CNR CONSIGLIO NAZIONALE DELLE RICERCHE Patent applications |
Patent application number | Title | Published |
20150355086 | FREQUENCY COMB SPECTROSCOPY APPARATUS AND METHOD OF FREQUENCY COMB SPECTROSCOPY - The present invention relates to a method and an apparatus to perform frequency comb spectroscopy. The method includes: —Arranging a waveguide optical cavity ( | 12-10-2015 |
20140093731 | CONDUCTIVE FIBER MATERIALS - The invention relates to a conductive fiber material comprising a base fiber material ( | 04-03-2014 |
20130197070 | AXL RECEPTOR TYROSINE KINASE APTAMER INHIBITOR FOR USE IN THERAPY - The present invention concerns a nucleotide aptamer having the sequence: 5′-AUGAUCAAUCGCCUCAAUUCGACAGGAGGCUCAC-3′(SEQ ID NO: 1) for use in the treatment and/or prevention and/or diagnosis of an Axl receptor tyrosine kinase induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of an Axl receptor tyrosine kinase induced disorder in a patient from which a sample is obtained and related diagnostic kit. | 08-01-2013 |
20130177556 | EGFR APTAMER INHIBITOR FOR USE IN THERAPY AND DIAGNOSIS - The present invention concerns a nucleotide aptamer having the sequence 5′ GCCUUAGUAACGUGCUUUGAUGUCGAUUCGACAGGAGGC3′ (SEQ ID No. 1) for use in the treatment and/or prevention and/or diagnosis of an EGFR induced disorder and a pharmaceutical composition comprising the same. The invention also relates to a method for the diagnosis of a EGFR induced disorder in a patient from which a sample is obtained and relative diagnostic kit. | 07-11-2013 |
20130163942 | WAVEGUIDE FOR EFFICIENT LIGHT TRAPPING AND ABSORPTION - A waveguide is provided on which an electromagnetic wave impinges, the electromagnetic wave having a wavelength λ included in a given interval Δλ of interest centered on a λ | 06-27-2013 |
20130089465 | MICROMECHANICAL SENSOR SYSTEM HAVING SUPER HYDROPHOBIC SURFACES - A sensor system is provided to detect the mass of a compound in a liquid solution, the system including a sensor including a plurality of pillars extending from a substrate and having a given height, the pillars having a free end opposite to the substrate, and including a lateral surface connecting said free end to the substrate. The free end defining a surface and the surface is functionalized in order to bind with the compound to be detected, and the lateral surface is hydrophobic. The distance between any two nearest neighbors pillars of the plurality satisfies the following equation | 04-11-2013 |
20120103978 | MICROWAVE CHEMICAL REACTOR - Microwave heating apparatus for chemical-physical processes comprising a microwave source, operatively connected to an end of an antenna at a connector. The antenna is put in a reaction container where it irradiates with microwaves a reacting material. The antenna is coated with a sheath that avoids a direct contact with the reacting material, or is put into in a housing executed in the container. The housing, made of a material transparent to microwaves, can cross the reaction container for a part thereof, or for all its width. The arrangement of the antenna in the reacting material provides a quick and effective heating. Furthermore, it is possible to increase considerably the selectivity, the control and the efficiency of a chemical-physical processes to which the heating technique above described is applied. This allows also to provide a considerable energy saving with respect to apparatus of prior art. | 05-03-2012 |
20120041046 | NON-STEROIDAL COMPOUNDS FOR ANDROGEN RECEPTOR MODULATION - The present invention concerns compounds of general Formula (I): method of preparation and uses thereof. | 02-16-2012 |
20110275829 | Androgen receptor modulating compounds, preparation and uses thereof - The present invention concerns compounds of general formula (I): Method of preparation and uses thereof. | 11-10-2011 |
20110262415 | ERYTHROCYTE-BASED DELIVERY SYSTEM, METHOD OF PREPARATION AND USES THEREOF - The invention relates to a cell-based drug delivery system comprising magneto nanoparticles, erythrocytes and a fusion-protein, its preparation and uses thereof in particular as a delivery system for biologically active compounds. | 10-27-2011 |
20110183427 | METHOD FOR SEPARATING THE CONSTITUENTS OF A COMPLEX MIXTURE OF PROTEINS TO SUBMIT TO PROTEOMIC ANALYSIS AND APPARATUS THEREFOR - A method and an apparatus for separating the constituents of a complex mixture of proteins, for example an organic fluid, such as blood plasma, to submit to proteomic analysis. The method comprises, in particular, a step of distributing the complex mixture of proteins on a determined number n of separation elements different from each other ( | 07-28-2011 |
20110163235 | SCINTIGRAPHIC DEVICE WITH HIGH SPATIAL RESOLUTION - A scintillation device with high resolution includes a detection unit ( | 07-07-2011 |
20100293885 | METHOD FOR CONSTRUCTING A BUILDING USING CORNER PANELS - A method for constructing a building comprises the steps of: preparing a base ( | 11-25-2010 |
20100293884 | CONNECTING ELEMENT FOR PANELS - A connecting element for panels comprises at least one plate ( | 11-25-2010 |
20100203620 | APPARATUS FOR CULTURING EUCARYOTIC AND/OR PROCARYOTIC CELLS - An apparatus for culturing eucaryotic and/or procaryotic cells comprising an incubator ( | 08-12-2010 |
20090074631 | Microwave Chemical Reactor - Microwave heating apparatus ( | 03-19-2009 |
20080262121 | Plurisubstituted Hydroxyapatite and the Composite Thereof With a Natural and/or Synthetic Polymer, Their Preparation and Uses Thereof - The present invention relates to a hydroxyapatite multi-substituted with, physiologically compatible ion species and to its biohybrid composite with a natural and/or synthetic polymer, which are useful in the preparation of a biomimetic bone substitute for treating bone tissue defects. Furthermore, the present invention relates to a method for their preparation and uses . | 10-23-2008 |
20080247441 | Low Cost Multimode Calorimeter - A structure of calorimeter provides a calorimetric head ( | 10-09-2008 |