGFR GENE | 07-07-2016 |
20160195544 | METHOD OF DIAGNOSING SEPSIS OR SEPSIS RISK | 07-07-2016 |
20160199402 | METHODS FOR TREATING ISCHEMIA-REPERFUSION INJURY | 07-14-2016 |
20160199403 | Methods and Compositions for Inducing Deregulation of EPHA7 and ERK Phosphorylation in Human Acute Leukemias | 07-14-2016 |
20160201056 | MICRO-RNA REGULATION OF BONE LOSS | 07-14-2016 |
20160201059 | RNA APTAMERS FOR THERAPEUTIC AND DIAGNOSTIC DELIVERY TO PANCREATIC CANCER CELLS | 07-14-2016 |
20160201061 | ANTISENSE-BASED SMALL RNA AGENTS TARGETING THE GAG OPEN READING FRAME OF HIV-1 RNA | 07-14-2016 |
20160201062 | Antisense RNA for Treating Cancer and Inhibition of Metastasis and Vectors for Antisense Sequestration | 07-14-2016 |
20160201064 | COMPOSITIONS AND METHODS FOR MODULATING EXPRESSION OF FRATAXIN | 07-14-2016 |
20160202242 | CELL DEATH-INDUCING AGENT, CELL GROWTH-INHIBITING AGENT, AND PHARMACEUTICAL COMPOSITION FOR TREATMENT OF DISEASE CAUSED BY ABNORMAL CELL GROWTH | 07-14-2016 |
20160251654 | Novel short hairpin RNA compositions, methods of making and applications thereof | 09-01-2016 |
20160251655 | COMPOSITIONS FOR MODULATING C9ORF72 EXPRESSION | 09-01-2016 |
20160251656 | MicroRNAs Modulating the Effect of Glucocorticoid Signaling | 09-01-2016 |
20160251657 | MICRORNA COMPOUNDS AND METHODS FOR MODULATING MIR-122 | 09-01-2016 |
20160251658 | MODULATION OF EXON RECOGNITION IN PRE-MRNA BY INTERFERING WITH THE SECONDARY RNA STRUCTURE | 09-01-2016 |
20160251659 | MicroRNA-Based Methods and Compositions for the Diagnosis, Prognosis and Treatment of Breast Cancer | 09-01-2016 |
20160251661 | TREATING HEPATITIS VIRUS INFECTION BY MODULATING MICRORNAS MIR-130A, MIR-130B, MIR-204, OR MIR-1236 | 09-01-2016 |
20160251662 | COMPOSITIONS AND METHODS FOR TREATING CANCER AND MODULATING STRESS GRANULE FORMATION | 09-01-2016 |
20160251696 | METHODS OF DIAGNOSING AND TREATING B CELL ACUTE LYMPHOBLASTIC LEUKEMIA | 09-01-2016 |
20160251720 | MicroRNA PROFILES IN HEART FAILURE: METHODS AND SYSTEMS FOR DETECTION AND USE | 09-01-2016 |
20160375049 | COMPOSITIONS - The present invention relates to administration of a dinucleoside polyphosphate analogue or a pharmaceutically acceptable salt thereof, topically in a formulation comprising a suitable excipient or using a device for transdermal delivery, and/or combined with a nanoparticle carrier. The present invention also relates to the therapeutic use of such compositions or devices, in particular in the treatment of pain or epilepsy. The analogue may be combined with an anaesthetic (such as a salt form) or delivered in a nanoparticle. | 12-29-2016 |
20160375050 | METHODS AND COMPOSITIONS INVOLVING CHITOSAN NANOPARTICLES - Disclosed are nanoparticles for the delivery of a therapeutic agent or a diagnostic agent to a subject that include a chitosan and a polyphosphate, wherein the weight ratio of the chitosan to the polyphosphate is about 1.0 or greater and the weight ratio of the polyphosphate to the therapeutic agent or diagnostic agent is about 15.0 or less. Also disclosed are nanoparticles that include a chitosan and an inhibitor of enhancer of Zeste homologue 2 (EZH2). Methods of delivering a therapeutic agent or a diagnostic agent to a subject for the treatment or prevention of a disease and methods of predicting prognosis of ovarian cancer in a subject that involve determining the expression and/or function of EZH2 in the subject are also disclosed. | 12-29-2016 |
20160375137 | TARGETING LIPIDS - The present invention provides targeting lipids of structure | 12-29-2016 |
20160375143 | MIKTO-ARM BRANCHED POLYMERS - The invention relates to branched polymer comprising a support moiety and at least three homopolymer chains each covalently coupled to and extending from the support moiety, wherein the at least three homopolymer chains include a cationic homopolymer chain, a hydrophilic homopolymer chain, and a hydrophobic homopolymer chain. | 12-29-2016 |
20160376224 | LIPIDS AND LIPID NANOPARTICLE FORMULATIONS FOR DELIVERY OF NUCLEIC ACIDS - Compounds are provided having the following structure: | 12-29-2016 |
20160376229 | IONIZABLE COMPOUNDS AND COMPOSITIONS AND USES THEREOF - This invention includes ionizable compounds, and compositions and methods of use thereof. The ionizable compounds can be used for making nanoparticle compositions for use in biopharmaceuticals and therapeutics. More particularly, this invention relates to compounds, compositions and methods for providing nanoparticles to encapsulate active agents, such as nucleic acid agents, and to deliver and distribute the active agents to cells, tissues, organs, and subjects. | 12-29-2016 |
20160376586 | NUCLEIC ACID MOLECULE, EXPRESSION CASSETTE, EXPRESSION VECTOR, EUKARYOTIC HOST CELL, INDUCTION METHOD OF RNA INTERFERENCDE IN EUKARYOTIC HOST AND USE OF THE NUCLEIC ACID MOLECULE IN THERAPY OF DISEASES INDUCED BY EXPANSION OF TRINUCLEOTIDE GAG REPEATS - Subjects of the invention are: nucleic acid molecule, expression cassette, expression vector, eukaryotic host cell, induction method of RNA interference in eukaryotic host and use of nucleic acid molecule in therapy of diseases induced by expansion of trinucleotide CAG-type repeats. Solution relates to the new concept of treating hereditary human neurological diseases caused by expansion of CAG-type trinucleotide repeats using RNA interference technology. | 12-29-2016 |
20160376590 | Methods and Compositions For The Specific Inhibition of Gene Expression by Double-Stranded RNA - The invention is directed to compositions and methods for selectively reducing the expression of a gene product from a desired target gene in a cell, as well as for treating diseases caused by the expression of the gene. More particularly, the invention is directed to compositions that contain double stranded RNA (“dsRNA”), and methods for preparing them, that are capable of reducing the expression of target genes in eukaryotic cells. The dsRNA has a first oligonucleotide sequence that is between 25 and about 30 nucleotides in length and a second oligonucleotide sequence that anneals to the first sequence under biological conditions. In addition, a region of one of the sequences of the dsRNA having a sequence length of at least 19 nucleotides is sufficiently complementary to a nucleotide sequence of the RNA produced from the target gene to trigger the destruction of the target RNA by the RNAi machinery. | 12-29-2016 |
20160376592 | Methods of Manipulating the Fate of Cells - A method of manipulating the fate of a cell, which comprises contacting the cell with at least one of (a) a cell fate-determining untranslated/noncoding RNA species (cuR), (b) a modified cuR, or (c) a compound that modifies or affects cuR, under conditions sufficient to cause a cell-changing or cell-maintaining fate that results in cell regeneration, cell differentiation or cell death, so that an increase of desirable cells or a decrease in undesirable cells can be obtained. Another aspect of the invention relates to a method of manipulating the fate of a cell by contacting the cell with a compound that affects a fate-determining mechanism involving homologous nucleic acid interactions of RNA:RNA or RNA:DNA or resolution of such interactions under conditions sufficient to cause a cell-changing or cell-maintaining fate that results in cell regeneration, cell differentiation or cell death, so that an increase of desirable cells or a decrease in undesirable cells can be obtained. The invention generates cell fate or cell maintenance in a subject, such as a human, so that an increase of desirable cells or a decrease in undesirable cells can be obtained in the subject. This feature can be applied to a therapeutic method of treating a condition in a subject. | 12-29-2016 |
20160376597 | METHOD OF TREATING INFLUENZA A - A method of treating Influenza A is disclosed. The method includes the step of administering a pharmaceutical composition including an oligonucleotide complementary to a corresponding segment of the nucleotide sequence of microRNA-1290 (miR-1290) (SEQ ID NO: 1) to a subject suffering from Influenza A, wherein at least one of the nucleotides in the oligonucleotide is Thymidine phosphate. | 12-29-2016 |
20160376598 | Polycomb-Associated Non-Coding RNAS - This invention relates to long non-coding RNAs (lncRNAs), libraries of those ncRNAs that bind chromatin modifiers, such as Polycomb Repressive Complex 2, inhibitory nucleic acids and methods and compositions for targeting lncRNAs. | 12-29-2016 |
20160376599 | RNAi Inhibition of Alpha-ENaC Expression - The invention relates to compositions and methods for modulating the expression of alpha-ENaC, and more particularly to the downregulation of alpha-ENaC expression by chemically modified oligonucleotides. | 12-29-2016 |
20160376651 | BIOMARKERS FOR PREMATURE BIRTH - The present invention provides a method for determining increased risk of premature birth in a pregnant woman by detecting altered expression level of one or more marker genes in the woman's blood. A kit and device useful for such a method are also provided. In addition, the present invention provides a method for preventing or reducing the likelihood of premature birth. | 12-29-2016 |
20160376666 | FUSION GENES ASSOCIATED WITH PROGRESSIVE PROSTATE CANCER - The present invention relates to methods and compositions for determining whether a subject having prostate cancer is at greater risk of developing progressive disease, and methods of treating the subjects. It is based, at least in part, on the discovery that approximately 90% of men carrying at least one of the following fusion genes: TRMT11-GRIK2, SLC45A2-AMACR, MTOR-TP53BP1, LRRC59-FLJ60017, TMEM135-CCDC67 and CCNH-C5orf30 experienced prostate cancer recurrence, metastases and/or prostate cancer-specific death after radical prostatectomy (each examples of “progressive prostate cancer”), while these outcomes occurred in only 36% of men not carrying any of these fusion genes. It is also based, at least in part, on the discovery that no patient studied survived five years without recurrence if their primary prostate cancer contained a TRMT11-GRIK2 or MTOR-TP53BP1 fusion gene. It is also based, at least in part, on the discovery that the protein encoded by the MAN2A1-FER fusion gene exhibits kinase activity. | 12-29-2016 |
20170233730 | REGULATION OF MIR-33 MICRORNAS IN THE TREATMENT OF CHOLESTEROL-RELATED DISORDERS | 08-17-2017 |
20170233731 | NOVEL TETRAGALNAC CONTAINING CONJUGATES AND METHODS FOR DELIVERY OF OLIGONUCLEOTIDES | 08-17-2017 |
20170233732 | MODULATION OF APOLIPOPROTEIN C-III (APOCIII) EXPRESSION IN LIPOPROTEIN LIPASE DEFICIENT (LPLD) POPULATIONS | 08-17-2017 |
20170233733 | TWIST SIGNALING INHIBITOR COMPOSITIONS AND METHODS OF USING THE SAME | 08-17-2017 |
20170233735 | ALLELE SELECTIVE INHIBITION OF MUTANT C9ORF72 FOCI EXPRESSION BY DUPLEX RNAS TARGETING THE EXPANDED HEXANUCLEOTIDE REPEAT | 08-17-2017 |
20170233736 | METHODS FOR DOSING AND MONITORING SMAD7 ANTISENSE OLIGONUCLEOTIDE TREATMENT USING BIOMARKER LEVELS | 08-17-2017 |
20170233737 | Means and Methods for the Treatment of Nephropathy | 08-17-2017 |
20170233743 | COMPOSITIONS FOR CONTROLLING VARROA MITES IN BEES | 08-17-2017 |
20170233744 | TREATMENT OF DISEASE BY MODULATION OF SIRT6 | 08-17-2017 |
20170233760 | BIOLOGICALLY ACTIVE NUCLEOTIDE MOLECULES FOR SELECTIVELY KILLING OFF CELLS, USE THEREOF, AND APPLICATION KIT | 08-17-2017 |
20180021323 | FLIP - A SELECTIVE MOLECULAR TARGET OF SENESCENT CELLS | 01-25-2018 |
20180023076 | DOUBLE STRAND RNA DELIVERY SYSTEM FOR PLANT-SAP-FEEDING INSECTS | 01-25-2018 |
20180023078 | Oligonucleotide Sequences Targeting Transcription FactorTSC22D4 for the Treatment of Insulin Resistance | 01-25-2018 |
20180023080 | Long Non-Coding RNA For The Treatment Of Endothelial Dysfunction | 01-25-2018 |
20180023081 | LNA OLIGONUCLEOTIDES WITH ALTERNATING FLANKS | 01-25-2018 |
20180023082 | VARIANT RNAi | 01-25-2018 |
20180023083 | DOUBLE STRAND RNA AS MOLECULAR BIOPESTICIDES FOR RNA INTERFERENCE THROUGH FEEDING IN THE HEMIPTERAN INVASIVE INSECT PEST, BROWN MARMORATED STINK BUG | 01-25-2018 |
20180023086 | Compositions and Methods for Inhibiting Gene Expression of Factor XII | 01-25-2018 |
20180023142 | MICRORNAS IN NEURODEGENERATIVE DISORDERS | 01-25-2018 |
20190142739 | TOPICAL ADMINISTRATION OF THERAPEUTIC AGENTS AND OLIGONUCLEOTIDE FORMULATIONS | 05-16-2019 |
20190142860 | NUCLEIC ACID BASED TIA-1 INHIBITORS | 05-16-2019 |
20190144539 | METHODS AND PHARMACEUTICAL COMPOSITIONS FOR THE TREATMENT OF PULMONARY BACTERIAL INFFECTIONS | 05-16-2019 |
20190144856 | METHODS TO PREVENT OR TREAT PERIODONTITIS OR PERI-IMPLANTITIS | 05-16-2019 |
20190144860 | RNAI INDUCED HUNTINGTIN GENE SUPPRESSION | 05-16-2019 |
20190144861 | ANTISENSE OLIGONUCLEOTIDES FOR INDUCING EXON SKIPPING AND METHODS OF USE THEREOF | 05-16-2019 |
20190144863 | MODULATING THE CELLULAR STRESS RESPONSE | 05-16-2019 |
20190144865 | MODIFIED TGF-BETA OLIGONUCLEOTIDE FOR USE IN A METHOD OF PREVENTING AND/OR TREATING AN OPHTHALMIC DISEASE | 05-16-2019 |
20190144866 | RNAi-MEDIATED INHIBITION OF HIF1A FOR TREATMENT OF OCULAR ANGIOGENESIS | 05-16-2019 |
20190144869 | ALLELE-SPECIFIC GENE SUPPRESSION | 05-16-2019 |
20190144870 | COMPOSITIONS AND METHODS FOR INHIBITING EXPRESSION OF THE ALAS1 GENE | 05-16-2019 |
20220133767 | TARGETING MICRORNAS TO OVERCOME DRUG TOLERANCE AND RESISTANCE - The invention provides methods and compositions for use in targeting micro RNAs (miRNAs), as well as methods and compositions for use in treating, reducing, inhibiting, or delaying resistance or tolerance to anti-cancer treatment, and methods and compositions for use in treating or preventing cancer. | 05-05-2022 |
20220133768 | CRISPR/RNA-GUIDED NUCLEASE-RELATED METHODS AND COMPOSITIONS FOR TREATING RHO-ASSOCIATED AUTOSOMAL-DOMINANT RETINITIS PIGMENTOSA (ADRP) - CRISPR/RNA-guided nuclease-related compositions and methods for treatment of RHO-associated retinitis pigmentosa, e.g., autosomal-dominant retinitis pigmentosa (adRP). | 05-05-2022 |
20220133770 | METHODS FOR TREATING MACROPHAGE-MEDIATED DISEASES, AND METHODS OF IDENTIFYING AGENTS USEFUL THEREFORE - Provided herein are methods of treating macrophage-mediated inflammatory diseases and disorders. Also, disclosed are methods for screening for agents useful in such methods. | 05-05-2022 |
20220133775 | P-ETHOXY NUCLEIC ACIDS FOR IGF-1R INHIBITION - Provided herein are methods of treating cancer or an autoimmune disease comprising administering a liposome that comprises neutral phospholipids and a P-ethoxy oligonucleotide that targets a IGF-1R-encoding polynucleotide. | 05-05-2022 |
20220133800 | TREATMENT OF DISEASE BASED ON IMMUNE CELL SEQUENCING - The present invention relates to treatment of disease, including treatment of antibody-mediated autoimmune disorders, as well as treatment of other conditions in which antibody therapeutics can be beneficial for targeting destruction of foreign or malignant cells. | 05-05-2022 |
20220135974 | NUCLEIC ACIDS FOR INHIBITING EXPRESSION OF PROS1 IN A CELL - The invention relates to nucleic acid products that interfere with or inhibit PROS1 gene expression. It further relates to therapeutic uses of PROS1 inhibition for the treatment of bleeding disorders. | 05-05-2022 |
20220135978 | ANTI-MIRNA CARRIER CONJUGATED WITH A PEPTIDE BINDING TO A CANCER CELL SURFACE PROTEIN AND USE THEREOF - The present disclosure relates to an anti-miRNA delivery system, and more specifically, relates to a technique of using a cancer-targeting anti-miRNA delivery system including porous silicon nanoparticles containing anti-miRNA to which a cancer cell surface protein-binding peptide is conjugated, for use in treating cancer. As a result of intensive studies in order to use and apply anti-miR-21 oligonucleotides to the treatment of ovarian cancer, the present inventors confirmed for the first time that when porous silicon nanoparticles containing an anti-miRNA-21 oligonucleotide to which a specific cancer cell surface protein-binding peptide is conjugated are applied, apoptosis is induced in an ovarian cancer cell line and cell viability is reduced, thus, an anti-miRNA delivery system, which is the aforementioned conjugate, is expected to be usefully used as a platform for treating various cancers, especially for treating ovarian cancer. | 05-05-2022 |
20220135980 | IMMUNOSTIMULATORY BACTERIA ENGINEERED TO COLONIZE TUMORS, TUMOR-RESIDENT IMMUNE CELLS, AND THE TUMOR MICROENVIRONMENT - Provided are delivery immunostimulatory bacteria that have enhanced colonization of tumors, the tumor microenvironment and/or tumor-resident immune cells, and enhanced anti-tumor activity. The immunostimulatory bacteria are modified by deletion of genes encoding the flagella or by modification of the genes so that functional flagella are not produced, and/or are modified by deletion of pagP or modification of pagP to produce inactive PagP product. As a result, the immunostimulatory bacteria are flagellin | 05-05-2022 |
20220135982 | COMPOSITIONS FOR SUPPRESSING TRIM28 AND USES THEREOF - The present disclosure relates generally to compositions and methods for treating or ameliorating acute myeloid leukemia in a subject in need thereof. In particular, the present disclosure provides a method comprising administering to a subject a therapeutically effective amount of at least one agent that suppresses Trim28 activity. | 05-05-2022 |
20220135983 | PREVENTION OR TREATMENT OF FIBROTIC DISEASE - A modality for preventing or treating fibrotic diseases by identifying a marker protein for myofibroblasts is provided. | 05-05-2022 |
20220136067 | KIT, DEVICE, AND METHOD FOR DETECTING UTERINE LEIOMYOSARCOMA - This invention provides a kit and device for detection of uterine leiomyosarcoma, and a method for detecting uterine leiomyosarcoma. This invention provides a kit and device for detection of uterine leiomyosarcoma containing a nucleic acid capable of specifically binding to a miRNA in a sample from a subject or a complementary strand thereof and a method for detecting uterine leiomyosarcoma including measuring the miRNA in vitro. | 05-05-2022 |