Patent application title: HPV DETECTION AND QUANTIFICATION BY REAL-TIME MULTIPLEX AMPLIFICATION
Inventors:
Stephane Rihet (Gargenville, FR)
Fatima Zeryouh (Choisy Le Roi, FR)
IPC8 Class: AC12Q170FI
USPC Class:
435 5
Class name: Chemistry: molecular biology and microbiology measuring or testing process involving enzymes or micro-organisms; composition or test strip therefore; processes of forming such composition or test strip involving virus or bacteriophage
Publication date: 2014-02-20
Patent application number: 20140051066
Abstract:
The present invention relates to amplification primers and detection
probes, which are useful for the detection of human papillomaviruses
(HPV), and more particularly of HPV, which can be oncogenic for the
mucosal epithelia. The amplification and detection systems provided by
the present invention are group-targeted systems, namely A5-, A6- A7-,
and A9-targeted systems. The amplification and detection systems of the
invention allow for an amplification of HPV in multiplex as well as for a
real-time detection, whereby at least the thirteen HR HPV can be detected
in a single-tube assay. The invention further allows for a reliable
quantitation of HPV viral loads in real-time multiplex amplification.Claims:
1. A process for detecting in a sample at least one HPV, which can be
oncogenic for the mucosal epithelia, which comprises contacting said
sample or nucleic acid material thereof with HPV amplification primers to
amplify at least one HPV nucleic acid from said sample or nucleic acid
material by means of said HPV amplification primers and detecting the HPV
amplicon(s) thereby produced, if any, wherein the production of at least
one HPV amplicon indicates that at least one HPV, which can be oncogenic
for the mucosal epithelia, is present in said sample, wherein said HPV
amplification primers comprise i/ primers of 14-30 nucleotides, which are
suitable for use as primer pair(s) in the amplification of at least one
template polynucleotide, wherein one primer of a primer pair anneals to
the 5' terminal end of said at least one template polynucleotide and the
other primer of the same primer pair anneals to the 5' terminal end of
the polynucleotide that is complementary to said at least one template
polynucleotide, wherein said at least one template polynucleotide is
selected from the group consisting of the HPV18 fragments, which comprise
one of the sequences of SEQ ID NOs: 46-51 or the complementary sequence
thereof or a fragment of said SEQ ID or complementary sequence, wherein
said HPV18 fragments differ by at most 5 nucleotides in length from said
SEQ ID or complementary sequence; and ii/ primers of 14-30 nucleotides,
which are suitable for use as primer pair(s) in the amplification of at
least one template polynucleotide, wherein one primer of a primer pair
anneals to the 5' terminal end of said at least one template
polynucleotide and the other primer of the same primer pair anneals to
the 5' terminal end of the sequence that is complementary to said at
least one template polynucleotide, wherein said at least one template
polynucleotide is selected from the group consisting of the HPV16
fragments, which comprise one of the sequences of SEQ ID NOs: 177-180,
189-192 and 195-198 or the complementary sequence thereof or a fragment
of said SEQ ID sequence or complementary sequence, wherein said HPV16
fragments differ by at most 5 nucleotides in length from said SEQ ID or
complementary sequence; wherein said primers of i. are suitable for
nucleic acid amplification from one or several HPV selected from the
group consisting of HPV18, HPV45, HPV39, HPV59 and HPV68; and wherein
said primers of ii. are suitable for nucleic acid amplification from one
or several HPV selected from the group consisting of HPV16, HPV31, HPV33,
HPV35, HPV52 and HPV58.
2. The process of claim 1, wherein the primers of i. are suitable for nucleic acid amplification from at least HPV18 and HPV45.
3. The process of claim 1, wherein the primers of i. are suitable for nucleic acid amplification from HPV18, HPV45, HPV39, HPV59 and HPV68.
4. The process of claim 1, wherein the primers of ii. are suitable for nucleic acid amplification from at least HPV16, HPV31 and HPV33.
5. The process of claim 1, wherein the primers of ii. are suitable for nucleic acid amplification from HPV16, HPV31, HPV33, HPV35, HPV52 and HPV58.
6. The process of claim 1, wherein the primers of i. are suitable for use as primer pairs in the amplification of several of said template polynucleotides.
7. The process of claim 1, wherein the at least one template polynucleotide of the primers of ii. is selected from the group consisting of the polynucleotides of SEQ ID NOs: 169-210 and the complementary sequences thereof.
8. The process of claim 1, wherein the primers of ii. are suitable for use as primer pairs in the amplification of several of said template polynucleotides.
9. The process of claim 1, wherein a primer of the primer pair of i., or of at least one of the primer pairs of i., is at least 85% identical to the sequence of the same length that is the 5' terminal end of said at least one template polynucleotide, and the other primer of the same primer pair is at least 85% identical to the sequence of the same length that is the 5' terminal end of the polynucleotide that is complementary to said at least one template polynucleotide.
10. The process of claim 1, wherein a primer of the primer pair of i., or of at least one of the primer pairs of i., is selected from the group consisting of the oligonucleotides of SEQ ID NOs: 68-70, and the other primer of the same primer pair is selected from the group consisting of the oligonucleotides of SEQ ID NOs: 79-81.
11. The process of claim 1, wherein a primer of the primer pair of ii., or of at least one of the primer pairs of ii., is at least 85% identical to the sequence of the same length that is the 5' terminal end of said at least one template polynucleotide, and the other primer of the same primer pair is at least 85% identical to the sequence of the same length that is the 5' terminal end of the polynucleotide that is complementary to said at least one template polynucleotide.
12. The process of claim 1, wherein a primer of the primer pair of ii., or of at least one of the primer pairs of ii., is selected from the group consisting of the oligonucleotides of SEQ ID NOs: 231-239, and the other primer of the same primer pair is selected from the group consisting of the oligonucleotides of SEQ ID NOs: 256-265.
13. The process of claim 1, wherein a primer of the primer pair of ii., or of at least one of the primer pairs of ii., is selected from the group consisting of the oligonucleotides of SEQ ID NOs: 232, 234 and 235, and the other primer of the same primer pair is selected from the group consisting of the oligonucleotides of SEQ ID NOs: 258, 261, 264 and 265.
14. The process of claim 1, wherein the primers of i. and the primers of ii. are in the same amplification container.
15. The process of claim 1, wherein said detecting comprises contacting said amplicon or at least one of said amplicon(s) with at least one HPV-specific probe in real-time amplification.
16. The process of claim 1, wherein said detecting comprises contacting said amplicon or at least one of said amplicon(s) with at least one HPV-specific probe, and wherein the oligonucleotide sequence of said at least one HPV-specific probe is at least one of SEQ ID NOs: 88-92 and 277-282, or one of the complementary sequences thereof, or a sequence, which differs by at most 5 nucleotides in length from said SEQ ID or complementary sequence and which is at least 90% identical to said SEQ ID or complementary sequence, said at least one HPV-specific probe being optionally linked to at least one detection label and/or to two complementary nucleotide sequences of 3 to 10 nucleotides, one of said two complementary nucleotide sequences of 3 to 10 nucleotides being linked at the 5' end of said probe, the other of said two complementary nucleotide sequences of 3 to 10 nucleotides being linked at the 3' end of said probe.
17. The process of claim 1, wherein said detecting comprises contacting said amplicon or at least one of said amplicon(s) with at least one HPV-specific probe, and wherein said at least one HPV-specific probe consists of at least one of SEQ ID NOs: 102-106 and 304-319, or of one of the complementary sequences thereof, said at least one HPV-specific probe being optionally linked to at least one detection label.
18. The process of claim 1, wherein said HPV amplification primers further comprise primers of 14-30 nucleotides, which are suitable for use as primer pair(s) in the amplification of at least one HPV selected from the group consisting of the oncogenic HPV belonging to HPV phylogenic groups A5 and A6.
19. The process of claim 1, wherein said HPV amplification primers further comprise primers of 14-30 nucleotides, which are suitable for use as primer pair(s) in the amplification of at least one template polynucleotide, wherein one primer of a primer pair anneals to the 5' terminal end of said at least one template polynucleotide and the other primer of the same primer pair anneals to the 5' terminal end of the polynucleotide that is complementary to said at least one template polynucleotide, wherein said at least one template polynucleotide is selected from the group consisting of the HPV51 fragments, which comprise the sequence of SEQ ID NO: 5 or the complementary sequence thereof or a fragment of said SEQ ID or complementary sequence, wherein said HPV51 fragments differ by at most 5 nucleotides in length from said SEQ ID or complementary sequence.
20. The process of claim 1, wherein said HPV amplification primers further comprise primers of 14-30 nucleotides, which are suitable for use as primer pair(s) in the amplification of at least one template polynucleotide, wherein one primer of a primer pair anneals to the 5' terminal end of said at least one template polynucleotide and the other primer of the same primer pair anneals to the 5' terminal end of the polynucleotide that is complementary to said at least one template polynucleotide, wherein said at least one template polynucleotide is selected from the group consisting of the HPV56 fragments, which comprise the sequence of SEQ ID NO: 25 or the complementary sequence thereof or a fragment of said SEQ ID or complementary sequence, wherein said HPV56 fragments differ by at most 5 nucleotides in length from said SEQ ID or complementary sequence.
21. A process of production of HPV primers, which comprises producing at least two oligonucleotides, the respective sequences of which consist of 14-30 nucleotides each and are suitable for use as primer pair(s) in the amplification of at least one template polynucleotide, wherein said at least one template polynucleotide is at least one of the HPV18 fragments, which comprise one of the sequences of SEQ ID NOs: 46-51 or the complementary sequence thereof or a fragment of said SEQ ID or complementary sequence, wherein said HPV18 fragments differ by at most 5 nucleotides in length from said SEQ ID or complementary sequence, wherein one primer of a primer pair anneal to the 5' terminal end of said at least one template polynucleotide and the other primer of the same primer pair anneal to the 5' terminal end of the polynucleotide that is complementary to said at least one template polynucleotide, and wherein said primer pair(s) anneals(anneal) to at least two HPV selected from the group consisting of HPV16, HPV31, HPV33, HPV35, HPV52, HPV58 and HPV67.
22. A process of production of HPV primers, which comprises producing at least two oligonucleotides, the respective sequences of which consist of 14-30 nucleotides each and are suitable for use as primer pair(s) in the amplification of at least one template polynucleotide, wherein said at least one template polynucleotide is at least one the HPV16 fragments, which comprise one of the sequences of SEQ ID NOs: 177-180, 189-192 and 195-198 or the complementary sequence thereof or a fragment of said SEQ ID sequence or complementary sequence, wherein said HPV16 fragments differ by at most 5 nucleotides in length from said SEQ ID or complementary sequence, wherein one primer of a primer pair anneal to the 5' terminal end of said at least one template polynucleotide and the other primer of the same primer pair anneal to the 5' terminal end of the polynucleotide that is complementary to said at least one template polynucleotide, and wherein said primer pair(s) anneals(anneal) to at least two HPV selected from the group consisting of HPV18, HPV45, HPV39, HPV59 and HPV68.
Description:
[0001] This application is a divisional of U.S. application Ser. No.
12/226,283 (allowed), filed Oct. 14, 2008 (published as US-2009-0275025
A1), which is a U.S. national phase of International Application No.
PCT/EP2006/004314, filed 11 Apr. 2006, which designated the U.S. and the
entire contents of each of which is incorporated herein by reference
FIELD
[0002] The present invention relates to the detection of human papillomaviruses (HPV), more particularly of HPV, which have a tropism for the mucosal epithelia (mucosal-type HPV), still more particularly of HPV, which can be oncogenic for the mucosal epithelia. The present invention provides amplification primers and detection probes, which are useful therefor, as well as reference template sequences suitable for designing and building such primers and probes.
BACKGROUND OF THE INVENTION
[0003] Human papillomavirus (HPV) contains a circular double-stranded DNA genome of about 7,900 bp, which is organized into three main regions, i.e.:
[0004] an early coding region containing genes E1, E2, E4, E5, E6 and E7, which are involved in viral replication and in neoplastic transformation,
[0005] a late coding region, containing genes L1 and L2, which code for viral capside proteins,
[0006] a non-coding regulatory region, which is referred to as LRC (Long Control Region), which is located between the E genes and the L genes.
[0007] HPV constitute a group of viruses, which are associated with benign and malignant lesions of cutaneous or mucosal epithelia. To date, more than 100 different HPV types have been identified.
[0008] More than 40 HPV types belonging to the mucosal group have been detected in the anogenital mucosa.
[0009] HPV is the major risk factor in the development of squamous intraepithelial lesions (SILs), which are classified as low grade (LSIL) or high grade (HSIL) in severity.
[0010] HPV may induce cervical intraepithelial neoplasia (CIN), ranging from benign lesions (CIN1), such as condylomata acuminata, through pre-cancerous lesions (CIN2 to CIN3), up to in situ carcinoma and invasive cancer.
[0011] It is now established that HPV is directly involved in cervical carcinogenesis. Detecting HPV is essential to the prognosis of CIN and cervical cancer.
[0012] Early and precise detection of HPV is the key factor for recovery from cervical cancer.
[0013] It has also been shown that an increased HPV viral load within a cervical smear specimen is associated with an increased risk of CIN3 and of cervical carcinomas.
[0014] A number of oncogenic HPV genotypes that infect the anogenital tract have been classified as potentially high risk HPV genotypes (HR HPV), based on their occurrence or prevalence in cervical carcinomas. The presence, persistence and/or re-occurrence of HR HPV is a bad prognostic indicator. So far, thirteen HPV types are said to be HR HPV, namely HPV 56, 51, 58, 33, 52, 35, 31, 16, 68, 39, 59, 45 and 18. Those HR HPV, which have the highest prevalence, are HPV types 33, 31, 16, 45 and 18.
[0015] Other oncogenic HPV are considered to be Low Risk HPV (LR HPV), e.g., HPV2, HPV3, HPV6, HPV11, HPV13, HPV32, HPV40, HPV42, HPV43, HPV44, HPV57.
[0016] The clinical classification of HPV types into either the HR or the LR group might evolve, or slightly diverge from one author to another, as the classification of a given HPV into the LR group only stands for as long as this HPV type is not found to be associated with a cervical carcinoma.
[0017] For example, it is now contemplated that HPV53 and HPV66 probably are HR HPV (van Ham et al. 2005, J. Clin. Microbiol. Vol. 43, no6, p. 2662-2667). Hence, the initial group of thirteen HR HPV might further increase to a number of at least 15 HPV types.
[0018] Other HPV have been described as oncogenic HPV, but without any definitive settlement on the issue of their HR or LR status, such as is the case for HPV67, HPV82, HPV85. Appropriate detection means are required to analyze their oncogenicity.
[0019] New, or yet unidentified, mucosal oncogenic HPV types may further arise. Furthermore, HPV multi-infection, involving several types of HPV, is a common situation: multi-infection is thought to account for about 20% of the HPV infection cases. An HPV multi-infection case may involve HPV types, which all are oncogenic HPV, or which comprise at least one oncogenic HPV and at least one non-oncogenic HPV. An HPV multi-infection case may involve HPV types, which all are mucosal HPV types, or may involve at least one mucosal type and at least one cutaneous type.
[0020] Also, co-infection may also occur, which involves at least one HPV and at least to one virus other than HPV, e.g., a co-infection with at least one HPV, and at least one HIV.
[0021] Such multi- and/or co-infection situations render accurate HPV detection much more difficult.
[0022] HPV primers and probes, which are suitable for the detection of mucosal oncogenic HPV, have been disclosed in prior art.
[0023] The first techniques that were developed involved type-specific probes, which were designed to detect oncogenic HPV by direct hybridization of a type-specific probe to a non-amplified HPV genome, e.g., by Southern blotting or dot blotting.
[0024] Signal-amplified tests have then been developed, such as the Hybrid Capture test (HC2®) of Digene Corporation, Gaithersburg, Md., USA. The HC2® test has been approved by the FDA, and is at present time the reference test for clinical diagnosis.
[0025] The HC2® system is a liquid phase microplate system using DNA/RNA hybridization assay, which does not comprise any target amplification: viral DNA hybridizes in liquid phase to a RNA probe which targets the 13 HR HPV, the hybrids thus formed being detected by anti-DNA/RNA antibodies and visualized by chemoluminescence.
[0026] The HC2® test is a sensitive assay. It however is only of qualitative value. Viral loads assessed by the HC2® test does not increase with increasing grade of SIL, and are not sufficiently reliable in case of multiple HPV infections. Hence, the HC2® test is not a quantitative assay.
[0027] As the HC2® test does not reflect the viral load initially contained in the analyzed sample, it is recommended to combine it with classic cytology, to distinguish the cases with high grade lesions from those without high grade lesions.
[0028] Amplification methods have then been developed, wherein HPV target(s) is(are) amplified by at least one primer pair, the amplicon thus produced being detected either by this (labelled) primer pair or by a probe.
[0029] Such prior art primers have first been designed as general consensus primers, which are intended for amplifying several HPV, usually several of the thirteen HR HPV, as well as other HPV (oncogenic LR, and sometimes also non-oncogenic HPV).
[0030] Such consensus primers are also referred to as "universal" primers. These consensus primers target conserved regions in the HPV L1 gene (e.g., the is MY09/MY11/HMB01 primers, the GP5+/GP6+ primers, the PGMY09/PGMY11 primers, and the SPF1/SPF2 or SPF10 primers), or the E1 ORF region (e.g., the CPIIG/CPI primers described in Tieben et al. 1993, J. Virol. Methods 42:265-279).
[0031] To render consensus PCR applicable to clinical diagnosis, HPV probes have been developed to detect and type HPV amplicons generated by consensus primer sets. Detection of the HPV amplicons generated by consensus primers is usually performed by a reverse hybridization line blot assay, or by colorimetric microtiter plate-based enzyme immunoassay.
[0032] Illustrative of such consensus PCR methods are the INNO-LiPA HPV test (Innogenetics, Gent, Belgium), and the Amplicor HPV test (Roche Molecular Systems, Branchburg, N.J., USA).
[0033] The INNO-LiPA HPV test is a reverse hybridization line probe assay, the prototype research version of which has been described in Kleter et al., 1999 (Journal of Clinical Microbiology, vol. 37, no8, p. 2508-2517), and Kleter et al. 1998 (American Journal of Pathology, vol. 153, no6, p. 1731-1739),
[0034] Briefly, a PCR primer set is used to generate a short PCR fragment (SPF PCR) of 65-bp from the L1 open reading frame. The prototype research INNO-LiPA primer set consists of 10 biotinylated primers (referred to as the SPF10 primer set), namely the six primers of the SPF1/2 system (described in Kleter et al. 1998), and four additional primers (MY09/11 and GP5+/6+).
[0035] The SPF10 amplimers are denatured, and incubated under hybridization conditions with poly(dT)-tailed type-specific oligonucleotide probes, which are immobilized as parallel lines on nitrocellulose membrane strips. The probe strips are then washed out for detection of the retained hybrids.
[0036] The INNO-LiPA HPV test allows the detection of at least 25 HPV genotypes (the 13 HR HPV, i.e., HPV 56, 51, 58, 33, 52, 35, 31, 16, 68, 39, 59, 45, 18, as well as other HPV, e.g., HPV 6, 11, 34, 40, 42, 43, 44, 53, 66, 70, and 74). It is a genotyping line probe assay, and is of qualitative value. The INNO-LiPA HPV test is not a quantitative assay.
[0037] The Amplicor HPV test uses amplification of target HPV DNA by PCR followed by is nucleic acid hybridization for the detection of the thirteen HR HPV. The Amplicor HPV test amplifies a sequence of about 165 bp within the L1 region. The primer sets consist of 12 primers, which have been designed as general consensus primers, to amplify the initial group of 13 HR HPV. After amplification and denaturation, the amplified HPV sequences are distributed in a microwell plate, and incubated with L1 capture probes, the hybrids being detected and visualized by colorimetric enzyme immunoassay (avidin-horseradish peroxidase conjugate). The Amplicor HPV test has been reported as being of higher analytical specificity, compared to the HC2® test (less false negative results; see Poljak et al. 2005, Acta Dermatoven APA, vol. 14, no4, p. 147-152).
[0038] The Amplicor HPV test is sensitive, but its HPV spectrum is restricted to those 13 HPV, which have been initially considered as being the HR HPV. For example, the Amplicor HPV test does not detect HPV66 and HPV53, which are now thought to be HR HPV. In other words, the Amplicor test is not designed to be adaptive to any change or evolution in HPV classification or knowledge.
[0039] Furthermore, the Amplicor HPV test is not a quantitative assay.
[0040] These line blot or microwell-based prior art techniques use consensus HPV primers, i.e., primers which result from sequence alignment of a pre-determined set of selected oncogenic HPV, and from the determination of those consensus sequences, which have a sufficient similarity or identity score with all of the selected HPV, to hybridize to all of them. Consensus primers are thus designed to amplify a predetermined sub-set of oncogenic HPV, and may not succeed in amplifying other oncogenic HPV (such as HR new corners, or non-HR oncogenic HPV).
[0041] Such a consensus approach is restricted by the possibility of determining primer sequences, which would still sufficiently hybridize to the ever increasing and ever evolving desired targets.
[0042] If one or several new oncogenic HPV strain(s) appear, such prior art consensus primers might give false negative results.
[0043] Also, none of the prior art line blot or microwell-based techniques is of a quantitative nature, whereas recent findings show that the HPV copy number accounts for the phase and/or severity of the disease, and/or have a diagnostic and/or prognostic value in the field of oncogeny.
[0044] Absence of quantitative performance limits the spectrum of clinical applicability, as such tests cannot give information on the actual cancer risk level, or on the actual cancer grade.
[0045] Moreover, according to these prior art consensus line blot or microwell-based techniques, the detection step is an additional and tedious step, which has to be performed as a separated step after amplification has occurred.
[0046] Real-time PCR amplification techniques have recently been developed for the detection of HPV16 or HPV18 (Hesselink et al. 2005, Journal of Clinical Microbiology, vol. 43, no9, p. 4868-4871; Gravitt et al. 2003, Cancer Epidemiology, Biomarkers & Prevention, vol. 12, p. 477-484).
[0047] These real-time PCR either are based on FRET (LightCycler), or use TaqMan probes (Applied Biosystems).
[0048] Compared to prior art line blot or microwell-based techniques, such real-time PCR have the advantage of combining amplification and detection in one single step, and of opening the way to quantification.
[0049] For example, van Duin et al. 2002 (Int. J. Cancer, vol. 98, no4, p. 590-595) describes a quantitative real-time PCR assay for the detection of HPV16.
[0050] Prior art real-time PCR protocols however are type-specific PCR protocols, which are limited to the detection of only one HPV per amplification run, and more particularly to the sole detection of HPV16 or HPV18. They thus represent valuable research tool, but have a very limited clinical applicability.
[0051] Attempts have been made to develop multiplex real-time PCR amplification of HPV. These attempts are however limited to duplex or triplex real-time PCR for the detection of HPV16, HPV18, HPV45. For example, Szuhai et al. 2001 (American Journal of Pathology, 159(5): 1651-1660) disclose seven type-specific molecular beacons, which are said to be type-specific molecular beacons, namely five HR HPV molecular beacons (HPV16, 18, 31, 33, 45) and two LR HPV molecular beacons (HPV6, 11); see table 1 of Szuhai et al. These molecular beacons are described as being useful for the detection of amplicons generated by the CPI/CPIIG "universal" primers. Multiplex attempts are disclosed in Szuhai is et al., but are limited to duplex or triplex assays (HPV16, HPV18, HPV45). The authors explicitly indicate that "although the multiplexing capacity of molecular beacon PCR is higher than three, it is unlikely that it will approach the number of different HPV genotypes" (see page 1656, right-hand column, second paragraph). For this reason, the authors came to the conclusion that type-specific molecular beacons cannot by their own solve the problem of HPV clinical diagnosis, and that they shall be used in combination with a general pre-screening HPV detection method, to arrive at a two-step HPV detection and genotyping strategy (see e.g., FIG. 6 of Szuhai et al.), wherein type-specific HPV molecular beacon PCR is disclosed to be used in combination with a SybrGreen general primer PCR pre-screening.
[0052] Hence, to the best of the inventors' knowledge, prior art does neither describe nor suggest any real-time amplification technique that could be worked in multiplex, whilst retaining the required HPV detection specificity, which would allow to cover at least the 13 HR HPV in a single step (amplification+detection) run. Furthermore, to the best of the inventors' knowledge, prior art does not describe any quantitative real-time HPV amplification technique, which would allow to cover at least the five most common HR HPV (namely, HPV16, 18, 45, 31 and 33), preferably at least the 13 HR HPV, more preferably at least the 13 HR HPV as well as five other oncogenic HPV, in a single step (amplification+detection) run, and which would be quantitative, even when implemented in multiplex.
ABSTRACT OF THE INVENTION
[0053] The present invention relates to the detection of HPV by amplification, more particularly of mucosal-type HPV, still more particularly of HPV, which can be oncogenic for the mucosal epithelia.
[0054] The present invention allows the detection of at least the five most common HR HPV (HPV16, 18, 45, 31, 33), preferably at least 7 HR HPV, still preferably the five most common HR HPV as well as at least two other HR HPV, advantageously at least two other HR HPV belonging to groups A6 and/or A5 (e.g., HPV 56, 51, 33, 31, 16, 45, 18), more preferably at least the 13 HR HPV (HPV 56, 51, 58, 33, 52, 35, 31, 16, 68, 39, 59, 45, 18), most preferably at least the 13 HR HPV and five other oncogenic HPV (HPV66, 53, 82, 67, 85).
[0055] The present invention relates to amplification primer systems, and to detection probe systems, as well as to the amplification-detection systems (i.e. real-time amplification systems), which result from the combination of at least one amplification primer system of the invention and at least one detection probe system of the invention.
[0056] The present invention also relates to reference template HPV sequences, which are suitable for the production of amplification primers and detection probes of the invention, as well as to amplicons obtainable by amplification of an HPV nucleic acid with at least one amplification primer system of the invention, and optionally by detection with at least one detection probe system of the invention.
[0057] The present invention further relates to the biological and pharmaceutical applications thereof, more particularly to the diagnostic and prognostic applications thereof, notably in the field of CIN and cervical cancer.
[0058] The HPV amplification method of the invention is based on an approach of HPV tropism and oncogenicity, which is completely different from, and completely innovative compared to prior art approaches: contrary to the global consensus approaches, or to the type-specific approaches, which prior art methods have up to now followed, the present inventors have designed and built an approach, which is an HPV group-based approach (see the phylogenetic tree shown in FIG. 1, which has been built by the present inventors). According to the inventors' HPV group-based approach, amplification primer systems and detection probe systems are provided for each HPV group that comprises at least one HPV type capable of being oncogenic for the mucosal epithelia, namely at least for each of groups A6, A5, A9 and A7.
[0059] Indeed, the present inventors have selected appropriate targets within each of said HPV groups, which are suitable for the production of primers and probes covering
at least the five most common HR HPV (namely, HPV16, 18, 45, 31 and 33), preferably at least 7 HR HPV, still preferably the five most common HR HPV as well as at least two other HR HPV, advantageously at least two other HR HPV is belonging to groups A6 and/or A5 (e.g., HPV 56, 51, 33, 31, 16, 45, 18), more preferably at least the 13 HR HPV, most preferably at least the 13 HR HPV and five other oncogenic HPV (HPV66, 53, 82, 67, 85), in a single step (amplification+detection) run.
[0060] The selected targets of the present invention are reference template sequences, which allow designing and building primers (hybridizing to one end of said selected targets, or to the complementary sequence thereof), as well as amplicon-annealing probes, which allow to cover said HPV in a single step (amplification+detection) run.
[0061] The amplification primer systems of the present invention are targeted to the HPV of group A6 or A5 or A9 or A7, and are intended to amplify as many HPV types belonging to one of these groups as possible.
[0062] The detection probe systems of the present invention allow the detection of one or several of the amplicon(s) obtainable by amplification of a given HPV by an amplification system of the present invention. They are targeted to group(s) A6 and/or A5 and/or A9 and/or A7, and are especially adapted to implementation in real-time with said amplification primer systems.
[0063] The detection probe systems of the invention comprise probes, which allow for the general detection of at least one HPV that belongs to the HPV set formed by groups A6 and A5 and A9 and A7, as well as more precise detections, such as:
[0064] the detection of at least one HPV that belongs to group A6 or A5 or A9 or A7, or
[0065] the detection of at least one HPV that belongs to a sub-set of group A6 HPV, or of group A5 HPV, or of group A9 HPV, or of group A7 HPV, or
[0066] the detection of at least one particular HPV type.
[0067] The present invention thereby provides a great flexibility of precision levels for the detection of HPV. Such flexibility has, to the best of the inventors' knowledge, never has been previously attained.
[0068] The present invention further provides A6- and/or A5- and/or A9- and/or A7-targeted systems, resulting from the combination of at least one amplification primer system of the invention and at least one detection probe system of the invention.
[0069] The present invention more particularly provides A6- or A5- or A9- or A7-targeted systems, which comprise at least one amplification primer system of the invention and at least one detection probe system of the invention, wherein said at least one amplification primer system and said at least one detection probe system are targeted to the same group, i.e., A6 or A5 or A9 or A7.
[0070] Most of the amplification primer and/or detection probe systems of the present invention comprise more than two primers and/or more than one probe. Hence, most of the amplification primer and/or detection probe systems of the invention, and notably the A9-targeted systems, and the A7-targeted systems, already are by themselves multiplex systems.
[0071] According to a very advantageous feature of the present invention, the group-targeted systems of the present invention are suitable for use together in a single-tube amplification, i.e., the present invention allows for implementation of at least one A6-targeted system, and at least one A5-targeted system, and at least one A9-targeted system, and at least one A7-targeted system, together in a single-tube assay, thereby resulting in what could be called a multi-multiplex, i.e., a "megaplex" amplification and/or detection: see e.g., in the examples below, illustrative "megaplex" involving 17 primers and 12 probes, which are capable of amplifying and detecting seventeen oncogenic mucosal-type HPV in a single-tube assay, without any significant loss in specificity, and without any significant loss in sensitivity.
[0072] Hence, the amplification primer systems and detection probe systems are specifically adapted to real-time multiplex amplification.
[0073] To the best of the inventors' knowledge, there is no prior art method, which would allow for a real-time multiplex amplification of at least the five most common HR HPV, preferably at least 7 HR HPV, still preferably the five most common HR HPV to as well as at least two other HR HPV, advantageously at least two other HR HPV belonging to groups A6 and/or A5 (e.g., HPV 56, 51, 33, 31, 16, 45, 18), more preferably at least the 13 HR HPV.
[0074] Advantageously, the present invention allows for the detection of at least 18 oncogenic mucosal-type HPV in a single-tube assay, namely the 13 HR HPV, as well as five other oncogenic HPV (HPV66, 53, 82, 67, 85).
[0075] A further advantageous aspect of the present invention is that it is especially adapted to HPV viral load quantification. The HPV method of the invention is able to remain specific and quantitative, even when implemented in a single-tube multiplex.
[0076] The amplification primer systems and detection probe systems are specifically adapted to real-time quantitative multiplex amplification, and retain this capacity even when implemented in a "megaplex" mode comprising at least one A6-targeted system, and at least one A5-targeted system, and at least one A9-targeted system, and at least one A7-targeted system, together in a single-tube assay.
[0077] To the best of the inventors' knowledge, there is no prior art method, which would allow for a real-time quantitative multiplex amplification of said at least five most common HR HPV, preferably at least 7 HR HPV, still preferably the five most common HR HPV as well as at least two other HR HPV, advantageously at least two other HR HPV belonging to groups A6 and/or A5 (e.g., HPV 56, 51, 33, 31, 16, 45, 18), more preferably at least the 13 HR HPV, more preferably at least the 13 HR HPV and five other oncogenic HPV (HPV66, 53, 82, 67, 85).
[0078] The amplification primer systems and the detection probe systems of the invention all share the special technical feature of being designed and built according to a group-based approach of HPV oncogenicity, and of being suitable for implementation together in a the same assay tube.
[0079] More particularly, they enable a real-time "megaplex" implementation covering at least the five most common HR HPV types, preferably at least 7 HR HPV (e.g., HPV 56, 51, 33, 31, 16, 45, 18), still preferably the five most common HR HPV as well as at least two other HR HPV, advantageously at least two other HR HPV belonging to groups A6 and/or A5 (e.g., HPV 56, 51, 33, 31, 16, 45, 18), more preferably at least the 13 HR HPV, more preferably at least 18 oncogenic mucosal-type HPV (i.e., at least the 13 HR HPV, and five other oncogenic HPV, e.g., HPV66, 53, 82, 67, 85), in a single-tube assay, without any significant loss in the qualitative accuracy of the HPV detection.
[0080] The amplification primer systems and the detection probe systems of the invention further show levels of specificity, Ct and sensitivity, which are sufficiently homogeneous to allow for a real-time "megaplex" amplification, which is of quantitative value.
[0081] The group-based approach of the present invention further provides flexibility to the amplification and/or detection systems, as their intrinsic design is likely to make them suitable for detection of any oncogenic HPV "new corner" that may arise by mutagenesis.
[0082] The group-based approach of the present invention also confers flexibility in the use for clinical diagnosis: depending on the choice of probe system(s) that is made by the user, the precision level in HPV detection can range from a general response indicating the detection of at least one HPV belonging to the set formed by groups A6 and A5 and A9 and A7, to the very precise response indicating the detection of at least one particular HPV type. To the best of the inventors' knowledge, such flexibility has up to now never been attained.
[0083] The group-based approach of the present invention further is suitable for providing accuracy in case of multi- and/or co-infections.
[0084] It is believed that such an achievement represents a technological breakthrough, compared to prior art HPV detection systems.
BRIEF DESCRIPTION OF THE FIGURES
[0085] FIG. 1: phylogenic tree of the present invention;
[0086] FIGS. 2A and 2B: schematic presentation of the amplification targets for HPV groups A6 (HPV56) and A5 (HPV51) (FIG. 2A), and for groups A9 (HPV16) and A7 (HPV18) (FIG. 2B);
[0087] FIG. 3: reprint of NCBI--001594.1, sequence of HPV56 (reference HPV for group A6); SEQ ID NO:420;
[0088] FIG. 4: reprint of NCBI--001533.1, sequence of HPV51 (reference HPV for group A5); SEQ ID NO:421;
[0089] FIG. 5: reprint of NCBI--001526.1, sequence of HPV16 (reference HPV for group A9); SEQ ID NO:422;
[0090] FIG. 6: reprint of NCBI--001357.1, sequence of HPV18 (reference HPV for group A7); SEQ ID NO:423;
[0091] FIG. 7: convention for positions, which is followed in present application.
[0092] All sequences, including reverse primers, are listed in their 5' to 3' orientation. Start and stop positions on a reference HPV sequences are given in increasing value order. Hence:
[0093] concerning primers: start and stop positions are either the start and stop positions of the reference HPV fragment, to which the sequence of the primer corresponds (case of forward primer), or the start and stop positions of the reference HPV target fragment, to which the primer anneals (case of the reverse primers);
[0094] with regards to the probes: as a probe and its complementary sequence are, at least in simplex amplification, products, which have equivalent functions, the start and stop positions are either those of the reference HPV fragment, to which the sequence of the probe corresponds, or those of the reference HPV target fragment, to which the probe anneals.
DETAILED DESCRIPTION
[0095] The present invention is based on an approach, which is completely different from, and truly innovative, compared to prior art techniques. The invention overcomes the drawbacks of prior art techniques, and has numerous advantages, notably in terms of clinical applicability, performance, reliance and flexibility.
[0096] As mentioned in the above "background" section, prior art primers are designed either as type-specific primers, or as general consensus primers by classic alignment of as many mucosal HPV sequence as required, or desired, or as possible (e.g., by direct alignment of the 13 HR HPV).
[0097] On the contrary, the primers of the invention have been designed by HPV groups (=HPV genera).
[0098] Indeed, the present inventors analyzed the phylogeny of HPV, and have constructed the resulting phylogenic tree, which is shown in FIG. 1.
[0099] The present inventors selected one HPV sub-family, which is involved in carcinogenesis of the mucosal epithelia, namely sub-family A. They further selected a set of HPV types, which is representative of HPV sub-family A. This representative set consists in 35 different HPV types, among which 18 types are mucosal HPV, which are at least potentially oncogenic HPV (i.e., the 13 HPV known as the 13 HR; two potentially HR HPV -HPV53 and HPV66-; and three other HPV, which are believed to have an oncogenic potential -HPV82, HPV67 and HPV85-), the remaining 17 other HPV types being up to now known as being non-oncogenic HPV (see FIG. 1).
[0100] The inventors thus came to the conclusion that those HPV, which have a tropism for the mucosal epithelia, and which are at least potentially oncogenic HPV, are distributed among groups A6, A5, A9 and A7 (see FIG. 1). More precisely, said mucosal oncogenic HPV are distributed among:
[0101] group A6, for HPV66, HPV56, HPV53;
[0102] group A5, for HPV51, HPV82;
[0103] group A9, for HPV58, HPV33, HPV67, HPV52, HPV35, HPV31, HPV16;
[0104] group A7, for HPV68, HPV39, HPV85, HPV59, HPV45, HPV18.
[0105] By "HPV, which is at least potentially oncogenic", it is meant that said HPV is either known to be oncogenic (such as those 13 HPV, which are usually referred to as the 13 HR HPV, as well as other oncogenic HPV, such as HPV66, HPV53, and HPV82), or which have been described at least by some authors as potentially oncogenic (such as HPV85), or which would be in the future described as associated to a tumorous mucosa.
[0106] The design by group is a special feature shared by all the products of the invention.
[0107] In addition to covering at least the five most common HR HPV types, preferably at least 7 HR HPV, still preferably the five most common HR HPV as well as at least two other HR HPV, advantageously at least two other HR HPV belonging to groups A6 and/or A5 (e.g., HPV 56, 51, 33, 31, 16, 45, 18), more preferably at least the thirteen HR HPV types, in a single-tube experiment, the means offered by the present invention is likely to detect any particular variant that a patient may have. Hence, the method of the invention is much safer than any prior art method.
[0108] In case of multiple HPV infections, several HPV types are present in the collected sample. A competitive effect may then be observed, wherein one HPV type takes prevalence over another one for the same consensus primer. Detection of the competed HPV may then be hampered, although the primer has initially been designed to hybridize to both HPV.
[0109] The present invention further has the advantage of enabling the analysis of multi- and/or co-infection cases, without any loss in specificity and sensitivity.
[0110] The present invention thus relates to amplification primer systems, to detection probes system, and to pharmaceutical compositions, biological compositions, and detection kits comprising at least one of said amplification and detection systems. The present invention also relates to a method of HPV detection, which comprises the amplification of at least one HPV nucleic acid fragment, by at least one amplification primer system of the invention, and which optionally comprises the detection of the amplicon(s) thereby produced, by at least one detection probe system of the invention.
[0111] The HPV detection method of the invention is notably useful for the diagnosis of an HPV-related disease or condition, for the prognosis or risk assessment of such an HPV-related disease or condition, for monitoring of the evolution of an HPV-related disease or condition, for monitoring the efficiency of an anti-HPV drug or treatment, such as e.g., an anti-HPV vaccine or an anti-HPV vaccine candidate (e.g., an anti-HPV16 and/or anti-HPV18 and/or anti-HPV45 vaccine, or vaccine candidate).
[0112] Said HPV-related disease or condition is any disease or condition involving HPV, and more particularly an HPV-related neoplasia (e.g., cervical intraepithelial neoplasia) or cancer, such as a cervical cancer.
[0113] The present invention thus provides amplification primer systems and detection probe systems, which are targeted to the oncogenic HPV of group A6, and/or to the oncogenic HPV of A5, and/or to the oncogenic HPV of A9, and/or to the oncogenic HPV of A7.
[0114] Most of the amplification and/or detection systems of the present invention are multiplex systems, which comprises more than two primers and/or more than one probe. It is notably the case of the A9-targeted systems and of the A7-targeted systems.
[0115] Each amplification primer system can be implemented with an amplification primer system of another group in a single-tube amplification assay, without any significant loss in specificity. Hence, at least one A6-targeted amplification primer system of the present invention and at least one A5-targeted amplification primer system of the present invention and at least one A9-targeted amplification primer system of the present invention and at least one A7-targeted amplification primer system of the present invention, can be used together in a single-tube amplification assay, without any significant loss in specificity.
[0116] For each amplification primer system, the invention provides at least one detection probe system, thereby forming an amplification and detection system (i.e., a real-time amplification system).
[0117] Each detection probe system of the present invention can be implemented with its corresponding amplification primer system in a single-tube assay, without any significant loss in specificity, thereby allowing for a real-time HPV amplification and detection.
[0118] The present invention thus provides with group-targeted amplification and detection systems, namely:
[0119] several A6-targeted amplification and detection systems,
[0120] several A5-targeted amplification and detection systems,
[0121] several A9-targeted amplification and detection systems,
[0122] several A7-targeted amplification and detection systems.
[0123] Each amplification and detection system can be implemented with an amplification and detection system of another group in a single-tube amplification assay, without any significant loss in specificity, thereby allowing for a single-tube multi-multiplex (or "megaplex") real-time amplification and detection of those HPV, which have a tropism for the mucosal epithelia, and which are at least potentially oncogenic HPV.
[0124] Hence, at least one A6-targeted amplification and detection system of the present invention, and at least one A5-targeted amplification and detection system of the present invention, and at least one A9-targeted amplification and detection system of the present invention, and at least one A7-targeted amplification and detection system of the present invention, can be used together in a single-tube amplification assay, without any significant loss in specificity.
[0125] Whilst the invention provides systems, which are especially adapted to multiplex or multi-multiplex implementation, the implementation of a system of the invention in simplex mode is of course also encompassed by the present invention.
[0126] The amplification and detection systems of the present invention further have levels of Ct and sensitivity, which are sufficiently homogeneous to allow for a quantitative HPV amplification and detection. The present invention thereby allows for the identification of the presence of one or several mucosal HPV in a single-tube assay, as well as for the determination of the viral HPV load(s). The quantitative property of the present invention is retained, even when it is implemented in a "megaplex" mode.
[0127] The invention thus relates to group-targeted amplification and/or detection systems, and to their use for the detection of mucosal HPV, said group-targeted amplification and/or detection systems sharing the special technical feature of being suitable for multiplex (in fact, multi-multiplex, i.e., "megaplex") amplification and for real-time detection thereof, whereby these systems allow for the detection in a single-tube assay of at least the five most common HR HPV (i.e., HPV16, 18, to 45, 31, 33),
preferably at least 7 HR HPV, still preferably the five most common HR HPV as well as at least two other HR HPV, advantageously at least two other HR HPV belonging to groups A6 and/or A5 (e.g., HPV 56, 51, 33, 31, 16, 45, 18), even still preferably at least the thirteen HPV known as HR HPV (HPV types 56, 51, 58, 33, 52, 35, 31, 16, 68, 39, 59, 45 and 18), more preferably, at least the thirteen HPV as well as at least one among HPV types 66, 82, 67, 85, and 53 still more preferably, at least the thirteen HPV as well as at least two among HPV types 66, 82, 67, 85, and 53 even still more preferably, at least the thirteen HPV as well as at least three among HPV types 66, 82, 67, 85, and 53 most preferably, at least the thirteen HPV as well as at least four among HPV types 66, 82, 67, 85, and 53, notably of least the seventeen mucosal HPV, consisting of said 13 HR HPV and HPV types 66, 82, 67, 85, still most preferably, at least the thirteen HPV as well as at least the five HPV types 66, 82, 67, 85, and 53.
[0128] The group-targeted amplification and/or detection systems of the present invention further share the special technical feature of allowing such a real-time "megaplex" amplification to be quantitative.
[0129] As above-mentioned, the amplification and detection systems of the present invention are based on a truly innovative group-based approach.
[0130] Indeed, according to prior art general consensus techniques, the design of the primers (also referred to as "universal" primers) is made by alignment of all HPV sequences to be amplified, e.g., the 13 HR HPV, and determination of consensus sequences, which targets as many of the 13 HPV as possible. Hence, such consensus sequences are found in a conserved gene or region, such as a gene of late coding region (e.g., gene L1), and the same conserved gene or region is selected for the whole set of HPV to be amplified.
[0131] On the contrary, the present inventors made a design per HPV group, i.e., they selected appropriate targets for each HPV group. More particularly, they selected genes of the early coding region, more particularly genes E1, E2, E6, E7. The present inventors have designed particular targets for each the desired HPV groups.
[0132] For example, the primers, which have been designed for group A5, have their target within genes E7, E1; the primers, which have been designed for group A6, have their target within genes E6, E7; the primers, which have been designed for group A7, have their target within gene E1; and the primers, which have been designed for group A9, have their target within genes E1, E2. Illustrative targets of the invention are shown in FIGS. 2A (groups A5 and A6) and 2B (groups A7 and A9).
[0133] Hence, the present inventors selected reference template sequences for each of groups A5, A6, A7 and A9, wherein the A5 reference template sequences are within the region consisting of genes E7 and E1, the A6 reference template sequences are within the region consisting of genes E6 and E7, the A7 reference template sequences are within gene E1, and the A9 reference template sequences are within the region consisting of genes E1 and E2.
[0134] The primers are designed and built to hybridize to one end of said targets (or to the complementary sequence thereof), whereby a primer pair anneals to each end of said target (or to the complementary sequence thereof).
[0135] The probes are designed and built to anneal to one of said reference template sequences, whereby each probe anneals to at least one of the amplicons generated by a primer system of the invention.
[0136] An amplification primer system of the invention comprises at least two primers. A detection probe system of the invention comprises at least one probe.
[0137] The amplification primer systems of the invention preferentially amplify HPV that belong to group A6 or A5 or A9 or A7, i.e., oncogenic HPV.
[0138] The present inventors further succeeded in producing amplification primer systems, which are specific of the HPV set formed by groups A5 and A6 and A7 and A9. These amplification primer systems of the invention do not amplify any HPV that would belong to a group other than A5, A6, A7, A9. Indeed, most primer systems of the invention are specific of the HPV set formed by groups A6 and A5 and A9 and A7.
[0139] Moreover, most of amplification primer systems of the invention are specific of the group to which they are targeted, i.e., most primer systems of the invention are specific of group A6 or A5 or A9 or A7: most primers of a given amplification system amplify one or several HPV of the same HPV group, without amplifying is any HPV that would belong to another HPV group.
[0140] Those primer systems of the invention, which are not specific of the HPV set formed by groups A5 and A6 and A7 and A9, may amplify nucleic acids that are not from an HPV of said groups, e.g., a non-oncogenic HPV. In such a case, these primer systems of the invention do however show a much lower amplification efficiency for these non-target amplicons (e.g., they lead to a PCR efficiency that is much lower than the one obtained for HPV of groups A5 and/or A6 and/or A9 and/or A7, and are therefore not quantitative).
[0141] When a group-targeted primer system of the invention is combined with a probe system of the invention that is targeted to the same group, the group-targeted real-time amplification system that results therefrom is specific of the HPV set formed by groups A5 and A6 and A9 and A7: none of such real-time amplification systems detects an HPV that would not belong to group A5 or A6 or A9 or A7. Furthermore, most of these real-time amplification systems are specific of the group to which they targeted.
[0142] Only one real-time amplification system of the invention has a cross-group reactivity: the real-time amplification primer system designed for group A9, which is referred to in the examples below as system C, detects the seven HPV types of group A9, and also HPV53, which is an oncogenic HPV belonging to group A6 (HPV53 being a potentially HR HPV); this group A9 system C does however not detect any other HPV among the 42 HPV tested (no group A6 HPV other than HPV53; no group A5 HPV; no group A11 HPV; no group A7 HPV, no group A4 HPV; no group A3 HPV).
[0143] In any case, does a real-time amplification system of the present invention detect a nucleic acid that would be a human nucleic acid.
[0144] When it is desired to amplify any HPV, which belongs to group A6, A5, A9, or A7, most of the amplification primer systems of the present invention will in fact comprise more than two primers, i.e., at least three primers.
[0145] For example, the amplification primer systems, which are targeted to group A6 or A5, only require a primer pair to amplify HPV56 and optionally HPV66 (for group A6), or HPV51 and optionally HPV82 (for group A5). But, those amplification primer systems, which are targeted to group A9 or A7, have to amplify six or seven HPV types of group A9, or five or six HPV types of group A7, if a complete coverage of the HPV spectrum of the group is desired. Under such instances, an A9- or A7-targeted amplification system of the invention may comprise e.g., at least three or four forward primers, and two, three, four, five or more reverse primers. Such A9- or A7-targeted amplification primer systems therefore are already multiplex systems by themselves.
[0146] Of course, the skilled person, who would like to restrict the spectrum of amplified HPV, might select fewer forward and/or reverse primers, depending on which HPV types or strain he/she would like to amplify.
[0147] Similarly, when it is desired to detect any HPV, which belongs to group A6, A5, A9, or A7, most of the detection probe systems of the present invention will in fact comprise more than one probe, i.e. at least two probes.
[0148] For example, the detection probe systems, which are targeted to group A6 or A5, only require probe to detect HPV56 and optionally HPV66 (for group A6), or HPV51 and optionally HPV82 (for group A5). But, those detection probe systems, which are targeted to group A9 or A7, may comprise one probe per HPV type or strain to be detected, notably when a both a complete coverage of the HPV group spectrum, and a simultaneous HPV group or type discrimination are desired. An A9- or A7-targeted detection probe system may thus comprise at least four probes, for example four, five or six probes.
[0149] As above-mentioned, all detection probe systems of the present invention are adapted to real-time detection, and can thus be implemented with their corresponding amplification primer systems in the very same tube.
[0150] In the examples below, are described several A6-, A5-, A9 and A7-targeted amplification and/or detection systems of the invention.
[0151] In these examples, are shown table 12 to table 88:
[0152] tables 12-35: these tables gives the SEQ ID NO: and positions of the reference amplicons (the sequences of these reference template amplicons are also listed after the last table, i.e., before the "claims" section), the forward primers, the reverse primers, the probes, the beacons probes of illustrative group-targeted systems of the invention;
[0153] tables 35-50: these tables show the number of nucleotide mismatches shown by primers and probes of the invention (alignment of the sequences of 50 HPV types); an empty box indicates there is no coherent sequence alignment;
[0154] tables 51-68: specificity of the detection systems of the invention;
[0155] tables 69-82: system sensitivity;
[0156] tables 83-88: "megaplex" specificity and sensitivity,
[0157] table 89: list of HPV genome sequences.
[0158] A reference genome has been elected for each HPV group, namely:
[0159] for group A5: the reference genome is the genome sequence of HPV51 available under accession number NC--001533.1,
[0160] for group A6: the reference genome is the genome sequence of HPV56 available under accession number NC--001594.1,
[0161] for group A7: the reference genome is the genome sequence of HPV18 available under accession number NC--001357.1,
[0162] for group A9: the reference genome is the genome sequence of HPV16 available under accession number NC--001526.1,
[0163] In the following tables, the term <<address>> means a nucleotide position in the reference genome. More precisely:
[0164] a forward primer having an address X is an isolated oligonucleotide, which has a sequence which is the sequence of a fragment of the reference genome starting at position X in said reference genome, or a variant of such a fragment sequence (see the mismatch count tables below),
[0165] a reverse primer having an address X is an isolated oligonucleotide, which has a sequence which is complementary to the sequence of a fragment of the reference genome ending at position X in said reference genome, or a variant of such a fragment sequence (see the mismatch count tables below),
[0166] a probe having an address X is an isolated oligonucleotide, the sequence of which is the sequence of a fragment of the reference genome starting at position X in said reference genome, or which is the complementary sequence of such a fragment sequence (over the entire length of this fragment sequence), or a variant of such a fragment sequence or of such a complementary fragment sequence (see the mismatch count tables below).
[0167] As a consequence, when a primer pair, which is selected from a given system, to consist of a forward primer having the address Xf, and of a reverse primer having the address Kr, is implemented on its reference HPV genome under conditions favorable to nucleic acid amplification, this primer pair then amplifies from said HPV reference genome an amplicon, which consists of the sequence that extends from position Xf to position Xr in said reference HPV genome (start and stop positions included).
[0168] When this primer pair is, under conditions favorable to nucleic acid amplification, implemented on a given HPV genome, which is not its reference HPV genome, but which belongs to the same group as this reference HPV genome, this primer pair then amplifies from said given HPV genome an amplicon, which consists in the sequence of the fragment of said given HPV genome, which corresponds by sequence alignment to the fragment that extends from position Xf to position Xr in said reference HPV genome.
[0169] A fragment A, which is a fragment of a given HPV genome and, which corresponds by sequence alignment to a fragment B of a HPV reference genome, means that said fragment A has the same length as said fragment B, and that the start and stop positions of said fragment A within said given HPV genome are such that, among those fragments of said given HPV genome, which have the same length as said fragment B, said fragment A is the fragment, which gives the best identity score when compared to the nucleotide sequence of said fragment B, as determined by global alignment to the nucleotide sequence of fragment B.
[0170] It will also be understood that:
[0171] a forward primer having an address Xf and a length Lf is an to isolated oligonucleotide, which has a sequence which is the sequence of a fragment of the reference genome starting at position Xf in said reference genome, and ending at position Xf+Lf-1 in said reference genome, or a variant of such a fragment sequence (see the alignments shown below),
[0172] a reverse primer having an address Xr and a length Lr is an isolated oligonucleotide, which has a sequence which is complementary to the sequence of a fragment of the reference genome starting at position Xr-Lr-1, and ending at position Xr in said reference genome, or a variant of such a fragment sequence (see the alignments shown below),
[0173] a probe having an address Xp and a length Lp is an isolated oligonucleotide, the sequence of which is the sequence of a fragment of the reference genome starting at position Xp and ending at position Xp+Lp-1 in said reference genome, or which is complementary to such a fragment sequence, or a variant of such a fragment sequence or of such a complementary fragment sequence (see the alignments shown below).
[0174] The present invention thus relates to a process for the nucleic acid amplification of at least one HPV target, wherein said HPV is an HPV, which has a tropism for the mucosal epithelia, and which is at least potentially oncogenic, preferably at least one oncogenic anogenital HPV target, most preferably at least one oncogenic cervical HPV. The amplification process of the invention comprises the step of producing from said at least one HPV target at least one amplicon by means of at least two primers.
[0175] According to an advantageous embodiment of the present invention, the amplification process of the present invention can be a real-time multiplex amplification process, involving at least one probe that can anneal to the amplicon(s) generated by said t least two primers.
[0176] The present invention relates to a process for the detection of at least one HPV, which has a tropism for the mucosal epithelia, and which is an at least potentially oncogenic HPV, preferably at least one oncogenic anogenital HPV, most preferably at least one oncogenic cervical HPV, in a sample. The detection process of the present invention comprises the detection of at least one nucleic acid HPV target which has been amplified by the process of nucleic acid amplification of the invention.
[0177] The present invention relates to a process for the detection of at least one HPV, which has a tropism for the mucosal epithelia, and which is an at least potentially oncogenic HPV, preferably at least one oncogenic anogenital HPV, most preferably at least one oncogenic cervical HPV, in a sample, by determination of whether at least one amplicon has been, or is produced from said sample, or from nucleic acid material thereof, by amplification by means of at least two amplification primers of the invention, and/or at least one amplification primer system of the invention.
[0178] The production of at least one amplicon indicates that at least one HPV, which has a tropism for the mucosal epithelia, and which is at least potentially oncogenic, preferably at least one oncogenic anogenital HPV, most preferably at least one oncogenic cervical HPV, is present in said sample.
[0179] According to an advantageous embodiment of the present invention, the determination of whether at least one amplicon is produced can be carried out in real-time multiplex amplification, preferably with at least one probe of the invention and/or at least one probe system of the invention.
[0180] The present invention thus relates to a process for the detection of at least one HPV, which has a tropism for the mucosal epithelia, and which is at least potentially oncogenic, preferably at least one oncogenic anogenital HPV, most preferably at least one oncogenic cervical HPV, in a sample, which comprises:
[0181] contacting said sample, or nucleic acid material thereof, with at least two amplification primers of the invention and/or at least one primer system of the invention, under conditions suitable to the production of at least one amplicon by said primers (i.e., under conditions, which would be suitable to the production by said primers of at least one amplicon from said at least one HPV to be detected, if this HPV were present in said sample),
[0182] determining whether at least one amplicon has been produced, or is produced by said primers (e.g., by means of at least one detection probe, preferably in real-time amplification involving at least one probe of the invention and/or at least one detection probe system of the invention).
[0183] The production of at least one amplicon indicates that at least one HPV, which has a tropism for the mucosal epithelia, and which is an at least potentially is oncogenic HPV, preferably at least one oncogenic anogenital HPV, most preferably at least one oncogenic cervical HPV, is present in said sample.
[0184] By "sample containing nucleic acid material", it is meant any sample, which contains at least one nucleic acid, e.g., a biological sample, such as a sample which has been collected from a cell culture, or from an animal or a human being, e.g., from a female human being, preferably a sample which has been collected from a uterine cervix.
[0185] Said sample may optionally have been further treated and/or purified according to any technique known by the skilled person, to improve the amplification efficiency and/or qualitative accuracy and/or quantitative accuracy. The sample may thus exclusively, or essentially, consist of nucleic acid(s), whether obtained by purification, isolation, or by chemical synthesis. Means are available to the skilled person, who would like to isolate or purify nucleic acids, such as DNA, from a biological sample, for example to isolate or purify DNA from cervical scrapes (e.g., QIAamp-DNA Mini-Kit; Qiagen, Hilden, Germany).
[0186] Hence, the detection method of the present invention enables the real-time multiplex detection, preferably the real-time quantitative multiplex detection of:
at least the five most common HR HPV (i.e., HPV16, 18, 45, 31, 33), preferably at least 7 HR HPV, still preferably the five most common HR HPV as well as at least two other HR HPV, advantageously at least two other HR HPV belonging to groups A6 and/or A5 (e.g., HPV 56, 51, 33, 31, 16, 45, 18), even still preferably at least the thirteen HPV known as HR HPV (HPV types 56, 51, 58, 33, 52, 35, 31, 16, 68, 39, 59, 45 and 18), more preferably, at least the thirteen HPV as well as at least one among HPV types 66, 82, 67, 85, and 53 still more preferably, at least the thirteen HPV as well as at least two among HPV to types 66, 82, 67, 85, and 53 even still more preferably, at least the thirteen HPV as well as at least three among HPV types 66, 82, 67, 85, and 53 most preferably, at least the thirteen HPV as well as at least four among HPV types 66, 82, 67, 85, and 53, notably of least the seventeen mucosal HPV, consisting of said 13 HR HPV and HPV types 66, 82, 67, 85, still most preferably, at least the thirteen HPV as well as at least the five HPV types 66, 82, 67, 85, and 53, in a single-tube assay.
[0187] The present invention also relates to all the medical, biological, pharmaceutical applications of the detection method of the invention, and/or of the primers and/or probes of the invention.
[0188] The present invention thus relates to a process for the diagnosis or prognosis of cervical neoplasia or cancer, which comprises determining the presence, re-occurrence, persistence, or cellular spread of at least one HPV by the detection method of the invention, e.g., by implementing it on a sample, which may have been collected from a patient, whereby a positive determination indicates that there is a cervical neoplasia or cancer, or that there is a prevalent risk of such a condition or disease.
[0189] The present invention also relates to a process for monitoring the efficiency of an anti-HPV treatment or drug, or an anti-HPV candidate treatment or drug, such as an anti-HPV16 and/or 18 and/or 45 treatment, drug, candidate treatment or candidate drug, which comprises determining said treatment, drug, candidate treatment or candidate drug induces the non-reoccurrence, non-persistence, disappearance, or a decrease in cellular spread of at least one HPV by the detection method of the invention, whereby a positive determination indicates that said treatment, drug, candidate treatment or candidate drug is an efficient anti-HPV drug.
[0190] The present invention also relates to a method to produce an anti-HPV drug, which comprises:
[0191] providing at least one anti-HPV candidate drug,
[0192] administering said at least one candidate anti-HPV drug to a cell culture or to a non-human animal, wherein said cell culture or animal is or comprises at least one cervical neoplasia or cancer, and
[0193] determining by the HPV detection method of the invention whether said candidate anti-HPV drug induces the regression or disappearance of said at least one neoplasia or cancer, whereby a positive determination indicates that said candidate drug is an efficient anti-HPV drug.
[0194] As above-mentioned, the present invention thus provides HPV amplification and detection means, which can be implemented in real-time and in multiplex, i.e., which combine target amplification and detection in one single operative step, and which enables the detection of mucosal HPV in one single operative step, without any significant loss in specificity.
[0195] Furthermore, the amplification and detection systems of the invention have Ct and sensitivity levels, which are sufficiently homogeneous to allow for a real-time quantitative multiplex HPV detection.
[0196] According to the present invention, said amplification primers may comprise:
[0197] at least two primers, which are intended for targeting oncogenic HPV of group A6, wherein said at least two A6-targeted primers are oligonucleotides, which consist of 14-30 nucleotides, preferably of 15-29, more preferably of 16-28, most preferably of 17-25 nucleotides, the sequences of which are suitable for use as forward and reverse primers, respectively, in the amplification of at least one nucleic acid of 90-390 nucleotides, preferably of 95-385 nucleotides, more preferably of 100-379 nucleotides, from the A6-target region consisting of the E6 and E7 genes of HPV56, and/or
[0198] at least two primers, which are intended for targeting oncogenic HPV of group A5, wherein said at least two A5-targeted primers are oligonucleotides, which consist of 14-30 nucleotides, preferably of 15-29, more preferably of 16-28, most preferably of 17-25 nucleotides, the sequences of which are suitable for use as forward and reverse primers, respectively, in the amplification of at least one nucleic acid of at least 90-240 nucleotides, preferably of 100-230 nucleotides, more preferably of 106-225 nucleotides, from the A5-target region consisting of the E7 and E1 genes of HPV51, and/or
[0199] at least two primers, which are intended for targeting oncogenic HPV of group A9, wherein said at least two A9-targeted primers are oligonucleotides, which consist of 14-30 nucleotides, preferably of 15-29, more preferably of 16-28, most preferably of 17-25 nucleotides, the sequences of which are suitable for use as forward and reverse primers, respectively, in the amplification of at least one nucleic acid of at least 80-260 nucleotides, preferably of 85-250 nucleotides, more preferably of 88-241 nucleotides, from the A9-target region consisting of the E1 and E2 genes of each of the following group A9 HPV: HPV58, HPV33, HPV52, HPV35, HPV31 and HPV16, preferably from the E2 gene of each of said group A9 HPV, and/or
[0200] at least two primers, which are intended for targeting oncogenic HPV of group A7, wherein said at least two A7-targeted primers are oligonucleotides, which consist of 14-30 nucleotides, preferably of 15-29, more preferably of 16-28, most preferably of 17-25 nucleotides, the sequences of which are suitable for use as forward and reverse primers, respectively, in the amplification of at least one nucleic acid of at least 100-220 nucleotides, preferably of 120-215 nucleotides, more preferably of 125-209 nucleotides, from the A7-target region consisting of the E1 gene of each of the following group A7 HPV: HPV68, HPV39, HPV59, HPV45, and HPV18.
[0201] The nucleic acid which is amplified from said A6 or A5 or A9 or A7 target region corresponds in said HPV to the nucleic acid sequence of the A6 or A5 or A9 or A7 reference template, respectively. Hence, these amplified nucleic acids usually have a high degree of identity with their respective reference template sequences, e.g., an identity of at least 80%, preferably of at least 85%, more preferably of at least 90%, most preferably of at least 95%, over the entire length of said respective reference template sequence.
[0202] By nucleic acid, it herein preferably meant DNA.
[0203] Preferably, the at least two primers, which are intended for targeting one HPV group, are different from the at least two primers, which are intended for targeting the three other groups.
[0204] Said at least two A6-targeted primers may target a sequence, which is entirely within the E6 gene of each of said group A6 HPV (namely, HPV56), or which is entirely within the E7 gene of each of said group A6 HPV, or which overlap the E6 and E7 genes, for example with a forward primer targeting E6 and the reverse primer targeting E7, or conversely. Preferably, said at least two A6-targeted primers target a sequence, which overlap the E6 and E7 genes, for example with a forward primer targeting E6 and the reverse primer targeting E7, or conversely.
[0205] Said at least two A5-targeted primers may target a sequence, which is entirely within the E7 gene of each of said group A5 HPV (namely, HPV51), or which is entirely within the E1 gene of each of said group A5 HPV, or which overlap the E7 and E1 genes, for example with a forward primer targeting E7 and the reverse primer targeting E1, or conversely.
[0206] Said at least two A9-targeted primers may target a sequence, which is entirely within the E1 gene of each of said group A9 HPV (namely, of at least each of HPV58, HPV33, HPV52, HPV35, HPV31 and HPV16), or which is entirely within the E2 gene of each of said group A9 HPV, or which overlap the E1 and E2 genes, for example with a forward primer targeting E1 and the reverse primer targeting E2, or conversely. In the examples given below, all A9 amplification systems target the E2 gene, except system C, which has a target that overlaps the E1 and E2 genes.
[0207] Said at least two A7-targeted primers may target a sequence, which is entirely within the E1 gene of each of said group A7 HPV (namely, within the E1 gene of at least each of HPV68, HPV39, HPV59, HPV45, HPV18).
[0208] In accordance with the present invention, said at least two A6-, A5-, A9- and A7-targeted primers notably share the specific technical feature of being suitable for use in a real-time (quantitative) multiplex detection of HPV, which can be oncogenic for the mucosal epithelia.
[0209] By "consisting of 14-30 nucleotides", it is meant "consisting of 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 nucleotides".
[0210] The same applies mutatis mutandis to any range, which is recited in the present application.
[0211] The nucleotide lengths of the primers can be chosen independently from each other.
[0212] By oligonucleotide or primer, "the sequence of which is suitable for use in the amplification of" at least one HPV, or nucleic acid or sequence, it is meant that the sequence of the oligonucleotide or primer is such that they can hybridize to this HPV or nucleic acid or sequence, under conditions of moderate, but preferably high or very high stringency.
[0213] A primer of the invention may consist of a 14-30 nt oligonucleotide (preferably a 17-25 nt oligonucleotide), the sequence of which has an identity of at least 80%, preferably of at least 85%, more preferably of at least 90%, most preferably of at least 92%, with a sequence of the same length contained in its group reference template sequence, most preferably with a sequence of the same length contained at the very 3' end or at the very 5' end of said group reference template sequence.
[0214] According to an advantageous embodiment of the present invention, said determination of whether at least one amplicon is produced can be carried out by using in real-time amplification at least one probe, preferably at least one A6-targeted probe and/or at least one at least one A5-targeted probe and/or at least one A9-targeted probe and/or at least one A7-targeted probe.
[0215] Preferably, said at least two A6-targeted primers are suitable for use in the amplification of more than one oncogenic HPV of group A6, namely at least HPV56 and at least one other oncogenic HPV of group A6 (e.g., HPV66, HPV53). According to the present invention, said at least two A6-targeted primers anneal to each of the group A6 HPV they target, in their E6 and/or E7 genes. Hence, according to an advantageous embodiment of the present invention, said at least two A6-targeted primers are oligonucleotides, the respective sequences of which are suitable for use as forward and reverse primers in the amplification of at least one nucleic acid from the region consisting of the E6 and E7 genes of each of the following group A6 HPV: HPV56 and HPV66. HPV66 is at present time not listed within the 13 HR HPV; some authors however consider that HPV66 could be a HR HPV.
[0216] Preferably, said at least two A5-targeted primers are suitable for use in the amplification of more than one oncogenic HPV of group A5, namely at least HPV51 and at least one other oncogenic HPV of group A5 (e.g., HPV82). According to the present invention, said at least two A5-targeted primers anneal to each of the group A5 HPV they target, in their E7 and/or E1 genes. Hence, according to an advantageous embodiment of the present invention, said at least two A5-targeted primers are oligonucleotides, the respective sequences of which are suitable for use as forward and reverse primers in the amplification of at least one nucleic acid from the region consisting of the E7 and E1 genes of each of the following group A5 HPV: HPV51 and HPV82.
[0217] Preferably, said at least two A9-targeted primers are suitable for use in the amplification of more than the six above-mentioned oncogenic HPV of group A9, namely at least HPV58, HPV33, HPV52, HPV35, HPV31 and HPV16, and at least one other oncogenic HPV of group A9 (e.g., HPV67). According to the present invention, said at least two A9-targeted primers anneal to each of the group A9 HPV they target, in their E1 and/or E2 genes. Hence, according to an advantageous embodiment of the present invention, said at least two A9-targeted primers are oligonucleotides, the respective sequences of which are suitable for use as forward and reverse primers in the amplification of at least one nucleic acid from the region consisting of the E1 and the E2 genes of each of the following group A9 HPV: HPV58, HPV33, HPV67, HPV52, HPV35, HPV31 and HPV16.
[0218] A group-targeted primer of the present invention may further target a HPV, which does not belong to the same group (as long as it does not target any group other than A6, A5, A7 or A9), i.e., an A9-targeted primer pair may target an HPV belonging to group A6 (such as HPV53), in addition to targeting the above-mentioned HPV of group A9. Hence, the respective sequences of said at least two A9-targeted primers may further be suitable for use as forward and reverse is primers in the amplification of at least one nucleic acid of HPV53.
[0219] Preferably, said at least two A7-targeted primers are suitable for use in the amplification of more than the five above-mentioned oncogenic HPV of group A7, namely at least HPV68, HPV39, HPV59, HPV45, and HPV18, and at least one other oncogenic HPV of group A7 (e.g., HPV85). According to the present invention, said at least two A7-targeted primers anneal to each of the group A7 HPV they target, in their E1 gene. Hence, according to an advantageous embodiment of the present invention, said at least two A7-targeted primers are oligonucleotides, the respective sequences of which are suitable for use as forward and reverse primers in the amplification of at least one nucleic acid from the E1 gene of each of the following group A7 HPV: HPV68, HPV39, HPV85, HPV59, HPV45, and HPV18.
[0220] To the best of the inventors' knowledge, there is no prior art multiplex process, which would allow the detection of a mucosal oncogenic HPV other than HPV56, HPV51, HPV58, HPV33, HPV52, HPV35, HPV31 and HPV16, HPV68, HPV39, HPV59, HPV45, and HPV18. Until recently, these thirteen HPV were considered to be the 13 HR HPV (i.e., the 13 high risk HPV, i.e., the HPV which have the highest tumor prevalence). However, other HPV are now thought to belong to the HR HPV group, e.g., HPV66 and HPV53 (group A6). As prior art techniques, such as the HPV Amplicor test, are based on a global consensus design, additional HPV cannot be encompassed. On the contrary, the present invention is based on a design by group, and cover more than the 13 basic HR HPV, which is much safer for the patient, and which has the special advantage of being evolutive, in the sense that any oncogenic A6, A5, A9 and A7 new corner are likely to be taken into account.
[0221] Hence, to the best of the inventors' knowledge, the present invention has a mucosal oncogenic HPV spectrum, which is broadest than any other prior art technique, and has a bigger potential of adaptability to any evolution of HPV spectrum to be detected. The present invention therefore is safer than any other prior art technique.
[0222] The amplification primer systems of the invention preferentially amplify HPV that is belong to group A6 or A5 or A9 or A7, i.e., oncogenic HPV.
[0223] As above-mentioned, most of amplification primer systems of the invention are specific of the HPV set formed by groups A5 and A6 and A7 and A9, and more particularly are specific of the group to which they are targeted, i.e., most primer systems of the invention are specific of group A6 or A5 or A9 or A7 (and do not amplify any HPV of groups A11 or A4 or A3).
[0224] Hence, said at least two primers can advantageously be specific of the HPV set formed by groups A5 and A6 and A7 and A9, and more particularly of group A6, or group A5, or group A9, or group A7, preferably of the oncogenic HPV of group A6, or group A5, or group A9, or group A7.
[0225] Hence, according to a preferred embodiment of the present invention, said at least two primers can have such sequences that they are not suitable for use as forward and reverse primers in the amplification of any nucleic acid from an HPV, which would not belong to group A6, A5, A9 or A7. According to a more preferred embodiment of the present invention, the respective sequences of said at least two primers therefore are not suitable for use as forward and reverse primers in the amplification of a nucleic acid from an HPV, which is not oncogenic, preferably which is not oncogenic for the mucosal epithelia, more preferably which is not an anogenital HPV, most preferably which is not a cervical HPV.
[0226] In other words, said at least two primers preferably are specific of oncogenic HPV, compared to non-oncogenic HPV.
[0227] The present invention can be implemented in simplex, multi-tube simplex, in multiplex, as well as in multi-multiplex ("megaplex"). According to an advantageous embodiment of the present invention, said amplification can be a single-tube multiplex amplification, or a single-tube multi-multiplex amplification ("megaplex").
[0228] By "single-tube multiplex amplification" or "multiplex amplification", it is herein meant any amplification reaction aiming at the amplification, and optionally the detection, of more than one target in the same tube. For instance, multiplex amplification include duplex amplification (two targets), triplex amplification (three targets), as well as higher multiplex amplification. Multiplex amplification includes amplification reactions with more than one primer pair, for instance two primer pairs. In this case, there might be four different primers, but it is also possible for the two primer pairs to have one primer in common, e.g., the forward primer, and to have two distinct reverse primers. Multiplex amplification and detection also includes amplification reactions with a unique primer pair, but with more than one probe.
[0229] Hence, according to the multiplex embodiment of the present invention, more than one primer pair is present in the amplification reaction mixture. As a very advantageous embodiment of the present invention, at least four, preferably at least six, more preferably at least eight primer pairs can be present in the amplification reaction mixture. Indeed, the primers of the invention allow for a multiplex amplification, without any significant specificity loss. Hence, all reagents can be placed in the same tube to carry out the amplification assay on the sample to be tested, whereby whatever mucosal oncogenic HPV is present in this sample, it will be detected in a single-step procedure.
[0230] Preferably, said amplification primers comprise said at least two A6-targeted primers, and at least two primers selected from:
[0231] said at least two A5-targeted primers,
[0232] said at least two A9-targeted primers, and
[0233] said at least two A7-targeted primers.
[0234] Preferably, said amplification primers comprise said at least two A5-targeted primers, and at least two primers selected from:
[0235] said at least two A6-targeted primers, and/or
[0236] said at least two A9-targeted primers, and/or
[0237] said at least two A7-targeted primers.
[0238] Preferably, said amplification primers comprise said at least two A9-targeted primers, and at least two primers selected from:
[0239] said at least two A5-targeted primers, and/or
[0240] said at least two A6-targeted primers, and/or
[0241] said at least two A7-targeted primers.
[0242] Preferably, said amplification primers comprise said at least two A7-targeted primers, and at least two primers selected from:
[0243] said at least two A5-targeted primers, and/or
[0244] said at least two A9-targeted primers, and/or
[0245] said at least two A6-targeted primers.
[0246] Most preferably, said amplification primers comprise:
[0247] said at least two A6-targeted primers, and
[0248] said at least two A5-targeted primers, and
[0249] said at least two A9-targeted primers, and
[0250] said at least two A7-targeted primers.
[0251] According to an advantageous embodiment of the present invention, said determination of whether at least one amplicon is produced, is carried out by means of at least one probe, which is intended to anneal to said at least one amplicon, i.e., the sequence of the probe is sufficiently complementary to said at least one amplicon (or to the complementary sequence thereof) that the probe can anneal to said at least one amplicon, preferably under conditions of moderate, high or very high stringency.
[0252] The probe(s) of the invention can be implemented in any appropriate format. Preferably, the probe(s) of the invention is(are) not immobilized onto a solid support.
[0253] Most preferably, the probe(s) of the invention is(are) used in real-time amplification.
[0254] Hence, according to an advantageous embodiment of the present invention, said amplification can be a real-time amplification.
[0255] According to an advantageous embodiment of the present invention, said at least one probe is used in real-time amplification, i.e., said at least two primers and said at least two probes can be both present in the amplification reaction mixture, whereby said at least one probe anneal to the amplicon(s) produced by said at least two primers in real-time. In other words, the amplification and the detection can be carried out in a single step, namely in real-time amplification.
[0256] By real-time amplification, we hereby understand any amplification-based process allowing for monitoring of fluorescence emitted during the reaction as an indicator of amplicon production during each amplification cycle as opposed to the endpoint detection by conventional amplification process.
[0257] The present invention provides probes, which are intended to target the amplicon(s) obtainable by amplification of a mucosal oncogenic HPV nucleic acid by at least two A6- and/or A5- and/or A9- and/or A7-targeted primers.
[0258] These probes share the specific technical features of being suitable for use in a real-time multiplex amplification.
[0259] Some probes of the present invention allow to detect all the HPV of one group (i.e., they anneal to every amplicon that is obtainable by means of a group-targeted primer pair of the invention). Other probes of the present invention detect one or only some HPV of one group. Hence, the present invention further provides different levels of detection: the response can be a global detection of the presence or absence of at least one mucosal oncogenic HPV, or a more precise response, such as presence or absence of at least one mucosal oncogenic HPV of group A6 and/or A5 and/or A9 and/or A7, or an even more precise response such as presence or absence of at least one mucosal oncogenic HPV type(s).
[0260] Preferably, said determination of whether at least one amplicon is produced, is carried out by using in real-time amplification at least one A6- and/or A5- and/or A9- and/or A7-targeted probe, the sequence of which is suitable for use as a probe for the detection of at least one amplicon produced by said at least two A6- and/or A5- and/or A9- and/or A7-targeted primers, respectively.
[0261] According to an advantageous embodiment of the present invention, said amplification can be a real-time multiplex amplification.
[0262] According to a very advantageous embodiment of the present invention, said amplification can be carried out as a real-time multiplex amplification. Hence, the amplification reaction mixture can comprise more than two primers, and also at least one probe, without any significant loss of specificity in the detection of HPV. To the best of the inventors' knowledge, the present technique is the first to allow a real-time multiplex amplification. It is very advantageous, in the sense that any mucosal oncogenic HPV can be screened in a single tube assay, wherein all reactants (primers and probe(s)) have been poured. More particularly, the present invention provides A6-, A5, A9- and A7-targeted primers and probes, which can all be placed in the same reaction mixture, without any significant loss in specificity.
[0263] The present invention therefore is much easier-to-handle and much quicker than any prior art technique. It further limits the possibility of any experimental error or contamination in the sample analysis.
[0264] To the best of the inventors' knowledge, the present technique is the first to enable a real-time multiplex amplification, which allows to cover at least the five most common HR HPV (HPV16, 18, 45, 31, 33), preferably at least 7 HR HPV, still preferably the five most common HR HPV as well as at least two other HR HPV, advantageously at least two other HR HPV belonging to groups A6 and/or A5 (e.g., HPV 56, 51, 33, 31, 16, 45, 18), more preferably at least the 13 HR HPV, and as above-mentioned, most preferably at least 18 oncogenic HPV (namely, at least the 13 HR and five other oncogenic HPV, i.e., HPV 66, 53, 82, 67, 85).
[0265] According to an advantageous embodiment of the present invention, said amplification can be a quantitative real-time multiplex amplification.
[0266] According to an even more advantageous embodiment of the present invention, said amplification can be carried out as a quantitative real-time multiplex amplification. Indeed, the primers and probes of the present invention have such a sequence that there is no loss in specificity and no loss in quantitative accuracy, even when they are implemented in real-time multiplex amplification.
[0267] To the best of the inventors' knowledge, the present technique is the first to enable a quantitative real-time multiplex amplification, which allows to cover at least the five most common HR HPV (HPV16, 18, 45, 31, 33), preferably at least 7 HR HPV, still preferably the five most common HR HPV as well as at least two other HR HPV, advantageously at least two other HR HPV belonging to groups A6 and/or A5 (e.g., HPV 56, 51, 33, 31, 16, 45, 18), more preferably at least the 13 HR HPV, and as above-mentioned, most preferably at least 18 oncogenic HPV is (namely, at least the 13 HR and five other oncogenic HPV, i.e., HPV 66, 53, 82, 67, 85).
[0268] The invention thereby finds applications not only in the field of diagnostic, but also in the field of therapy evaluation, such as to monitor the efficiency of an anti-HPV treatment, or to evaluate the efficiency of an anti-HPV drug. To the best of the inventors' knowledge, such therapy-related applications were previously unattainable by any of the prior art process.
[0269] The present invention thus represents a technological breakthrough in the field of HPV monitoring.
[0270] Hence, said amplification can be a quantitative real-time multiplex amplification, which allows for the detection of one or several of HPV, which can be oncogenic for the mucosal epithelia, in a single-tube amplification run.
[0271] The present invention thereby allows for the real-time multiplex detection, preferably the real-time quantitative multiplex detection of:
at least the five most common HPV (HPV16, 18, 45, 31, 33) preferably at least 7 HR HPV, still preferably the five most common HR HPV as well as at least two other HR HPV, advantageously at least two other HR HPV belonging to groups A6 and/or A5 (e.g., HPV 56, 51, 33, 31, 16, 45, 18), even still preferably at least the thirteen HPV known as HR HPV (HPV types 56, 51, 58, 33, 52, 35, 31, 16, 68, 39, 59, 45 and 18), more preferably, at least the thirteen HPV as well as at least one among HPV types 66, 82, 67, 85, and 53 still more preferably, at least the thirteen HPV as well as at least two among HPV types 66, 82, 67, 85, and 53 even still more preferably, at least the thirteen HPV as well as at least three among HPV types 66, 82, 67, 85, and 53 most preferably, at least the thirteen HPV as well as at least four among HPV types 66, 82, 67, 85, and 53, notably of least the seventeen mucosal HPV, consisting of said 13 HR HPV and HPV types 66, 82, 67, 85, still most preferably, at least the thirteen HPV as well as at least the five HPV types 66, 82, 67, 85, and 53, in a single-tube assay.
[0272] Preferably, the respective sequences of said at least two A6-targeted primers are suitable for use in the amplification of at least one reference template sequence, wherein said at least one reference template sequence is a fragment consisting of positions 413-791 (SEQ ID NO:337) of the HPV56 sequence of SEQ ID NO:420 (accession NC--001594.1); or a conservative sub-fragment thereof, which has retained the property of being a suitable reference template sequence, to construct and produce A6-targeted primers, which allow for a real-time multiplex detection of those HPV, which can be oncogenic for the mucosal epithelia, preferably of at least the five most common HPV (HPV16, 18, 45, 31, 33), still preferably at least 7 HR HPV, even still preferably the five most common HR HPV as well as at least two other HR HPV, advantageously at least two other HR HPV belonging to groups A6 and/or A5 (e.g., HPV 56, 51, 33, 31, 16, 45, 18), more preferably at least the 13 HR HPV, most preferably at least the 13 HR HPV and at least one, at least two, at least three, at least four, or the five of HPV66, 53, 82, 67, 85; or a sequence which is fully complementary to said fragment or sub-fragment over the entire length of said fragment or sub-fragment.
[0273] More preferably, the respective sequences of said at least two A6-targeted primers are suitable for use in the specific amplification of at least one reference template sequence, which consists of one of SEQ ID NO:25-29 and NO:334-338, as shown in Table 18 (A6 reference templates); or a sequence which is fully complementary thereto over the entire length of said SEQ ID NO sequence.
[0274] Said reference template sequences notably share the specific technical feature of being suitable references to construct and produce A6-targeted primers, which allow for a real-time multiplex detection of HPV, which can be oncogenic for the mucosal epithelia, preferably of at least the five most common HPV (HPV16, 18, 45, 31, 33), still preferably at least 7 HR HPV, even still preferably the five most common HR HPV as well as at least two other HR HPV, advantageously at least two other HR HPV belonging to groups A6 and/or A5 (e.g., HPV 56, 51, 33, 31, 16, 45, 18), more preferably at least the 13 HR HPV, most preferably at least the 13 HR HPV and at least one, at least two, at least three, at least four, or the five of is HPV66, 53, 82, 67, 85, and preferably for a real-time quantitative multiplex detection of such HPV.
[0275] As the reference template sequence is defined as consisting of one of the above-mentioned SEQ ID NOs (and not as comprising one of the above-mentioned SEQ ID NOs), the primers do not flank these reference template sequences, but fall within the reference template sequence, in such a way that the amplicon consists of one of the listed SEQ ID NOs. Unless otherwise stated, it applies to any reference template sequence that is herein defined as consisting of a SEQ ID NO.
[0276] Said at least two A6-targeted primers can, for example, be at least one of SEQ ID NO: 30-34 (forward primer) and at least one of SEQ ID NO: 35-37 (reverse primer).
[0277] As illustrated by the examples below (see e.g., Table 23), preferred combinations of forward and reverse primers are as follows:
TABLE-US-00001 TABLE 1 (A6 primer systems): SEQ ID NO: 35 36 37 30 X X 31 X X 32 X X X 33 X X 34 X wherein X indicates that the primers can be combined with each other as a pair.
[0278] According to an advantageous embodiment of the present invention, said determination of whether at least one amplicon is produced by said at least one A6-targeted primer system, can be carried out by using in real-time amplification at least one probe, preferably at least one A6-targeted probe.
[0279] Advantageously, said determination of whether at least one amplicon is produced is carried out by using in real-time amplification at least one A6-targeted probe, which consists of one of SEQ ID NO:38-40, or of one of the complementary sequences thereof (i.e., sequences of the same length, which are fully complementary over the entire length of the sequence), and optionally at least one 5' and/or 3' detection label and/or at least one HPV-unrelated arm intended to carry a quencher or a reporter (e.g., a fluorophore), such as at least one beacon arm, or Scorpion® arm, preferably at least one of such arms in 5' and/or 3', most preferably two of such arms, in 5' and in 3', respectively.
[0280] As illustrated by the examples below (see e.g., table 23), preferred combinations of primer pair and probe are as follows:
TABLE-US-00002 TABLE 2 (A6 primer and probe systems): A6 amplification Primer pair At least one probe system SEQ ID NO: of SEQ ID NO: A 30; 35 38 AE 30; 37 38 and/or 40 B 31; 35 38 BE 31; 37 38 and/or 40 C 32; 36 39 CA 32; 35 38 and/or 39 CE 32; 37 38 and/or 39 and/or 40 D 33; 35 38 DE 33; 37 38 and/or 40 E 34; 37 40
[0281] Advantageously, said at least one A6-targeted probe is a beacon probe, the sequence of which is one of SEQ ID NO:41-45, or of one of the complementary sequences thereof (i.e., sequences of the same length, which are fully complementary over the entire length of the sequence).
[0282] As illustrated by the examples below (see e.g., Table 23), most preferred combinations of primer pair and beacon probes are as follows:
TABLE-US-00003 TABLE 3 (A6 primer and beacon probe systems): A6 amplification Primer pair At least one beacon system SEQ ID NO: probe of SEQ ID NO: A 30; 35 41 AE 30; 37 41 and/or 44 and/or 45 B 31; 35 41 BE 31; 37 41 and/or 44 and/or 45 C 32; 36 42 and/or 43 CA 32; 35 41 and/or 42 and/or 43 CE 32; 37 41 and/or 42 and/or 43 and/or 44 and/or 45 D 33; 35 41 DE 33; 37 41 and/or 44 and/or 45 E 34; 37 44 and/or 45
[0283] Preferably, the respective sequences of said at least two A5-targeted primers are suitable for use in the amplification of at least one reference template sequence, which is a fragment consisting of positions 678-902 (SEQ ID NO:326) of the HPV51 sequence of SEQ ID NO:421 (accession NC--001533.1), or a conservative sub-fragment thereof, which has retained the property of being a suitable reference template sequence, to construct and produce A5-targeted primers, which allow for a real-time multiplex detection of those HPV, which can be oncogenic for the mucosal epithelia, preferably of at least the five most common HPV (HPV16, 18, 45, 31, 33), still preferably at least 7 HR HPV, even still preferably the five most common HR HPV as well as at least two other HR HPV, advantageously at least two other HR HPV belonging to groups A6 and/or A5 (e.g., HPV 56, 51, 33, 31, 16, 45, 18), more preferably at least the 13 HR HPV, most preferably at least the 13 HR HPV and at least one, at least two, at least three, at least four, or the five of HPV66, 53, 82, 67, 85; or a sequence which is is fully complementary to said fragment or sub-fragment over the entire length of said fragment or sub-fragment.
[0284] More preferably, the respective sequences of said at least two A5-targeted primers are suitable for use in the specific amplification of at least one reference template sequence, wherein said at least one reference template sequence consists of one of SEQ ID NO: 1-5 and NO: 320-333, as shown in Table 12; or a sequence which is fully complementary thereto over the entire length of said SEQ ID sequence.
[0285] Said reference template sequences share the specific technical feature of being suitable references to construct and produce A5-targeted primers, which allow for a real-time multiplex detection of HPV, which can be oncogenic for the mucosal epithelia, preferably of at least the five most common HPV (HPV16, 18, 45, 31, 33), still preferably at least 7 HR HPV, even still preferably the five most common HR HPV as well as at least two other HR HPV, advantageously at least two other HR HPV belonging to groups A6 and/or A5 (e.g., HPV 56, 51, 33, 31, 16, 45, 18), more preferably at least the 13 HR HPV, most preferably at least the 13 HR HPV and at least one, at least two, at least three, at least four, or the five of HPV66, 53, 82, 67, 85, and preferably for a real-time quantitative multiplex detection of such HPV.
[0286] Said at least two A5-targeted primers may, for example, be at least one of SEQ ID NO: 6-10 (forward primer) and at least one of SEQ ID NO: 11-15 (reverse primer).
[0287] As illustrated by the examples below (see e.g., Table 17), preferred combinations of forward and reverse primers are as follows:
TABLE-US-00004 TABLE 4 (A5 primer systems): SEQ ID NO: 6 7 8 9 10 11 X X X X X 12 X X X X X 13 X 14 X X X X X 15 X X X wherein X indicates that the primers can be combined with each other as a pair.
[0288] Advantageously, said determination of whether at least one amplicon is produced is carried out by using in real-time amplification at least one A5-targeted probe, which consists of one of SEQ ID NO:16-19, or of one of the complementary is sequences thereof (i.e., sequences of the same length, which are fully complementary over the entire length of the sequence), and optionally at least one detection label and/or at least one HPV-unrelated arm intended to carry a quencher or a reporter (e.g., a fluorophore), such as at least one beacon arm, or Scorpion® arm, preferably at least one of such arms in 5' and/or 3', most preferably two of such arms, in 5' and in 3', respectively.
[0289] As illustrated by the examples below (see e.g., Table 17), preferred combinations of primer pair and probe are as follows:
TABLE-US-00005 TABLE 5 (A5 primer and probe systems): A5 amplification Primer pair At least one probe system SEQ ID NO: of SEQ ID NO: A 6; 11 16 AB 6; 12 16 AD 6; 14 16 B 7; 12 16; 17 BA 7; 11 16; 17 BD 7; 14 16; 17 C 8; 13 18 CA 8; 11 16; 17; 18; 19 CB 8; 12 16; 17; 18; 19 CD 8; 14 16; 17; 18; 19 CE 8; 15 18; 19 D 9; 14 16; 17; 19 DA 9; 11 16; 17; 19 DB 9; 12 16; 17; 19 DE 9; 15 19 E 10; 15 19 EA 10; 11 16; 17; 19 EB 10; 12 16; 17; 19 ED 10; 14 16; 17; 19
[0290] Advantageously, said at least one A5-targeted probe is a beacon probe, the sequence of which is one of SEQ ID NO: 20-24, or of one of the complementary sequences thereof (i.e., sequences of the same length, which are fully complementary over the entire length of the sequence).
[0291] As illustrated by the examples below (see e.g., Table 17), most preferred combinations of primer pair and probe are as follows:
TABLE-US-00006 TABLE 6 (A5 primer and beacon probe systems): A5 amplification Primer pair At least one beacon system SEQ ID NO: probe of SEQ ID NO: A 6; 11 20; 21 AB 6; 12 20; 21 AD 6; 14 20; 21 B 7; 12 20; 21; 22 BA 7; 11 20; 21; 22 BD 7; 14 20; 21; 22 C 8; 13 23 CA 8; 11 20; 21; 22; 23; 24 CB 8; 12 20; 21; 22; 23; 24 CD 8; 14 20; 21; 22; 23; 24 CE 8; 15 23; 24 D 9; 14 20; 21; 22; 24 DA 9; 11 20; 21; 22; 24 DB 9; 12 20; 21; 22; 24 DE 9; 15 24 E 10; 15 24 EA 10; 11 20; 21; 22; 24 EB 10; 12 20; 21; 22; 24 ED 10; 14 20; 21; 22; 24
[0292] Preferably, the respective sequences of said at least two A9-targeted primers are suitable for use in the amplification of at least one reference template sequence, which is:
[0293] a fragment consisting of positions 2707-2794 (SEQ ID NO:122) of the HPV16 sequence of SEQ ID NO:422 (accession NC--001526.1); or a conservative sub-fragment thereof, which has retained the property of being a suitable reference template sequence, to construct and produce A9-targeted primers, which allow for a real-time multiplex detection of those HPV, which can be oncogenic for the mucosal epithelia, preferably of at least the five most common HPV (HPV16, 18, 45, 31, 33), still preferably at least 7 HR HPV, even still preferably the five most common HR HPV as well as at least two other HR HPV, advantageously at least two other HR HPV belonging to groups A6 and/or A5 (e.g., HPV 56, 51, 33, 31, 16, 45, 18), more preferably at least the 13 HR HPV, most preferably at least the 13 HR HPV and at least one, at least two, at least three, at least four, or the five of HPV66, 53, 82, 67, 85; or a sequence which is fully complementary to said fragment or sub-fragment over the entire length of said fragment or sub-fragment or
[0294] a fragment consisting of positions 3600-3840 (SEQ ID NO:377) of the HPV16 sequence of SEQ ID NO:422 (accession NC--001526.1); or a conservative sub-fragment thereof, which has retained the property of being a suitable reference template sequence, to construct and produce A9-targeted primers, which allow for a real-time multiplex detection of those HPV, which can be oncogenic for the mucosal epithelia, preferably of at least the five most common HPV (HPV16, 18, 45, 31, 33), still preferably at least 7 HR HPV, even still preferably the five most common HR HPV as well as at least two other HR HPV, advantageously at least two other HR HPV belonging to groups A6 and/or A5 (e.g., HPV 56, 51, 33, 31, 16, 45, 18), more preferably at least the 13 HR HPV, most preferably at least the is 13 HR HPV and at least one, at least two, at least three, at least four, or the five of HPV66, 53, 82, 67, 85; or a sequence which is fully complementary to said fragment or sub-fragment over the entire length of said fragment or sub-fragment.
[0295] More preferably, the respective sequences of said at least two A9-targeted primers are suitable for use in the specific amplification of at least one reference template sequence, which consists of any one of SEQ ID NO: 122-210 and 359-419, as shown in Table 30; or a sequence which is fully complementary thereto over the entire length of said SEQ ID NO sequence.
[0296] Said reference template sequences notably share the specific technical feature of being suitable references to construct and produce A9-targeted primers, which allow for a real-time multiplex detection of HPV, which can be oncogenic for the mucosal epithelia, preferably of at least the five most common HPV (HPV16, 18, 45, 31, 33), still preferably at least 7 HR HPV, even still preferably the five most common HR HPV as well as at least two other HR HPV, advantageously at least two other HR HPV belonging to groups A6 and/or A5 (e.g., HPV 56, 51, 33, 31, 16, 45, 18), more preferably at least the 13 HR HPV, most preferably at least the 13 HR HPV and at least one, at least two, at least three, at least four, or the five of HPV66, 53, 82, 67, 85, and preferably for a real-time quantitative multiplex detection of such HPV.
[0297] Said at least two A9-targeted primers can, for example, be at least one of SEQ ID NO: 211-239 (forward primers) and at least one of SEQ ID NO: 240-265 (reverse primers).
[0298] As illustrated by the examples below (see e.g., Table 35), preferred combinations of forward and reverse primers are as follows:
[0299] A9 amplification system C: at least one of SEQ ID NO:211-217 and at least one of SEQ ID NO:240-241; preferably, when amplification of all oncogenic HPV of group A9 is desired, at least three of SEQ ID NO: 211-217, e.g., 212, 214 and 216, and both of SEQ ID NO:240-241;
[0300] A9 amplification system E1: at least one of SEQ ID NO:218-220 and at least one of SEQ ID NO:242-247; preferably, when amplification of all oncogenic HPV of group A9 is desired, at least the three of SEQ ID NO:218-220 and at least five of SEQ ID NO:242-247 (e.g., SEQ ID NO:242-243, 245-247);
[0301] A9 amplification system E2: at least one of SEQ ID NO:221-223 and at least one of SEQ ID NO:242-247; preferably, when amplification of all oncogenic HPV of group A9 is desired, at least the three of SEQ ID NO:221-223 and at least five of SEQ ID NO:242-247 (e.g., SEQ ID NO:242-243, 245-247);
[0302] A9 amplification system E3: at least one of SEQ ID NO:221-223 and at least one of SEQ ID NO:248-255; preferably, when amplification of all oncogenic HPV of group A9 is desired, at least the three of SEQ ID NO:221-223 and at least five of SEQ ID NO:248-255 (e.g., SEQ ID NO:248-252);
[0303] A9 amplification system E4: at least one of SEQ ID NO:224-226 and at least one of SEQ ID NO:248-255; preferably, when amplification of all oncogenic HPV of group A9 is desired, at least the three of SEQ ID NO:224-226 and at least five of SEQ ID NO:248-255 (e.g., SEQ ID NO:248-252);
[0304] A9 amplification system E5: at least one of SEQ ID NO:224-226 and at least one of SEQ ID NO:242-247; preferably, when amplification of all oncogenic HPV of group A9 is desired, at least the three of SEQ ID NO:224-226 and at least five of SEQ ID NO:242-247 (e.g., SEQ ID NO:242-243, 245-247);
[0305] A9 amplification system E6: at least one of SEQ ID NO:218-220 and at least one of SEQ ID NO:248-255; preferably, when amplification of all oncogenic HPV of group A9 is desired, at least the three of SEQ ID NO:218-220 and at least five of SEQ ID NO:248-255 (e.g., SEQ ID NO:248-252);
[0306] A9 amplification system E1H Z7: at least one of SEQ ID NO:218-220 and at least one of SEQ ID NO:256-259; 261-265; preferably, when amplification of all oncogenic HPV of group A9 is desired, at least the three of SEQ ID NO:218-220 and at least four of SEQ ID NO: 256-259; 261-265 (e.g., SEQ ID NO:258; 261; 264; 265);
[0307] A9 amplification system E1H Z8: at least one of SEQ ID NO: 218-220 and at least one of SEQ ID NO:256-259; 261-265; preferably, when amplification of all oncogenic HPV of group A9 is desired, at least the three of SEQ ID NO:218-220 and at least four of SEQ ID NO:256-259; 261-265 (e.g., SEQ ID NO:258; 261; 264; 265);
[0308] A9 amplification system E2H Z7: at least one of SEQ ID NO:221-223 and at least one of SEQ ID NO:256-259; 261-265; preferably, when amplification of all oncogenic HPV of group A9 is desired, at least the three of SEQ ID NO:221-223 and at least four of SEQ ID NO:256-259; 261-265 (e.g., SEQ ID NO: 258; 261; 264; 265);
[0309] A9 amplification system E2H Z8: identical to A9 amplification system E2H Z7, i.e., at least one of SEQ ID NO:221-223 and at least one of SEQ ID NO: 256-259; 261-265; preferably, when amplification of all oncogenic HPV of group A9 is desired, at least the three of SEQ ID NO:221-223 and at least four of SEQ ID NO:256-259; 261-265 (e.g., SEQ ID NO:258; 261; 264; 265);
[0310] A9 amplification system E4H Z7: at least one of SEQ ID NO:224-226 and at least one of SEQ ID NO: 256-259; 261-265; preferably, when amplification of all oncogenic HPV of group A9 is desired, at least the three of SEQ ID NO:224-226 and at least four of SEQ ID NO:256-259; 261-265 (e.g., SEQ ID NO:258; 261; 264; 265);
[0311] A9 amplification system E4H Z8: at least one of SEQ ID NO:224-226 and at least one of SEQ ID NO: 256-259; 261-265; preferably, when amplification of all oncogenic HPV of group A9 is desired, at least the three of SEQ ID NO:224-226 and at least four of SEQ ID NO:256-259; 261-265 (e.g., SEQ ID NO: 258; 261; 264; 265);
[0312] A9 amplification system F: at least one of SEQ ID NO:227-230 and at least one of SEQ ID NO:248-255; preferably, when amplification of all oncogenic HPV of group A9 is desired, at least the four of SEQ ID NO:227-230 and at least five of SEQ ID NO:248-255 (e.g., SEQ ID NO:248-252);
[0313] A9 amplification system FE: at least one of SEQ ID NO:227-230 and at least one of SEQ ID NO:242-247; preferably, when amplification of all oncogenic HPV of group A9 is desired, at least the four of SEQ ID NO:227-230 and at least five of SEQ ID NO:242-247 (e.g., SEQ ID NO:242-243; 245-247);
[0314] A9 amplification system FH Z7: at least one of SEQ ID NO:227-230 and at least one of SEQ ID NO:256-259; 261-265; preferably, when amplification of all oncogenic HPV of group A9 is desired, at least the four of SEQ ID NO:227-230 and at least four of SEQ ID NO:256-259; 261-265 (e.g., SEQ ID NO:258; 261; 264; 265);
[0315] A9 amplification system FHZ8: identical to A9 amplification system FH Z7, i.e., at least one of SEQ ID NO:227-230 and at least one of SEQ ID NO:256-259; 261-265; preferably, when amplification of all oncogenic HPV of group A9 is desired, at least the three of SEQ ID NO:227-230 and at least four of SEQ ID NO:256-259; 261-265 (e.g., SEQ ID NO:258; 261; 264; 265);
[0316] A9 amplification system G Z7: at least one of SEQ ID NO:227-230 and at least one of SEQ ID NO:256-261; preferably, when amplification of all oncogenic HPV of group A9 is desired, at least the three of SEQ ID NO:227-230 and at least five of SEQ ID NO:256-261 (e.g., SEQ ID NO:257-261);
[0317] A9 amplification system G Z8: identical to A9 amplification system G Z7, i.e., at least one of SEQ ID NO:227-230 and at least one of SEQ ID NO:256-261; preferably, when amplification of all oncogenic HPV of group A9 is desired, at least the three of SEQ ID NO:227-230 and at least five of SEQ ID NO:256-261 (e.g., SEQ ID NO:257-261);
[0318] A9 amplification system H: at least one of SEQ ID NO:231-239 and at least one of SEQ ID NO: 256-259; 261-265; preferably, when amplification of all oncogenic HPV of group A9 is desired, at least three of SEQ ID NO:231-239 (e.g., SEQ ID NO:232; 234; 235) and at least four of SEQ ID NO: 256-259; 261-265 (e.g., SEQ ID NO:258; 261; 264; 265).
[0319] Advantageously, said determination of whether at least one amplicon is produced to is carried out by using in real-time amplification at least one A9-targeted probe, which consists of one of SEQ ID NO: 266-282, or of one of the complementary sequences thereof (i.e., sequences of the same length, which are fully complementary over the entire length of the sequence), and optionally at least one detection label and/or at least one HPV-unrelated arm intended to carry a quencher or a reporter (e.g., a fluorophore), such as at least one beacon arm, or Scorpion® arm, preferably at least one of such arms in 5' and/or 3', most preferably two of such arms, in 5' and in 3', respectively.
[0320] As illustrated by the examples below (see e.g., Table 35), preferred combinations of primer pair and probe are as follows:
TABLE-US-00007 TABLE 7 (A9 primer and probe systems): A9 amplification At least one probe system of SEQ ID NO: C 266-271 E1 272-276 E2 272-276 E3 272-276 E4 272-276 E5 272-276 E6 272-276 E1H Z7 272-276 E1H Z8 277-282 E2H Z7 272-276 E2H Z8 277-282 E4H Z7 272-276 E4H Z8 277-282 F 272-276 FE 272-276 FH Z7 272-276 FH Z8 277-282 G Z7 272-276 G Z8 277-282 H 277-282
[0321] Advantageously, said at least one A9-targeted probe is a beacon probe, the sequence of which is one of SEQ ID NO: 283-319, or of one of the complementary sequences thereof (i.e., sequences of the same length, which are fully complementary over the entire length of the sequence).
[0322] As illustrated by the examples below (see e.g., Table 35), most preferred combinations of primer pair and probe are as follows:
TABLE-US-00008 TABLE 8 (A9 primer and beacon probe systems): A9 amplification At least one beacon system probe of SEQ ID NO: C 283-295 E1 296-303 E2 296-303 E3 296-303 E4 296-303 E5 296-303 E6 296-303 E1 H Z7 296-303 E1 H Z8 304-319 E2H Z7 296-303 E2H Z8 304-319 E4H Z7 296-303 E4H Z8 304-319 F 296-303 FE 296-303 FH Z7 296-303 FH Z8 304-319 G Z7 296-303 G Z8 304-319 H 304-319
[0323] Some of the specificity results of the above-mentioned probes are shown in Tables 60-68 (Specificity A9).
[0324] In all tables, when the name of a probe differs from the name of another probe by only the last letter (e.g., A9E1S10 and A9E1S10a), these probes have the same hybridizing segment, and only differ in their beacon arms.
[0325] Gray boxes indicate that the tested probe detects the amplicon.
[0326] For example, probe A9E1S11 of SEQ ID NO: 285 detects HPV31 and HPV35, without detecting the other HPV.
[0327] For example, probe A9E1S10a of SEQ ID NO: 284 detects all oncogenic HPV of group A9 (HPV16, 31, 33, 35, 52, 58, 67) and one HPV of group A6 (HPV53), and probe A9E1S12a of SEQ ID NO: 288 detects HPV31 and HPV35, without detecting HPV53 ("ND"). Hence, a combination of A9E1S10a and of A9E1S12a allows the specific detection of HPV16, 31, 33, 35, 52, 58, 67, 53.
[0328] Any combination that the skilled person may find appropriate is herein specifically encompassed.
[0329] Preferably, the respective sequences of said at least two A7-targeted primers are suitable for use in the amplification of at least one reference template sequence, wherein said at least one reference template sequence is:
[0330] a fragment consisting of positions 1895-2103 (SEQ ID NO:48) of the HPV18 sequence of SEQ ID NO:423 (accession NC--001357.1); or a conservative sub-fragment thereof, which has retained the property of being a suitable reference template sequence, to construct and produce A7-targeted primers, which allow for a real-time multiplex detection of those HPV, which can be oncogenic for the mucosal epithelia, preferably of at least the five most common HPV (HPV16, 18, 45, 31, 33), still preferably at least 7 HR HPV, even still preferably the five most common HR HPV as well as at least two other HR HPV, advantageously at least two other HR HPV belonging to groups A6 and/or A5 (e.g., HPV 56, 51, 33, 31, 16, 45, 18), more preferably at least the 13 HR HPV, most preferably at least the 13 HR HPV and at least one, at least two, at least three, at least four, or the five of HPV66, 53, 82, 67, 85; or a sequence which is fully complementary to said fragment or sub-fragment over the entire length of said fragment or sub-fragment, or
[0331] a fragment consisting of positions 916-1044 (SEQ ID NO: 65) of the HPV18 sequence of SEQ ID NO:423 (accession NC--001357.1); or a conservative sub-fragment thereof, which has retained the property of being a suitable reference template sequence, to construct and produce A7-targeted primers, which allow for a real-time multiplex detection of those HPV, which can be oncogenic for the mucosal epithelia, preferably of at least the five most common HPV (HPV16, 18, 45, 31, 33), still preferably at least 7 HR HPV, even still preferably the five most common HR HPV as well as at least two other HR HPV, advantageously at least two other HR HPV belonging to groups A6 and/or A5 (e.g., HPV 56, 51, 33, 31, 16, 45, 18), more preferably at least the 13 HR HPV, most preferably at least the 13 HR HPV and at least one, at least two, at least three, at least four, or the five of HPV66, 53, 82, 67, 85; or a sequence which is fully complementary to said fragment or sub-fragment over the entire length of said fragment or sub-fragment.
[0332] More preferably, the respective sequences of said at least two A7-targeted primers are suitable for use in the specific amplification of at least one reference template sequence, which consists of one of SEQ ID NO:46-67; 339-358, as shown in Table 24; or a sequence which is fully complementary thereto over the entire length of said SEQ ID NO sequence.
[0333] Said reference template sequences notably share the specific technical feature of being suitable references to construct and produce A7-targeted primers, which allow for a real-time multiplex detection of HPV, which can be oncogenic for the mucosal epithelia, preferably of at least the five most common HPV (HPV16, 18, 45, 31, 33), still preferably at least 7 HR HPV, even still preferably the five most common HR HPV as well as at least two other HR HPV, advantageously at least two other HR HPV belonging to groups A6 and/or A5 (e.g., HPV 56, 51, 33, 31, 16, 45, 18), more preferably at least the 13 HR HPV, most preferably at least the 13 HR HPV and at least one, at least two, at least three, at least four, or the five of HPV66, 53, 82, 67, 85, and preferably for a real-time quantitative multiplex detection of such HPV.
[0334] Said at least two A7-targeted primers can, for example, be at least one of SEQ ID NO: 68-78 (forward primer) and at least one of SEQ ID NO: 79-87 (reverse primer).
[0335] As illustrated by the examples below (see e.g., Table 29), preferred combinations of forward and reverse primers are as follows:
[0336] A7 amplification system A: at least one of SEQ ID NO:68-70 and at least one of SEQ ID NO:79-81; preferably, when amplification of all oncogenic HPV of group A7 is desired, all of them;
[0337] A7 amplification system A1: identical to A7 amplification system A, i.e., at least one of SEQ ID NO:68-70 and at least one of SEQ ID NO:79-81; preferably, when amplification of all oncogenic HPV of group A7 is desired, all of them;
[0338] A7 amplification system A2: identical to A7 amplification system A or A1, i.e., at least one of SEQ ID NO:68-70 and at least one of SEQ ID NO:79-81; preferably, when amplification of all oncogenic HPV of group A7 is desired, all of them;
[0339] A7 amplification system AB: at least one of SEQ ID NO:68-70 and at least one of SEQ ID NO:82-83; preferably, when amplification of all oncogenic HPV of group A7 is desired, all of them;
[0340] A7 amplification system AC1: at least one of SEQ ID NO:68-70 and at least one of SEQ ID NO:84-85; preferably, when amplification of all oncogenic HPV of group A7 is desired, all of them;
[0341] A7 amplification system AC2: identical to A7 amplification system AC1, i.e., at least one of SEQ ID NO:68-70 and at least one of SEQ ID NO:84-85; preferably, when amplification of all oncogenic HPV of group A7 is desired, all of them;
[0342] A7 amplification system AC3: identical to A7 amplification system AC1 or AC2, i.e., at least one of SEQ ID NO:68-70 and at least one of SEQ ID NO:84-85; preferably, when amplification of all oncogenic HPV of group A7 is desired, all of them;
[0343] A7 amplification system B: at least one of SEQ ID NO:71-73 and at least one of SEQ ID NO:82-83; preferably, when amplification of all oncogenic HPV of group A7 is desired, all of them;
[0344] A7 amplification system BA1: at least one of SEQ ID NO:71-73 and at least one of SEQ ID NO:79-81; preferably, when amplification of all oncogenic HPV of group A7 is desired, all of them;
[0345] A7 amplification system BA2: identical to A7 amplification system BA1, i.e., at least one of SEQ ID NO:71-73 and at least one of SEQ ID NO:79-81; preferably, when amplification of all oncogenic HPV of group A7 is desired, all of them;
[0346] A7 amplification system BA3: identical to A7 amplification system BA1 or BA2, i.e., at least one of SEQ ID NO:71-73 and at least one of SEQ ID NO:79-81; preferably, when amplification of all oncogenic HPV of group A7 is desired, all of them;
[0347] A7 amplification system BC1: at least one of SEQ ID NO:71-73 and at least one of SEQ ID NO:84-85; preferably, when amplification of all oncogenic HPV of group A7 is desired, all of them;
[0348] A7 amplification system BC2: identical to A7 amplification system BC1, i.e., at least one of SEQ ID NO:71-73 and at least one of SEQ ID NO:84-85; preferably, when amplification of all oncogenic HPV of group A7 is desired, all of them;
[0349] A7 amplification system BC3: identical to A7 amplification system BC1 or BC2, i.e., at least one of SEQ ID NO:71-73 and at least one of SEQ ID NO:84-85; preferably, when amplification of all oncogenic HPV of group A7 is desired, all of them;
[0350] A7 amplification system C: at least one of SEQ ID NO:74-76 and at least one of SEQ ID NO:84-85; preferably, when amplification of all oncogenic HPV of group A7 is desired, all of them;
[0351] A7 amplification system C1: identical to A7 amplification system C, i.e., at least one of SEQ ID NO:74-76 and at least one of SEQ ID NO:84-85; preferably, when amplification of all oncogenic HPV of group A7 is desired, all of them;
[0352] A7 amplification system CA1: identical to A7 amplification system C1, i.e., at least one of SEQ ID NO:74-76 and at least one of SEQ ID NO:79-81; preferably, when amplification of all oncogenic HPV of group A7 is desired, all of them;
[0353] A7 amplification system CA2: identical to A7 amplification system C1 or CA1, i.e., at least one of SEQ ID NO:74-76 and at least one of SEQ ID NO:79-81; preferably, when amplification of all oncogenic HPV of group A7 is desired, all of them;
[0354] A7 amplification system D: at least one of SEQ ID NO:77-78 and at least one of SEQ ID NO:86-87; preferably, when amplification of all oncogenic HPV of group A7 is desired, all of them.
[0355] Advantageously, said determination of whether at least one amplicon is produced is carried out by using in real-time amplification at least one A7-targeted probe, which consists of one of SEQ ID NO:88-101, or of one of the complementary sequences thereof (i.e., sequences of the same length, which are fully complementary over the entire length of the sequence), and optionally at least one detection label and/or at least one HPV-unrelated arm intended to carry a quencher or a reporter (e.g., a fluorophore), such as at least one beacon arm, or Scorpion® arm, preferably at least one of such arms in 5' and/or 3', most preferably two of such arms, in 5' and in 3', respectively.
[0356] As illustrated by the examples below (see e.g., Table 29), preferred combinations of primer pair and probe are as follows:
TABLE-US-00009 TABLE 10 (A7 primer and probe systems): At least one A7 amplification system probe of SEQ ID NO: A 88-92 A1 92-95 A2 89-91; 96 AB 92-95 AC1 88-92 AC2 92-95 AC3 89-91; 96 B 92-95 BA1 88-92 BA2 92-95 BA3 89-91; 96 BC1 88-92 BC2 92-95 BC3 89-91; 96 C 89-91; 96 C1 88-91; 96 CA1 89-91; 96 CA2 88-91; 96 D 97-101
[0357] Advantageously, said at least one A7-targeted probe is a beacon probe, the sequence of which is one of SEQ ID NO:102-121, or of one of the complementary sequences thereof (i.e., sequences of the same length, which are fully complementary over the entire length of the sequence).
[0358] As illustrated by the examples below (see e.g., Table 29), most preferred combinations of primer pair and probe are as follows:
TABLE-US-00010 TABLE 11 (A7 primer and beacon probe systems): At least one beacon A7 amplification system probe of SEQ ID NO: A 102-106 A1 106-110 A2 105; 111-114 AB 106-110 AC1 102-106 AC2 106-110 AC3 105; 111-114 B 106-110 BA1 102-106 BA2 106-110 BA3 105; 111-114 BC1 102-106 BC2 106-110 BC3 105; 111-114 C 105; 111-114 C1 102-105; 114 CA1 105; 111-114 CA2 102-105; 114 D 115-121
[0359] Said amplification can be any nucleic acid amplification, which is found appropriate to the skilled person, for example a PCR (Polymerase Chain Reaction), or an isothermal amplification technique, e.g., TMA (transcription mediated amplification), NASBA (nucleic acid sequence based amplification), 3SR (self sustained sequence replication) or strand displacement amplification. Said amplification preferably is a PCR.
[0360] In a preferred embodiment, the primers according to the invention are used in a final concentration range 100-2000 nM. Typically, said primers can be used at a final concentration range 200-1500 nM, preferably 250-1000 nM, more preferably 500-1000 nM, even more preferably 600-1000 nM.
[0361] Probe concentration in a PCR reaction can be optimized, typically by varying the final concentration from 50 nM to 1000 nM. In a preferred embodiment, the probes is according to the invention are used at a final concentration range 50-1000 nM, preferably 100-800 nM, more preferably 100-600 nM, even more preferably 200-600 nM.
[0362] Appropriate amplification conditions are known to those skilled in the art. They include temperature conditions, in particular thermal cycling conditions, e.g. temperature, duration, number, heating rate of the cycles. In a preferred embodiment, said temperature conditions include conditions suitable for a PCR. In another preferred embodiment, said conditions include conditions suitable for a Q-PCR.
[0363] Any megaplex, i.e., multi-multiplex comprising at least A6-targeted one real-time amplification system of the invention and at least one A5-targeted one real-time to amplification system of the invention and at least one A9-targeted one real-time amplification system of the invention and at least one A7-targeted one real-time amplification system of the invention, which would be contemplated by the person of ordinary skill in the art is encompassed by the present application.
[0364] For example, the A5-targeted system E, and the A6-targeted system A, and the A7-targeted system A, and the A9-targeted system H, can be used together in a single-tube assay, thereby forming a megaplex ("megaplex EAAH").
[0365] For example, the A5-targeted system E, and the A6-targeted system B, and the A7-targeted system A, and the A9-targeted system C, can be used together in a single-tube assay, thereby forming a megaplex ("megaplex EBAC").
[0366] Illustrative specificity and sensitivity results of such megaplex are shown in tables 83-88 below.
[0367] From tables 84 and 87 ("megaplex EAAH"), it can be seen that such a megaplex enable to efficiently detect the oncogenic HPV, namely the 13 HR HPV and five other oncogenic HPV (HPV66, 53, 82, 67, 85), and that this megaplex has sufficiently homogeneous sensitivity and specificity (Ct) results to be quantitative for at least the 13 HR HPV and four other oncogenic HPV (HPV66, 53, 82, 85). From tables 86 and 88 ("megaplex EBAC"), it can be seen that such a megaplex enable to efficiently detect the oncogenic HPV, namely at least the 13 HR HPV, and that this megaplex has sufficiently homogeneous sensitivity and specificity (Ct) results to be quantitative for at least the five most common HR HPV (HPV16, 18, 45, 31, 33).
[0368] Preferred megaplex notably comprise the above-mentioned EAAH and EBAC megaplex, as well as the following megaplex systems:
[0369] the combination of A5-targeted system E, and the A6-targeted system B, and the A7-targeted system C, and the A9-targeted system C, can be used together in a single-tube assay, thereby forming a megaplex ("megaplex EBCC");
[0370] the combination of A5-targeted system E, and the A6-targeted system B, and the A7-targeted system B, and the A9-targeted system C, can be used together in a single-tube assay, thereby forming a megaplex ("megaplex to EBBC");
[0371] the combination of A5-targeted system E, and the A6-targeted system B, and the A7-targeted system D, and the A9-targeted system C, can be used together in a single-tube assay, thereby forming a megaplex ("megaplex EBDC");
[0372] the combination of A5-targeted system E, and the A6-targeted system B, and the A7-targeted system A, and the A9-targeted system H, can be used together in a single-tube assay, thereby forming a megaplex ("megaplex EBAH").
[0373] The present application also relates to any amplicon obtainable by implementation of the process according to any one claims 1-45 on a HPV-containing sample, which contains at least one HPV of group A6, A5, A9 or A7, for example, a sample which contains HPV66 and/or HPV53 and/or HPV82 and/or HPV58 and/or HPV33 and/or HPV67 and/or HPV52 and/or HPV35 and/or HPV31 and/or HPV68 and/or HPV39 and/or HPV85 and/or HPV59 and/or HPV45.
[0374] The invention is also directed to a polynucleotide suitable for use as a reference template sequence in the design of primers that can be used in multiplex to cover:
at least the five most common HR HPV (HPV16, 18, 45, 31, 33), preferably at least 7 HR HPV, still preferably the five most common HR HPV as well as at least two other HR HPV, advantageously at least two other HR HPV belonging to groups A6 and/or A5 (e.g., HPV 56, 51, 33, 31, 16, 45, 18), even still preferably at least the thirteen HPV known as HR HPV (HPV types 56, 51, 58, 33, 52, 35, 31, 16, 68, 39, 59, 45 and 18), more preferably, at least the thirteen HPV as well as at least one among HPV types 66, 82, 67, 85, and 53 still more preferably, at least the thirteen HPV as well as at least two among HPV types 66, 82, 67, 85, and 53 even still more preferably, at least the thirteen HPV as well as at least three among HPV types 66, 82, 67, 85, and 53 most preferably, at least the thirteen HPV as well as at least four among HPV types 66, 82, 67, 85, and 53, notably of least the seventeen mucosal HPV, consisting of said 13 HR HPV and HPV types 66, 82, 67, 85, still most preferably, at least the thirteen HPV as well as at least the five HPV types 66, 82, 67, 85, and 53, in a single amplification run while still offering a real time quantitative amplification thereof.
[0375] Of course, the polynucleotides according to the present invention are also suitable is for further protocols, including simplex protocols, multiplex protocols, end-point protocols, qualitative protocols, quantitative protocols, combinations thereof, and the like.
[0376] By polynucleotide, we hereby understand any polymer of nucleotides, wherein nucleotides can be ribonucleotides, deoxyribonucleotides, dideoxyribonucleotides, degenerated nucleotides, and the like. Said nucleotides are preferably single-stranded, but can also be double stranded. The length of said polynucleotides can vary, and is usually under 500 nucleotides (nt), preferably in the range of 50-400 nt, more preferably 100-300 nt, even more preferably 80-260 nt.
[0377] The present application also relates to any polynucleotide suitable for use as a reference template sequence in the design of primers that can be used in a single-tube multiplex to amplify those HPV of groups A6, A5, A9 and A7, and in the design of probes that can be used in said single-tube multiplex for real-time detection of said amplified HPV, said reference template polynucleotide being selected from:
[0378] for group A6: a fragment consisting of positions 413-791 of the HPV56 sequence of SEQ ID NO:420 (accession NC--001594.1), or a conservative sub-fragment thereof, or a sequence which is fully complementary to said fragment or sub-fragment over the entire length of said fragment or sub-fragment;
[0379] for group A5: a fragment consisting of positions 678-902 of the HPV51 sequence of SEQ ID NO:421 (accession NC--001533.1), or a conservative sub-fragment thereof, or a sequence which is fully complementary to said fragment or sub-fragment over the entire length of said fragment or sub-fragment;
[0380] for group A9: a fragment consisting of positions 2707-2794 of the HPV16 to sequence of SEQ ID NO:422 (accession NC--001526.1), or a conservative sub-fragment thereof, or a sequence which is fully complementary to said fragment or sub-fragment over the entire length of said fragment or sub-fragment; or a fragment consisting of positions 3600-3840 of the HPV16 sequence of SEQ ID NO:422 (accession NC--001526.1), or a conservative sub-fragment thereof, or a sequence which is fully complementary to said fragment or sub-fragment over the entire length of said fragment or sub-fragment;
[0381] for group A7: a fragment consisting of positions 1895-2103 of the HPV18 sequence of SEQ ID NO:423 (accession NC--001357.1), or a conservative sub-fragment thereof, or a sequence which is fully complementary to said fragment or sub-fragment over the entire length of said fragment or sub-fragment; or a fragment consisting of positions 916-1044 of the HPV18 sequence of SEQ ID NO:423 (accession NC--001357.1), or a conservative sub-fragment thereof, or a sequence which is fully complementary to said fragment or sub-fragment over the entire length of said fragment or sub-fragment,
[0382] wherein said conservative fragment thereof have retained the property of being a suitable reference template sequence, to construct and produce group-targeted primers, which allow for a real-time multiplex detection of those HPV, which can be oncogenic for the mucosal epithelia.
[0383] The present application more particularly relates to any reference template polynucleotide, which consists of one of SEQ ID NO:25-29 and NO:334-338 (group A6-targeted reference template polynucleotides), or a sequence which is fully complementary thereto over the entire length of said SEQ ID NO sequence.
[0384] The present application more particularly relates to any reference template polynucleotide, which consists of one of SEQ ID NO: 1-5 and NO:320-333 (group A5-targeted reference template sequences), or a sequence which is fully complementary thereto over the entire length of said SEQ ID NO sequence.
[0385] The present application more particularly relates to any reference template polynucleotide, which consists of one of SEQ ID NO: SEQ ID NO:122-210 and 359-419 (group A9-targeted reference template sequences), or a sequence which is fully complementary thereto over the entire length of said SEQ ID NO sequence.
[0386] The present application more particularly relates to any reference template polynucleotide, which consists of one of SEQ ID NO: 46-67; 339-358 (group A7-targeted reference template sequences), or a sequence which is fully complementary thereto over the entire length of said SEQ ID NO sequence.
[0387] Conservative variants of the reference template polynucleotide of the invention are also encompassed by the present application. Conservative variants of a given parent reference template polynucleotide notably include any polynucleotide, which derives from said parent reference template polynucleotide, or the sequence which is fully complementary thereto, by deletion and/or substitution and/or addition of at least one nucleotide, but which has retained the capacity of being a reference template polynucleotide for designing and building an A5- and/or A6- and/or A7- and/or A9-targeted primer pair enabling the amplification of at least one HPV, which can be oncogenic for the mucosal epithelia. Illustrative conservative variants usually comprise those polynucleotides, which have a sequence identity of at least 80%, preferably of at least 85%, more preferably of at least 90%, most preferably of at least 95%, with said parent reference template polynucleotide or with the sequence which is fully complementary thereto (said identity score being computed over the entire length of said parent reference template polynucleotide, or fully complementary sequence). Illustrative conservative variants comprise those which do not differ from plus or minus 5 nucleotides in length from the parent sequence.
[0388] The present application also relates to the primers and probes of the present invention, as such, i.e., as individual oligonucleotide products.
[0389] Conservative variants of the primers of the invention are also encompassed by the present application. Conservative variants of a given parent primer notably include any oligonucleotide, which derives from said parent primer by deletion and/or substitution and/or addition of at least one nucleotide, but which has retained the capacity of being a forward or reverse A5- and/or A6- and/or A7- and/or A9-targeted primer for the amplification of at least one HPV, which can be oncogenic for the mucosal epithelia. Illustrative conservative variants usually comprise those oligonucleotides, which have a sequence identity of at least 80%, is preferably of at least 81%, more preferably of at least 83%, most preferably of least 85%, with said parent primer (said identity score being computed over the entire length of said parent primer). Illustrative conservative variants comprise those which do not differ from plus or minus 5 nucleotides in length from the parent sequence.
[0390] Conservative variants of the probes of the invention are also encompassed by the present application. Conservative variants of a given parent probe notably include any oligonucleotide, which derives from said parent probe, or the sequence which is fully complementary thereto, by deletion and/or substitution and/or addition of at least one nucleotide, but which has retained the capacity of being an A5- and/or A6- and/or A7- and/or A9-targeted probe for the detection of at least one HPV, which can be oncogenic for the mucosal epithelia. Illustrative conservative variants usually comprise those oligonucleotides, which have a sequence identity of at least 90%, preferably of at least 91%, more preferably of at least 93%, most preferably of at least 95%, with said parent probe or with the sequence which is fully complementary thereto (said identity score being computed over the entire length of said parent probe). Illustrative conservative variants comprise those which do not differ from plus or minus 5 nucleotides in length from the parent sequence.
[0391] The present application more particularly relates to primers, which are suitable for HPV amplification, and which are especially adapted to the real-time multiplex amplification of HPV groups A6 and A5 and A9 and A7.
[0392] Said primer can e.g., be:
[0393] an A6-targeted primer, consisting of any one of SEQ ID NO: 30-34 and SEQ ID NO: 35-37; or
[0394] an A5-targeted primer, consisting of any one of SEQ ID NO: 6-10 and SEQ ID NO: 11-15; or
[0395] an A9-targeted primer, consisting of any one of SEQ ID NO: 211-239 and SEQ ID NO: 240-265; or
[0396] an A7-targeted primer, consisting of any one of SEQ ID NO: 68-78 and SEQ ID NO: 79-87.
[0397] The present application more particularly relates to primer systems suitable for HPV amplification, which are especially adapted to the real-time multiplex amplification of HPV groups A6 and A5 and A9 and A7.
[0398] Said primer system may e.g., be:
[0399] at least one A6-targeted primer consisting of one of SEQ ID NO: 30-34, and at least one A6-targeted primer consisting of one of SEQ ID NO: 35-37; and/or
[0400] at least one A5-targeted primer consisting of one of SEQ ID NO: 6-10, and at least one A5-targeted primer consisting of one of SEQ ID NO: 11-15; and/or
[0401] at least one A9-targeted primer consisting of one of SEQ ID NO: 211-239, and at least one A9-targeted primer consisting of one of SEQ ID NO: 240-265; and/or
[0402] at least one A7-targeted primer consisting of one of SEQ ID NO: 68-78, and at least one A7-targeted primer consisting of one of SEQ ID NO: 79-87.
[0403] The present application more particularly relates to probes, which are suitable for HPV detection, and which are especially adapted to the real-time multiplex amplification of HPV groups A6 and A5 and A9 and A7.
[0404] Said probe may e.g., be:
[0405] an A6-targeted probe, consisting of any one of SEQ ID NO:38-40, or a sequence which is fully complementary thereto over the entire length of said SEQ ID NO sequence; or
[0406] an A5-targeted probe, consisting of any one of SEQ ID NO:16-19, or a sequence which is fully complementary thereto over the entire length of said SEQ ID NO sequence; or
[0407] an A9-targeted probe, consisting of any one of SEQ ID NO: 266-282, or a sequence which is fully complementary thereto over the entire length of said SEQ ID NO sequence; or
[0408] an A7-targeted probe, consisting of any one of SEQ ID NO:88-101, or a sequence which is fully complementary thereto over the entire length of said SEQ ID NO sequence.
[0409] Said probes can be produced in various format, e.g., including Taqman® probes (hydrolysis probes), Molecular Beacons® (beacon probes or molecular beacon probes), and Scorpion® probes. One of preferred formats is the beacon format. Hence, the present application more particularly relates to beacon probes, which is are suitable for HPV detection, and which are especially adapted to the real-time multiplex amplification of HPV groups A6 and A5 and A9 and A7.
[0410] Said beacon probe may e.g., be:
[0411] an A6-targeted probe, consisting of any one of SEQ ID NO:41-45, or a sequence which is fully complementary thereto over the entire length of said SEQ ID NO sequence; or
[0412] an A5-targeted probe, consisting of any one of SEQ ID NO:20-24, or a sequence which is fully complementary thereto over the entire length of said SEQ ID NO sequence; or
[0413] an A9-targeted probe, consisting of any one of SEQ ID NO: 283-319, or a sequence which is fully complementary thereto over the entire length of said SEQ ID NO sequence; or
[0414] an A7-targeted probe, consisting of any one of SEQ ID NO:102-121, or a sequence which is fully complementary thereto over the entire length of said SEQ ID NO sequence.
[0415] Beacon probe may further comprise a quencher and a reporter (e.g., a fluorophore).
[0416] Preferably, each probe has its own reporter, whereby each probe has a reporter that is different from the ones displayed by the other probes, whereby each probe can be easily distinguished from the other probes.
[0417] The present application more particularly relates to primer and probe systems, which are suitable for HPV amplification, and which are especially adapted to the real-time multiplex amplification of HPV groups A6 and A5 and A9 and A7.
[0418] Said primer and probe system comprises at least one primer system according to the invention, and at least one probe according to the invention.
[0419] The present application further relates to any amplicon obtainable by amplification of at least one nucleic acid from an HPV of group A6, A5, A9 or A7, by means of at least one primer system according to claim 53, for example, HPV66 and/or HPV53 and/or HPV82 and/or HPV58 and/or HPV33 and/or HPV67 and/or HPV52 and/or HPV35 and/or HPV31 and/or HPV68 and/or HPV39 and/or HPV85 and/or HPV59 and/or HPV45.
[0420] An amplification composition comprising such an amplicon is also encompassed by the present invention.
[0421] The present invention also relates to an amplification composition, a pharmaceutical composition, a biological composition, comprising at least one primer or probe of the invention.
[0422] The present invention also relates to a kit for the diagnostic or prognostic of a cervical neoplasia or cancer, comprising:
[0423] at least one primer system according to the invention, and/or
[0424] at least one probe according to the invention,
[0425] optionally, instructions for the use thereof and/or nucleotides.
[0426] Preferably, said kit comprises at least two primer systems according to the invention, more preferably at least three primer systems according to the invention, most preferably at least four primer systems according to the invention. Said kit comprises more than one probe, e.g. at least two, at least three, at least four, at least five different probes, notably when the kit is intended to discriminate between different HPV types.
[0427] In the kit according to the invention, the oligonucleotides (primers, probes) can be either kept separately, or partially mixed, or totally mixed.
[0428] Said oligonucleotides can be provided under dry form, or solubilized in a suitable solvent, as judged by the skilled person. Suitable solvents include TE, PCR-grade water, and the like.
[0429] In a preferred embodiment, the kit according to the invention can also contain further reagents suitable for a PCR step.
[0430] Such reagents are known to those skilled in the art, and include water, like nuclease-free water, RNase free water, DNAse-free water, PCR-grade water; salts, like magnesium, potassium; buffers such as Tris; enzymes, including polymerases, such as Taq, Vent, Pfu (all of them Trade-Marks), activable polymerase, and the like; nucleotides like deoxynucleotides, dideoxunucleotides, dNTPs, dATP, dTTP, dCTP, dGTP, dUTP; other reagents, like DTT and/or RNase inhibitors; and polynucleotides like polyT, polydT, and other oligonucleotides, e.g., primers.
[0431] In another preferred embodiment, the kit according to the invention comprises PCR controls. Such controls are known in the art, and include qualitative controls, positive controls, negative controls, internal controls, quantitative controls, internal quantitative controls, as well as calibration ranges. The internal control for said PCR step can be a template which is unrelated to the target template in the PCR step. Such controls also may comprise control primers and/or control probes. For example, in the case of HPV detection, it is possible to use as an internal control, a polynucleotide chosen within a gene whose presence is excluded in a sample originating from a human body (for example, from a plant gene), and whose size and GC content is equivalent to those from the target sequence.
[0432] In a preferred embodiment, the kit according to the invention contains means for extracting and/or purifying nucleic acid from a biological sample, e.g. from blood, serum, plasma. Such means are well known to those skilled in the art.
[0433] In a preferred embodiment, the kit according to the invention contains instructions for the use thereof. Said instructions can advantageously be a leaflet, a card, or the like. Said instructions can also be present under two forms: a detailed one, gathering exhaustive information about the kit and the use thereof, possibly also including literature data; and a quick-guide form or a memo, e.g., in the shape of a card, gathering the essential information needed for the use thereof.
[0434] In a preferred embodiment, said kit is a diagnostics kit, especially an in vitro diagnostics kit, i.e., an HPV diagnostics kit.
[0435] The present invention also relates to the field of diagnostics, prognosis and drug/treatment efficiency monitoring, as above-described.
[0436] The oligonucleotides according to the present invention can be used for the diagnostic of HPV group, types, subtypes or strains. In particular, the primers and probes according to the invention can be used for in vitro typing, sub-typing, and quantification of HPV nucleic acids present in an in vitro sample, for instance, in a to patient's cervical sample, or in a cell culture supernatant.
[0437] The term "comprising", which is synonymous with "including" or "containing", is open-ended, and does not exclude additional, unrecited element(s), ingredient(s) or method step(s), whereas the term "consisting of" is a closed term, which excludes any additional element, step, or ingredient which is not explicitly recited. The term "essentially consisting of" is a partially open term, which does not exclude additional, unrecited element(s), step(s), or ingredient(s), as long as these additional element(s), step(s) or ingredient(s) do not materially affect the basic and novel properties of the invention.
[0438] The term "comprising" (or "comprise(s)") hence includes the term "consisting of" ("consist(s) of"), as well as the term "essentially consisting of" ("essentially consist(s) of"). Accordingly, the term "comprising" (or "comprise(s)") is, in the present application, meant as more particularly encompassing the term "consisting of" ("consist(s) of"), and the term "essentially consisting of" ("essentially consist(s) of").
[0439] In the present application, the term "at least x" relating to a set or group of n elements (wherein x is different from zero, and n is a number that is higher than x), explicitly encompasses each value, which is comprises between x and n. For example, the term "at least one" relating to a group or set of six elements explicitly encompasses one, two, three, four, five and six of said elements, as well as at least two, at least three, at least four, at least five of said elements.
[0440] Each of the relevant disclosures of all references cited herein is specifically incorporated by reference. The following examples are offered by way of illustration, and not by way of limitation.
DEFINITIONS
[0441] The terms and names used in the present application have their ordinary meaning in the field of HPV detection in general, and of molecular biology in particular.
[0442] By <<amplification>>, it is meant any technique of nucleic acid amplification, such as the PCR (Polymerase Chain Reaction), or the isothermal amplification techniques, e.g., TMA (transcription mediated amplification), NASBA (nucleic acid sequence based amplification), 3SR (self sustained sequence replication) or strand displacement amplification.
[0443] Amplification methods, especially PCR-based methods, are known in the art (Molecular Cloning: A Laboratory Manual, Maniatis, Fritsch, and Sambrook, CSHL Press; Molecular Biology of the Cell, Alberts et al.; PCR Primer: A Laboratory Manual, Dieffenbach and Dveksler, CSHL Press; The Polymerase Chain Reaction, Mullis, Ferre, and Gibbs, Birkhauser Boston Press; Gene quantification, Ferre, Birkhauser Boston Press).
[0444] By PCR or PCR reaction, we hereby understand any PCR-based method. This includes standard PCR, qualitative, quantitative and semi-quantitative PCR, real-time PCR, reverse-transcriptase PCR (RT-PCR), simplex and multiplex PCR, and the like.
[0445] By real-time PCR, we hereby understand any PCR-based method allowing for monitoring of a signal, such as fluorescence, emitted during the reaction as an indicator of amplicon production during each PCR cycle as opposed to the endpoint detection by conventional PCR methods.
[0446] By quantitative PCR, we hereby understand any PCR-based method allowing for the estimation of the initial amount of a given PCR target in a given sample.
[0447] By multiplex PCR, we hereby understand any PCR reaction aiming at the amplification of more than one target. For instance, multiplex PCR include duplex PCR (two targets), triplex PCR (three targets), and higher multiplex PCR. Multiplex PCR includes PCR reactions with more than one primer pair, for instance two primer pairs. In this case, there might be four different primers, but it is also possible for the two primer pairs to have one primer in common, e.g. the forward primer, and to have two distinct reverse primers. Multiplex PCR also includes PCR reactions with a unique primer pair, but with more than one probe. The term "megaplex" is herein sometimes used: it basically has the same meaning as "multiplex", but is used to distinguish multi-multiplex, which involves at least two different group-targeted systems (e.g., an A5- and an A6- and an A7- and an A9-targeted systems), from the "multiplex", which involve one group-targeted system (e.g., an A7- or an A9-targeted system).
[0448] By nucleic acid, we hereby understand any nucleic acid: it can be synthetic or not, recombinant or naturally occurring, linear or circular. This includes DNA and RNA. The nucleic acid can be either single stranded or double stranded or even triple stranded. It can stem from various biological sources, such as micro organisms (bacteria, yeasts, and the like), or higher organisms, like mammal cells. Said nucleic acid can also be of viral nature, e.g., the HPV nucleic acids. The nucleic acid can also comprise total DNA, total RNA, genomic DNA, mitochondrial DNA, plasmidic DNA, BAC DNA, and mixtures thereof. Moreover, the nucleic acid can assume various states of purity.
[0449] By oligonucleotide, we hereby understand any short polymer of nucleotides, wherein nucleotides can be ribonucleotides, deoxyribonucleotides, dideoxyribonucleotides, degenerated nucleotides, and the like. Said oligonucleotides are preferably single-stranded. The length of said oligonucleotides can vary, and is usually under 150 nucleotides (nt), preferably in the range of 10-100 nt, more preferably 13-60 nt, even more preferably 13-50 nt. Said oligonucleotides can bear chemical modifications, such as tagging or marking, for instance radioactive, fluorescent, biotinylated, dig labelling. An oligonucleotide according to the invention can be either forward (sense) or reverse (antisense). In addition, it should be stressed, that although preferred functions may be mentioned in relation to some oligonucleotides according to the present invention, it is obvious that a given oligonucleotide may assume several functions, and may be used in different ways according to the present invention. For example, an oligonucleotide can be used either as a primer, or as a probe. Also, when an oligonucleotide is described as being useful as an amplicon-targeting probe, the skilled person understands that the complementary sequence of this oligonucleotide is equally useful as a probe to target the same amplicon. Moreover, it is also obvious, that any primer suitable for a multiplex assay, can also, within the meaning of the present invention, be used in a simplex protocol. The same applies to a primer suitable for a real-time protocol, which can also be used in the framework of an end-point assay within the meaning of the present invention.
[0450] Oligonucleotides according to the invention especially include PCR primers and probes. Unless otherwise stated, nucleic acid sequences are given in the 5' to 3' is direction. Said oligonucleotides can be under many forms, e.g. under dry state, in solution/suspension with the desired solvent and the desired concentration. The skilled person would know, which solvents, concentrations, storage conditions are suitable for the oligonucleotides of the invention. In particular, the skilled person would know how to prepare said oligonucleotides as stock solutions. The oligonucleotides according to the invention can also assume various degrees of purity, as can be judged by those skilled in the art, e.g., by HPLC chromatography.
[0451] By set or systems of oligonucleotides, we hereby understand any combination comprising at least one oligonucleotide, preferably at least two, e.g. 2-10 oligonucleotides. Said set can thus comprise one PCR primer, or a pair of PCR primers, or a probe, or a probe and a pair of primers. Said oligonucleotides can be separately kept, or partially mixed, or entirely mixed.
[0452] The notion of primer or PCR primer is known to those skilled in the art. For example, it includes any oligonucleotide able to anneal to a target template under suitable stringency conditions, and allowing for polymerase strand elongation. The typical length of said primer is 13-30 nt, preferably 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26 or 27 nt.
[0453] The terms "primer", "amplification primer" or "nucleic acid primer" are used interchangeably herein. A "primer" refers to a short polynucleotide, whether occurring naturally as in a purified restriction digest or produced synthetically, which is capable of acting as a point of initiation of synthesis when placed under conditions in which synthesis of a primer extension product, which is complementary to a nucleic acid strand, is induced, i.e., in the presence of nucleotides and an inducing agent such as a polymerase and at a suitable temperature and pH. The primer must be sufficiently long to prime the synthesis of the desired extension product. The exact length of the primer will depend upon to experimental factors, and notably upon temperature, source of primer and use of the process.
[0454] A primer pair consists of a forward primer and a reverse primer, wherein the forward primer is sufficiently complementary to one HPV strand to hybridize thereto, and the reverse primer is sufficiently complementary to the other HPV strand to hybridize thereto.
[0455] Stringency refers to hybridization conditions chosen to optimize binding of polynucleotide sequences with different degrees of complementarity. Stringency is affected by factors such as temperature, salt conditions, the presence of organic solvents in the hybridization mixtures, and the lengths and base compositions of the sequences to be hybridized and the extent of base mismatching, and the combination of parameters is more important than the absolute measure of any one factor.
[0456] Very High Stringency: Very high stringency conditions refers to hybridization to filter-bound DNA in 5×SSC, 2% sodium dodecyl sulfate (SDS), 100 microgrammes/ml single stranded DNA at 55-65° C. for 8 hours, and washing in 0.1×SSC and 0.1% SDS at 60-65° C. for thirty minutes.
[0457] High Stringency High stringency conditions refers to hybridization to filter-bound DNA in 5×SSC, 2% sodium dodecyl sulfate (SDS), 100 microgrammes/ml single stranded DNA at 55-65° C. for 8 hours, and washing in 0.2×SSC and 0.2% SDS at 60-65° C. for thirty minutes.
[0458] Moderate Stringency Moderate stringency conditions refers to hybridization to filter-bound DNA in 5×SSC, 2% sodium dodecyl sulfate (SDS), 100 microgrammes/ml single stranded DNA at 55-65° C. for 8 hours, and washing in 0.2×SSC and 0.2% SDS at 50-55° C. for thirty minutes.
[0459] The notion of probe is also known to those skilled in the art. For example, it includes any oligonucleotide able to anneal to a target template under the desired hybridization conditions. The typical length of said probe is 15-60 nt, preferably 16-50 nt, more preferably 17-40 nt, more preferably 17-35 nt, more preferably 20-30 nt. Preferably, said probe is fluorescently labelled. However, it is clear to those skilled in the art that under certain conditions, one may use a primer as a probe and vice-versa. Moreover, it is herein stressed that the products according to the present invention, especially, inter alia, oligonucleotides, are not limited to the intended use herein mentioned, but rather are to be broadly construed, irrespective of the indicated destination. For instance, a claim to a product (oligonucleotide) for a particular use should be construed as meaning a product is (oligonucleotide) which is in fact suitable for the stated use. Thus, an oligonucleotide suitable for use as a primer in a multiplex protocol is also clearly adapted to a simplex protocol within the meaning of the present invention.
[0460] A probe may entirely consist of a hybridizing segment. By "hybridizing segment" or "annealing segment" of a probe, it is meant the nucleotide sequence, which is intended to anneal to the HPV target(s).
[0461] Alternatively, a probe may comprise at least one detection component, e.g. at least one detection label (such as a radioactive element, or a fluorophore). This detection label can be linked to the hybridizing segment of the probe via short HPV-unrelated oligonucleotide arms, which are known to the skilled person as beacon arm, or Scorpion® arm. A probe, which comprises at least one 5' and/or 3' detection label, or at least one 5' and/or 3' beacon arm, consists of a hybridizing segment and of at least one 5' and/or 3' label or beacon arm.
[0462] Various formats (types) of probes, including Taqman® probes (hydrolysis probes), Molecular Beacons® (beacon probes or molecular beacon probes), and Scorpion® probes are known in the art.
[0463] In a preferred embodiment, the probes according to the invention can all be synthesized and used in the molecular beacon format.
[0464] The structure of molecular beacons is as follows. A short nucleotide sequence (so-called beacon arm) which is unrelated to the target sequence is thus covalently linked to both ends of the probe. A short unrelated arm is thus linked in 5' of the probe, and is labelled with a fluorescent moiety (i.e. fluorescent dye or fluorescent marker). Another but still unrelated arm is linked to the 3' end of probe and is labelled with a fluorescence quenching moiety. Thus, molecular beacons have a fluorophore and a quencher at opposite ends. The 5' short arm is totally complementary to the one in 3' so that they can anneal together, and thus can assume a hairpin structure when unhybridized to the target in solution. In this hairpin conformation, the quencher and the fluorescent dye are close enough to each other to allow efficient quenching of the fluorophore. However, when the probe encounters a target molecule, annealing is favoured with respect to the hairpin conformation when values of beacon arm Tm and probe Tm are suitably chosen (theoretically: probe Tm>beacon arm Tm>primer Tm, wherein Tm is the melting temperature of interest). The fluorophore and quencher move away from each other and the fluorophore can then fluoresce when illuminated by suitable light excitation. As PCR proceeds, amplification product accumulates, and the amount of fluorescence at any given cycle depends on the amount of amplification product present at that time. (See e.g., Sanjay Tyagi and Fred Russell Kramer, Nature Biotechnology 1996, volume 14, pages 303-308; Nature Biotechnology 1998, volume 16, pages 49-53).
(Remark: It is also possible to link the fluorophore at the 3' end, while attaching the quencher at the 5' end.)
[0465] Schematically, said probe can have the following formulae (molecular beacon format):
5' Fluorophore-(arm1)-probe-(arm2)-Quencher 3' 5' Quencher-(arm1)-probe-(arm2)-Fluorophore 3' wherein arm1 and arm2 can be any short nucleotide sequences, e.g. in the range of 3-10 nucleotides, preferably 5, 6, 7 nucleotides, allowing for the hair pin structure formation under suitable stringency conditions, i.e. arm1 and arm2 are totally complementary to anneal under the desired stringency conditions (standard PCR stringency conditions include, for example, an annealing temperature of 55 to 65° C. and an Mg concentration of 4 to 8 mM). However, arm1 and arm2 are unrelated to the target sequence of the probe, i.e. the hairpin conformation resulting from the annealing between arm1 and arm2 is essentially the only possible secondary structure for the probe when unhybridized. The skilled person would know how to choose such arms for a given probe.
[0466] Illustrative beacon formats include:
TABLE-US-00011 TGCGC-(probe sequence)-GCGCA GCGCA-(probe sequence)-TGCGC AGCGC-(probe sequence)-GCGCT GCGCT-(probe sequence)-AGCGC CGCGA-(probe sequence)-TCGCG CGCGC-(probe sequence)-GCGCG.
[0467] By fluorophore, it is herein understood any fluorescent marker/dye known in the art. Examples of such suitable fluorescent markers include Fam, Hex, Tet, Joe, Rox, Tamra, Max, Edans, Cy dyes such as Cy5, Fluorescein, Coumarin, Eosine, Rhodamine, Bodipy, Alexa, Cascade Blue, Yakima Yellow, Lucifer Yellow and Texas Red (all of them are Trade-Marks), the family of ATTO dyes.
[0468] By quencher, we herein understand any quencher known in the art. Examples of such quenchers include Dabcyl, Dark Quencher, Eclipse Dark Quencher, ElleQuencher, Tamra, BHQ and QSY (all of them are Trade-Marks).
[0469] The skilled person would know which combinations of dye/quencher are suitable when designing a probe.
[0470] In a preferred embodiment according to the invention, spectral properties of said probes can be chosen as to not interfere with each other. In particular, when probes are used in multiplex, each single probe can have its own fluorophore being spectrally significantly different from each other, i.e. the absorption/emission spectra are essentially non-overlapping. This advantageously allows for low-noise multiplex detection for all single probes, making sure that individual signals do not interfere with each other in detection. Examples of dyes which can be used together in multiplex include Fam with Tamra, Fam with Tamra with Texas Red. The choice of appropriate dyes to be used together may also be dependent of the filter contained in the amplification apparatus.
[0471] According to the invention, all the provided oligonucleotides can be either kept separately, or partially mixed, or totally mixed.
[0472] Said oligonucleotides can be provided under dry form, or solubilized in a suitable solvent, as judged by the skilled person. Suitable solvents include TE, PCR-grade water, and the like.
[0473] The term "significantly" is herein used in its usual meaning in the field of statistics (e.g., t test, z test, chi squared value, or F ratio, etc.), i.e., for comparing a value to another one, and determining whether these values differ from each other. The term "significantly" hence encompasses the fact that the skilled person may take into account the standard deviation (if any), which measures the amount of spread to of data in a frequency distribution. The desired p value is usually set at an alpha level of 5%, or at the more stringent alpha level of 1%.
[0474] In the examples below, are described several A6-, A5-, A9 and A7-targeted amplification and/or detection systems of the invention.
Tables 12-35: these tables give the SEQ ID NO: and positions of the reference amplicons, the forward primers, the reverse primers, the probes, the beacons probes of illustrative group-targeted systems of the invention. Table 12: Reference amplicons of A5-targeted systems (from HPV51 genome) Table 13: Forward primers of A5-targeted systems Table 14: Reverse primers of A5-targeted systems Table 15: Probes of A5-targeted systems Table 16: Beacon probes of A5-targeted systems Table 17: A5-targeted systems Table 18: Reference amplicons of A6-targeted systems (from HPV56 genome) Table 19: Forward primers of A6-targeted systems Table 20: Reverse primers of A6-targeted systems Table 21: Probes of A6-targeted systems Table 22: Beacon probes of A6-targeted systems Table 23: A6-targeted systems Table 24: Reference amplicons of A7-targeted systems (from HPV18 genome) Table 25: Forward primers of A7-targeted systems Table 26: Reverse primers of A7-targeted systems Table 27: Probes of A7-targeted systems Table 28: Beacon probes of A7-targeted systems Table 29: A7-targeted systems Table 30: Reference amplicons of A9-targeted systems (from HPV16 genome) Table 31: Forward primers of A9-targeted systems Table 32: Reverse primers of A9-targeted systems Table 33: Probes of A9-targeted systems Table 34: Beacon probes of A9-targeted systems Table 35: A9-targeted systems Tables 36-50: these tables show the number of nucleotide mismatches shown by primers and probes of the invention (alignment of the sequences of 50 HPV types); an empty box indicates there is no coherent sequence alignment; a gray box indicates that the number of mismatch(es) is of 0, 1, 2 or 3. Table 36: mismatch numbers shown by primers and probes of A5-targeted systems of the invention (systems A to C) Table 37: mismatch numbers shown by primers and probes of A5-targeted systems of the invention (systems D to E) Table 38: mismatch numbers shown by primers and probes of A6-targeted systems of the invention (systems A to C) Table 39: mismatch numbers shown by primers and probes of A6-targeted systems of the invention (systems D to E) Table 40: mismatch numbers shown by primers and probes of A7-targeted systems of the invention (systems A to B) Table 41: mismatch numbers shown by primers and probes of A7-targeted systems of the invention (systems C to D) Table 42: mismatch numbers shown by primers and probes of A9-targeted systems of the invention (system C) Table 43: mismatch numbers shown by primers and probes of A9-targeted systems of the invention (system E1) Table 44: mismatch numbers shown by primers and probes of A9-targeted systems of the invention (system E2) Table 45: mismatch numbers shown by primers and probes of A9-targeted systems of the invention (system E3) Table 46: mismatch numbers shown by primers and probes of A9-targeted systems of the invention (system E4) Table 47: mismatch numbers shown by primers and probes of A9-targeted systems of the invention (system F) Table 48: mismatch numbers shown by primers and probes of A9-targeted systems of the invention (system GZ7) Table 49: mismatch numbers shown by primers and probes of A9-targeted systems of the invention (system GZ8) Table 50: mismatch numbers shown by primers and probes of A9-targeted systems of the invention (system H) Tables 51-68: specificity of the detection systems of the invention
[0475] The amplification systems described in tables 36-50 have been used to test the specificity of the probes of the invention.
Table 51: illustrative list of HPV plasmids, which can be used to test the HPV specificity of the detection systems of the invention; the whole list of plasmids have been used for the specificity results, which are herein described Table 52: illustrative PCR material and method conditions, which can be used to test the specificity of the A5- and A6-targeted detection systems of the invention Table 53: specificity results of A5-targeted probes (box "other HPV"=all the other HPV of the list given in Table 51) Table 54: specificity results of A6-targeted probes (box "other HPV"=all the other HPV of the list given in Table 51) Table 55: illustrative PCR material and method conditions, which can be used to test the specificity of the A7-targeted detection systems of the invention Tables 56-59: specificity results of A7-targeted probes (box "other HPV"=all the other HPV of the list given in Table 51) Table 56: A7-targeted amplification system A, and probes of A7-targeted amplification system A (one probe per PCR) Table 57: A7-targeted amplification system B, and probes of A7-targeted amplification system B (one probe per PCR) Table 58: A7-targeted amplification system C, and probes of A7-targeted amplification system C (one probe per PCR) Table 59: A7-targeted amplification system D, and probes of A7-targeted to amplification system D (one probe per PCR) Table 60: illustrative PCR material and method conditions, which can be used to test the specificity of the A9-targeted detection systems of the invention Tables 61-68: specificity results of A9-targeted probes (box "other HPV"=all the other HPV of the list given in Table 51) Table 61: A9-targeted amplification system C, and probes of A9-targeted amplification system C (one probe per PCR) Table 62: A9-targeted amplification system E2, and probes of A9-targeted amplification system E2 (one probe per PCR) Table 63: A9-targeted amplification system E3, and probes of A9-targeted amplification system E3 (one probe per PCR) Table 64: A9-targeted amplification system E4, and probes of A9-targeted amplification system E4 (one probe per PCR) Table 65: A9-targeted amplification system F, and probes of A9-targeted amplification system F (one probe per PCR) Table 66: A9-targeted amplification system GZ7, and probes of A9-targeted amplification system GZ7 (one probe per PCR) Table 67: A9-targeted amplification system GZ8, and probes of A9-targeted amplification system GZ8 (one probe per PCR) Table 68: A9-targeted amplification system H, and probes of A9-targeted amplification system H (one probe per PCR)
[0476] The amplification and detection systems, which were used for the specificity tests, are those shown in Table 17 (A5-targeted systems); Table 23 (A6-targeted systems); Table 29 (A7-targeted systems); Table 35 (A9-targeted systems).
[0477] For the A9-targeted systems, those primers, which are shown between brackets in Table 35 were not used, as they would have been redundant: indeed, those primers, which are not between brackets, are sufficient to amplify all group A9 HPV. Hence, in table 35, those A9-targeted primers which are shown between brackets are optional and/or equivalent and/or alternative primers, if it is wished to amplify all group A9 HPV.
Tables 69-82: system sensitivity
[0478] The sensitivity of systems of the invention has been tested under the same experimental conditions, as for the specificity tests (see Tables 52, 55, 60).
Table 69: sensitivity of A5-targeted systems (systems A, B, C, D and E) Table 70: sensitivity of A6-targeted systems (systems A, B, C, D and E) Tables 71-74: sensitivity of A7-targeted systems Table 71: sensitivity of A7-targeted system A Table 72: sensitivity of A7-targeted system B Table 73: sensitivity of A7-targeted system C Table 74: sensitivity of A7-targeted system D Tables 75-82: sensitivity of A9-targeted systems Table 75: sensitivity of A9-targeted system C Table 76: sensitivity of A9-targeted system E2 Table 77: sensitivity of A9-targeted system E3 Table 78: sensitivity of A9-targeted system E4 Table 79: sensitivity of A9-targeted system F Table 80: sensitivity of A9-targeted system GZ7 Table 81: sensitivity of A9-targeted system GZ8 Table 82: sensitivity of A9-targeted system H Tables 83-88: "meqaplex" specificity and sensitivity
[0479] PCR runs have been conducted with one A5-targeted system, one A6-targeted system, one A7-targeted system, one A9-targeted system, in a single-tube amplification.
[0480] As the A7- and A9-targeted systems already are multiplex systems (i.e., they each have more than two primers), the mix of the four group-targeted systems is herein referred to as a "megaplex".
[0481] The megaplex PCR have been tested with the plasmids listed in Table 51, in to specificity (Ct; RFU) and in sensitivity (Ct; RFU).
Tables 83-86: specificity results for megaplex EAAH and EBAC Tables 83-84: specificity of the megaplex EAAH Table 83: illustrative megaplex material and method conditions, which can be used for a mix of A5-targeted system E, A6-targeted system A, A7-targeted system A and A9-targeted system H (i.e., megaplex EAAH); these experimental conditions have been used for the results depicted in table 84 Table 84: specificity results of the EAAH megaplex Tables 85-86: specificity of the megaplex EBAC Table 85: illustrative megaplex material and method conditions, which can be used for a mix of A5-targeted system E, A6-targeted system B, A7-targeted system A and A9-targeted system C (i.e., megaplex EBAC); these experimental conditions have been used for the results depicted in table 86; Table 86: specificity results of the EBAC megaplex Tables 87-88: sensitivity results of the megaplex EAAH and EBAC Table 87: sensitivity results of the megaplex EAAH Table 88: sensitivity results of the megaplex EBAC Table 89: list of HPV genome sequences.
[0482] These tables are followed by a listing of sequences of reference templates.
A5 Group=HPV51; HPV26; HPV69; HPV82
A5 HR HPV=HPV51
A5 Reference Genome=HPV51
NC--001533.1; Human HPV, Complete Genome
TABLE-US-00012
[0483] TABLE 12 A5 REFERENCE AMPLICON SEQUENCES (from reference genome) = Size Start and stop positions SEQ Systems (bp) within reference genome ID NO: System A 106 772-877 1 System AB 109 772-880 320 System AD 131 772-902 321 System B 145 736-880 2 System BA 142 736-877 322 System BD 167 736-902 323 System C 117 678-794 3 System CA 200 678-877 324 System CB 203 678-880 325 System CD 225 678-902 326 System CE 151 678-828 327 System D 192 711-902 4 System DA 167 711-877 328 System DB 170 711-880 329 System DE 118 711-828 330 System E 125 704-828 5 System EA 174 704-877 331 System EB 177 704-880 332 System ED 199 704-902 333
TABLE-US-00013 TABLE 13 A5 FORWARD PRIMERS Size SEQ Name Sequence Address (bp) ID NO: A5E6f1 GGCAGTGGAAAGCAGTGGAGAC 772 22 6 A5E6f2 AGCTCCGTGTTGCAGGTGTTC 736 21 7 A5E6f3 ATATGCGTGACCAGCTACCAG 678 21 8 A5E6f4 GACAGGCTACGTGTTACAGAA 711 21 9 A5E6f5 CGGGCTGGACAGGCTACG 704 18 10
TABLE-US-00014 TABLE 14 A5 REVERSE PRIMERS Size SEQ Name Sequence Address bp ID NO: A5E6r1 CCATCGCCGTTGCTAGTTGTTC 877 22 11 A5E6r2 AGTCCATCGCCGTTGCTAGTTG 880 22 12 A5E6r3 TGTCTCCACTGCTTTCCACTG 794 21 13 A5E6r4 CCCTCATCCTCTGTACCTTC 902 20 14 A5E6r5 TCGCCCATTAACATCTGCTGT 828 21 15
TABLE-US-00015 TABLE 15 A5 PROBES SEQ Corresponding Size ID beacon probes Sequence Address (bp) NO: A5E6s1, GCTTAGTTCGCCCATTAACA 835 27 16 A5E6s1b TCTGCTG A5E6s2 CGAAGGGTGTCTCCACTGCT 801 25 17 TTCCA A5E6s3 ACACGGAGCTTCAATTCTGT 745 26 18 AACACG A5E6s4 TAGTACAACTGGCAGTGGAA 762 26 19 AGCAGT
TABLE-US-00016 TABLE 16 A5 BEACON PROBES SEQ Sequence (underlined ID Name are shown the beacon arms) Address NO: A5E6s1 CCCCCTCGCTTAGTTCGCCCATTAACATCT 835 20 GCTGGAGGGGG A5E6s1b CGCTGCGCTTAGTTCGCCCATTAACATCTG 835 21 CTGGCAGCG A5E6s2 CGCGATCCGAAGGGTGTCTCCACTGCTTTC 801 22 CAGATCGCG A5E6s3 CGCGATCACACGGAGCTTCAATTCTGTAAC 745 23 ACGGATCGCG A5E6s4 CGCGATCTAGTACAACTGGCAGTGGAAAGC 762 24 AGTGATCGCG A5E6s4 CGCGATCTAGTACAACTGGCAGTGGAAAGC 762 24 AGTGATCGCG
TABLE-US-00017 TABLE 17 A5 systems; minimal set = one forward primer, one reverse primer, and one probe HPV51 reference amplicon Forward primer Reverse primer Probe Beacon ® Probe A5 SEQ ID NO: Name SEQ ID NO: Name SEQ ID NO: SEQ ID NO: Name SEQ ID NO: System A 1 A5E6f1 6 A5E6r1 11 16 A5E6s1 20 16 A5E6s1b 21 System AB 320 A5E6f1 6 A5E6r2 12 16 A5E6s1 20 16 A5E6s1b 21 System AD 321 A5E6f1 6 A5E6r4 14 16 A5E6s1 20 16 A5E6s1b 21 System B 2 A5E6f2 7 A5E6r2 12 17 A5E6s2 22 16 A5E6s1 20 16 A5E6s1b 21 System BA 322 A5E6f2 7 A5E6r1 11 16 A5E6s1 20 16 A5E6s1b 21 17 A5E6s2 22 System BD 323 A5E6f2 7 A5E6r4 14 16 A5E6s1 20 16 A5E6s1b 21 17 A5E6s2 22 System C 3 A5E6f3 8 A5E6r3 13 18 A5E6s3 23 System CA 324 A5E6f3 8 A5E6r1 11 16 A5E6s1 20 16 A5E6s1b 21 17 A5E6s2 22 18 A5E6s3 23 19 A5E6s4 24 System CB 325 A5E6f3 8 A5E6r2 12 16 A5E6s1 20 16 A5E6s1b 21 17 A5E6s2 22 18 A5E6s3 23 19 A5E6s4 24 System CD 326 A5E6f3 8 A5E6r4 14 16 A5E6s1 20 16 A5E6s1b 21 17 A5E6s2 22 18 A5E6s3 23 19 A5E6s4 24 System CE 327 A5E6f3 8 A5E6r5 15 18 A5E6s3 23 19 A5E6s4 24 System D 4 A5E6f4 9 A5E6r4 14 19 A5E6s4 24 16 A5E6s1 20 16 A5E6s1b 21 17 A5E6s2 22 System DA 328 A5E6f4 9 A5E6r1 11 16 A5E6s1 20 16 A5E6s1b 21 17 A5E6s2 22 19 A5E6s4 24 System DB 329 A5E6f4 9 A5E6r2 12 16 A5E6s1 20 16 A5E6s1b 21 17 A5E6s2 22 19 A5E6s4 24 System DE 330 A5E6f4 9 A5E6r5 15 19 A5E6s4 24 System D 4 A5E6f4 9 A5E6r4 14 19 A5E6s4 24 16 A5E6s1 20 16 A5E6s1b 21 17 A5E6s2 22 System DA 328 A5E6f4 9 A5E6r1 11 16 A5E6s1 20 16 A5E6s1b 21 17 A5E6s2 22 19 A5E6s4 24 System DB 329 A5E6f4 9 A5E6r2 12 16 A5E6s1 20 16 A5E6s1b 21 17 A5E6s2 22 19 A5E6s4 24 System DE 330 A5E6f4 9 A5E6r5 15 19 A5E6s4 24
A6 Group=HPV30; HPV63; HPV56; HPV66
A6 HR HPV=HPV56
A6 Reference Genome=HPV56
NC--001594.1; Human HPV56, Complete Genome
TABLE-US-00018
[0484] TABLE 18 A6 REFERENCE AMPLICON SEQUENCES (from reference genome) = Size Start and stop positions SEQ Systems (bp) within reference genome ID NO: System A 100 504-603 25 System AE 288 504-791 334 System B 115 489-603 26 System BE 303 489-791 335 System C 138 413-550 27 System CA 191 413-603 336 System CE 379 413-791 337 System D 102 502-603 28 System DE 290 502-791 338 System E 127 665-791 29
TABLE-US-00019 TABLE 19 A6 FORWARD PRIMERS SEQ ID Name Sequence Address Size (bp) NO: A6E6f1 TGGACCGGGTCATGTTTGGG 504 20 30 A6E6f2 CTAATAGCACATGGTTGGACCG 489 22 31 A6E6f3 AAGGTGCTACAGATGTCAAAG 413 21 32 A6E6f4 GTTGGACCGGGTCATGTTTGG 502 21 33 A6E6f5 TCAGAGGATGAGGATGAGGATG 665 22 34
TABLE-US-00020 TABLE 20 A6 REVERSE PRIMERS SEQ ID Name Sequence Address Size bp NO: A6E6r1 ACGTCTTGCAGCGTTGGTAC 603 20 35 A6E6r1 ACGTCTTGCAGCGTTGGTAC 603 20 35 A6E6r2 GGTTCTCTAGATGTTTGTCT 550 22 36 CC A6E6r1 ACGTCTTGCAGCGTTGGTAC 603 20 35 A6E6r3 ACTGCACCACAAACTTACAC 791 22 37 TC
TABLE-US-00021 TABLE 21 A6 PROBES SEQ Corresponding Size ID beacon probes Sequence Address (bp) NO: A6E6s1 ACATCTAGAGAACCTAGAGA 537 30 38 ATCTACAGTA A6E6s2, GGTCCAACCATGTGCTATTA 509 26 39 A6E6s2b GATGAA A6E6s3, CGGCCACAGCAAGCTAGACA 707 20 40 A6E6s3b
TABLE-US-00022 TABLE 22 A6 BEACON PROBES SEQ Sequence (underlined ID Name are shown the beacon arms) Address NO: A6E6s1 CGCGATCACATCTAGAGAACCTAGAGAATC 537 41 TACAGTAGATCGCG A6E6s1 CGCGATCACATCTAGAGAACCTAGAGAATC 537 41 TACAGTAGATCGCG A6E6s2 CGCGATCGGTCCAACCATGTGCTATTAGAT 509 42 GAAGATCGCG A6E6s2b CGCCTCGGTCCAACCATGTGCTATTAGATG 509 43 AAGAGGCG A6E6s1 CGCGATCACATCTAGAGAACCTAGAGAATC 537 41 TACAGTAGATCGCG A6E6s3 CGCGACGGCCACAGCAAGCTAGACATCGCG 707 44 A6E6s3b CGCCTCCGGCCACAGCAAGCTAGACAGAGG 707 45 CG
TABLE-US-00023 TABLE 23 A6 SYSTEMS; minimal set = one forward primer, one reverse primer, and one probe HPV56 reference amplicon Forward primer Reverse Primer Probe Beacon ® Probe A6 SEQ ID NO: Name SEQ ID NO: Name SEQ ID NO: SEQ ID NO: Name SEQ ID NO: System A 25 A6E6f1 30 A6E6r1 35 38 A6E6s1 41 System 334 A6E6f1 30 A6E6r3 37 38 A6E6s1 41 AE 40 A6E6s3 44 40 A6E6s3b 45 System B 26 A6E6f2 31 A6E6r1 35 38 A6E6s1 41 System 335 A6E6f2 31 A6E6r3 37 38 A6E6s1 41 BE 40 A6E6s3 44 40 A6E6s3b 45 System C 27 A6E6f3 32 A6E6r2 36 39 A6E6s2 42 39 A6E6s2b 43 System 336 A6E6f3 32 A6E6r1 35 38 A6E6s1 41 CA 39 A6E6s2 42 39 A6E6s2b 43 System 337 A6E6f3 32 A6E6r3 37 38 A6E6s1 41 CE 39 A6E6s2 42 39 A6E6s2b 43 40 A6E6s3 44 40 A6E6s3b 45 System D 28 A6E6f4 33 A6E6r1 35 38 A6E6s1 41 System 338 A6E6f4 33 A6E6r3 37 38 A6E6s1 41 DE 40 A6E6s3 44 40 A6E6s3b 45 System E 29 A6E6f5 34 A6E6r3 37 40 A6E6s3 44 40 A6E6s3b 45
A7 Group=HPV18; HPV39; HPV45; HPV59; HPV68; HPV70; HPV85
A7 HR HPV=HPV18; HPV39; HPV45; HPV59; HPV68
A7 Reference Genome=HPV18
NC--001357.1; Human HPV, Complete Genome
TABLE-US-00024
[0485] TABLE 24 A7 REFERENCE AMPLICON SEQUENCES (from reference genome) = Start and stop Size positions within SEQ ID Systems (bp) reference genome NO: Systems A, 198 a 209 1895-2099 46 A1, A2 1895-2102 47 1895-2103 48 1902-2099 49 1902-2102 50 1902-2103 51 System AB 161 a 171 1895-2062 52 1895-2065 53 1902-2062 339 1902-2065 340 Systems 199 a209 1895-2100 341 AC1, AC2, 1895-2103 48 AC3 1902-2100 342 1902-2103 51 System B 166 a 171 1895-2062 52 1895-2065 53 1896-2062 54 1896-2065 55 1897-2062 56 1897-2065 57 Systems 203 a 209 1895-2099 46 BA1, BA2, 1895-2102 47 BA3 1895-2103 48 1896-2099 343 1896-2102 344 1896-2103 345 1897-2099 346 1897-2102 347 1897-2103 348 Systems 204 a 209 1895-2100 349 BC1, BC2, 1895-2103 48 BC3 1896-2100 350 1896-2103 345 1897-2100 351 1897-2103 352 Systems 113 a 125 1987-2100 58 C, C1 1987-2103 59 1988-2100 60 1988-2103 61 1979-2100 62 1979-2103 63 Systems 112 a 125 1979-2099 353 CA1, CA2 1979-2102 354 1979-2103 63 1987-2099 355 1987-2102 356 1987-2103 59 1988-2099 357 1988-2102 358 1988-2103 61 System D 113 a 129 916-1032 64 916-1044 65 920-1032 66 920-1044 67
TABLE-US-00025 TABLE 25 A7 FORWARD PRIMERS SEQ Size ID Name Sequence Address (bp) NO: A7E16f1a TGGTATAGAACAGGAATATCAAAT 1895 24 68 A7E16f2a GAACAGGTATATCCAATATTAGTG 1902 24 69 A7E16f3a GAACAGGAATGTCCAATATTAG 1902 22 70 A7E115f1a TGGTATAGAACAGGAATATCAAAT 1895 26 71 AT A7E115f2a GTACAGAACAGGAATGTCCAA 1897 21 72 A7E115f3d GGTATCGCACAGGTATATCC 1896 20 73 A7E17f1 TGATAGCAATTTTGATTTGTCAG 1987 23 74 A7E17f2 GATAGCGTATTTGACCTATCAG 1988 22 75 A7E17f3 GGAATAGATGATAGTGTATTTGAT 1979 25 76 C A7E12f1 GGCCGATCCAGAAGGTACAGAC 916 22 77 A7E12f2 CAATCGTGAAGGTACAGATGG 920 21 78
TABLE-US-00026 TABLE 26 A7 REVERSE PRIMERS SEQ Size ID Name Sequence Address bp NO: A7E16r1b CATTGCTGTTGCAGTCTG 2099 18 79 A7E16r2b GCAGCATTACTGTTACAATC 2103 20 80 A7E16r3b CGGCGTTACTATTACTATCTG 2102 21 81 A7E115r1a TGCCATATCGCTTTCATCTG 2062 20 82 A7E115r2b AAATGCTATATCACTTTCATCTG 2065 23 83 A7E17r1 GCATTACTGTTGCTGTCTG 2100 19 84 A7E17r2 GCGGCATTACTATTACAATCTG 2103 22 85 A7E12r2 GCATTTTCATCCTCATCCTCTG 1032 22 86 A7E12r3 CCTGTGTCTGTTGCATTTTC 1044 20 87
TABLE-US-00027 TABLE 27 A7 PROBES Size SEQ ID Corresponding Sequence Address (bp) NO: beacon probes CAGATGAAAGCGATATGGCATT 2043 22 88 A7E1ZAS61f CAGATGAAAGTGATATTGCATAT 2043 23 89 A7E1ZAS63f CTGATGAAAGTGACATAGCATTT 2043 23 98 A7E1ZAS64f CAGATGAAAGTGATATGGCATTT 2043 23 91 A7E1ZCS40f TGGAATAGATGATAGTGTATTTGAT 1978 25 92 A7E1ZBS74f GATAGCAATTTTGATTTGTCAGA 1988 23 93 A7E1ZBS26f TGGAATAGATGATAGTGTATTTGAT 1978 25 92 A7E1ZBS74f AGTTGATGATAGCGTGTTTGAC 1981 22 94 A7E1ZBS79f AGTTGATGATAGCGTGTTTGAC 1981 22 94 A7E1ZBS80f CGATAGTAATTTTGATTTGTCAGA 1987 24 96 A7E1ZBS27f CAGATGAAAGTGATATGGCATTT 2043 23 91 A7E1ZCS11f CAGATGAAAGTGATATGGCATTT 2043 23 91 A7E1ZCS40f CTGATGAAAGTGACATAGCATTT 2043 23 90 A7E1ZCS45f CAGATGAAAGTGATATTGCATAT 2043 23 89 A7E1ZCS63f AATGAGTTAACAGATGAAAGTGA 2032 23 96 A7E1ZCS90f GTAATGGCTGGTTCTTYGTAGAAACAA 954 27 97 A7E1ZDS36f GTMCGGCTGGTTTTATGTACAAGCTA 954 27 98 A7E1ZDS37f GTAATGGATGGTTTTTTGTACAGGCAAT 954 28 99 A7E1ZDS38f GTAACGGATGGTTTTTTGTACAAGCAAT 954 28 100 A7E1ZDS2f GGTGTAATGGCTGGTTCITTGTAGA 951 25 101 A7E1ZDS3f GGTGTAATGGCTGGTTCTTTGTAGA 951 25 101 A7E1ZDS4f GGTGTAATGGCTGGTTCTTTGTAGA 951 25 101 A7E1ZDS11f
TABLE-US-00028 TABLE 28 A7 BEACON PROBES Sequence (underlined SEQ ID Name are shown the beacon arms) Address NO: A7E1ZAS61f CGACGTCAGATGAAAGCGATATGGCATTACGTCG 2043 102 A7E1ZAS63f CGACGTCAGATGAAAGTGATATTGCATATACGTCG 2043 103 A7E1ZAS64f CGACGTCTGATGAAAGTGACATAGCATTTACGTCG 2043 104 A7E1ZCS40f CCGAGTCAGATGMAGTGATATGGCATTTACTCGG 2043 106 A7E1ZBS74f ACGTCGTGGAATAGATGATAGTGTATTTGATCGACGT 1978 106 A7E1ZBS26f CGCAGTGATAGCAATTTTGATTTGTCAGAACTGCG 1988 107 A7E1ZBS74f ACGTCGTGGAATAGATGATAGTGTATTTGATCGACGT 1978 106 A7EIZBS79f ACGTCGAGTTGATGATAGCGTGTTTGACCGACGT 1981 108 A7E1ZBS80f CCGGCTAGTTGATGATAGCGTGTTTGACAGCCGG 1981 109 A7E1ZBS27f CGCAGTCGATAGTAATTTTGATTTGTCAGAACTGCG 1987 110 A7E1ZCS11f CGCAGTCAGATGAAAGTGATATGGCATTTACTGCG 2043 111 A7EIZCS40f CCGAGTCAGATGAAAGTGATATGGCATTTACTCGG 2043 105 A7E1ZCS45f CGTCGTCTGATGAAAGTGACATAGCATTTACGACG 2043 112 A7E1ZCS63f CGAGGTCAGATGAAAGTGATATTGCATATACCTCG 2043 113 A7EIZCS90f CCACGTAATGAGTTAACAGATGAAAGTGAACGTGG 2032 114 A7E1ZDS36f CGCGACGTAATGGCTGGTTCTTTGTAGAAACAAGTCGCG 954 115 A7E1ZDS37f CGCGATCGTAACGGCTGGTTTTATGTACAAGCTAGATCGCG 954 116 A7E1ZDS38f CGCGATCGTAATGGATGGTTTTTTGTACAGGCAATGATCGCG 954 117 A7E1ZDS2f CGCGCTGTAACGGATGGTTTTTTGTACAAGCAATAGCGCG 954 118 A7E1ZDS3f CGCGATGGTGTAATGGCTGGTTCTTTGTAGAATCGCG 951 119 A7E1ZDS4f CGCGATCGGTGTAATGGCTGGTTCTTTGTAGAGATCGCG 951 120 A7E1ZDS11f CTCGCTCGGTGTAATGGCTGGTTCTTTGTAGAGAGCGAG 951 121
TABLE-US-00029 TABLE 29 A7 SYSTEMS HPV18 reference amplicon Forward Primers Reverse Primers Probes Beacon ® Probes SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID A7 NO: Name NO: Name NO: NO: Name NO: System A 46 to 51 A7E16f1a 68 A7E16r1b 79 88 A7E1ZAS61f 102 A7E16f2a 69 A7E16r2b 80 89 A7E1ZAS63f 103 A7E16f3a 70 A7E16r3b 81 90 A7E1ZAS64f 104 91 A7E1ZCS40f 105 92 A7E1ZBS74f 106 System A1 46 to 51 A7E16f1a 68 A7E16r1b 79 93 A7E1ZBS26f 107 A7E16f2a 69 A7E16r2b 80 92 A7E1ZBS74f 106 A7E16f3a 70 A7E16r3b 81 94 A7E1ZBS79f 108 94 A7E1ZBS80f 109 95 A7E1ZBS27f 110 System A2 46 to 51 A7E16f1a 68 A7E16r1b 79 91 A7E1ZCS11f 111 A7E16f2a 69 A7E16r2b 80 91 A7E1ZCS40f 105 A7E16f3a 70 A7E16r3b 81 90 A7E1ZCS45f 112 89 A7E1ZCS63f 113 96 A7E1ZCS90f 114 System AB 52-53- A7E16f1a 68 A7E115r1a 82 93 A7E1ZBS26f 107 339-340 A7E16f2a 69 A7E115r2b 83 92 A7E1ZBS74f 106 A7E16f3a 70 94 A7E1ZBS79f 108 94 A7E1ZBS80f 109 95 A7E1ZBS27f 110 System AC1 48-51- A7E16f1a 68 A7E17r1 84 88 A7E1ZAS61f 102 341-342 A7E16f2a 69 A7E17r2 85 89 A7E1ZAS63f 103 A7E16f3a 70 90 A7E1ZAS64f 104 91 A7E1ZCS40f 105 92 A7E1ZBS74f 106 System AC2 48-51- A7E16f1a 68 A7E17r1 84 93 A7E1ZBS26f 107 341-342 A7E16f2a 69 A7E17r2 85 92 A7E1ZBS74f 106 A7E16f3a 70 94 A7E1ZBS79f 108 94 A7E1ZBS80f 109 95 A7E1ZBS27f 110 System AC3 48-51- A7E16f1a 68 A7E17r1 84 91 A7E1ZCS11f 111 341-342 A7E16f2a 69 A7E17r2 85 91 A7E1ZCS40f 105 A7E16f3a 70 90 A7E1ZCS45f 112 89 A7E1ZCS63f 113 96 A7E1ZCS90f 114 System B 52 to -57 A7E115f1a 71 A7E115r1a 82 93 A7E1ZBS26f 107 A7E115f2a 72 A7E115r2b 83 92 A7E1ZBS74f 106 A7E115f3d 73 94 A7E1ZBS79f 108 94 A7E1ZBS80f 109 95 A7E1ZBS27f 110 System BA1 46-47-48- A7E115f1a 71 A7E16r1b 79 88 A7E1ZAS61f 102 343 to A7E115f2a 72 A7E16r2b 80 89 A7E1ZAS63f 103 348 A7E115f3d 73 A7E16r3b 81 90 A7E1ZAS64f 104 91 A7E1ZCS40f 105 92 A7E1ZBS74f 106 System BA2 46-47-48- A7E115f1a 71 A7E16r1b 79 93 A7E1ZBS26f 107 343 to A7E115f2a 72 A7E16r2b 80 92 A7E1ZBS74f 106 348 A7E115f3d 73 A7E16r3b 81 94 A7E1ZBS79f 108 94 A7E1ZBS80f 109 96 A7E1ZBS27f 110 System BA3 46-47-48- A7E115f1a 71 A7E16r1b 79 91 A7E1ZCS11f 111 343 to A7E115f2a 72 A7E16r2b 80 91 A7E1ZCS40f 105 348 A7E115f3d 73 A7E16r3b 81 90 A7E1ZCS45f 112 89 A7E1ZCS63f 113 96 A7E1ZCS90f 114 System BC1 48-345- A7E115f1a 71 A7E17r1 84 88 A7E1ZAS61f 102 349 to A7E115f2a 72 A7E17r2 85 89 A7E1ZAS63f 103 352 A7E115f3d 73 90 A7E1ZAS64f 104 91 A7E1ZCS40f 105 92 A7E1ZBS74f 106 System BC2 48-345- A7E115f1a 71 A7E17r1 84 93 A7E1ZBS26f 107 349 to A7E115f2a 72 A7E17r2 85 92 A7E1ZBS74f 106 352 A7E115f3d 73 94 A7E1ZBS79f 108 94 A7E1ZBS80f 109 95 A7E1ZBS27f 110 System BC3 48-345- A7E115f1a 71 A7E17r1 84 91 A7E1ZCS11f 111 349 to A7E115f2a 72 A7E17r2 85 91 A7E1ZCS40f 105 352 A7E115f3d 73 90 A7E1ZCS45f 112 89 A7E1ZCS63f 113 96 A7E1ZCS90f 114 System C 58 to 63 A7E17f1 74 A7E17r1 84 91 A7E1ZCS11f 111 A7E17f2 75 A7E17f2 85 91 A7E1ZCS40f 105 A7E17f3 76 90 A7E1ZCS45f 112 89 A7E1ZCS63f 113 96 A7E1ZCS90f 114 System C1 58 to 63 A7E17f1 74 A7E17r1 84 88 A7E1ZAS61f 102 A7E17f2 75 A7E17r2 85 89 A7E1ZAS63f 103 A7E17f3 76 90 A7E1ZAS64f 104 91 A7E1ZCS40f 105 96 A7E1ZCS90f 114 System CA1 59-61-63- A7E17f1 74 A7E16r1b 74 91 A7E1ZCS11f 111 353 to A7E17f2 75 A7E16r2b 80 91 A7E1ZCS40f 105 358 A7E17f3 76 A7E16r3b 81 90 A7E1ZCS45f 112 89 A7E1ZCS63f 113 96 A7E1ZCS90f 114 System CA2 59-61-63- A7E17f1 74 A7E16r1b 79 88 A7E1ZAS61f 102 353 to A7E17f2 75 A7E16r2b 80 89 A7E1ZAS63f 103 358 A7E17f3 76 A7E16r3b 81 90 A7E1ZAS64f 104 91 A7E1ZCS40f 105 96 A7E1ZCS90f 114 System D 64 to 67 A7E12f1 77 A7E12r2 86 97 A7E1ZDS36f 115 A7E12f2 78 A7E12r3 87 98 A7E1ZDS37f 116 99 A7E1ZDS38f 117 100 A7E1ZDS2f 118 101 A7E1ZDS3f 119 101 A7E1ZDS4f 120 101 A7E1ZDS11f 121
A9 Group=HPV16; HPV31; HPV33; HPV35; HPV52; HPV58; HPV67
A9 HR HPV=HPV16; HPV31; HPV33; HPV35; HPV52; HPV58
A9 Reference Genome=HPV16
NC--001526.1; Human HPV16, Complete Genome
TABLE-US-00030
[0486] TABLE 30 A9 REFERENCE AMPLICON SEQUENCES (from reference genome) = Amplicons Forward Reverse Start-stop Systems size bp address address positions SEQ ID NO: System C 88 2707 2794 2707-2794 122 2707 2794 2707 2707 2707 2707 2707 System E1 191 a 198 3600 3790 3600-3790 123 3600 3793 3600-3793 124 3600 3791 3600-3791 125 3790 3600-3797 126 3797 3600-3795 127 3795 System E2 190 a 198 3600 3790 3600-3790 123 3601 3793 3600-3793 124 3600 3791 3600-3791 125 3790 3600-3797 126 3797 3600-3795 127 3795 3601-3790 128 3601-3793 129 3601-3791 130 3601-3797 131 3601-3795 132 Amplicons address address Start-stop Systems size pb forw rev position SEQ ID NO: System E3 188 a 193 3600 3788 3600-3788 133 3601 3792 3600-3792 134 3600 3792 3600-3790 135 3790 3601-3788 136 3792 3601-3792 137 3792 3601-3790 138 3792 3790 System E4 179 a 186 3607 3788 3607-3788 139 3610 3792 3607-3792 140 3609 3792 3607-3790 141 3790 3610-3788 142 3792 3610-3792 143 3792 3610-3790 144 3792 3609-3788 145 3790 3609-3792 146 3609-3790 147 System E5 181 a 191 3607 3790 3607-3790 141 3610 3793 3607-3791 359 3609 3791 3607-3793 360 3790 3607-3795 361 3797 3607-3797 362 3795 3609-3790 363 3609-3791 364 3609-3793 365 3609-3795 366 3609-3797 367 3610-3790 144 3610-3791 368 3610-3793 369 3610-3795 370 3610-3797 371 System E6 189 a 193 3600 3788 3600-3788 133 3600 3792 3600-3790 135 3600 3792 3600-3792 134 3790 3792 3792 3792 3790 System E1H 231 a 241 3600 3838 3600-3830 372 Z7, Z8 3600 3831 3600-3831 373 3600 3830 3600-3837 374 3830 3600-3838 375 3838 3600-3839 376 3840 3600-3840 377 3839 3838 3837 System E2H 230 a 241 3600 3838 3600-3830 372 Z7, Z8 3601 3831 3600-3831 373 3600 3830 3600-3837 374 3830 3600-3838 375 3838 3600-3839 376 3840 3600-3840 377 3839 3601-3830 378 3838 3601-3831 379 3837 3601-3837 380 3601-3838 381 3601-3839 382 3601-3840 383 System E4H 224 a 234 3607 3838 3607-3830 384 Z7, Z8 3610 3831 3607-3831 385 3609 3830 3607-3837 386 3830 3607-3838 387 3838 3607-3839 388 3840 3607-3840 389 3839 3609-3830 390 3838 3609-3831 391 3837 3609-3837 392 3609-3838 393 3609-3839 394 3609-3840 395 3610-3830 396 3610-3831 397 3610-3837 398 3610-3838 399 3610-3839 400 3610-3840 401 System F 163 a 172 3626 3788 3626-3788 148 3626 3792 3626-3792 149 3621 3792 3626-3790 150 3625 3790 3621-3788 151 3792 3621-3792 152 3792 3621-3790 153 3792 3625-3788 154 3790 3625-3792 155 3625-3790 156 System FE 165 a 177 3626 3790 3621-3790 153 3626 3793 3621-3791 402 3621 3791 3621-3793 403 3625 3790 3621-3795 404 3797 3621-3797 405 3795 3625-3790 156 3625-3791 406 3625-3793 407 3625-3795 408 3625-3797 409 3626-3790 150 3626-3791 410 3626-3793 411 3626-3795 412 3626-3797 413 System FH 205 a 220 3626 3838 3621-3830 163 Z7, Z8 3626 3831 3621-3831 162 3621 3830 3621-3837 164 3625 3830 3621-3838 414 3838 3621-3839 415 3840 3621-3840 161 3839 3625-3830 167 3838 3625-3831 166 3837 3625-3837 168 3625-3838 416 3625-3839 417 3625-3840 165 3626-3830 159 3626-3831 158 3626-3837 160 3626-3838 418 3626-3839 419 3626-3840 157 System G Z7, 205 a 220 3626 3840 3626-3840 157 Z8 3626 3831 3626-3831 158 3621 3830 3626-3830 159 3625 3837 3626-3837 160 3840 3621-3840 161 3840 3621-3831 162 3621-3830 163 3621-3837 164 3625-3840 165 3625-3831 166 3625-3830 167 3625-3837 168 System H 132 a 150 3699 3838 3699-3838 169 3691 3831 3699-3831 170 3693 3830 3699-3830 171 3696 3830 3699-3840 172 3695 3838 3699-3839 173 3698 3840 3699-3837 174 3697 3839 3691-3838 175 3699 3838 3691-3831 176 3698 3837 3691-3830 177 3691-3840 178 3691-3839 179 3691-3837 180 3693-3838 181 3693-3831 182 3693-3830 183 3693-3840 184 3693-3839 185 3693-3837 186 System H 132 a 150 3696 3838 3696-3838 187 3695 3831 3696-3831 188 3698 3830 3696-3830 189 3697 3840 3696-3840 190 3839 3696-3839 191 3837 3696-3837 192 3695-3838 193 3695-3831 194 3695-3830 195 3695-3840 196 3695-3839 197 3695-3837 198 3698-3838 199 3698-3831 200 3698-3830 201 3698-3840 202 3698-3839 203 3698-3837 204 3697-3838 205 3697-3831 206 3697-3830 207 3697-3840 208 3697-3839 209 3697-3837 210
TABLE-US-00031 TABLE 31 A9 FORWARD PRIMERS Forward Primer SEQ ID Name 5' Sequence 3' address size bp NO: A9E1f7 AGGACGTGGTCCAGATTAAGTTT 2707 23 211 A9E118 AGGACGTGGTGCAGATTAAG 2707 20 212 A9E1f9 AGGACGTGGTGCAAATTAAGTTT 2707 23 213 A9E1f10 AGGACGTGGTGCAGATTAAATTT 2707 23 214 A9E1f11 AGGACGTGGTGCAGATTAGGTTT 2707 23 215 A9E1f12 AGGACGTGGTGCAAATTAAATTT 2707 23 216 A9E1f13 AGGACGTGGTGCAAATTAGGTTT 2707 23 217 A9E2f1 TAGTAACACTACACCCATAGTACAT 3600 25 218 A9E2f2 TCTAACGTTGCACCTATCGTG 3600 21 219 A9E2f4 TCCTTCTACTGCACCTATAATACA 3600 24 220 A9E2f1a TAGTACCACTACACCCATAGTACAT 3600 26 221 A9E2f2a TCTAACGTTGCACCTATCGTGCAT 3601 24 222 A9E2f4a TCCTTCTACTGCACCTATAATACAC 3600 25 223 A9E2Z5Z6f1c ACTACACCTATAGTACATTTAAAAGG 3607 26 224 A9E2Z5Z6f2c GCACCTATAGTGCATTTAAAAG 3610 22 225 A9E2Z5Z6f3b TGCACCTATAATACACCTAAAAG 3609 23 226 A9E21f1az TAAAAGGTGATGCTAATACTTTAAA 3626 25 227 A9E21f2bz TAAAAGGTGATGCAAATACATTAAA 3626 25 228 A9E21f3dz GCATTTAAAAGGTGAATCAAATAG 3621 24 229 A9E21f4cz CTAAAAGGTGATCCTAATAGTTTAAA 3625 26 230 A9E2f5 GTCGTCTACATGGCATTGGA 3699 20 231 A9E2f6 CAAGATGCTTCATCTACATGGAG 3691 23 232 A9E2f7 AGAAGCGTCATCTACATGGAG 3693 21 233 A9E2f8 AGTGTCGTCTACATGGCATTG 3696 21 234 A9E2f9 ATATGTCATCTACATGGCATTGG 3695 23 235 A9E2f10 TGTCATCCAGATGGCATTGG 3698 20 236 A9E2f10b ATGTCATCCACATGGCATTG 3697 20 237 A9E2f11 TTCATCTACCTGGAGTTGGAC 3699 21 238 A9E2f12 TTTCATCTACATGGAGTTGGAC 3698 22 239
TABLE-US-00032 TABLE 32 A9 REVERSE PRIMERS SEQ Reverse Primer size ID Name 5' Sequence 3' address bp NO: A9E1r5 TGTCCTGACACACATTTAAACG 2794 22 240 A9E1r6 TGTCCTGCACTGCATTTAAAC 2794 21 241 A9E2r1 ATTGGTCACGTTGCCATTG 3790 19 242 A9E2r2 AAAATTGTTGACGTTGTGTTTC 3793 22 243 A9E2r3 AACTGTTGACGTTGTGTTTC 3791 20 244 A9E2r4 ACATTTGTCGTTGCGGTTC 3790 19 245 A9E2r13 GTCTCTTTGTGATGTACTTATATA 3797 26 246 TG A9E2r14 CCCTTTGATATTCTGTTGTGTAAG 3795 24 247 A9E21r1cz TGGTCACGTTGCCATTC 3788 17 248 A9E21r2az AAAATCGTGTCTTTGTGATGT 3792 21 249 A9E21r3az AAACATTTGTTGTTGCTGTTC 3792 21 250 A9E21r4fz ATTTATCCCTTTGATATTCTGTTG 3790 24 251 A9E21r5az AAACAGTTGACGTTGTGTTTC 3792 21 252 A9E21r6az AAACTGTTGACGTTGTGTTTC 3792 21 253 A9E21r7az AAATTGTTGACGTTGTGTTTC 3792 21 254 A9E21r8az ACAGTTGTCGTTGTGTTTC 3790 19 255 A9E2r7C AAATCCTGTAGACACTGTAACAGT 3840 24 256 A9E2r8 ACTTATTTGCACAGTAGGTGGT 3831 22 257 A9E2r10 CTTACTTGCACAGTAGTTGGTA 3830 22 258 A9E2r12 ATCCTGTTGACACTGATACTGT 3837 22 259 A9E2r12B TATCCTGTAGACACTGAAACTGTG 3840 24 260 A9E2r15 AAATCCAGTAGACACTGTAATAGT 3840 25 261 T A9E2r7B ATCCTGTAGACACTGTAACAGTT 3838 23 262 A9E2r8 ACTTATTTGCACAGTAGGTGGT 3831 22 257 A9E2r9 CTTACTTGCACAGTAGGTGGTA 3830 22 263 A9E2r10 CTTACTTGCACAGTAGTTGGTA 3830 22 258 A9E2r12 ATCCTGTTGACACTGATACTGT 3838 22 259 A9E2r7C AAATCCTGTAGACACTGTAACAGT 3840 24 256 A9E2r12B TATCCTGTAGACACTGAAACTGTG 3839 24 264 A9E2r15 AAATCCAGTAGACACTGTAATAGT 3838 26 261 TT A9E2r16 ACCGTACTTATTTGCACAGTG 3837 21 265
TABLE-US-00033 TABLE 33 A9 PROBES 5' Sequence 3' address size pb SEQ ID NO: Corresponding beacon probes TCCATCGTTTTCCTTGTCCTCT 2738 22 266 A9E1S10 and S10a TCCATCGTTTTCTTTGACCTCT 2738 22 267 A9E1S11 and S11a TCCATCATTTTCTTTGACCTCT 2738 22 268 A9E1S12, S12a and S12b TCTCCATCATTTTCTTTGTCCTCT 2738 24 269 A9E1S13a, S13b and S13c CTCCATCGTTTTCTTTGTCCTC 2739 22 270 A9E1S14a CTCCATCATTTTCTTTGACCTCTC 2737 24 271 A9E1S15a and 15b AGTGTCGTCTACATGGCATTGGAC 3696 24 272 A9E2Z7S1 ATATGTCATCCACCTGGCATTGGAC 3695 25 273 A9E2Z7S2 and S2a ATATGTCATCCACCTGGCATTGGA 3695 24 274 A9E2Z7S2b ATGCTTCATCTACATGGAGATGGAC 3695 25 275 A9E2Z7S3 and S3a CAAGTTTCATCTACATGGCATTGGAC 3694 26 276 A9E2Z7S4 and S4a GATAGTGAATGGCAACGTGA 3766 20 277 A9E2Z8S2f, S21f and S28f ATAAGTACATCACAAAGAGACGA 3766 23 278 A9E2Z8S56f, S58f and S61f TAACTGAACAGCAACAACAAATG 3767 23 279 A9E2Z8S101f, 105f and 127f CACAACAGAATATCAAAGGGATAAATT 3765 27 280 A9E2Z8S146f, 155f and 156f CGTACAGTGATGAAACACAAC 3761 21 281 A9E2Z8S210f AACGGAAACACAACGACAAC 3768 20 282 A9E2Z8S231f, 236f and 250f
TABLE-US-00034 TABLE 34 A9 BEACON PROBES Beacon probe Name 5' Sequence 3' address size bp SEQ ID NO: A9E1S10 CGCGATTCCATCGTTTTCCTTGTCCTCTATCGCG 2738 22 283 A9E1S10a CGCGATCCATCGTTTTCCTTGTCCTCTTCGCG 2738 22 284 A9E1S11 CGCGATTCCATCGTTTTCTTTGACCTCTATCGCG 2738 22 285 A9E1S11a CGCGATCCATCGTTTTCTTTGACCTCTTCGCG 2738 22 286 A9E1S12 CGCGATTCCATCATTTTCTTTGACCTCTATCGCG 2738 22 287 A9E1S12a CGCGATCCATCATTTTCTTTGACCTCTTCGCG 2738 22 288 A9E1S12b CGCTGTCCATCATTTTCTTTGACCTCTCAGCG 2738 22 289 A9E1S13a CGCGTTCTCCATCATTTTCTTTGTCCTCTACGCG 2738 24 290 A9E1S13b CGCCGTCTCCATCATTTTCTTTGTCCTCTCGGCG 2738 24 291 A9E1S13c CGCGATTCTCCATCATTTTCTTTGTCCTCTATCGCG 2738 24 292 A9E1S14a CGCGATCTCCATCGTTTTCTTTGTCCTCATCGCG 2739 22 293 A9E1S15a CGCCGCTCCATCATTTTCTTTGACCTCTCCGGCG 2737 24 294 A9E1S15b CGCGATCTCCATCATTTTCTTTGACCTCTCATCGCG 2737 24 295 A9E2Z7S1 CGCGAAGTGTCGTCTACATGGCATTGGACTCGCG 3696 24 296 A9E2Z7S2 CGCTCGATATGTCATCCACCTGGCATTGGACCGAGCG 3695 25 297 A9E2Z7S2a CGCATGATATGTCATCCACCTGGCATTGGACCATGCG 3695 25 298 A9E2Z7S2b CGCATGATATGTCATCCACCTGGCATTGGACATGCG 3695 24 299 A9E2Z7S3 CGCACTATGCTTCATCTACATGGAGATGGACAGTGCG 3695 25 300 A9E2Z7S3a CCGACGATGCTTCATCTACATGGAGATGGACCGTCGG 3695 25 301 A9E2Z7S4 CGCGATCAAGTTTCATCTACATGGCATTGGACATCGCG 3694 26 302 A9E2Z7S4a CGCGAGCAAGTTTCATCTACATGGCATTGGACCTCGCG 3694 26 303 A9E2Z8S2f CAGCGTGATAGTGAATGGCAACGTGAACGCTG 3766 20 304 A9E2Z8S21f CGGACTGATAGTGAATGGCAACGTGAAGTCCG 3766 20 305 A9E2Z8S28f CTCGCTGATAGTGAATGGCAACGTGAAGCGAG 3766 20 306 A9E2Z8S56f CGAGCTATAAGTACATCACAAAGAGACGAAGCTCG 3766 23 307 A9E2Z8S58f CGCAGTATAAGTACATCACAAAGAGACGAACTGCG 3766 23 308 A9E2Z8S61f CGCGTTATAAGTACATCACAAAGAGACGAAACGCG 3766 23 309 A9E2Z8S101f CGAGGTTAACTGAACAGCAACAACAAATGACCTCG 3767 23 310 A9E2Z8S105f CGCGATTAACTGAACAGCAACAACAAATGATCGCG 3767 23 311 A9E2Z8S127f CCGGCTTAACTGAACAGCAACAACAAATGAGCCGG 3767 23 312 A9E2Z8S146f CGCGATCACAACAGAATATCAAAGGGATAAATTATCGCG 3765 27 313 A9E2Z8S155f CGCACGCACAACAGAATATCAAAGGGATAAATTCGTGCG 3765 27 314 A9E2Z8S156f CCGGCTCACAACAGAATATCAAAGGGATAAATTAGCCGG 3765 27 315 A9E2Z8S210f CCGGCTCGTACAGTGATGAAACACAACAGCCGG 3761 21 316 A9E2Z8S231f CGAGGTAACGGAAACACAACGACAACACCTCG 3768 20 317 A9E2Z8S236f CGCGTTAACGGAAACACAACGACAACAACGCG 3768 20 318 A9E2Z8S250f CGATGCAACGGAAACACAACGACAACGCATCG 3768 20 319
TABLE-US-00035 TABLE 35 A9 SYSTEMS HPV16 reference Forward Primer Reverse Primer Beacon ® Probe amplicon SEQ SEQ Probe SEQ A9 SEQ ID NO: Name ID NO: Name ID NO: SEQ ID NO: Name ID NO: System C 122 A9E1f8 212; 214; A9E1r5 240-241 266-271 A9E1S10 283-295 A9E1f10 216 A9E1r6 A9E1S10a A9E1f12 (211; 213; -- (A9E1f7) 215; 217) A9E1S11 (A9E1f9) A9E1S11a (A9E1f11) -- (A9E1f13) A9E1S12 A9E1S12a A9E1S12b -- A9E1S13a A9E1S13b A9E1S13c -- A9E1S14a -- A9E1S15a A9E1S15b System E1 123 to 127 A9E2f1 218-220 A9E2r1 242-243; 272-276 A9E2Z7S1 296-303 A9E2f2 A9E2r2 245-247 -- A9E2f4 A9E2r4 (244) A9E2Z7S2 A9E2r13 A9E2Z7S2a A9E2r14 A9E2Z7S2b (A9E2r3) -- A9E2Z7S3 A9E2Z7S3a -- A9E2Z7S4 A9E2Z7S4a System E2 123 to 132 A9E2f1a 221-223 A9E2r1 242-243; 272-276 A9E2Z7S1 296-303 A9E2f2a A9E2r2 245-247 -- A9E2f4a A9E2r4 (244) A9E2Z7S2 A9E2r13 A9E2Z7S2a A9E2r14 A9E2Z7S2b (A9E2r3) -- A9E2Z7S3 A9E2Z7S3a -- A9E2Z7S4 A9E2Z7S4a System E3 133 to 138 A9E2f1a 221-223 A9E21r1cz 248-252 272-276 A9E2Z7S1 296-303 A9E2f2a A9E21r2az (253-255) -- A9E2f4a A9E21r3az A9E2Z7S2 A9E21r4fz A9E2Z7S2a A9E21r5az A9E2Z7S2b (A9E21r6az) -- (A9E21r7az) A9E2Z7S3 (A9E21r8az) A9E2Z7S3a -- A9E2Z7S4 A9E2Z7S4a System E4 139 to 147 A9E2Z5Z6f1c 224-226 A9E21r1cz 248-252 272-276 A9E2Z7S1 296-303 A9E2Z5Z6f2c A9E21r2az (253-255) -- A9E2Z5Z6f3b A9E21r3az A9E2Z7S2 A9E21r4fz A9E2Z7S2a A9E21r5az A9E2Z7S2b (A9E21r6az -- A9E21r7az A9E2Z7S3 A9E21r8az) A9E2Z7S3a -- A9E2Z7S4 A9E2Z7S4a System E5 141; 144 and 359 A9E2Z5Z6f1c 224-226 A9E2r1 242-243; 272-276 A9E2Z7S1 296-303 to 371 A9E2Z5Z6f2c A9E2r2 245-247; -- A9E2Z5Z6f3b A9E2r4 (244) A9E2Z7S2 A9E2r13 A9E2Z7S2a A9E2r14 A9E2Z7S2b (A9E2r3) -- A9E2Z7S3 A9E2Z7S3a -- A9E2Z7S4 A9E2Z7S4a System E6 133 to 135 A9E2f1 218-220 A9E21r1cz 248-252; 272-276 A9E2Z7S1 296-303 A9E2f2 A9E21r2az (253-255) -- A9E2f4 A9E21r3az A9E2Z7S2 A9E21r4fz A9E2Z7S2a A9E21r5az A9E2Z7S2b (A9E21r6az) -- (A9E21r7az) A9E2Z7S3 (A9E21r8az) A9E2Z7S3a -- A9E2Z7S4 A9E2Z7S4a System 372 to 377 A9E2f1 218-220 (A9E2r7B) (256; 257; 259; 262; 263); 272-276 A9E2Z7S1 296-303 E1H Z7 A9E2f2 (A9E2r8) 258; 261; 264; 265 -- A9E2f4 (A9E2r9) A9E2Z7S2 A9E2r10 A9E2Z7S2a (A9E2r12) A9E2Z7S2b (A9E2r7C) -- A9E2r12B A9E2Z7S3 A9E2r15 A9E2Z7S3a A9E2r16 -- A9E2Z7S4 A9E2Z7S4a System 372 to 377 A9E2f1 218-220 (A9E2r7B) (256; 257; 259, 277-282 A9E2Z8S2f 304-319 E1H Z8 A9E2f2 (A9E2r8) 262; 263); A9E2Z8S21f A9E2f4 (A9E2r9) 258; 261; 264; A9E2Z8S28f A9E2r10 265 -- (A9E2r12) A9E2Z8S56f (A9E2r7C) A9E2Z8S58f A9E2r12B A9E2Z8S61f A9E2r15 -- A9E2r16 A9E2Z8S101f A9E2Z8S105f A9E2Z8S127f -- A9E2Z8S146f A9E2Z8S155f A9E2Z8S156f -- A9E2Z8S210f -- A9E2Z8S231f A9E2Z8S236f A9E2Z8S250f System 372 to 383 A9E2f1a 221-223 (A9E2r7B) (256; 257; 259, 262; 263); 272-276 A9E2Z7S1 296-303 E2H Z7 A9E2f2a (A9E2r8) 258; 261; 264; 265 -- A9E2f4a (A9E2r9) A9E2Z7S2 A9E2r10 A9E2Z7S2a (A9E2r12) A9E2Z7S2b (A9E2r7C) -- A9E2r12B A9E2Z7S3 A9E2r15 A9E2Z7S3a A9E2r16 -- A9E2Z7S4 A9E2Z7S4a System 372 to 383 A9E2f1a 221-223 (A9E2r7B) (256; 257; 259; 262; 263); 277-282 A9E2Z8S2f 304-319 E2H Z8 A9E2f2a (A9E2r8) 258; 261; 264; 265 A9E2Z8S21f A9E2f4a (A9E2r9) A9E2Z8S28f A9E2r10 -- (A9E2r12) A9E2Z8S56f (A9E2r7C) A9E2Z8S58f A9E2r12B A9E2Z8S61f A9E2r15 -- A9E2r16 A9E2Z8S101f A9E2Z8S105f A9E2Z8S127f -- A9E2Z8S146f A9E2Z8S155f A9E2Z8S156f -- A9E2Z8S210f -- A9E2Z8S231f A9E2Z8S236f A9E2Z8S250f System 384 to 401 A9E2Z5Z6f1c 224-226 (A9E2r7B) (256; 257; 259; 272-276 A9E2Z7S1 296-303 E4H Z7 A9E2Z5Z6f2c (A9E2r8) 262; 263); -- A9E2Z5Z6f3b (A9E2r9) 258; 261; 264; A9E2Z7S2 A9E2r10 265 A9E2Z7S2a (A9E2r12) A9E2Z7S2b (A9E2r7C) -- A9E2r12B A9E2Z7S3 A9E2r15 A9E2Z7S3a A9E2r16 -- A9E2Z7S4 A9E2Z7S4a System 384 to 401 A9E2Z5Z6f1c 224-226 (A9E2r7B) (256; 257; 259; 262; 263); 277-282 A9E2Z8S2f 304-319 E4H Z8 A9E2Z5Z6f2c (A9E2r8) 258; 261; 264; 265 A9E2Z8S21f A9E2Z5Z6f3b (A9E2r9) A9E2Z8S28f A9E2r10 -- (A9E2r12) A9E2Z8S56f (A9E2r7C) A9E2Z8S58f A9E2r12B A9E2Z8S61f A9E2r15 -- A9E2r16 A9E2Z8S101f A9E2Z8S105f A9E2Z8S127f -- A9E2Z8S146f A9E2Z8S155f A9E2Z8S156f -- A9E2Z8S210f -- A9E2Z8S231f A9E2Z8S236f A9E2Z8S250f System F 148 to 156 A9E21f1az 227-230 A9E21r1cz 248-252; 272-276 A9E2Z7S1 296-303 A9E21f2bz A9E21r2az (253-255) -- A9E21f3dz A9E21r3az A9E2Z7S2 A9E21f4cz A9E21r4fz A9E2Z7S2a A9E21r5az A9E2Z7S2b (A9E21r6az) -- (A9E21r7az) A9E2Z7S3 (A9E21r8az) A9E2Z7S3a -- A9E2Z7S4 A9E2Z7S4a System FE 150; 153; 156; 402 to A9E21f1az 227-230 A9E2r1 242-243; 272-276 A9E2Z7S1 296-303 413 A9E21f2bz A9E2r2 (244); -- A9E21f3dz (A9E2r3) 245-247 A9E2Z7S2 A9E21f4cz A9E2r4 A9E2Z7S2a A9E2r13 A9E2Z7S2b A9E2r14 -- A9E2Z7S3 A9E2Z7S3a -- A9E2Z7S4 A9E2Z7S4a System FH 157 to 168 and 414 A9E21f1az 227-230 (A9E2r7B) (262); 272-276 A9E2Z7S1 296-303 Z7 to 419 A9E21f2bz (A9E2r8) (257); -- A9E21f3dz (A9E2r9) (263); A9E2Z7S2 A9E21f4cz (A9E2r12) (259); A9E2Z7S2a (A9E2r7C) (256); A9E2Z7S2b A9E2r10 258; -- A9E2r12B 264 A9E2Z7S3 A9E2r15 261 A9E2Z7S3a A9E2r16 265 -- A9E2Z7S4 A9E2Z7S4a System FH 157 to 168 and 414 A9E21f1az 227-230 (A9E2r7B) (262); 277-282 A9E2Z8S2f 304-319 Z8 to 419 A9E21f2bz (A9E2r8) (257); A9E2Z8S21f A9E21f3dz (A9E2r9) (263); A9E2Z8S28f A9E21f4cz (A9E2r12) (259); -- (A9E2r7C) (256); A9E2Z8S56f A9E2r10 258; A9E2Z8S58f A9E2r12B 264 A9E2Z8S61f A9E2r15 261 -- A9E2r16 265 A9E2Z8S101f A9E2Z8S105f A9E2Z8S127f -- A9E2Z8S146f A9E2Z8S155f
A9E2Z8S156f -- A9E2Z8S210f -- A9E2Z8S231f A9E2Z8S236f A9E2Z8S250f System G 157 to 168 A9E21f1az 227-230 (A9E2r7C) (256); 272-276 A9E2Z7S1 296-303 Z7 A9E21f2bz A9E2r8 257-261 -- A9E21f3dz A9E2r10 A9E2Z7S2 A9E21f4cz A9E2r12 A9E2Z7S2a A9E2r12B A9E2Z7S2b A9E2r15 -- A9E2Z7S3 A9E2Z7S3a -- A9E2Z7S4 A9E2Z7S4a System G 157 to 168 A9E21f1az 227-230 (A9E2r7C) (256); 277-282 A9E2Z8S2f 304-319 Z8 A9E21f2bz A9E2r8 257-261 A9E2Z8S21f A9E21f3dz A9E2r10 A9E2Z8S28f A9E21f4cz A9E2r12 -- A9E2r12B A9E2Z8S56f A9E2r15 A9E2Z8S58f A9E2Z8S61f -- A9E2Z8S101f A9E2Z8S105f A9E2Z8S127f -- A9E2Z8S146f A9E2Z8S155f A9E2Z8S156f -- A9E2Z8S210f -- A9E2Z8S231f A9E2Z8S236f A9E2Z8S250f System H 169 to 210 (A9E2f5) (231); (A9E2r7B) (262); 277-282 A9E2Z8S2f 304-319 A9E2f6 232; (A9E2r8) (257); A9E2Z8S21f (A9E2f7) (233); (A9E2r9) (263); A9E2Z8S28f A9E2f8 234; (A9E2r12) (259); -- A9E2f9 235; (A9E2r7C) (256); A9E2Z8S56f (A9E2f10) (236); A9E2r10 258; A9E2Z8S58f (A9E2f10b) (237); A9E2r12B 264; A9E2Z8S61f (A9E2f11) (238); A9E2r15 261; -- (A9E2f12) (239) A9E2r16 265 A9E2Z8S101f A9E2Z8S105f A9E2Z8S127f -- A9E2Z8S146f A9E2Z8S155f A9E2Z8S156f -- A9E2Z8S210f -- A9E2Z8S231f A9E2Z8S236f A9E2Z8S250f Those primers which are between brackets are optional and/or equivalent and/or alternative primers.
TABLE-US-00036 TABLE 36 A5 Systems A to C: sequence aligment mismach evaluation Reference of sequence: HPV 56->ref|NC_001594.1| System A System B System C forward reverse forward reverse forward reverse primer primer probe primer primer probe primer primer SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID NO: 6 NO: 11 NO: 20 NO: 7 NO: 12 NO: 22 NO: 8 NO: 13 NO: 23 NoHPC Group A5E6f1 A5E6r1 A5E6s1 A5E6f2 A5E6r2 A5E6s2 A5E6f3 A5E6r3 A5E6s3 51 A5 0 0 0 0 0 0 0 0 0 26 A5 7 11 8 7 8 7 5 6 4 69 A5 8 9 8 10 7 9 6 7 6 82 A5 1 4 3 4 4 1 3 0 5 56 A6 12 13 10 9 12 12 10 13 8 30 A6 12 10 8 6 10 15 11 13 8 53 A6 12 11 11 6 11 15 9 13 6 66 A6 12 14 10 8 13 13 10 13 8 18 A7 7 18 11 9 18 7 18 7 13 39 A7 10 16 7 8 16 11 18 10 11 45 A7 9 16 11 10 17 10 19 8 13 59 A7 9 17 7 9 16 12 18 9 12 68 A7 12 16 10 8 16 12 16 11 10 85 A7 9 17 9 11 16 10 17 9 14 70 A7 11 17 11 9 16 11 16 10 12 16 A9 12 13 9 8 14 12 16 12 12 16 A9 12 13 9 8 14 13 16 12 12 31 A9 12 13 9 11 14 13 16 12 14 33 A9 14 15 11 11 15 13 17 13 13 35 A9 14 14 12 9 15 15 16 14 12 52 A9 14 16 10 11 15 11 17 13 13 58 A9 14 14 9 9 14 14 17 14 12 67 A9 13 15 8 10 15 13 17 13 12 54 A 14 12 14 12 12 15 21 13 42 A1 13 10 10 11 10 15 19 13 13 32 A1 13 11 9 13 11 15 18 13 13 61 A3 11 19 13 9 20 14 18 12 13 72 A3 9 20 14 7 20 13 21 10 14 89 A3 16 18 12 8 18 19 21 16 13 86 A3 12 18 11 11 19 14 21 13 16 87 A3 13 18 12 11 19 15 21 14 16 84 A3 11 18 11 10 19 14 21 12 14 83 A3 13 18 15 9 19 17 21 13 15 71 A3 9 18 8 10 20 11 16 9 16 90 A3 11 18 11 7 19 15 17 12 15 57 A4 11 18 13 9 19 14 20 12 14 57 A4 12 18 13 8 19 14 20 12 14 7 A8 13 13 8 12 13 17 21 13 13 40 A8 14 12 9 10 12 20 21 14 12 91 A8 14 12 13 11 13 15 14 11 6 A10 12 11 10 12 11 15 19 13 16 6 A10 12 11 11 12 11 15 19 13 17 6 A10 12 11 10 12 11 15 19 13 17 11 Al0 10 12 11 12 12 13 20 11 17 44 Al0 10 9 15 10 10 13 16 11 13 55 Al0 10 8 15 10 9 13 16 11 13 74 A10 12 8 11 10 9 15 16 12 14 13 A10 10 11 14 9 11 12 16 11 12 34 A11 13 11 10 14 18 12 10 73 A11 10 11 12 13 18 10 9
TABLE-US-00037 TABLE 37 A5 Systems D & E: sequence aligment mismach evaluation Reference of sequence: HPV 56->ref|NC_001594.1| System D System E forward reverse forward reverse primer primer probe primer primer probe SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID NO: 9 NO: 14 NO: 24 NO: 10 NO: 15 NO: 24 NoHPV Group A5E6f4 A5E6r4 A5E6s4 A5E6f5 A5E6r5 A5E6s4 51 A5 0 0 0 0 0 0 26 A5 5 3 6 7 4 6 69 A5 6 3 7 7 5 7 82 A5 1 0 3 3 3 3 56 A6 6 5 13 7 6 13 30 A6 8 1 13 10 4 13 53 A6 8 3 12 8 6 12 66 A6 7 5 13 7 6 13 18 A7 15 3 11 13 8 11 39 A7 14 4 11 12 5 11 45 A7 15 4 12 13 6 12 59 A7 16 4 11 12 5 11 68 A7 15 4 11 13 8 11 85 A7 17 4 13 14 6 13 70 A7 14 4 13 12 7 13 16 A9 13 9 14 9 8 14 16 A9 13 9 14 9 8 14 31 A9 12 4 14 8 6 14 33 A9 13 6 15 9 7 15 35 A9 14 6 12 10 9 12 52 A9 12 4 13 7 6 13 58 A9 12 6 16 8 5 16 67 A9 13 6 17 9 7 17 54 A 18 2 11 14 11 42 A1 42 6 13 7 13 32 A1 12 6 13 8 13 61 A3 15 10 12 8 12 72 A3 16 12 10 9 10 89 A3 18 13 18 11 8 18 86 A3 17 10 14 7 14 87 A3 18 11 14 7 14 84 A3 17 13 13 8 13 83 A3 17 11 14 11 10 14 71 A3 17 15 11 6 11 90 A3 17 13 10 8 10 57 A4 17 14 11 10 11 57 A4 17 14 12 10 12 7 A8 24 3 11 7 11 40 A8 24 4 13 6 13 91 A8 18 1 14 10 14 6 A10 19 4 12 10 12 6 A10 20 4 12 10 12 6 A10 20 4 12 10 12 11 A10 19 4 10 9 10 44 A10 21 9 12 11 12 55 A10 21 9 12 11 12 74 A10 18 9 15 10 15 13 A10 32 6 12 10 12 34 A11 42 15 13 15 9 13 73 A11 42 15 10 14 9 10
TABLE-US-00038 TABLE 38 A6 Systems A to C: sequence aligment mismach evaluation Reference of sequence: HPV 56->ref|NC_001594.1| System A System B System C forward reverse forward reverse forward reverse primer primer probe primer primer probe primer primer probe SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID NO: 30 NO: 35 NO: 41 NO: 31 NO: 35 NO: 41 NO: 32 NO: 36 NO: 42 NoHPV Group A6E6f1 A6E6r1 A6E6s1 A6E6f2 A6E6r1 A6E6s1 A6E6f3 A6E6r2 A6E6s2 51 A5 9 7 17 8 7 17 3 14 9 26 A5 9 10 19 10 10 19 4 13 11 69 A5 10 11 16 10 11 16 5 11 11 82 A5 10 8 18 9 8 18 4 14 9 56 A6 0 0 0 0 0 0 0 0 0 30 A6 4 8 16 7 8 16 2 10 8 53 A6 5 7 14 7 7 14 2 10 8 66 A6 2 2 6 6 2 6 2 6 6 18 A7 14 7 21 14 7 21 8 22 15 39 A7 11 9 23 10 9 23 8 22 10 45 A7 13 8 22 15 8 22 8 22 16 59 A7 10 9 20 13 9 20 7 22 14 68 A7 12 9 25 11 9 25 9 22 11 85 A7 12 8 22 12 8 22 6 22 13 70 A7 13 8 23 9 8 23 8 22 10 16 A9 6 9 17 10 9 17 8 13 11 16 A9 6 9 17 10 9 17 8 13 11 31 A9 9 6 21 10 6 21 7 16 12 33 A9 8 10 16 11 10 16 6 16 11 35 A9 8 7 18 12 7 18 7 14 13 52 A9 7 10 23 11 10 23 9 14 11 58 A9 8 9 18 10 9 18 8 14 10 67 A9 8 9 23 9 9 23 7 15 9 54 A 10 10 30 14 10 30 8 18 16 42 A1 9 9 11 9 9 20 12 32 A1 10 5 9 5 9 20 11 61 A3 9 8 11 8 10 21 13 72 A3 10 8 13 8 9 21 15 89 A3 9 10 10 10 9 18 10 86 A3 11 10 9 10 10 18 9 87 A3 11 10 10 10 9 17 12 84 A3 9 9 10 9 9 18 12 83 A3 10 10 10 10 10 18 10 71 A3 10 12 9 12 6 18 9 90 A3 10 8 11 8 8 18 12 57 A4 8 10 10 10 8 18 12 57 A4 8 9 9 9 8 18 11 7 A8 6 7 11 7 6 18 13 40 A8 7 7 10 7 8 18 13 91 A8 10 8 12 8 11 19 14 6 A10 11 12 14 12 7 16 18 6 A10 11 12 14 12 7 16 17 6 Al0 11 12 14 12 7 16 18 11 A10 10 11 13 11 9 16 17 44 A10 10 12 11 12 9 17 14 55 A10 10 10 12 10 10 17 14 74 A10 9 11 12 11 8 16 14 13 A10 9 9 12 9 9 18 14 34 A11 9 7 25 6 7 25 6 15 7 73 A11 8 7 24 6 7 24 6 15 6
TABLE-US-00039 TABLE 39 A6 Systems D & E: sequence aligment mismach evaluation Reference of sequence: HPV 56->ref|NC_001594.1| System D System E forward reverse forward reverse primer primer probe primer primer probe SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID SEQ ID NO: 33 NO: 35 NO: 41 NO: 34 NO: 37 NO: 44 NoHPV Group A6E6f4 A6E6r1 A6E6s1 A6E6f5 A6E6r3 A6E6s3 51 A5 8 7 17 11 9 26 A5 10 10 19 8 9 69 A5 11 11 16 8 8 82 A5 10 8 18 9 9 56 A6 0 0 0 0 0 30 A6 5 8 16 6 1 53 A6 6 7 14 6 2 66 A6 3 2 6 3 0 18 A7 15 7 21 13 12 39 A7 12 9 23 10 13 45 A7 14 8 22 13 15 59 A7 12 9 20 10 15 68 A7 13 9 25 10 12 85 A7 14 8 22 10 12 70 A7 13 8 23 9 12 16 A9 6 9 17 9 16 A9 6 9 17 9 31 A9 9 6 21 9 33 A9 7 10 16 13 35 A9 8 7 18 14 52 A9 6 10 23 15 58 A9 7 9 18 14 67 A9 7 9 23 12 54 A 10 10 30 13 42 A1 10 9 13 32 A1 10 5 14 61 A3 10 8 11 13 72 A3 11 8 14 14 89 A3 10 10 11 12 86 A3 12 10 13 15 87 A3 12 10 14 13 84 A3 10 9 13 13 83 A3 11 10 16 14 71 A3 10 12 14 16 90 A3 10 8 13 13 57 A4 9 10 12 57 A4 9 9 12 7 A8 7 7 12 14 40 A8 8 7 8 14 91 A8 11 8 14 14 6 A10 12 12 14 6 A10 12 12 14 6 A10 12 12 14 11 A10 11 11 14 44 A10 11 12 13 55 A10 11 10 13 74 A10 10 11 12 13 A10 8 9 14 34 A11 10 7 25 13 73 A11 10 7 24 12
TABLE-US-00040 TABLE 40 A7 Systems A & B: sequence alignment mismach evaluation Reference of sequence: HPV 18->gi|9626069|ref|NC_001357.1| System A SEQ forward reverse ID primer primer probes No NO: 68 69 70 79 80 81 102 103 104 105 106 HPV Group 6f1a 6f2a 6f3a 6r1b 6r2b 6r3b A7E1ZAS61f A7E1ZAS63f A7E1ZAS64f A7E1ZCS40f A7E1ZBS74f 51 A5 4 5 4 7 5 5 5 5 4 4 9 26 A5 7 5 4 7 7 7 4 3 4 3 8 69 A5 5 6 6 7 7 6 4 3 4 3 8 82 A5 3 4 3 7 7 7 6 6 5 5 10 56 A6 5 5 3 5 8 9 5 6 7 6 9 30 A6 8 6 4 7 8 7 4 3 3 3 13 53 A6 8 4 6 6 7 8 6 6 4 5 10 66 A6 5 5 3 5 10 8 5 6 7 6 11 18 A7 0 2 2 1 5 6 0 3 4 1 4 39 A7 4 1 3 3 0 4 4 4 0 3 1 45 A7 2 0 2 1 3 6 1 2 3 0 6 59 A7 3 2 0 6 4 0 3 0 4 2 5 68 A7 1 2 2 4 1 3 2 2 2 1 0 85 A7 1 3 3 5 2 4 5 3 3 4 3 70 A7 3 5 3 5 2 2 6 4 4 5 2 16 A9 2 2 4 5 7 5 7 4 7 6 9 16 A9 3 3 3 5 7 5 7 4 7 6 9 31 A9 3 5 2 6 7 6 8 5 7 7 10 33 A9 4 5 3 5 3 5 7 4 5 6 7 35 A9 4 5 3 6 7 5 5 3 5 4 10 52 A9 4 3 3 5 5 6 5 3 3 4 9 58 A9 3 5 3 6 4 4 5 2 4 4 8 67 A9 2 4 2 5 4 5 5 3 4 4 6 54 A 7 9 8 10 9 9 9 9 9 9 10 42 A1 3 7 5 4 6 6 7 4 4 6 12 32 A1 4 6 6 7 7 7 7 4 5 6 12 61 A3 6 11 9 10 9 12 6 5 7 5 13 72 A3 4 10 7 11 9 13 5 5 6 6 13 89 A3 4 10 7 9 10 13 6 4 5 5 13 86 A3 9 9 9 10 9 12 6 6 7 7 12 87 A3 8 9 8 11 9 11 8 6 5 7 12 84 A3 5 9 7 12 12 14 5 4 6 4 12 83 A3 6 11 10 10 10 10 7 8 7 9 12 71 A3 10 13 12 8 6 7 6 5 7 5 13 90 A3 7 8 7 8 7 7 7 6 8 6 13 57 A4 10 12 11 7 9 12 6 9 8 7 14 57 A4 10 12 11 18 20 21 6 9 8 7 14 7 A8 6 9 7 9 9 8 5 3 4 4 14 40 A8 6 10 7 8 10 10 6 5 6 6 15 91 A8 7 8 8 9 10 9 7 5 5 6 15 6 A10 4 6 7 9 8 9 7 6 6 6 11 6 A10 4 6 7 9 8 9 7 6 6 6 11 6 A10 4 6 7 9 8 9 7 6 6 6 12 11 A10 4 8 7 6 9 12 6 6 3 5 10 44 A10 5 6 7 8 11 8 6 5 4 5 12 55 A10 6 7 8 9 11 9 6 5 4 5 12 74 A10 8 10 11 8 12 10 6 5 4 5 10 13 A10 4 5 5 9 9 9 4 6 3 5 9 34 A11 6 6 7 8 8 9 7 5 6 6 10 73 A11 4 4 6 9 6 10 7 5 6 6 6 System B SEQ forward reverse ID primer primer probes No NO: 71 72 73 82 83 107 106 108 109 110 HPV Group 15f1a 15f2a 15f3d 15r1a 15r2b A7E1ZBS26f A7E1ZBS74f A7E1ZBS79f A7E1ZBS80f A7E1ZBS27f 51 A5 4 5 6 5 3 6 9 8 8 6 26 A5 7 5 8 4 3 7 8 9 9 7 69 A5 5 6 8 4 3 6 8 8 8 7 82 A5 3 4 6 6 4 7 10 5 5 9 56 A6 5 5 9 5 6 7 9 10 10 7 30 A6 8 5 11 4 3 8 13 10 10 10 53 A6 8 7 7 6 4 10 10 10 10 10 66 A6 5 5 9 5 6 8 11 12 12 8 18 A7 0 3 4 0 2 0 4 6 6 2 39 A7 4 5 0 4 2 8 1 4 4 8 45 A7 2 3 2 1 1 1 6 8 8 0 59 A7 3 0 5 2 2 5 5 0 0 7 68 A7 1 3 4 2 0 6 0 5 5 6 85 A7 1 4 4 4 3 7 3 6 6 7 70 A7 3 3 6 5 4 8 2 5 5 8 16 A9 2 5 4 6 6 7 9 9 9 7 16 A9 3 4 5 6 6 7 9 9 9 7 31 A9 3 1 6 7 7 7 10 10 10 8 33 A9 4 4 7 6 6 8 7 8 8 8 35 A9 4 5 8 4 3 9 10 8 8 10 52 A9 4 4 5 4 3 7 9 8 8 8 58 A9 3 4 7 4 4 9 8 9 9 9 67 A9 2 3 6 4 3 7 6 7 7 7 54 A 9 6 8 8 9 6 10 9 9 8 42 A1 5 5 6 6 6 7 12 11 11 9 32 A1 6 6 5 6 6 7 12 10 10 8 61 A3 8 6 8 5 6 11 13 13 13 12 72 A3 6 5 8 4 5 13 13 11 11 14 89 A3 6 5 8 5 4 10 13 11 11 12 86 A3 11 6 8 5 6 12 12 12 12 13 87 A3 10 5 9 7 6 10 12 12 12 11 84 A3 7 4 7 4 5 9 12 12 12 10 83 A3 8 6 7 6 8 10 12 13 13 12 71 A3 12 10 11 5 6 8 13 10 10 10 90 A3 9 6 8 6 7 8 13 10 10 10 57 A4 12 8 11 6 8 11 14 12 12 12 57 A4 12 8 11 6 8 11 14 12 12 12 7 A8 8 6 9 4 3 12 14 12 12 13 40 A8 8 6 9 5 5 11 15 10 10 12 91 A8 9 8 9 6 5 10 15 12 12 11 6 A10 6 7 3 7 6 8 11 11 11 8 6 A10 6 7 3 7 6 8 11 11 11 8 6 A10 6 7 3 7 6 8 12 11 11 8 11 A10 6 6 6 6 4 9 10 11 11 9 44 A10 7 6 5 6 5 8 12 11 11 10 55 A10 8 7 6 6 5 9 12 11 11 11 74 A10 10 10 8 6 5 9 10 12 12 9 13 A10 6 5 5 4 4 9 9 10 10 9 34 A11 6 6 8 6 5 10 10 10 10 10 73 A11 4 7 6 6 5 8 6 7 7 8
TABLE-US-00041 TABLE 41 A7 Systems C & D: sequence aligment mismach evaluation Reference of sequence: HPV 18 ->gi|9626069|ref|NC_001357.1| System C System D SEQ ID forward primer reverse primer probes forward primer NO: 74 75 76 84 85 111 105 112 113 114 77 78 NoHPV Group A7E17f1 A7E17f2 A7E1f3 A7E17r1 A7E17r2 A7E1ZCS11f A7E1ZCS40f A7E1ZCS45f A7E1ZCS63f A7E1ZCS90f A7E12f1 A7E12f2 51 A5 7 7 10 5 5 4 4 4 5 6 8 7 26 A5 7 8 9 5 7 3 3 4 3 4 9 7 69 A5 7 6 9 5 8 3 3 4 3 4 8 6 82 A5 7 6 9 7 7 5 5 5 6 7 8 6 56 A6 8 7 9 6 9 6 6 7 6 5 6 5 30 A6 9 8 12 6 7 3 3 3 3 3 6 6 53 A6 11 8 10 5 8 5 5 4 6 5 6 6 66 A6 9 10 11 5 9 6 6 7 6 5 6 5 18 A7 0 6 5 1 6 1 1 4 3 3 1 5 39 A7 8 2 1 3 2 3 3 0 4 4 3 1 45 A7 2 7 7 1 4 0 0 3 2 3 2 6 59 A7 5 2 5 4 2 2 2 4 0 2 3 4 68 A7 6 2 0 4 1 1 1 2 2 0 5 1 85 A7 7 3 3 5 2 4 4 3 3 4 3 3 70 A7 8 4 2 3 2 5 5 4 4 4 5 1 16 A9 7 7 10 3 6 6 6 7 4 6 6 10 16 A9 7 7 10 3 6 6 6 7 4 6 6 10 31 A9 7 10 11 4 7 7 7 7 5 6 3 5 33 A9 8 8 8 5 3 6 6 5 4 4 3 3 35 A9 9 5 10 4 6 4 4 5 3 4 4 7 52 A9 8 8 10 6 5 4 4 3 3 4 5 5 58 A9 9 9 9 5 3 4 4 4 2 4 5 6 67 A9 7 7 7 4 4 4 4 4 3 3 4 6 54 A 7 8 11 9 9 9 9 9 9 10 6 8 42 A1 8 8 13 4 6 6 6 4 4 6 8 10 32 A1 8 9 13 5 7 6 6 5 4 4 8 10 61 A3 11 14 14 10 11 5 5 7 5 3 16 13 72 A3 13 11 13 11 12 6 6 6 5 4 16 13 89 A3 10 9 12 9 12 5 5 5 4 4 16 14 86 A3 12 8 12 10 11 7 7 7 6 4 17 18 87 A3 10 8 13 11 10 7 7 5 6 4 18 19 84 A3 10 11 13 12 13 4 4 6 4 3 15 17 83 A3 10 10 13 10 10 9 9 7 8 9 17 18 71 A3 8 8 13 7 6 5 5 7 5 5 16 16 90 A3 8 8 13 7 6 6 6 8 6 6 17 16 57 A4 11 11 14 8 11 7 7 8 9 8 15 16 57 A4 11 11 14 8 11 7 7 8 9 8 15 16 7 A8 12 14 15 8 8 4 4 4 3 5 8 9 40 A8 11 9 14 8 9 6 6 6 5 7 7 9 91 A8 11 12 15 8 9 6 6 5 5 6 5 8 6 A10 9 9 12 9 8 6 6 6 6 7 8 10 6 A10 9 9 12 9 8 6 6 6 6 7 8 10 6 A10 9 9 12 9 8 6 6 6 6 7 8 10 11 A10 9 9 11 8 11 5 5 3 6 7 8 10 44 A10 9 8 13 8 9 5 5 4 5 6 11 13 55 A10 9 9 13 8 10 5 5 4 5 6 11 13 74 A10 10 9 11 7 11 5 5 4 5 6 11 13 13 A10 10 9 10 10 8 5 5 3 6 6 10 11 34 A11 11 7 9 9 8 6 6 6 5 5 12 16 73 A11 8 5 6 8 9 6 6 6 5 5 12 16 System D SEQ ID reverse primer probes NO: 86 87 115 116 117 118 119 120 121 NoHPV Group A7E12r2 A7E12r3 A7E1ZDS36f A7E1ZDS37f A7E1ZDS38f A7E1ZDS2f A7E1ZDS3f A7E1ZDS4f A7E1ZDS11f 51 A5 2 4 4 6 4 4 3 3 3 26 A5 8 7 8 6 8 7 6 6 6 69 A5 9 8 7 7 7 6 6 6 6 82 A5 4 5 9 7 7 7 6 6 6 56 A6 8 11 9 9 6 8 8 8 8 30 A6 8 9 12 9 9 10 8 8 8 53 A6 11 12 12 11 9 10 11 11 11 66 A6 9 9 8 8 7 7 8 8 8 18 A7 3 0 6 0 5 3 5 5 5 39 A7 1 1 8 6 3 3 7 7 7 45 A7 2 2 0 6 5 5 0 0 0 59 A7 2 1 7 7 2 4 5 5 5 68 A7 1 3 5 3 2 0 4 4 4 85 A7 5 6 6 6 2 4 5 5 5 70 A7 2 1 7 7 4 4 6 6 6 16 A9 5 5 7 5 4 6 4 4 4 16 A9 5 5 6 6 5 7 3 3 3 31 A9 7 9 6 6 6 6 5 5 5 33 A9 3 7 8 8 8 8 6 6 6 35 A9 4 6 3 3 3 3 3 52 A9 1 6 8 7 7 8 7 7 7 58 A9 4 8 8 7 9 9 6 6 6 67 A9 2 5 7 7 6 5 6 6 6 54 A 6 9 4 6 3 3 3 3 3 42 A1 4 7 7 6 6 6 5 5 5 32 A1 2 6 6 7 6 6 5 5 5 61 A3 9 7 12 12 12 11 11 11 11 72 A3 9 10 12 11 9 9 11 11 11 89 A3 13 14 12 11 10 10 10 10 10 86 A3 9 7 11 11 11 10 10 10 10 87 A3 11 11 13 13 13 12 12 12 12 84 A3 10 8 11 11 10 9 10 10 10 83 A3 11 10 11 12 11 10 11 11 11 71 A3 9 10 9 8 9 8 9 9 9 90 A3 11 12 12 10 13 11 12 12 12 57 A4 10 7 11 11 13 12 10 10 10 57 A4 11 8 11 11 13 12 10 10 10 7 A8 8 11 11 10 8 9 7 7 7 40 A8 9 13 11 10 10 9 8 8 8 91 A8 10 12 9 9 9 10 7 7 7 6 A10 5 10 8 7 7 6 6 6 6 6 A10 5 10 8 7 7 6 6 6 6 6 A10 5 10 8 7 7 6 6 6 6 11 A10 6 10 8 8 7 6 6 6 6 44 A10 5 12 11 10 8 9 9 9 9 55 A10 6 12 9 10 8 9 6 6 6 74 A10 3 9 8 9 8 7 7 7 7 13 A10 4 9 11 10 8 9 8 8 8 34 A11 8 10 9 7 8 7 7 7 7 73 A11 6 9 8 6 7 6 6 6 6
TABLE-US-00042 TABLE 42 A9 System C: sequence aligment mismach evaluation Reference of sequence: HPV 16->gi|9627100|ref|NC_001526.1| forward reverse primer primer probes 211 212 213 214 215 216 217 240 241 283 284 285 NoHPV Group A9E1f7 A9E1f8 A9E1f9 A9E1f10 A9E1f11 A9E1f12 A9E1f13 A9E1r5 A9E1r6 A9E1S1 A9E1S1 A9E1S1 51 A5 5 6 7 5 5 6 6 2 6 4 4 4 26 A5 5 6 7 5 5 6 6 3 5 6 6 6 69 A5 5 6 7 5 5 6 6 3 5 6 6 6 82 A5 5 6 7 5 5 6 6 2 6 4 4 4 56 A6 1 2 3 1 3 2 4 3 5 3 3 3 30 A6 3 4 5 3 3 4 4 4 6 3 3 5 53 A6 3 4 5 3 3 4 4 4 6 2 2 4 66 A6 2 3 4 2 4 3 5 4 6 3 3 3 18 A7 3 4 5 3 3 4 4 7 4 9 9 9 39 A7 6 5 6 5 4 5 5 2 4 9 9 9 45 A7 3 4 5 3 3 4 4 4 4 9 9 9 59 A7 3 2 3 1 1 2 2 5 7 9 9 9 68 A7 13 12 13 11 13 12 14 16 17 17 17 17 85 A7 2 3 4 2 2 3 3 3 5 5 5 5 70 A7 7 6 5 5 5 4 4 4 4 9 9 9 16 A9 0 1 2 2 2 3 3 0 5 1 1 3 16 A9 0 1 2 2 2 3 3 0 5 1 1 3 31 A9 2 1 2 0 1 1 3 0 5 1 1 1 33 A9 4 3 2 2 3 1 1 6 1 1 1 3 35 A9 2 1 2 0 2 1 3 1 6 3 3 1 52 A9 4 3 2 2 2 1 1 6 1 0 0 2 58 A9 4 3 2 4 2 3 1 6 1 0 0 2 67 A9 5 4 3 3 3 2 2 6 1 1 1 3 54 A 9 10 11 10 9 11 10 3 7 9 9 11 42 A1 6 7 8 6 6 7 7 5 7 3 3 5 32 A1 6 7 8 6 6 7 7 5 7 4 4 6 61 A3 12 13 14 12 12 13 13 4 6 9 9 11 72 A3 12 13 14 12 12 13 13 4 6 9 9 11 89 A3 9 10 11 9 9 10 10 4 6 8 8 10 86 A3 7 8 9 7 7 8 8 3 5 9 9 11 87 A3 7 8 9 7 7 8 8 3 5 11 11 13 84 A3 8 9 10 8 8 9 9 4 6 11 11 13 83 A3 9 10 11 9 9 10 10 4 6 9 9 11 71 A3 9 10 11 9 9 10 10 4 6 7 7 9 90 A3 9 10 11 9 9 10 10 4 6 6 6 8 57 A4 8 9 10 8 8 9 9 4 6 4 4 6 57 A4 8 9 10 8 8 9 9 4 6 4 4 6 7 A8 9 10 11 9 9 10 10 7 11 7 7 9 40 A8 10 11 12 10 10 11 11 7 11 9 9 11 91 A8 12 13 14 12 12 13 13 6 10 9 9 9 6 A10 11 12 13 11 11 12 12 5 7 5 5 7 6 A10 11 12 13 11 11 12 12 5 7 5 5 7 6 A10 11 12 13 11 11 12 12 5 7 6 6 8 11 A10 10 11 12 10 10 11 11 5 7 5 5 7 44 A10 12 13 14 12 12 13 13 5 9 6 6 8 55 A10 13 14 15 13 13 14 14 5 9 7 7 9 74 A10 13 14 15 13 13 14 14 5 9 6 6 8 13 A10 12 13 14 12 12 13 13 6 8 7 7 9 34 A11 6 7 6 6 6 7 5 3 6 3 3 5 73 A11 7 8 7 7 7 8 6 3 6 3 3 5 probes 286 287 288 289 290 291 292 293 294 295 NoHPV Group A9E1S1 A9E1S12 A9E1S12a A9E1S12b A9E1S1 A9E1S1 A9E1S13c A9E1S1 A9E1S1 A9E1S1 51 A5 4 4 4 4 3 3 3 3 4 4 26 A5 6 6 6 6 5 5 5 4 6 6 69 A5 6 6 6 6 5 5 5 4 6 6 82 A5 4 4 4 4 3 3 3 3 4 4 56 A6 3 4 4 4 3 3 3 1 4 4 30 A6 5 6 6 6 5 5 5 3 6 6 53 A6 4 5 5 5 4 4 4 2 5 5 66 A6 3 4 4 4 3 3 3 1 4 4 18 A7 9 10 10 10 10 10 10 9 11 11 39 A7 9 10 10 10 9 9 9 9 10 10 45 A7 9 10 10 10 13 13 13 11 13 13 59 A7 9 8 8 8 8 8 8 9 9 9 68 A7 17 17 17 17 20 20 20 18 22 22 85 A7 5 4 4 4 7 7 7 8 7 7 70 A7 9 10 10 10 8 3 8 8 9 9 16 A9 3 4 4 4 3 3 3 1 4 4 16 A9 3 4 4 4 3 3 3 1 4 4 31 A9 1 2 2 2 1 1 1 0 2 2 33 A9 3 4 4 4 4 4 4 3 4 4 35 A9 1 0 0 0 1 1 1 2 0 0 52 A9 2 3 3 3 3 3 3 2 3 3 58 A9 2 3 3 3 3 3 3 2 3 3 67 A9 3 4 4 4 4 4 4 3 4 4 54 A 11 11 11 11 12 12 12 11 13 13 42 A1 5 6 6 6 5 5 5 4 7 7 32 A1 6 6 6 6 5 5 5 5 7 7 61 A3 11 11 11 11 20 20 20 20 20 20 72 A3 11 10 10 10 19 19 19 19 19 19 89 A3 10 10 10 10 20 20 20 19 20 20 86 A3 11 11 11 11 21 21 21 19 22 22 87 A3 13 13 13 13 18 18 18 16 18 18 84 A3 13 13 13 13 18 18 18 17 19 19 83 A3 11 11 11 11 19 19 19 18 19 19 71 A3 9 10 10 10 13 13 13 11 14 14 90 A3 8 9 9 9 12 12 12 10 13 13 57 A4 6 7 7 7 11 11 11 10 13 13 57 A4 6 7 7 7 11 11 11 10 13 13 7 A8 9 9 9 9 8 8 8 8 10 10 40 A8 11 11 11 11 10 10 10 9 12 12 91 A8 9 9 9 9 8 8 8 8 10 10 6 A10 7 7 7 7 8 8 8 8 9 9 6 A10 7 7 7 7 8 8 8 8 9 9 6 A10 8 8 8 8 9 9 9 8 10 10 11 A10 7 7 7 7 8 8 8 8 9 9 44 A10 8 8 8 8 7 7 7 7 9 9 55 A10 9 9 9 9 8 8 8 7 10 10 74 A10 8 8 8 8 7 7 7 7 9 9 13 A10 9 9 9 9 8 8 8 7 10 10 34 A11 5 4 4 4 3 3 3 3 4 4 73 A11 5 4 4 4 3 3 3 3 4 4 indicates data missing or illegible when filed
TABLE-US-00043 TABLE 43 A9 System E1: sequence aligment mismach evaluation Reference of sequence: HPV 16->gi||ref|NC_001526.1| forward primer reverse primer probes SEQ ID NO: 218 219 220 242 243 244 245 246 247 296 NoHPV Group A9E2f1 A9E2f2 A9E2f4 A9E2r1 A9E2r2 A9E2r3 A9E2r4 A9E2r13 A9E2r14 A9E2Z7S1 51 A5 10 9 10 8 9 9 7 13 12 6 26 A5 11 13 11 9 6 6 9 10 15 5 69 A5 11 13 11 8 7 6 8 11 13 3 82 A5 9 9 10 8 7 5 5 12 14 3 56 A6 6 10 9 8 6 6 6 10 14 8 30 A6 6 7 9 8 8 8 10 13 14 6 53 A6 6 7 7 7 3 4 5 12 13 7 66 A6 8 11 9 7 6 6 7 9 11 9 18 A7 4 9 7 9 5 6 7 10 11 7 39 A7 4 9 7 7 4 5 6 12 10 8 45 A7 4 9 7 11 10 10 9 9 12 6 59 A7 4 9 8 7 4 5 8 9 10 6 68 A7 4 9 7 7 4 5 6 12 10 8 85 A7 5 8 9 8 4 5 5 9 10 7 70 A7 4 7 8 7 3 4 5 10 10 8 16 A9 0 8 8 0 5 6 8 9 11 0 16 A9 0 8 8 2 4 5 8 10 10 1 31 A9 7 10 3 8 9 9 10 0 10 2 33 A9 7 1 8 9 8 7 2 12 12 5 35 A9 3 9 6 6 8 9 9 11 0 8 52 A9 8 9 3 5 0 1 6 13 12 5 58 A9 9 2 10 8 3 2 3 10 8 5 67 A9 6 4 6 7 2 1 4 9 12 5 54 A 4 7 8 8 5 6 9 10 10 6 42 A1 9 11 11 9 7 8 7 12 13 5 32 A1 8 13 10 8 8 7 7 13 12 6 61 A3 7 10 8 8 6 7 9 13 15 6 72 A3 7 7 8 10 9 10 12 15 16 5 89 A3 5 7 6 8 8 8 11 13 12 6 86 A3 10 7 11 10 8 6 9 13 16 7 87 A3 9 5 12 10 8 7 10 15 15 7 84 A3 9 7 10 11 11 9 11 11 14 8 83 A3 9 10 9 7 10 10 9 11 11 7 71 A3 7 7 8 9 9 9 12 16 15 7 90 A3 9 10 9 12 13 11 11 13 13 9 57 A4 13 10 11 9 10 9 12 14 12 8 57 A4 13 8 11 9 10 9 12 15 13 8 7 A8 7 10 7 8 8 8 9 12 11 10 40 A8 8 11 5 9 11 10 9 12 11 10 91 A8 5 7 11 10 10 9 9 9 9 5 6 A10 8 9 9 9 6 5 8 11 11 8 6 A10 8 9 9 9 6 5 8 11 11 8 6 A10 8 9 9 9 6 5 8 11 11 8 11 A10 8 9 10 6 4 5 9 11 12 7 44 A10 8 9 10 6 6 5 5 13 13 5 55 A10 8 9 10 4 6 5 7 11 11 5 74 A10 9 9 11 8 5 4 5 12 12 4 13 A10 8 8 9 9 6 6 6 9 10 4 34 A11 9 7 9 8 7 8 9 11 16 6 73 A11 10 6 10 7 7 7 7 13 12 7 probes SEQ ID NO: 297 298 299 300 301 302 303 NoHPV Group A9E2Z7S2 A9E2Z7S2a A9E2Z7S2b A9E2Z7S3 A9E2Z7S3a A9E2Z7S4 A9E2Z7S4a 51 A5 5 5 5 9 9 6 6 26 A5 3 3 3 6 6 4 4 69 A5 3 3 3 7 7 3 3 82 A5 3 3 3 7 7 3 3 56 A6 7 7 7 9 9 7 7 30 A6 6 6 6 9 9 7 7 53 A6 5 5 5 10 10 8 8 66 A6 8 8 8 10 10 8 8 18 A7 1 1 1 8 8 6 6 39 A7 4 4 4 8 8 6 6 45 A7 3 3 3 10 10 6 6 59 A7 3 3 3 7 7 5 5 68 A7 4 4 4 8 8 6 6 85 A7 6 6 6 10 10 5 5 70 A7 5 5 5 8 8 6 6 16 A9 6 6 6 8 8 4 4 16 A9 5 5 5 9 9 5 5 31 A9 4 4 4 6 6 1 1 33 A9 1 1 1 9 9 7 7 35 A9 8 8 8 0 0 6 6 52 A9 3 3 3 7 7 2 2 58 A9 1 1 1 7 7 5 5 67 A9 1 1 1 7 7 4 4 54 A 8 8 8 8 8 5 5 42 A1 6 6 6 8 8 4 4 32 A1 6 6 6 9 9 5 5 61 A3 6 6 6 7 7 5 5 72 A3 8 8 8 7 7 5 5 89 A3 6 6 6 8 8 7 7 86 A3 9 9 9 8 8 9 9 87 A3 8 8 8 7 7 8 8 84 A3 9 9 9 8 8 10 10 83 A3 8 8 8 9 9 8 8 71 A3 7 7 7 9 9 7 7 90 A3 8 8 8 9 9 9 9 57 A4 6 6 6 9 9 8 8 57 A4 6 6 6 9 9 8 8 7 A8 9 9 9 3 3 8 8 40 A8 9 9 9 4 4 9 9 91 A8 5 5 5 3 3 5 5 6 A10 7 7 7 11 11 8 8 6 A10 7 7 7 11 11 8 8 6 A10 7 7 7 11 11 8 8 11 A10 9 9 9 10 10 8 8 44 A10 9 9 9 7 7 8 8 55 A10 9 9 9 7 7 8 8 74 A10 7 7 7 8 8 6 6 13 A10 7 7 7 6 6 4 4 34 A11 6 6 6 7 7 5 5 73 A11 6 6 6 8 8 6 6
TABLE-US-00044 TABLE 44 A9 System E2: sequence aligment mismach evaluation Reference of sequence: HPV 16->gi||ref|NC_001526.1| forward primer reverse primer probes SEQ ID NO: 221 222 223 242 243 244 245 246 247 296 NoHPV Group A9E2f1a A9E2f2a A9E2f4a A9E2r1 A9E2r2 A9E2r3 A9E2r4 A9E2r13 A9E2r14 A9E2Z7S1 51 A5 11 9 11 8 9 9 7 13 12 6 26 A5 13 14 11 9 6 6 9 10 15 5 69 A5 12 13 12 8 7 6 8 11 13 3 82 A5 10 9 11 8 7 5 5 12 14 3 56 A6 7 10 10 8 6 6 6 10 14 8 30 A6 7 7 10 8 8 8 10 13 14 6 53 A6 7 7 8 7 3 4 5 12 13 7 66 A6 9 11 10 7 6 6 7 9 11 9 18 A7 5 9 8 9 5 6 7 10 11 7 39 A7 5 9 8 7 4 5 6 12 10 8 45 A7 6 10 7 11 10 10 9 9 12 6 59 A7 6 10 8 7 4 5 8 9 10 6 68 A7 7 4 5 6 12 10 8 85 A7 7 9 9 8 4 5 5 9 10 7 70 A7 5 7 9 7 3 4 5 10 10 8 16 A9 1 8 9 0 5 6 8 9 11 0 16 A9 1 8 9 2 4 5 8 10 10 1 31 A9 7 11 3 8 9 9 10 0 10 2 33 A9 8 1 9 9 8 7 2 12 12 5 35 A9 2 9 7 6 8 9 9 11 0 8 52 A9 9 10 3 5 0 1 6 13 12 5 58 A9 10 2 11 8 3 2 3 10 8 5 67 A9 7 4 7 7 2 1 4 9 12 5 54 A 6 8 8 8 5 6 9 10 10 6 42 A1 10 11 12 9 7 8 7 12 13 5 32 A1 10 14 10 8 8 7 7 13 12 6 61 A3 9 11 8 8 6 7 9 13 15 6 72 A3 8 7 9 10 9 10 12 15 16 5 89 A3 7 8 6 8 8 8 11 13 12 6 86 A3 12 8 11 10 8 8 9 13 16 7 87 A3 11 6 12 10 8 7 10 15 15 7 84 A3 11 8 10 11 11 9 11 11 14 8 83 A3 11 11 9 7 10 10 9 11 11 7 71 A3 9 8 8 9 9 9 12 16 15 7 90 A3 11 11 9 12 13 11 11 13 13 9 57 A4 15 11 11 9 10 9 12 14 12 8 57 A4 15 9 11 9 10 9 12 15 13 8 7 A8 9 11 8 8 8 8 9 12 11 10 40 A8 8 12 6 9 11 10 9 12 11 10 91 A8 7 8 12 10 10 9 9 9 9 5 6 A10 8 10 10 9 6 5 8 11 11 8 6 A10 8 10 10 9 6 5 8 11 11 8 6 A10 3 10 10 9 6 5 8 11 11 8 11 A10 8 10 11 6 4 5 9 11 12 7 44 A10 8 10 11 6 6 5 5 13 13 5 55 A10 8 10 11 4 6 5 7 11 11 5 74 A10 10 10 12 8 5 4 5 12 12 4 13 A10 8 9 10 9 6 6 6 9 10 4 34 A11 10 7 10 8 7 8 9 11 16 6 73 A11 11 6 11 7 7 7 7 13 12 7 probes SEQ ID NO: 297 298 299 300 301 302 303 NoHPV Group A9E2Z7S2 A9E2Z7S2a A9E2Z7S2b A9E2Z7S3 A9E2Z7S3a A9E2Z7S4 A9E2Z7S4a 51 A5 5 5 5 9 9 6 6 26 A5 3 3 3 6 6 4 4 69 A5 3 3 3 7 7 3 3 82 A5 3 3 3 7 7 3 3 56 A6 7 7 7 9 9 7 7 30 A6 6 6 6 9 9 7 7 53 A6 5 5 5 10 10 8 8 66 A6 8 8 8 10 10 8 8 18 A7 1 1 1 8 8 6 6 39 A7 4 4 4 8 8 6 6 45 A7 3 3 3 10 10 6 6 59 A7 3 3 3 7 7 5 5 68 A7 4 4 4 8 8 6 6 85 A7 6 6 6 10 10 5 5 70 A7 5 5 5 8 8 6 6 16 A9 6 6 6 8 8 4 4 16 A9 5 5 5 9 9 5 5 31 A9 4 4 4 6 6 1 1 33 A9 1 1 1 9 9 7 7 35 A9 8 8 8 0 0 6 6 52 A9 3 3 3 7 7 2 2 58 A9 1 1 1 7 7 5 5 67 A9 1 1 1 7 7 4 4 54 A 8 8 8 8 8 5 5 42 A1 6 6 6 8 8 4 4 32 A1 6 6 6 9 9 5 5 61 A3 6 6 6 7 7 5 5 72 A3 8 8 8 7 7 5 5 89 A3 6 6 6 8 8 7 7 86 A3 9 9 9 8 8 9 9 87 A3 8 8 8 7 7 8 8 84 A3 9 9 9 8 8 10 10 83 A3 8 8 8 9 9 8 8 71 A3 7 7 7 9 9 7 7 90 A3 8 8 8 9 9 9 9 57 A4 6 6 6 9 9 8 8 57 A4 6 6 6 9 9 8 8 7 A8 9 9 9 3 3 8 8 40 A8 9 9 9 4 4 9 9 91 A8 5 5 5 3 3 5 5 6 A10 7 7 7 11 11 8 8 6 A10 7 7 7 11 11 8 8 6 A10 7 7 7 11 11 8 8 11 A10 9 9 9 10 10 8 8 44 A10 9 9 9 7 7 8 8 55 A10 9 9 9 7 7 8 8 74 A10 7 7 7 8 8 6 6 13 A10 7 7 7 6 6 4 4 34 A11 6 6 6 7 7 5 5 73 A11 6 6 6 8 8 6 6
TABLE-US-00045 TABLE 45 A9 System E3: sequence aligment mismach evaluation Reference of sequence: HPV 16->gi||ref|NC_001526.1| forward primer reverse primer SEQ ID NO: 254 221 222 223 248 249 250 251 252 253 A9E- NoHPV Group A9E2f1a A9E2f2a A9E2f4a A9E21r1cz A9E21r2az A9E21r3az A9E21r4fz A9E21r5az A9E21r6az 21r7az 51 A5 11 9 11 8 10 7 9 9 9 8 26 A5 13 14 11 9 7 11 13 7 6 6 69 A5 12 13 12 8 9 10 12 6 6 6 82 A5 10 9 11 8 10 5 12 6 5 6 56 A6 7 10 10 8 8 8 14 6 6 6 30 A6 7 7 10 8 11 12 14 9 8 8 53 A6 7 7 8 7 10 7 11 5 4 3 66 A6 9 11 10 7 8 9 11 6 6 6 18 A7 5 9 8 9 8 9 11 7 6 5 39 A7 5 9 8 7 9 8 8 6 5 4 45 A7 6 10 7 11 10 10 12 10 10 10 59 A7 6 10 8 7 8 10 9 6 5 4 68 A7 85 A7 7 9 9 8 8 7 8 6 5 4 70 A7 5 7 9 7 9 7 9 5 4 3 16 A9 1 8 9 0 8 9 10 7 6 5 16 A9 1 8 9 2 9 9 9 6 5 4 31 A9 7 11 3 8 0 12 11 10 9 9 33 A9 8 1 9 9 12 0 11 6 7 8 35 A9 2 9 7 6 8 9 0 10 9 8 52 A9 9 10 3 5 9 8 13 2 1 0 58 A9 10 2 11 8 9 5 11 1 2 3 67 A9 7 4 7 7 8 6 12 2 1 2 54 A 6 8 8 8 9 9 10 7 6 5 42 A1 10 11 12 9 8 9 12 7 8 7 32 A1 10 14 10 8 9 7 10 8 7 8 61 A3 9 11 8 8 10 9 13 8 7 6 72 A3 8 7 9 10 11 12 15 11 10 9 89 A3 7 8 6 8 10 11 11 9 8 7 86 A3 12 8 11 10 9 9 16 7 6 7 87 A3 11 6 12 10 9 10 16 8 7 8 84 A3 11 8 10 10 12 12 15 11 10 11 83 A3 11 11 9 7 10 9 10 9 10 9 71 A3 9 8 8 9 12 12 13 10 9 8 90 A3 11 11 9 12 11 12 12 12 12 12 57 A4 15 11 11 9 12 13 13 11 10 9 57 A4 15 9 11 9 12 13 14 11 10 9 7 A8 9 11 8 8 12 9 12 9 8 7 40 A8 8 12 6 9 12 10 12 12 11 11 91 A8 7 8 12 10 8 9 10 9 9 10 6 A10 8 10 10 9 10 8 11 6 5 6 6 A10 8 10 10 9 10 8 11 6 5 6 6 A10 8 10 10 9 10 8 11 6 5 6 11 A10 8 10 11 6 11 9 12 6 5 4 44 A10 8 10 11 6 11 5 13 6 5 6 55 A10 8 10 11 4 10 7 11 6 5 6 74 A10 10 10 12 8 10 5 12 5 4 5 13 A10 8 9 10 9 7 6 10 7 6 6 34 A11 10 7 10 8 7 9 13 9 8 7 73 A11 11 6 11 7 9 6 11 8 7 7 reverse primer probes SEQ ID NO: 255 296 297 298 299 300 301 302 303 NoHPV Group A9E21r8az A9E2Z7S1 A9E2Z7S2 A9E2Z7S2a A9E2Z7S2b A9E2Z7S3 A9E2Z7S3a A9E2Z7S4 A9E2Z7S4a 51 A5 9 6 5 5 5 9 9 6 6 26 A5 8 5 3 3 3 6 6 4 4 69 A5 7 3 3 3 3 7 7 3 3 82 A5 7 3 3 3 3 7 7 3 3 56 A6 5 8 7 7 7 9 9 7 7 30 A6 10 6 6 6 6 9 9 7 7 53 A6 5 7 5 5 5 10 10 8 8 66 A6 6 9 8 8 8 10 10 8 8 18 A7 6 7 1 1 1 8 8 6 6 39 A7 6 8 4 4 4 8 8 6 6 45 A7 9 6 3 3 3 10 10 6 6 59 A7 6 6 3 3 3 7 7 5 5 68 A7 8 4 4 4 8 8 6 6 85 A7 5 7 6 6 6 10 10 5 5 70 A7 5 8 5 5 5 8 8 6 6 16 A9 8 0 6 6 6 8 8 4 4 16 A9 7 1 5 5 5 9 9 5 5 31 A9 9 2 4 4 4 6 6 1 1 33 A9 5 5 1 1 1 9 9 7 7 35 A9 10 8 8 8 8 0 0 6 6 52 A9 3 5 3 3 3 7 7 2 2 58 A9 0 5 1 1 1 7 7 5 5 67 A9 1 5 1 1 1 7 7 4 4 54 A 7 6 8 8 8 8 8 5 5 42 A1 6 5 6 6 6 8 8 4 4 32 A1 7 6 6 6 6 9 9 5 5 61 A3 7 6 6 6 6 7 7 5 5 72 A3 11 5 8 8 8 7 7 5 5 89 A3 9 6 6 6 6 8 8 7 7 86 A3 7 7 9 9 9 8 8 9 9 87 A3 8 7 8 8 8 7 7 8 8 84 A3 10 8 9 9 9 8 8 10 10 83 A3 9 7 8 8 8 9 9 8 8 71 A3 10 7 7 7 7 9 9 7 7 90 A3 11 9 8 8 8 9 9 9 9 57 A4 11 8 6 6 6 9 9 8 8 57 A4 11 8 6 6 6 9 9 8 8 7 A8 9 10 9 9 9 3 3 8 8 40 A8 11 10 9 9 9 4 4 9 9 91 A8 9 5 5 5 5 3 3 5 5 6 A10 6 8 7 7 7 11 11 8 8 6 A10 6 8 7 7 7 11 11 8 8 6 A10 6 8 7 7 7 11 11 8 8 11 A10 7 7 9 9 9 10 10 8 8 44 A10 6 5 9 9 9 7 7 8 8 55 A10 7 5 9 9 9 7 7 8 8 74 A10 4 4 7 7 7 8 8 6 6 13 A10 6 4 7 7 7 6 6 4 4 34 A11 8 6 6 6 6 7 7 5 5 73 A11 7 7 6 6 6 8 8 6 6
TABLE-US-00046 TABLE 46 A9 System E4: sequence aligment mismach evaluation forward primer reverse primer SEQ ID NO: 224 225 226 248 A9E- A9E- A9E- A9E- 249 250 251 252 253 254 N°HPV Group 2Z5Z6f1c 2Z5Z6f2c 2Z5Z6f3b 21r1cz A9E21r2az A9E21r3az A9E21r4fz A9E21r5az A9E21r6az A9E21r7az 51 A5 5 3 7 8 10 7 9 9 9 8 26 A5 7 7 5 9 7 11 13 7 6 6 69 A5 5 5 7 8 9 10 12 6 6 6 82 A5 5 4 7 8 10 5 12 6 5 6 58 A6 2 4 6 8 8 8 14 6 6 6 30 A6 2 2 6 8 11 12 14 9 8 8 53 A6 3 3 4 7 10 7 11 5 4 3 66 A6 4 5 6 7 8 9 11 6 6 6 18 A7 2 4 4 9 8 9 11 7 6 5 39 A7 2 4 4 7 9 8 8 6 5 4 45 A7 3 5 3 11 10 10 12 10 10 10 59 A7 3 5 3 7 8 10 9 6 5 4 68 A7 85 A7 4 4 4 8 8 7 8 6 5 4 70 A7 1 1 5 7 9 7 9 5 4 3 16 A9 1 3 5 0 8 9 10 7 6 5 16 A9 1 3 5 2 9 9 9 6 5 4 31 A9 2 4 2 8 0 12 11 10 9 9 33 A9 4 0 4 9 12 0 11 6 7 8 35 A9 0 2 4 6 8 9 0 10 9 8 52 A9 4 4 0 5 9 8 13 2 1 0 58 A9 5 2 6 8 9 5 11 1 2 3 67 A9 2 0 4 7 8 6 12 2 1 2 54 A 3 3 5 8 9 9 10 7 6 5 42 A1 6 6 7 9 8 9 12 7 8 7 32 A1 6 8 6 8 9 7 10 8 7 8 61 A3 6 6 2 8 10 9 13 8 7 6 72 A3 4 2 2 10 11 12 15 11 10 9 89 A3 6 6 2 8 10 11 11 9 8 7 86 A3 8 5 4 10 9 9 16 7 6 7 87 A3 9 5 4 10 9 10 16 8 7 8 84 A3 7 6 3 10 12 12 15 11 10 11 83 A3 8 7 4 7 10 9 10 9 10 9 71 A3 8 7 3 9 12 12 13 10 9 8 90 A3 10 9 5 12 11 12 12 12 12 12 57 A4 12 10 7 9 12 13 13 11 10 9 57 A4 12 10 7 9 12 13 14 11 10 9 7 A8 6 7 4 8 12 9 12 9 8 7 40 A8 4 5 4 9 12 10 12 12 11 11 91 A8 5 5 7 10 8 9 10 9 9 10 6 A10 6 5 8 9 10 8 11 6 5 6 6 A10 6 5 8 9 10 8 11 6 5 6 6 A10 6 5 8 9 10 8 11 6 5 6 11 A10 7 6 7 6 11 9 12 6 5 4 44 A10 6 6 8 6 11 5 13 6 5 6 55 A10 6 6 8 4 10 7 11 6 5 6 74 A10 5 5 7 8 10 5 12 5 4 5 13 A10 4 4 6 9 7 6 10 7 6 6 34 A11 5 3 5 8 7 9 13 9 8 7 73 A11 6 2 6 7 9 6 11 8 7 7 reverse primer probes SEQ ID NO: 255 296 297 298 299 300 301 302 303 NoHPV Group A9E21r8az A9E2Z7S1 A9E2Z7S2 A9E2Z7S2a A9E2Z7S2b A9E2Z7S3 A9E2Z7S3a A9E2Z7S4 A9E2Z7S4a 51 A5 9 6 5 5 5 9 9 6 6 26 A5 8 5 3 3 3 6 6 4 4 69 A5 7 3 3 3 3 7 7 3 3 82 A5 7 3 3 3 3 7 7 3 3 56 A6 5 8 7 7 7 9 9 7 7 30 A6 10 6 6 6 6 9 9 7 7 53 A6 5 7 5 5 5 10 10 8 8 66 A6 6 9 8 8 8 10 10 8 8 18 A7 6 7 1 1 1 8 8 6 6 39 A7 6 8 4 4 4 8 8 6 6 45 A7 9 6 3 3 3 10 10 6 6 59 A7 6 6 3 3 3 7 7 5 5 68 A7 8 4 4 4 8 8 6 6 85 A7 5 7 6 6 6 10 10 5 5 70 A7 5 8 5 5 5 8 8 6 6 16 A9 8 0 6 6 6 8 8 4 4 16 A9 7 1 5 5 5 9 9 5 5 31 A9 9 2 4 4 4 6 6 1 1 33 A9 5 5 1 1 1 9 9 7 7 35 A9 10 8 8 8 8 0 0 6 6 52 A9 3 5 3 3 3 7 7 2 2 58 A9 0 5 1 1 1 7 7 5 5 67 A9 1 5 1 1 1 7 7 4 4 54 A 7 6 6 8 8 8 8 5 5 42 A1 6 5 6 6 6 8 8 4 4 32 A1 7 6 6 6 6 9 9 5 5 61 A3 7 6 6 6 6 7 7 5 5 72 A3 11 5 8 8 8 7 7 5 5 89 A3 9 6 6 6 6 8 8 7 7 86 A3 7 7 9 9 9 8 8 9 9 87 A3 8 7 8 8 8 7 7 8 8 84 A3 10 8 9 9 9 8 8 10 10 83 A3 9 7 8 8 8 9 9 8 8 71 A3 10 7 7 7 7 9 9 7 7 90 A3 11 9 8 8 8 9 9 9 9 57 A4 11 8 6 6 6 9 9 8 8 57 A4 11 8 6 6 6 9 9 8 8 7 A8 9 10 9 9 9 3 3 8 8 40 A8 11 10 9 9 9 4 4 9 9 91 A8 9 5 5 5 5 3 3 5 5 6 A10 6 8 7 7 7 11 11 8 8 6 A10 6 8 7 7 7 11 11 8 8 6 A10 6 8 7 7 7 11 11 8 8 11 A10 7 7 9 9 9 10 10 8 8 44 A10 6 5 9 9 9 7 7 8 8 55 A10 7 5 9 9 9 7 7 8 8 74 A10 4 4 7 7 7 8 8 6 6 13 A10 6 4 7 7 7 6 6 4 4 34 A11 8 6 6 6 6 7 7 5 5 73 A11 7 7 6 6 6 8 8 6 6
TABLE-US-00047 TABLE 47 A9 System F: sequence aligment mismach evaluation forward primer reverse primer SEQ ID 227 228 229 230 248 249 250 251 252 253 NO: A9E A9E A9E A9E A9E A9E A9E A9E A9E A9E NoHPV Group 21f1az 21f2bz 21f3dz 21f4cz 21r1cz 21r2az 21r3az 21r4fz 21r5az 21r6az 51 A5 4 4 3 4 8 10 7 9 9 9 26 A5 3 3 5 2 9 7 11 13 7 6 69 A5 4 4 4 4 8 9 10 12 6 6 82 A5 6 6 4 6 8 10 5 12 6 5 56 A6 5 5 4 4 8 8 8 14 6 6 30 A6 6 4 2 5 8 11 12 14 9 8 53 A6 6 4 4 7 7 10 7 11 5 4 66 A6 3 3 3 4 7 8 9 11 6 6 18 A7 6 6 5 6 9 8 9 11 7 6 39 A7 6 6 5 6 7 9 8 8 6 5 45 A7 7 7 6 7 11 10 10 12 10 10 59 A7 9 8 6 9 7 8 10 9 6 5 68 A7 85 A7 5 3 5 4 8 8 7 8 6 5 70 A7 6 6 4 6 7 9 7 9 5 4 16 A9 0 2 5 3 0 8 9 10 7 6 16 A9 0 2 5 3 2 9 9 9 6 5 31 A9 3 1 5 5 8 0 12 11 10 9 33 A9 4 4 0 4 9 12 0 11 6 7 35 A9 2 0 4 5 6 8 9 0 10 9 52 A9 2 4 6 0 5 9 8 13 2 1 58 A9 4 4 2 3 8 9 5 11 1 2 67 A9 3 5 3 2 7 8 6 12 2 1 54 A 4 4 5 5 8 9 9 10 7 6 42 A1 7 8 6 6 9 8 9 12 7 8 32 A1 6 7 7 5 8 9 7 10 8 7 61 A3 4 2 6 3 8 10 9 13 8 7 72 A3 5 4 3 5 10 11 12 15 11 10 89 A3 7 6 8 8 8 10 11 11 9 8 86 A3 8 9 7 7 10 9 9 16 7 6 87 A3 8 8 6 6 10 9 10 16 8 7 84 A3 8 8 5 7 10 12 12 15 11 10 83 A3 7 5 6 6 7 10 9 10 9 10 71 A3 7 6 8 8 9 12 12 13 10 9 90 A3 8 6 10 7 12 11 12 12 12 12 57 A4 7 7 8 7 9 12 13 13 11 10 57 A4 6 6 9 6 9 12 13 14 11 10 7 A8 5 6 9 5 8 12 9 12 9 8 40 A8 6 6 6 7 9 12 10 12 12 11 91 A8 5 5 9 8 10 8 9 10 9 9 6 A10 6 8 5 6 9 10 8 11 6 5 6 A10 6 8 5 6 9 10 8 11 6 5 6 A10 7 8 5 7 9 10 8 11 6 5 11 A10 6 7 7 5 6 11 9 12 6 5 44 A10 3 5 7 4 6 11 5 13 6 5 55 A10 4 6 7 3 4 10 7 11 6 5 74 A10 6 6 6 5 8 0 5 12 5 4 13 A10 6 8 6 6 9 7 6 10 7 6 34 A11 6 6 5 6 8 7 9 13 9 8 73 A11 7 6 4 7 7 9 6 11 8 7 reverse primer probes SEQ ID 254 255 296 297 298 299 300 301 302 303 NO: A9E A9E A9E A9E A9E A9E A9E A9E A9E A9E NoHPV Group 21r7az 21r8az 2Z7S1 2Z7S2 2Z7S2a 2Z7S2b 2Z7S3 2Z7S3a 2Z7S4 2Z7S4a 51 A5 8 9 5 5 5 5 9 9 6 6 26 A5 6 8 4 3 3 3 6 6 4 4 69 A5 6 7 2 3 3 3 7 7 3 3 82 A5 6 7 2 3 3 3 7 7 3 3 56 A6 6 5 7 7 7 7 9 9 7 7 30 A6 8 10 5 6 6 6 9 9 7 7 53 A6 3 5 7 5 5 5 10 10 8 8 66 A6 6 6 8 8 8 8 10 10 8 8 18 A7 5 6 6 1 1 1 8 8 6 6 39 A7 4 6 7 4 4 4 8 8 6 6 45 A7 10 9 5 3 3 3 10 10 6 6 59 A7 4 6 5 3 3 3 7 7 5 5 68 A7 4 4 4 8 8 6 6 85 A7 4 5 6 6 6 6 10 10 5 5 70 A7 3 5 7 5 5 5 8 8 6 6 16 A9 5 8 0 6 6 6 8 8 4 4 16 A9 4 7 1 5 5 5 9 9 5 5 31 A9 9 9 1 4 4 4 6 6 1 1 33 A9 8 5 5 1 1 1 9 9 7 7 35 A9 8 10 7 8 8 8 0 0 6 6 52 A9 0 3 4 3 3 3 7 7 2 2 58 A9 3 0 4 1 1 1 7 7 5 5 67 A9 2 1 4 1 1 1 7 7 4 4 54 A 5 7 5 8 8 8 8 8 5 5 42 A1 7 6 4 6 6 6 8 8 4 4 32 A1 8 7 5 6 6 6 9 9 5 5 61 A3 6 7 5 6 6 6 7 7 5 5 72 A3 9 11 4 8 8 8 7 7 5 5 89 A3 7 9 5 6 6 6 8 8 7 7 86 A3 7 7 6 9 9 9 8 8 9 9 87 A3 8 8 6 8 8 8 7 7 8 8 84 A3 11 10 7 9 9 9 8 8 10 10 83 A3 9 9 6 8 8 8 9 9 8 8 71 A3 8 10 6 7 7 7 9 9 7 7 90 A3 12 11 8 8 8 8 9 9 9 9 57 A4 9 11 7 6 6 6 9 9 8 8 57 A4 9 11 7 6 6 6 9 9 8 8 7 A8 7 9 9 9 9 9 3 3 8 8 40 A8 11 11 9 9 9 9 4 4 9 9 91 A8 10 9 4 5 5 5 3 3 5 5 6 A10 6 6 7 7 7 7 11 11 8 8 6 A10 6 6 7 7 7 7 11 11 8 8 6 A10 6 6 7 7 7 7 11 11 8 8 11 A10 4 7 6 9 9 9 10 10 8 8 44 A10 6 6 5 9 9 9 7 7 8 8 55 A10 6 7 5 9 9 9 7 7 8 8 74 A10 5 4 4 7 7 7 8 8 6 6 13 A10 6 6 3 7 7 7 6 6 4 4 34 A11 7 8 5 6 6 6 7 7 5 5 73 A11 7 7 6 6 6 6 8 8 6 6
TABLE-US-00048 TABLE 48 A9 System GZ7: sequence aligment mismach evaluatior forward primer reverse primer SEQ ID 227 228 229 230 256 257 258 259 260 261 NO: A9E A9E A9E A9E A9E A9E A9E A9E A9E A9E NoHPV Group 21f1az 21f2bz 21f3dz 21f4cz 2r7C 2r8 2r10 2r12 2r12B 2r15 51 A5 4 4 3 4 8 11 11 8 12 9 26 A5 3 3 5 2 14 12 12 13 17 13 69 A5 4 4 4 4 14 11 11 13 17 14 82 A5 6 6 4 6 8 10 8 9 12 9 56 A6 5 5 4 4 14 8 7 13 14 16 30 A6 6 4 2 5 13 9 10 12 14 13 53 A6 6 4 4 7 12 10 10 9 12 14 66 A6 3 3 3 4 14 6 6 13 14 16 18 A7 6 6 5 6 13 8 8 11 13 15 39 A7 6 6 5 6 13 10 8 10 13 15 45 A7 7 7 6 7 12 11 10 10 11 14 59 A7 9 8 6 9 13 8 8 13 14 14 68 A7 13 10 8 10 13 15 85 A7 5 3 5 4 9 10 7 11 11 10 70 A7 6 6 4 6 10 7 7 10 11 12 16 A9 0 2 5 3 2 11 9 6 6 0 16 A9 0 2 5 3 2 11 9 6 6 0 31 A9 3 1 5 5 5 13 10 0 2 8 33 A9 4 4 0 4 8 0 2 10 11 9 35 A9 2 0 4 5 3 12 10 4 2 6 52 A9 2 4 6 0 12 6 3 11 14 15 58 A9 4 4 2 3 10 1 3 12 12 11 67 A9 3 5 3 2 13 5 7 14 14 14 54 A 4 4 5 5 12 11 12 9 13 13 42 A1 7 8 6 6 13 12 12 13 14 12 32 A1 6 7 7 5 14 12 12 15 15 13 61 A3 4 2 6 3 12 12 10 12 13 13 72 A3 5 4 3 5 14 13 11 13 14 13 89 A3 7 6 8 8 17 13 10 16 18 18 86 A3 8 9 7 7 14 15 12 13 15 14 87 A3 8 8 6 6 16 17 14 15 16 15 84 A3 8 8 5 7 16 15 12 15 17 14 83 A3 7 5 6 6 14 14 11 14 16 15 71 A3 7 6 8 8 14 18 15 11 14 15 90 A3 8 6 10 7 17 15 12 15 16 16 57 A4 7 7 8 7 14 14 11 14 15 16 57 A4 6 6 9 6 14 14 11 14 15 16 7 A8 5 6 9 5 12 10 9 15 15 12 40 A8 6 6 6 7 16 11 9 14 17 15 91 A8 5 5 9 8 9 12 11 11 11 9 6 A10 6 8 5 6 12 10 10 14 16 12 6 A10 6 8 5 6 13 10 10 15 17 13 6 A10 7 8 5 7 13 12 12 14 16 13 11 A10 6 7 7 5 14 12 12 16 16 14 44 A10 3 5 7 4 12 11 11 11 12 12 55 A10 4 6 7 3 11 11 11 10 11 11 74 A10 6 6 6 5 14 14 12 14 14 13 13 A10 6 8 6 6 12 12 12 11 15 12 34 A11 6 6 5 6 7 10 9 4 7 7 73 A11 7 6 4 7 9 10 9 8 9 9 A9 System GZ7: sequence aligment mismach evaluation probes SEQ ID 296 297 298 299 300 301 302 303 NO: A9E A9E A9E A9E A9E A9E A9E A9E NoHPV Group 2Z7S1 2Z7S2 2Z7S2a 2Z7S2b 2Z7S3 2Z7S3a 2Z7S4 2Z7S4a 51 A5 5 5 5 5 9 9 6 6 26 A5 4 3 3 3 6 6 4 4 69 A5 2 3 3 3 7 7 3 3 82 A5 2 3 3 3 7 7 3 3 56 A6 7 7 7 7 9 9 7 7 30 A6 5 6 6 6 9 9 7 7 53 A6 7 5 5 5 10 10 8 8 66 A6 8 8 8 8 10 10 8 8 18 A7 6 1 1 1 8 8 6 6 39 A7 7 4 4 3 8 8 6 6 45 A7 5 3 3 3 10 10 6 6 59 A7 5 3 3 3 7 7 5 5 68 A7 85 A7 6 6 6 5 10 10 5 5 70 A7 7 5 5 4 8 8 6 6 16 A9 0 6 6 6 8 8 4 4 16 A9 1 5 5 5 9 9 5 5 31 A9 1 4 4 4 6 6 1 1 33 A9 5 1 1 1 9 9 7 7 35 A9 7 8 8 8 0 0 6 6 52 A9 4 3 3 3 7 7 2 2 58 A9 4 1 1 1 7 7 5 5 67 A9 4 1 1 1 7 7 4 4 54 A 5 8 8 8 8 8 5 5 42 A1 4 6 6 6 8 8 4 4 32 A1 5 6 6 6 9 9 5 5 61 A3 5 6 6 6 7 7 5 5 72 A3 4 8 8 8 7 7 5 5 89 A3 5 6 6 6 8 8 7 7 86 A3 6 9 9 9 8 8 9 9 87 A3 6 8 8 8 7 7 8 8 84 A3 7 9 9 9 8 8 10 10 83 A3 6 8 8 8 9 9 8 8 71 A3 6 7 7 7 9 9 7 7 90 A3 8 8 8 8 9 9 9 9 57 A4 7 6 6 6 9 9 8 8 57 A4 7 6 6 6 9 9 8 8 7 A8 9 9 9 9 3 3 8 8 40 A8 9 9 9 9 4 4 9 9 91 A8 4 5 5 5 3 3 5 5 6 A10 7 7 7 7 11 11 8 8 6 A10 7 7 7 7 11 11 8 8 6 A10 7 7 7 7 11 11 8 8 11 A10 6 9 9 9 10 10 8 8 44 A10 5 9 9 9 7 7 8 8 55 A10 5 9 9 9 7 7 8 8 74 A10 4 7 7 7 8 8 6 6 13 A10 3 7 7 7 6 6 4 4 34 A11 5 6 6 6 7 7 5 5 73 A11 6 6 6 6 8 8 6 6
TABLE-US-00049 TABLE 49 A9 System GZ8: sequence aligment mismach evaluation forward primer reverse primer SEQ ID 227 228 229 230 256 257 258 259 264 261 NO: A9E A9E A9E A9E A9E A9E A9E A9E A9E A9E NoHPV Group 21f1az 21f2bz 21f3dz 21f4cz 2r7C 2r8 2r10 2r12 2r12B 2r15 51 A5 4 4 3 4 8 11 11 8 12 9 26 A5 3 3 5 2 14 12 12 13 17 13 69 A5 4 4 4 4 14 11 11 13 17 14 82 A5 6 6 4 6 8 10 8 9 12 9 56 A6 5 5 4 4 14 8 7 13 14 16 30 A6 6 4 2 5 13 9 10 12 14 13 53 A6 6 4 4 7 12 10 10 9 12 14 66 A6 3 3 3 4 14 6 6 13 14 16 18 A7 6 6 5 6 13 8 8 11 13 15 39 A7 6 6 5 6 13 10 8 10 13 15 45 A7 7 7 6 7 12 11 10 10 11 14 59 A7 9 8 6 9 13 8 8 13 14 14 68 A7 13 10 8 10 13 15 85 A7 5 3 5 4 9 10 7 11 11 10 70 A7 6 6 4 6 10 7 7 10 11 12 16 A9 0 2 5 3 2 11 9 6 6 0 16 A9 0 2 5 3 2 11 9 6 6 0 31 A9 3 1 5 5 5 3 10 0 2 8 33 A9 4 4 0 4 8 0 2 10 11 9 35 A9 2 0 4 5 3 12 10 4 2 6 52 A9 2 4 6 0 12 6 3 11 14 15 58 A9 4 4 2 3 10 1 3 12 12 11 67 A9 3 5 3 2 13 5 7 14 14 14 54 A 4 4 5 5 12 11 12 9 13 13 42 A1 7 8 6 6 13 12 12 13 14 12 32 A1 6 7 7 5 14 12 12 15 15 13 61 A3 4 2 6 3 12 12 10 12 13 13 72 A3 5 4 3 5 14 13 11 13 14 13 89 A3 7 6 8 8 17 13 10 16 18 18 86 A3 8 9 7 7 14 15 12 13 15 14 87 A3 8 8 6 6 16 17 14 15 16 15 84 A3 8 8 5 7 16 15 12 15 17 14 83 A3 7 5 6 6 14 14 11 14 16 15 71 A3 7 6 8 8 14 18 15 11 14 15 90 A3 8 6 10 7 17 15 12 15 16 16 57 A4 7 7 8 7 14 14 11 14 15 16 57 A4 6 6 9 6 14 14 11 14 15 16 7 A8 5 6 9 5 12 10 9 15 15 12 40 A8 6 6 6 7 16 11 9 14 17 15 91 A8 5 5 9 8 9 12 11 11 11 9 6 A10 6 8 5 6 12 10 10 14 16 12 6 A10 6 8 5 6 13 10 10 15 17 13 6 A10 7 8 5 7 13 12 12 14 16 13 11 A10 6 7 7 5 14 12 12 16 16 14 44 A10 3 5 7 4 12 11 11 11 12 12 55 A10 4 6 7 3 11 11 11 10 11 11 74 A10 6 6 6 5 14 14 12 14 14 13 13 A10 6 8 6 6 12 12 12 11 15 12 34 A11 6 6 5 6 7 10 9 4 7 7 73 A11 7 6 4 7 9 10 9 8 9 9 probes SEQ ID 304 305 306 307 308 309 310 311 NO: A9E A9E A9E A9E A9E A9E A9E A9E NoHPV Group 2Z8S2f 2Z8S21f 2Z8S28f 2Z8S56f 2Z8S58f 2Z8S61f 2Z8S101f 2Z8S105f 51 A5 6 6 6 12 12 12 10 10 26 A5 8 8 8 9 9 9 14 14 69 A5 4 4 4 12 12 12 13 13 82 A5 6 6 6 12 12 12 8 8 56 A6 9 9 9 11 11 11 12 12 30 A6 10 10 10 13 13 13 15 15 53 A6 9 9 9 12 12 12 10 10 66 A6 8 8 8 10 10 10 12 12 18 A7 8 8 8 10 10 10 12 12 39 A7 9 9 9 13 13 13 11 11 45 A7 8 8 8 11 11 11 13 13 59 A7 9 9 9 9 9 9 13 13 68 A7 85 A7 9 9 9 10 10 10 9 9 70 A7 8 8 8 11 11 11 9 9 16 A9 0 0 0 10 10 10 12 12 16 A9 1 1 1 11 11 11 12 12 31 A9 9 9 9 0 0 0 13 13 33 A9 8 8 8 13 13 13 0 0 35 A9 9 9 9 10 10 10 11 11 52 A9 8 8 8 12 12 12 12 12 58 A9 10 10 10 11 11 11 7 7 67 A9 7 7 7 10 10 10 9 9 54 A 9 9 9 10 10 10 12 12 42 A1 9 9 9 12 12 12 13 13 32 A1 7 7 7 12 12 12 10 10 61 A3 9 9 9 12 12 12 11 11 72 A3 13 13 13 14 14 14 15 15 89 A3 9 9 9 12 12 12 14 14 86 A3 13 13 13 12 12 12 13 13 87 A3 13 13 13 13 13 13 15 15 84 A3 10 10 10 10 10 10 12 12 83 A3 7 7 7 11 11 11 11 11 71 A3 8 8 8 14 14 14 15 15 90 A3 8 8 8 12 12 12 14 14 57 A4 9 9 9 11 11 11 14 14 57 A4 9 9 9 12 12 12 15 15 7 A8 9 9 9 13 13 13 12 12 40 A8 8 8 8 12 12 12 12 12 91 A8 7 7 7 10 10 10 12 12 6 A10 8 8 8 12 12 12 11 11 6 A10 8 8 8 12 12 12 11 11 6 A10 7 7 7 12 12 12 11 11 11 A10 8 8 8 12 12 12 12 12 44 A10 7 7 7 14 14 14 8 8 55 A10 4 4 4 12 12 12 9 9 74 A10 8 8 8 13 13 13 8 8 13 A10 9 9 9 8 8 8 7 7 34 A11 10 10 10 9 9 9 12 12 73 A11 9 9 9 11 11 11 7 7 probes SEQ ID 312 313 314 315 316 317 318 319 NO: A9E A9E A9E A9E A9E A9E A9E A9E NoHPV Group 2Z8S127f 2Z8S146f 2Z8S155f 2Z8S156f 2Z8S210f 2Z8S231f 2Z8S236f 2Z8S250f 51 A5 10 11 11 11 12 10 10 10 26 A5 14 14 14 14 9 9 9 9 69 A5 13 14 14 14 7 8 8 8 82 A5 8 14 14 14 12 9 9 9 56 A6 12 15 15 15 5 7 7 7 30 A6 15 15 15 15 8 11 11 11 53 A6 10 12 12 12 6 6 6 6 66 A6 12 12 12 12 5 7 7 7 18 A7 12 12 12 12 6 7 7 7 39 A7 11 10 10 10 10 6 6 6 45 A7 13 13 13 13 9 10 10 10 59 A7 13 10 10 10 7 6 6 6 68 A7 85 A7 9 10 10 10 8 5 5 5 70 A7 9 10 10 10 6 5 5 5 16 A9 12 12 12 12 9 9 9 9 16 A9 12 11 11 11 9 8 8 8 31 A9 13 12 12 12 10 9 9 9 33 A9 0 13 13 13 11 6 6 6 35 A9 11 0 0 0 10 9 9 9 52 A9 12 13 13 13 0 5 5 5 58 A9 7 11 11 11 6 0 0 0 67 A9 9 14 14 14 7 3 3 3 54 A 12 11 11 11 8 8 8 8 42 A1 13 14 14 14 7 9 9 9 32 A1 10 12 12 12 9 9 9 9 61 A3 11 15 15 15 9 8 8 8 72 A3 15 17 17 17 11 13 13 13 89 A3 14 13 13 13 10 10 10 10 86 A3 13 17 17 17 8 10 10 10 87 A3 15 16 16 16 9 11 11 11 84 A3 12 16 16 16 12 10 10 10 83 A3 11 12 12 12 13 10 10 10 71 A3 15 15 15 15 12 11 11 11 90 A3 14 14 14 14 12 12 12 12 57 A4 14 13 13 13 10 11 11 11 57 A4 15 14 14 14 10 12 12 12 7 A8 12 13 13 13 8 10 10 10 40 A8 12 13 13 13 8 12 12 12 91 A8 12 12 12 12 10 11 11 11 6 A10 11 13 13 13 10 8 8 8 6 A10 11 13 13 13 10 8 8 8 6 A10 11 13 13 13 10 8 8 8 11 A10 12 13 13 13 8 8 8 8 44 A10 8 15 15 15 7 9 9 9 55 A10 9 13 13 13 8 9 9 9 74 A10 8 14 14 14 8 6 6 6 13 A10 7 12 12 12 9 6 6 6 34 A11 12 15 15 15 12 9 9 9 73 A11 7 12 12 12 11 6 6 6
TABLE-US-00050 TABLE 50 A9 System H forward primer SEQ ID 232 232 233 234 235 236 237 238 239 NO: A9E A9E A9E A9E A9E A9E A9E A9E A9E NoHPV Group 2f5 2f6 2f7 2f8 2f9 2f10 2f10b 2f11 2f12 51 A5 4 8 8 5 6 4 5 5 6 26 A5 3 7 8 4 3 3 4 3 4 69 A5 2 8 6 2 3 2 3 3 4 82 A5 2 6 4 2 3 2 3 3 4 56 A6 6 10 11 7 6 5 6 8 7 30 A6 3 10 11 5 4 5 5 7 6 53 A6 6 12 13 7 7 4 5 6 7 66 A6 7 10 11 8 7 6 7 9 8 18 A7 4 7 8 6 3 2 2 4 5 39 A7 5 7 9 6 3 4 4 4 5 45 A7 4 10 9 5 5 3 3 5 6 59 A7 3 7 9 5 3 4 4 3 4 68 A7 5 7 9 6 3 4 4 4 5 85 A7 5 9 8 5 4 4 4 6 6 70 A7 5 6 8 6 3 4 4 5 5 16 A9 0 8 6 0 4 2 3 5 4 16 A9 1 8 6 1 5 1 2 6 5 31 A9 1 5 3 1 2 1 2 4 3 33 A9 3 10 10 5 3 1 1 4 5 35 A9 5 0 2 7 6 6 7 2 2 52 A9 3 8 8 4 3 3 3 2 3 58 A9 2 9 9 4 1 0 0 5 4 67 A9 2 8 8 4 1 0 0 5 4 54 A 4 7 6 4 6 4 5 7 7 42 A1 3 7 6 3 4 3 3 6 5 32 A1 5 9 7 5 6 3 4 8 7 61 A3 4 7 6 4 5 2 3 6 6 72 A3 3 7 6 3 5 4 5 6 6 89 A3 3 7 7 4 5 2 3 7 7 86 A3 5 9 8 6 10 6 7 6 7 87 A3 5 9 8 6 9 6 7 6 7 84 A3 5 9 9 7 10 6 7 6 7 83 A3 4 10 10 6 8 4 5 7 7 71 A3 5 10 9 5 7 4 5 7 8 90 A3 8 12 11 7 9 6 7 7 8 57 A4 5 10 10 6 7 4 5 6 8 57 A4 5 10 10 6 7 4 5 6 8 7 A8 6 5 7 9 7 7 8 3 3 40 A8 6 8 9 9 7 7 8 4 4 91 A8 3 5 5 4 3 3 4 4 3 6 A10 6 11 10 6 6 4 4 7 7 6 A10 6 11 10 6 6 4 4 7 7 6 A10 6 11 10 6 6 4 4 7 7 11 A10 5 9 8 5 8 5 6 7 8 44 A10 4 8 7 5 9 5 6 6 6 55 A10 4 8 7 5 9 5 6 6 6 74 A10 3 10 9 4 7 3 4 6 6 13 A10 2 8 7 3 5 3 4 4 4 34 A11 4 8 9 5 4 4 5 6 5 73 A11 5 8 9 6 5 4 5 7 6 reverse primer SEQ ID 262 257 263 258 259 256 264 261 265 NO: A9E A9E A9E A9E A9E A9E A9E A9E A9E NoHPV Group 2r7B 2r8 2r9 2r10 2r12 2r7C 2r12B 2r15 2r16 51 A5 8 11 10 11 8 8 12 9 14 26 A5 13 12 11 12 13 14 17 13 15 69 A5 14 11 10 11 13 14 17 14 13 82 A5 8 10 8 8 9 8 12 9 12 56 A6 13 8 7 7 13 14 14 16 10 30 A6 13 9 9 10 12 13 14 13 11 53 A6 12 10 9 10 9 12 12 14 14 66 A6 13 6 5 6 13 14 14 16 11 18 A7 12 8 8 8 11 13 13 15 10 39 A7 12 10 8 8 10 13 13 15 12 45 A7 11 11 11 10 10 12 11 14 10 59 A7 13 8 9 8 13 13 14 14 8 68 A7 12 10 8 8 10 13 13 15 12 85 A7 9 10 8 7 11 9 11 10 10 70 A7 10 7 6 7 10 10 11 12 11 16 A9 2 11 10 9 6 2 6 0 10 16 A9 2 11 10 9 6 2 6 0 10 31 A9 5 13 11 10 0 5 2 8 11 33 A9 9 0 1 2 10 8 11 9 2 35 A9 3 12 11 10 4 3 2 6 11 52 A9 12 6 4 3 11 12 14 15 8 58 A9 11 1 2 3 12 10 12 11 0 67 A9 13 5 6 7 14 13 14 14 5 54 A 12 11 11 12 9 12 13 13 15 42 A1 13 12 12 12 13 13 14 12 13 32 A1 13 12 11 12 15 14 15 13 13 61 A3 12 12 11 10 12 12 13 13 12 72 A3 14 13 12 11 13 14 14 13 12 89 A3 17 13 11 10 16 17 18 18 14 86 A3 14 15 13 12 13 14 15 14 16 87 A3 15 17 15 14 15 16 16 15 18 84 A3 15 15 13 12 15 16 17 14 15 83 A3 14 14 12 11 14 14 16 15 15 71 A3 14 18 16 15 11 14 14 15 17 90 A3 15 15 13 12 15 17 16 16 16 57 A4 13 14 12 11 14 14 15 16 14 57 A4 13 14 12 11 14 14 15 16 14 7 A8 11 10 10 9 15 12 15 12 11 40 A8 15 11 10 9 14 16 17 15 12 91 A8 9 12 12 11 11 9 11 9 13 6 A10 13 10 9 10 14 12 16 12 14 6 A10 14 10 9 10 15 13 17 13 15 6 A10 14 12 11 12 14 13 16 13 16 11 A10 15 12 11 12 16 14 16 14 15 44 A10 11 11 10 11 11 12 12 12 14 55 A10 10 11 10 11 10 11 11 11 13 74 A10 13 14 13 12 14 14 14 13 16 13 A10 12 12 11 12 11 12 15 12 14 34 A11 6 10 8 9 4 7 7 7 13 73 A11 7 10 8 9 8 9 9 9 12 probes 304 305 306 307 308 309 310 311 SEQ ID A9E A9E A9E A9E A9E A9E A9E A9E NO: 2Z8S 2Z8S 2Z8S 2Z8S 2Z8S 2Z8S 2Z8S 2Z8S NoHPV Group 2f 21f 28f 56f 58f 61f 101f 105f 51 A5 6 6 6 12 12 12 10 10 26 A5 8 8 8 9 9 9 14 14 69 A5 4 4 4 12 12 12 13 13 82 A5 6 6 6 12 12 12 8 8 56 A6 9 9 9 11 11 11 12 12 30 A6 10 10 10 13 13 13 15 15 53 A6 9 9 9 12 12 12 10 10 66 A6 8 8 8 10 10 10 12 12 18 A7 8 8 8 10 10 10 12 12 39 A7 9 9 9 13 13 13 11 11 45 A7 8 8 8 11 11 11 13 13 59 A7 9 9 9 9 9 9 13 13 68 A7 85 A7 9 9 9 10 10 10 9 9 70 A7 8 8 8 11 11 11 9 9 16 A9 0 0 0 10 10 10 12 12 16 A9 1 1 1 11 11 11 12 12 31 A9 9 9 9 0 0 0 13 13 33 A9 8 8 8 13 13 13 0 0 35 A9 9 9 9 10 10 10 11 11 52 A9 8 8 8 12 12 12 12 12 58 A9 10 10 10 11 11 11 7 7 67 A9 7 7 7 10 10 10 9 9 54 A 9 9 9 10 10 10 12 12 42 A1 9 9 9 12 12 12 13 13 32 A1 7 7 7 12 12 12 10 10 61 A3 9 9 9 12 12 12 11 11 72 A3 13 13 13 14 14 14 15 15 89 A3 9 9 9 12 12 12 14 14 86 A3 13 13 13 12 12 12 13 13 87 A3 13 13 13 13 13 13 15 15 84 A3 10 10 10 10 10 10 12 12 83 A3 7 7 7 11 11 11 11 11 71 A3 8 8 8 14 14 14 15 15 90 A3 8 8 8 12 12 12 14 14 57 A4 9 9 9 11 11 11 14 14 57 A4 9 9 9 12 12 12 15 15 7 A8 9 9 9 13 13 13 12 12 40 A8 8 8 8 12 12 12 12 12 91 A8 7 7 7 10 10 10 12 12 6 A10 8 8 8 12 12 12 11 11 6 A10 8 8 8 12 12 12 11 11 6 A10 7 7 7 12 12 12 11 11 11 A10 8 8 8 12 12 12 12 12 44 A10 7 7 7 14 14 14 8 8 55 A10 4 4 4 12 12 12 9 9 74 A10 8 8 8 13 13 13 8 8 13 A10 9 9 9 8 8 8 7 7 34 A11 10 10 10 9 9 9 12 12 73 A11 9 9 9 11 11 11 7 7 probes 312 313 314 315 316 317 318 319 SEQ ID A9E A9E A9E A9E A9E A9E A9E A9E NO: 2Z8S 2Z8S 2Z8S 2Z8S 2Z8S 2Z8S 2Z8S 2Z8S NoHPV Group 127f 146f 155f 156f 210f 231f 236f 250f 51 A5 10 11 11 11 12 10 10 10 26 A5 14 14 14 14 9 9 9 9 69 A5 13 14 14 14 7 8 8 8 82 A5 8 14 14 14 12 9 9 9 56 A6 12 15 15 15 5 7 7 7 30 A6 15 15 15 15 8 11 11 11 53 A6 10 12 12 12 6 6 6 6 66 A6 12 12 12 12 5 7 7 7 18 A7 12 12 12 12 6 7 7 7 39 A7 11 10 10 10 10 6 6 6 45 A7 13 13 13 13 9 10 10 10 59 A7 13 10 10 10 7 6 6 6 68 A7 85 A7 9 10 10 10 8 5 5 5 70 A7 9 10 10 10 6 5 5 5 16 A9 12 12 12 12 9 9 9 9 16 A9 12 11 11 11 9 8 8 8 31 A9 13 12 12 12 10 9 9 9 33 A9 0 13 13 13 11 6 6 6 35 A9 11 0 0 0 10 9 9 9 52 A9 12 13 13 13 0 5 5 5 58 A9 7 11 11 11 6 0 0 0 67 A9 9 14 14 14 7 3 3 3 54 A 12 11 11 11 8 8 8 8 42 A1 13 14 14 14 7 9 9 9 32 A1 10 12 12 12 9 9 9 9 61 A3 11 15 15 15 9 8 8 8 72 A3 15 17 17 17 11 13 13 13 89 A3 14 13 13 13 10 10 10 10 86 A3 13 17 17 17 8 10 10 10 87 A3 15 16 16 16 9 11 11 11 84 A3 12 16 16 16 12 10 10 10 83 A3 11 12 12 12 13 10 10 10 71 A3 15 15 15 15 12 11 11 11 90 A3 14 14 14 14 12 12 12 12 57 A4 14 13 13 13 10 11 11 11 57 A4 15 14 14 14 10 12 12 12 7 A8 12 13 13 13 8 10 10 10 40 A8 12 13 13 13 8 12 12 12 91 A8 12 12 12 12 10 11 11 11 6 A10 11 13 13 13 10 8 8 8 6 A10 11 13 13 13 10 8 8 8 6 A10 11 13 13 13 10 8 8 8 11 A10 12 13 13 13 8 8 8 8 44 A10 8 15 15 15 7 9 9 9 55 A10 9 13 13 13 8 9 9 9 74 A10 8 14 14 14 8 6 6 6 13 A10 7 12 12 12 9 6 6 6 34 A11 12 15 15 15 12 9 9 9 73 A11 7 12 12 12 11 6 6 6
TABLE-US-00051 TABLE 51 list of HPV plasmids Name Group Plasmid size kb Insert size kb Source Publications pHPV 16 A9 2.961 7.904 ATCC 45113 pHPV 6B A10 2.686 7.900 ATCC 45150 The EMBO Journal vol2 no12 p.2341-2348 (1983) pHPV 18 A7 4.363 7.857 ATCC 45152 J. Mol. Biol, (1987) 193 p.599-608 pHPV 31 A9 4.363 8.000 ATCC 65446 J Virol 58: 225-229, 1986 pHPV 11 A10 4.363 7.931 ATCC 45151 Virology 151 124-130 (1986) pHPV 35 cl 2A A9 4.363 3.750 ATCC 40330 U.S. Pat. No. 4,849,332 pHPV 35 cl 2B A9 4.363 4.100 ATCC 40331 U.S. Pat. No. 4,849,332 pHPV 56 cl 2A A6 2.818 5.100 ATCC 40341 U.S. Pat. No. 4,908,306 pHPV 56 cl 2C A6 2.818 7.900 ATCC 40549 U.S. Pat. No. 4,908,306 pHPV 56 cl 2B A6 2.818 3.100 ATCC 40379 U.S. Pat. No. 4,908,306 pHPV 43 cl 2A A8 2.812 6.300 ATCC 40338 U.S. Pat. No. 4,849,334 pHPV 43 cl 2B A8 2.812 2.850 ATCC 40339 U.S. Pat. No. 4,849,334 pHPV 44 cl 2 A10 2.818 7.800 ATCC 40353 U.S. Pat. No. 4,849,331 pHPV 7cl 7/4 A8 2.686 3.905 DKFZ pHPV 7cl 7/5 A8 2.686 4.131 DKFZ pHPV 13 cl 13 A10 2.686 7.241 DKFZ pHPV 30 cl 30 A6 4.36 7.157 DKFZ pHPV 40 cl 40 A8 2.686 7.296 DKFZ pHPV 53 cl 53 A8 3.939 7.154 DKFZ pHPV 57 cl 57 A4 2.686 7.235 DKFZ pHPV 72 cl 72 A3 2.961 7.307 DKFZ pHPV 73 cl 73 A11 2.961 7.005 DKFZ pHPV 45 cl 45 A7 2.871 7.149 DKFZ pHPV 51 A5 2.68 7.800 DKFZ J. of Virology 1998 p1452-1455/aug.1991 p.4216-4225 pHPV 26 A5 2.686 7.100 DKFZ pHPV 52 A9 2.686 7.940 DKFZ pHPV 89 Frag 1 A3 3.015 0.700 DKFZ The Journal of infectious diseases 2002 185: 1794-7 pHPV 89 Frag 2 A3 3.015 1.100 DKFZ The Journal of infectious diseases 2002 185: 1794-7 pHPV 89 Frag 3 A3 3.015 2000 DKFZ The Journal of infectious diseases 2002 185: 1794-7 pHPV 89 Frag 4 A3 3.015 5.100 DKFZ The Journal of infectious diseases 2002 185: 1794-7 pHPV 62 Frag 1 A3 3.015 3.325 DKFZ pHPV 62 Frag 2 A3 3.015 4.040 DKFZ pHPV 62 Frag 3 A3 3.015 1.268 DKFZ pHPV 84 Frag 1 A3 3.015 0.700 DKFZ Virology 279, 109-115, 2001 pHPV 84 Frag 2 A3 3.015 4.500 DKFZ Virology 279, 109-115, 2001 pHPV 84 Frag 3 A3 3.015 1000 DKFZ Virology 279, 109-115, 2001 pHPV 84 Frag 4 A3 3.015 1.800 DKFZ Virology 279, 109-115, 2001 pHPV 84 Frag 5 A3 3.015 0.600 DKFZ Virology 279, 109-115, 2001 pHPV 90 Frag1 A3 3.015 4.200 DKFZ The Journal of infectious diseases 2002 185: 1794-7 pHPV 90 Frag 2 A3 3.015 1.700 DKFZ The Journal of infectious diseases 2002 185: 1794-7 pHPV 90 Frag 3 A3 3.015 2.500 DKFZ The Journal of infectious diseases 2002 185: 1794-7 pHPV 86 Frag 1 A3 3.015 3.900 DKFZ J Gen Virol 2001, 82, 2035-2040 pHPV 86 Frag 2 A3 3.015 5.800 DKFZ J Gen Virol 2001, 82, 2035-2040 pHPV 86 Frag 3 A3 3.015 0.140 DKFZ J Gen Virol 2001, 82, 2035-2040 pHPV 91 Frag 1 A8 3.015 3.200 DKFZ The Journal of infectious diseases 2002 185: 1794-7 pHPV 91 Frag 2 A8 3.015 1.500 DKFZ The Journal of infectious diseases 2002 185: 1794-7 pHPV 91 Frag 3 A8 3.015 1.400 DKFZ The Journal of infectious diseases 2002 185: 1794-7 pHPV 91 Frag 4 A8 3.015 2.500 DKFZ The Journal of infectious diseases 2002 185: 1794-7 pHPV 33 A9 4.363 7.093 CNCM I-450 pHPV 39 A7 3.005 7.160 CNCM I-507 JCM mar 1996, 738-744 pHPV 42 A1 3.030 7.107 CNCM I-508 pHPV 54 A4 3.030 7.107 CNCM I-756 pHPV 23 B1 4.363 7.324 CNCM I-391 J Virol, dec 1984, 52, 1013-1018 pHPV 68 A7 4.363 6.042 CNCM I-1540 JCM mar 1996, 738-744/U.S. Pat. No. 5,981,173 pHPV 66 A6 4.363 7.158 CNCM I-951 J virol, 1986, 57, 688-692 pHPV 87 L1 E1 16 A3 3.015 1.014 DKFZ Journal of Virology dec.2001 p11913-11919 pHPV 87 L1 f A3 3.015 0.974 DKFZ Journal of Virology dec.2001 p11913-11919 pHPV 87 MY 16 A3 3.015 0.448 DKFZ Journal of Virology dec.2001 p11913-11919 pHPV 87 E1 L1 11/2 A3 3.015 2.794 DKFZ Journal of Virology dec.2001 p11913-11919 pHPV 87 L1 E1 37 A3 3.015 1.227 DKFZ Journal of Virology dec.2001 p11913-11919 pHPV 87 E11 E2 as A3 3.015 1.130 DKFZ Journal of Virology dec.2001 p11913-11919 pHPV 58 A8 3.800 7.824 DKFZ Virology (1990) 177: 833-836 pHPV 59 AT 2.695 7.896 DKFZ Int. J. Cancer (1995) 61: 13-22 pHPV 67 A9 2.695 7.801 DKFZ Int. J. Cancer (1995) 61: 13-22 pHPV 81 A3 3.204 4.759 DKFZ Virology (2001) 283: 139-147 pHPV 82 A5 3.204 7.871 DKFZ Clin. Diagn. Lab. Immu. (2000) 7: 91-95 pHPV 85 A7 3.500 7.812 DKFZ Journal of General Virology (1999) 80, 2923-2929 DKFZ is Deusches Kresbsorschungszentrum; Tumorvirologie; ATV0660; Im Neuenheimer Feld 242; DE-Heidelberg; Germany; CNCM is Collection Nationale de Cultures de Microorganisme; Institut Pasteur; 25, rue du Docteur Roux; F-75724 Paris Cedex 15; France; ATCC is American Type Culture Collection; 10801 University Blvd.; Manassas, Virginia 20110-2209; U.S.A. All HPV strains are available from DKFZ.
TABLE-US-00052 TABLE 52 A5 and A6 Systems PCR simplex probe conditions Kit Kit Quantitect probe PCR MgCl2 6 mM Plasmid concentration 108 cop de plasmides/PCR A5 System A. B. C. D. E: PCR simplex probe conditions forward primer reverse primer probes Thermoprofile Name μM Name μM Name μM System A 55° C. A5E6f1 0.4 A5E6r1 0.4 A5E6S1 0.3 System A 53° C. A5E6f1 0.4 A5E6r1 0.4 A5E6S1b 0.2 System B 55° C. A5E6f2 0.3 A5E6r2 0.3 A5E6S2 0.4 System C 55° C. A5E6f3 0.6 A5E6r3 0.6 A5E6S3 0.3 System D 56° C. A5E6f4 0.3 A5E6r4 0.3 A5E6S4 0.3 System E 55° C. A5E6f5 0.6 A5E6r5 0.6 A5E6S4 0.2 A6 System A . B. C. D. E: PCR simplex probe carditions forward primer reverse primer probes Thermoprofile Name μM Name μM Name μM System A 58° C. A6E6f1 0.4 A6E6r1 0.4 A6E6S1 0.3 System B 57° C. A6E6f2 0.6 A6E6r1 0.6 A6E6S1 0.4 System C 55° C. A6E6f3 0.6 A6E6r2 0.6 A6E6S2 0.3 System C 57° C. A6E6f3 0.6 A6E6r2 0.6 A6E6S2b 0.2 System D 58° C. A6E6f4 0.5 A6E6r1 0.5 A6E6S1 0.4 System E 57° C. A6E6f5 0.4 A6E6r3 0.4 A6E6S3 0.3 System E 56° C. A6E6f5 0.4 A6E6r3 0.4 A6E6S3b 0.2
TABLE-US-00053 TABLE 53 A5 System A, B, C, D, E, specificity Syt A Syt A Syt B Syt C Syt D Syt E A5E6S1b A5E6S1 A5E6S2 A5E6S3 A5E6S4 A5E6S4 NoHPV Group CT RFU CT RFU CT RFU CT RFU CT RFU CT RFU 51 A5 22.2* 500 10.95 600 9.9 350 9.9 500 10.5 1200 9.6 1700 26 A5 ND ND ND ND ND ND ND ND ND ND ND ND 69 A5 NT NT NT NT NT NT NT NT NT NT NT NT 82 A5 ND ND ND ND 22.5 200 ND ND ND ND ND ND Other HPV ND ND ND ND ND ND ND ND ND ND ND ND DNA sample ND ND ND ND ND ND ND ND ND ND ND ND H2O sample ND ND ND ND ND ND ND ND ND ND ND ND *Plasmid concentration: 5.105 copies of plasmids/PCR ND: no Detection NT: no test
TABLE-US-00054 TABLE 54 A6 System A, B, C, D, E, specificity Syt A Syt B Syt C Syt C Syt D Syt E Syt E A6E6S1 A6E6S1 A6E6S2 A6E6S2b A6E6S1 A5E6S3 A5E6S3b NoHPV Group CT RFU CT RFU CT RFU CT RFU CT RFU CT RFU CT RFU 56 A6 14.3 250 13.0 500 13.6 3200 19.9* 700 14.3 550 12.3 350 18.5* 900 30 A6 ND ND ND ND ND ND ND ND ND ND ND ND ND ND 53 A6 NT NT NT NT NT NT NT NT NT NT NT NT NT NT 66 A6 ND ND ND ND ND ND ND ND ND ND 22.6* 450 24.9* 820 Other HPV ND ND ND ND ND ND ND ND ND ND ND ND ND ND DNA sample ND ND ND ND ND ND ND ND ND ND ND ND ND ND H2O sample ND ND ND ND ND ND ND ND ND ND ND ND ND ND *Plasmid concentration: 5 106 copies of plasmids/PCR ND: no Detection NT: no test
TABLE-US-00055 TABLE 55 A7 System A. B. C. D: PCR simplex probe and PCR multiplex probes conditions Kit Kit Quantitect probe PCR MgCl2 6 mM Plasmid concentration 106 cop de plasmides/PCR forward primer reverse primer probes Thermoprofile Name μM Name μM Name μM System A 53° C. A7E16f1a 0.3 A7E16r1b 0.2 A7E1ZAS61f 0.2 A7E16f2a 0.3 A7E16r2b 0.3 A7E1S63f 0.2 A7E16f3a 0.3 A7E16r3b 0.3 A7E1S64f 0.2 A7E1S40f 0.2 A7E1ZBS74f 0.2 System B 52° C. A7E115f1a 0.3 A7E115r1a 0.2 A7E1ZBS26f 0.2 A7E115f2a 0.3 A7E115r2b 0.3 A7E1ZBS74f 0.2 A7E115f3d 0.3 A7E1ZBS80f 0.2 System C 51° C. A7E17f1 0.4 A7E17r1 0.3 A7E1ZCS11f 0.2 A7E17f2 0.4 A7E17r2 0.4 A7E1ZCS45f 0.2 A7E17f3 0.4 A7E1ZCS63f 0.2 A7E1ZCS90f 0.2 System D 53° C. A7E12f1 0.3 A7E12r2 0.3 A7E1S36f 0.2 A7E12f2 0.3 A7E12r3 0.1 A7E1S37f 0.2 A7E1S38f 0.2 A7E1ZDS2f 0.2
TABLE-US-00056 TABLE 56 A7 System A. specificity Multiplex A7E1ZAS61f A7E1ZAS63f Simplex Simplex Simplex Simplex Simplex 7E1ZCS40f Probe A7E1ZAS61f A7E1ZAS63f A7E1ZAS64f A7E1ZCS40f A7E1ZBS74f A7E1ZBS74f No HPV Group CT RFU CT RFU CT RFU CT RFU CT RFU CT RFU 18 A7 22.5 175 ND ND ND ND ND ND ND ND 22.5 168 39 A7 ND ND ND ND 22.1 145 ND ND 22.8 248 21.0 263 45 A7 ND ND ND ND ND ND 25.5 115 ND ND 20.3 160 59 AT ND ND 20.5 62.5 ND ND ND ND ND ND 20.2 188 68 A7 ND ND ND ND ND ND ND ND 26.2 125 25.9 31 85 A7 ND ND ND ND ND ND ND ND ND ND ND ND 70 A7 NT NT NT NT NT NT NT NT NT NT NT NT Other HPV ND ND ND ND ND ND ND ND ND ND NT NT DNA sample ND ND ND ND ND ND ND ND ND ND ND ND H2O sample ND ND ND ND ND ND ND ND ND ND ND ND ND: no Detection NT: no test
TABLE-US-00057 TABLE 57 A7 System B. specificity Simplex Simplex Simplex Simplex Simplex Probe A7E1ZBS74f A7E1ZBS79f A7E1ZB80f A7EIZBS26f A7EIZBS27f NoHPV Groupe CT RFU CT RFU CT RFU CT RFU CT RFU 18 A7 ND ND ND ND ND ND 22.9 770 22.5 43 39 A7 24.2 900 ND ND ND ND ND ND ND ND 45 A7 ND ND ND ND ND ND 25.6 312 21.7 665 59 A7 ND ND 18.6 2525 21.2 845 ND ND ND ND 68 A7 25.7 77 ND ND ND ND ND ND ND ND 85 A7 ND ND ND ND ND ND ND ND ND ND 70 A7 NT NT NT NT NT NT NT NT NT NT Other HPV ND ND ND ND ND ND ND ND ND ND DNA sample ND ND ND ND ND ND ND ND ND ND H2O sample ND ND ND ND ND ND ND ND ND ND Multiplex Multiplex Multiplex A7E1ZBS26f A7E1ZBS26f A7E1ZBS26f A7E1ZBS74f A7E1ZBS74f A7E1ZBS74f A7E1ZBS80f Probe A7E1ZBS79f A7E1ZBS80f A7E1ZBS27f NoHPV Groupe CT RFU CT RFU CT RFU 18 A7 22.3 215 20.9 248 20.3 318 39 A7 34.8 155 26.7 375 32.9 213 45 A7 26 72 26.3 98 26.2 173 59 A7 24 505 21.7 338 21.5 308 68 A7 34.5 128 22.8 163 27.1 135 85 A7 ND ND ND ND ND ND 70 A7 NT NT NT NT NT NT DNA sample ND ND ND ND ND ND H2O sample ND ND ND ND ND ND ND: no Detection NT: no test
TABLE-US-00058 TABLE 58 A7 System C. specificity Multiplex Multiplex A7E1ZCS40f A7E1ZCS11f A7E1ZCS45f A7E1ZCS45f Simplex Simplex Simplex Simplex Simplex A7E1ZCS63f 7E1ZCS63f Probe A7E1ZCS11f A7E1ZCS40f A7E1ZCS45f A7E1ZCS63f A7E1ZCS90f A7E1ZCS90f A7E1ZCS90f NoHPV Groupe CT RFU CT RFU CT RFU CT RFU CT RFU CT RFU CT RFU 18 A7 22.0 247 23.4 200 ND ND ND ND ND ND 22.6 231 22.0 239 39 A7 ND ND ND ND 21.9 350 ND ND ND ND 21.7 649 21.1 451 45 A7 21.9 349 24.0 325 ND ND ND ND ND ND 25.6 319 24.7 192 59 A7 ND ND 24.4 35 ND ND 22.4 400 ND ND 24.4 491 25.3 309 68 A7 ND ND ND ND ND ND ND ND 26.2 250 24.5 344 25.3 181 85 A7 ND ND ND ND ND ND ND ND ND ND ND ND ND ND 70 A7 NT NT NT NT NT NT NT NT NT NT NT NT NT NT Other HPV ND ND ND ND ND ND ND ND ND ND NT NT NT NT DNA sample ND ND ND ND ND ND ND ND ND ND ND ND ND ND H2O sample ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND: no Detection NT: no test
TABLE-US-00059 TABLE 59 A7 System D. specificity Multiplex Multiplex A7E1S36f A7E1S3f A7E1S37f A7E1S37f Simplex Simplex Simplex Simplex Simplex A7E1S38f A7E1S38f Probe A7E1ZDS37f A7E1ZDS38f A7E1S36 f A7E1ZDS2f A7E1ZDS3f A7E1ZDS2f A7E1ZDS2f NoHPV Groupe CT RFU CT RFU CT RFU CT RFU CT RFU CT RFU CT RFU 18 A7 23.0 230 ND ND ND ND ND ND ND ND 21.1 357 21.8 420 39 A7 ND ND 23.9 269 ND ND 25.1 323 ND ND 22.5 233 22.3 310 45 A7 ND ND ND ND 27.2 426 ND ND 23.0 1545 26.6 295 23.5 508 59 A7 ND ND 23.8 592 ND ND ND ND ND ND 22.6 135 22.6 230 68 A7 ND ND ND ND ND ND 22.9 897 ND ND 23.4 363 23.5 548 85 A7 ND ND 31.8 262 ND ND ND ND ND ND 32.6 63 29.2 103 70 A7 NT NT NT NT NT NT NT NT NT NT NT NT NT NT Other HPV ND ND ND ND ND ND ND ND ND ND NT NT NT NT DNA sample ND ND ND ND ND ND ND ND ND ND ND ND ND ND H2O sample ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND: no Detection NT: no test
TABLE-US-00060 TABLE 60 A9 Systems: PCR simplex and PCR multiplex probes conditions Kit Kit Quantitect probe PCR MgCl2 5 mM Plasmid concentration 106 cop/PCR forward primer reverse primer probes Thermoprofile Name μM Name μM Name μM System C 51° C. A9E1f8 0.4 A9E1r5 0.4 A9E1S10a 0.2 A9E1f10 0.4 A9E1r6 0.4 A9E1S12a 0.2 A9E1f12 0.2 System E2 52° C. A9E2f1a 0.4 A9E2r1 0.4 A9E2Z7S1 0.2 A9E2f2a 0.6 A9E2r2 0.4 A9E2Z7S2 0.2 A9E2f4a 0.4 A9E2r4 0.6 A9E2Z7S3a 0.2 A9E2r13 0.4 A9E2Z7S4a 0.2 A9E2r14 0.4 System E3 52° C. A9E2f1a 0.4 A9E21r1cz 0.4 A9E2Z7S1 0.2 A9E2f2a 0.4 A9E21r2az 0.4 A9E2Z7S2 0.2 A9E2f4a 0.4 A9E21r3az 0.4 A9E2Z7S3a 0.2 A9E21r4fz A9E2Z7S4a 0.2 A9E21r5az System E4 52° C. A9E2Z5Z6f1c 0.4 A9E21r1cz 0.4 A9E2Z7S1 0.2 A9E2Z5Z6f2c 0.4 A9E21r2az 0.4 A9E2Z7S2 0.2 A9E2Z5Z6f3b 0.4 A9E21r3az 0.4 A9E2Z7S3a 0.2 A9E21r4fz A9E2Z7S4a 0.2 A9E21r5az System F 52° C. A9E2-1f1az 0.4 A9E2-1r1cz 0.4 A9E2Z7S1 0.2 A9E2-1f2bz 0.5 A9E2-1r2az 0.4 A9E2Z7S2 0.2 A9E2-1f3dz 0.4 A9E2-1r3az 0.4 A9E2Z7S3a 0.2 A9E2-1f4cz 0.4 A9E2-1r4fz 0.4 A9E2Z7S4a 0.2 A9E2-1r5az 0.4 System G Z7 52° C. A9E2-1f1az 0.4 A9E2r8 0.4 A9E2Z7S1 0.2 A9E2-1f2bz 0.4 A9E2r10 0.4 A9E2Z7S2a 0.2 A9E2-1f3dz 0.4 A9E2r12 0.4 A9E2Z7S3a 0.2 A9E2-1f4cz 0.5 A9E2r12B 0.4 A9E2Z7S4a 0.2 A9E2r15 0.4 System G Z8 52° C. A9E2-1f1az 0.6 A9E2r8 0.4 A9E2Z8S2f 0.2 A9E2-1f2bz 0.4 A9E2r10 0.4 A9E2Z8S61f 0.2 A9E2-1f3dz 0.4 A9E2r12 0.4 A9E2Z8S127f 0.2 A9E2-1f4cz 0.5 A9E2r12B 0.4 A9E2Z8S156f 0.2 A9E2r15 0.6 A9E2Z8S210f 0.2 A9E2Z8S250f 0.2 System H 53° C. A9E2f6 0.4 A9E2r10 0.4 A9E2Z8S2f 0.2 A9E2f8 0.4 A9E2r12B 0.4 A9E2Z8S61f 0.2 A9E2f9 0.4 A9E2r15 0.4 A9E2Z8S127f 0.2 A9E2r16 0.4 A9E2Z8S156f 0.2 A9E2Z8S210f 0.2 A9E2Z8S231f 0.2 A9E2Z8S250f 0.2
TABLE-US-00061 TABLE 61 A9 System C specificity Multiplex Simplex Simplex Simplex Simplex Simplex Simplex Simplex A9E2S10a Probes A9E1S10* A9E1S10a A9E1S11* A9E1S11a* A9E1S12* A9E1S12a A9E1S12b* A9E2S12a NoHPV Group CT RFU CT RFU CT RFU CT RFU CT RFU CT RFU CT RFU CT RFU 16 A9 22.3 1125 21.9 492 NT NT NT NT NT NT ND ND NT NT 21.0 442 31 A9 27.3 625 23.0 469 25.7 679 24.6 415 39.4 14.5 26.6 103 ND ND 20.8 458 33 A9 25.8 450 22.9 374 NT NT NT NT NT NT ND ND NT NT 22.3 327 35 A9 33.0 181 24.9 188 27.2 342 26.4 234 26.5 224 23.2 502 26.9 241 23.0 435 52 A9 23.4 1059 22.7 599 NT NT 23.8 215 NT NT ND ND NT NT 21.7 581 58 A9 23.5 1435 23.7 582 NT NT 24.3 278 NT NT ND ND NT NT 23.7 525 67 A9 25.0 334 22.4 294 NT NT NT NT NT NT ND ND NT NT 21.9 279 53 A6 NT NT 29.7 449 NT NT NT NT NT NT ND ND NT NT 31.1 263 Other HPV ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND DNA sample ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND H2O sample ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND *Probes tested only with some A9 plasmids (i.e.. those A9 plasmids. which are indicated in this table) ND: not detected NT: not tested
TABLE-US-00062 TABLE 62 A9 System E2 specificity Multiplex A9E2S1 A9E2S2 Simplex Simplex Simplex Simplex A9E2S3a Probes A9E2Z7S1 A9E2Z7S2 A9E2Z7S3a A9E2Z7S4a A9E2S4a NoHPV Group CT RFU CT RFU CT RFU CT RFU CT RFU 16 A9 21.35 806 ND ND ND ND 22.85 113 20.55 333 31 A9 23.8 485 ND ND ND ND 23.5 295 25.3 238 33 A9 32.1 73 27.7 1415 ND ND 27.5 45 31.45 256 35 A9 ND ND ND ND 27.8 840 ND ND 30.1 160 52 A9 25.2 80 22.4 186 ND ND 21.45 278 21.7 115 58 A9 24.45 130 22.1 435 ND ND 23.55 94 24.1 113 67 A9 30.2 173 28.7 447 ND ND 29.35 123 31.9 125 Other HPV ND ND ND ND ND ND ND ND NT NT DNA sample ND ND ND ND ND ND ND ND ND ND H2O sample ND ND ND ND ND ND ND ND ND ND ND: not detected NT: not tested
TABLE-US-00063 TABLE 63 A9 System E3 specificity Multiplex A9E2S1 A9E2S2 Simplex Simplex Simplex Simplex A9E2S3a Probes A9E2Z7S1 A9E2Z7S2 A9E2Z7S3a 9E2Z7S4a A9E2S4a NoHPV Group CT RFU CT RFU CT RFU CT RFU CT RFU 16 A9 20.5 2000 ND ND ND ND 21.85 520 21 546 31 A9 22.35 1200 ND ND ND ND 22.65 660 25.2 336 33 A9 27.05 250 20.7 1600 ND ND 24.8 135 22.2 496 35 A9 ND ND ND ND 26.95 750 ND ND 31.5 79 52 A9 25.35 300 21.7 370 ND ND 21.65 220 21.7 169 58 A9 32.6 100 22.05 200 ND ND 23.6 180 22.7 189 67 A9 30.05 150 28.95 420 ND ND 29.95 120 NT NT Other HPV ND ND ND ND ND ND ND ND NT NT DNA sample ND ND ND ND ND ND ND ND ND ND H2O sample ND ND ND ND ND ND ND ND ND ND ND: not detected NT: not tested
TABLE-US-00064 TABLE 64 A9 System E4 specificity Multiplex A9E2S1 A9E2S2 Simplex Simplex Simplex Simplex A9E2S3a Probes A9E2Z7S1 A9E2Z7S2 A9E2Z7S3a A9E2Z7S4a A9E2S4a NoHPV Group CT RFU CT RFU CT RFU CT RFU CT RFU 16 A9 21.05 600.24 ND ND ND ND 23.25 139.94 23.55 473.54 31 A9 22.0 461.14 ND ND ND ND 22.5 447.6 23.65 524.07 33 A9 25.95 68.73 21.65 3190.34 ND ND 24.95 108.385 23.2 800.33 35 A9 ND ND ND ND 21.6 1355.5 ND ND 23.4 348.45 52 A9 26.9 26.58 22.85 314.81 ND ND 21.5 320.785 22.4 207.195 58 A9 26.25 104.23 24.1 899.37 ND ND 24.8 158.91 24.9 357.445 67 A9 24.6 134.345 22.9 1275.03 ND ND 23.85 188.72 NT NT Other HPV ND ND ND ND ND ND ND ND NT NT DNA sample ND ND ND ND ND ND ND ND ND ND H2O sample ND ND ND ND ND ND ND ND ND ND ND: not detected NT: not tested
TABLE-US-00065 TABLE 65 A9 System F specificity Multiplex A9E2S1 A9E2S2 Simplex Simplex Simplex Simplex A9E2S3a Probes A9E2Z7S1 A9E2Z7S2 A9E2Z7S3a A9E2Z7S4a A9E2S4a NoHPV Group CT RFU CT RFU CT RFU CT RFU CT RFU 16 A9 21.75 765 ND ND ND ND 23.95 77 21.1 335 31 A9 22.4 510 ND ND ND ND 22.05 287 22.7 235 33 A9 27.0 117 21.1 1298.5 ND ND 24.4 61.5 21.1 443 35 A9 ND ND ND ND 21.0 1542.5 ND ND 22.8 154 52 A9 30.95 78.5 25.3 180 ND ND 22.45 399 22.3 199 58 A9 26.05 187.5 23.1 538.5 ND ND 23.05 178 22.2 280 67 A9 25.15 190.5 23.0 569.5 ND ND 23.1 185.5 NT NT Other HPV ND ND ND ND ND ND ND ND NT NT DNA sample ND ND ND ND ND ND ND ND ND ND H2O sample ND ND ND ND ND ND ND ND ND ND ND: not detected NT: not tested
TABLE-US-00066 TABLE 66 A9 System G Z7 specificity Multiplex A9E2S1 A9E2S2a Simplex Simplex Simplex Simplex A9E2S3a Probes A9E2Z7S1 A9E2Z7S2a A9E2Z7S3a A9E2Z7S4a A9E2S4a NoHPV Group CT RFU CT RFU CT RFU CT RFU CT RFU 16 A9 20.3 600 ND ND ND ND 24.6 56 21 658 31 A9 20.6 303.5 ND ND ND ND 22.7 167 23.1 501 33 A9 22.9 80 ND ND ND ND 22.1 280 20.4 920 35 A9 ND ND ND ND 22.2 1330 ND ND 23.9 254 52 A9 24.1 53 23 371.5 ND ND 23 284 22.9 519 58 A9 23.1 150 21.6 739 ND ND 23.8 124 21.9 779 67 A9 21.9 191.5 21.7 692 ND ND 23.6 156.5 NT NT Other HPV ND ND ND ND ND ND ND ND NT NT DNA sample ND ND ND ND ND ND ND ND ND ND H2O sample ND ND ND ND ND ND ND ND ND ND ND: not detected NT: not tested
TABLE-US-00067 TABLE 67 A9 system G Z8 specificity Simplex Simplex Simplex Simplex Simplex Simplex Probes A9E2Z8S2f A9E2Z8S61f A9E2Z8S127f A9E2Z8S156f A9E2Z8S210f A9E2Z8S250f NoHPV Group CT RFU CT RFU CT RFU CT RFU CT RFU CT RFU 16 A9 21.5 261 ND ND ND ND ND ND ND ND ND ND 31 A9 ND ND 21.9 291 ND ND ND ND ND ND ND ND 33 A9 ND ND ND ND 20.5 677 ND ND ND ND ND ND 35 A9 ND ND ND ND ND ND 22.6 333.5 ND ND ND ND 52 A9 ND ND ND ND ND ND ND ND 23.0 115 ND ND 58 A9 ND ND ND ND ND ND ND ND ND ND 20.0 1348 67 A9 ND ND ND ND ND ND ND ND ND ND 22.1 351.5 Other HPV ND ND ND ND ND ND ND ND ND ND ND ND DNA sample ND ND ND ND ND ND ND ND ND ND ND ND H2O sample ND ND ND ND ND ND ND ND ND ND ND ND Multiplex Multiplex A9E2Z8S2f A9E2Z8S2f** A9E2Z8S61f A9E2Z8S61f A9E2Z8S127f A9E2Z8S127f A9E2Z8S156f A9E2Z8S156f A9E2Z8S210f A9E2Z8S210f** Probes A9E2Z8S250f* A9E2Z8S250f* NoHPV Group CT RFU CT RFU 16 A9 22.4 27 22.4 22 31 A9 23.6 73.5 24 42 33 A9 21.8 83.5 20.9 110 35 A9 22.7 42 23.6 45 52 A9 25.8 25 24 30 58 A9 19.3 169 19.6 201 67 A9 21.6 57 NT NT DNA sample ND ND ND ND H2O sample ND ND ND ND ND: not detected NT: not tested *probe at 0.1 μM in these tests **probes at 0.3 μM in this test
TABLE-US-00068 TABLE 68 A9 System H specificity Simplex Simplex Simplex Simplex Simplex Simplex Simplex Probes A9E2Z8S2f A9E2Z8S61f A9E2Z8S127f A9E2Z8S156f A9E2Z8S210f A9E2Z8S231f A9E2Z8S250f NoHPV Group CT RFU CT RFU CT RFU CT RFU CT RFU CT RFU CT RFU 16 A9 21.7 665 ND ND ND ND ND ND ND ND ND ND ND ND 31 A9 ND ND 22.1 307 ND ND ND ND ND ND ND ND ND ND 33 A9 ND ND ND ND 21.4 889 ND ND ND ND ND ND ND ND 35 A9 ND ND ND ND ND ND 22.2 155 ND ND ND ND ND ND 52 A9 ND ND ND ND ND ND ND ND 23.9 270 ND ND ND ND 58 A9 ND ND ND ND ND ND ND ND ND ND 21.3 345 19.8 2690 67 A9 ND ND ND ND ND ND ND ND ND ND 27.0 82.5 27.1 276 Other HPV ND ND ND ND ND ND ND ND ND ND ND ND ND ND DNA sample ND ND ND ND ND ND ND ND ND ND ND ND ND ND H2O sample ND ND ND ND ND ND ND ND ND ND ND ND ND ND Multiplex Multiplex Multiplex Multiplex A9E2Z8S2f A9E2Z8S2f A9E2Z8S2f A9E2Z8S2f A9E2Z8S61f A9E2Z8S61f A9E2Z8S61f A9E2Z8S61f A9E2Z8S127f A9E2Z8S127f A9E2Z8S127f A9E2Z8S127f A9E2Z8S156f A9E2Z8S156f A9E2Z8S156f A9E2Z8S156f A9E2Z8S210f A9E2Z8S210f A9E2Z8S210f A9E2Z8S210f Probes A9E2Z8S250f A9E2Z8S231f A9E2Z8S250f A9E2Z8S231f NoHPV Group CT RFU CT RFU CT RFU CT RFU 16 A9 21.9 143 21.9 167 21.7 106 22.9 98 31 A9 21.5 81 21.9 101 21.6 50 22.5 62 33 A9 22.7 114 22.5 155 22.2 93 22.2 158 35 A9 22.5 63 22.4 70 22.4 46 22.9 48 52 A9 23.7 44 25.4 50 24.6 15 25.0 39 58 A9 19.7 403 19.9 280 19.1 398 19.7 255 67 A9 29.0 29 29.1 26 27.6 16 27.0 38 DNA sample ND ND ND ND ND ND ND ND H2O sample ND ND ND ND ND ND ND ND ND: not detected NT: not tested
TABLE-US-00069 TABLE 69 A5 Systems A, B, C, D, E/sensitivity System A System B System C A5E6S1/HPV51 A5E6S1b/HPV51 A5E6S2/HPV51 A5E6S3/HPV51 Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 103 cop/PCR 27.95 2700 25.65 1100 27.3 180 24.3 430 102 cop/PCR 31.3 2500 29.75 1000 31.0 180 26.85 380 .sup. 10 cop/PCR 34.85 2200 34.3 700 35.7 160 30.0 280 .sup. 1 cop/PCR 36.95 1700 36.65 450 38.85 150 33.1 180 H2O sample ND ND ND ND ND ND ND ND ADN Sample ND ND ND ND ND ND ND ND r2/slope/PCR efficiency 0.997/-2.988/116.1% 0.997/-3.647/88% 0.990/-3.924/79.8% 0.997/-2.955/118% System D System E Copy number HPV A5E6S4/HPV51 A5E6S4/HPV51 plasmid/PCR Moy Ct Moy RFUs Moy Ct Moy RFUs 103 cop/PCR 31.45 750 24.55 500 102 cop/PCR 35.1 700 27.45 450 .sup. 10 cop/PCR 39.7 500 31.15 450 .sup. 1 cop/PCR 43.2 250 33.75 500 H2O sample ND ND ND ND ADN Sample ND ND ND ND r2/slope/PCR efficiency 0.994/-3.990/78.1% 0.997/-3.128/108.8% ND: No Detection NT: Not tested
TABLE-US-00070 TABLE 70 A6 Systems A, B, C, D, E/sensitivity System A System B System C Copy number HPV A6E6S1/HPV56 A6E6S1/HPV56 A6E6S2/HPV56 A6E6S2b/HPV56 plasmid/PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 103 cop/PCR 27.25 400 27.1 600 33.955 1700 29.55 650 102 cop/PCR 27.8 450 27.9 700 35.78 1500 33.1 550 .sup. 10 cop/PCR 30.8 450 30.75 700 38.89 1200 38.25 300 .sup. 1 cop/PCR 34.25 350 34.15 450 43.09 600 ND ND H2O sample ND ND ND ND ND ND ND ND ADN Sample ND ND ND ND ND ND ND ND r2/slope/PCR 0.974/-3.228/104.1% 0.997/-3.16/107% 0.989/-3.270/102.2% 0.998/-3.699/86.4% efficiency System D System E Copy number HPV A6E6S1/HPV56 A6E6S3/HPV56 A6E6S3b/HPV56 plasmid/PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 103 cop/PCR 28.95 750 26.1 600 27.5 750 102 cop/PCR 30.75 750 27.45 650 30.35 750 .sup. 10 cop/PCR 33.65 800 30.45 550 33.9 600 .sup. 1 cop/PCR 35.4 700 32.15 550 ND ND H2O sample ND ND ND ND ND ND ADN Sample ND ND ND ND ND ND r2/slope/PCR 0.987/-2.461/154.8% 0.986/-2.126/195.4% 0.990/-3.183/106.1% efficiency ND: No detection NT: Not tested
TABLE-US-00071 TABLE 71 A7 System A, sensitivity copy number HPV plasmid/ A7E1ZAS61f HPV 18 A7E1S63f HPV 59 A7E1S64f HPV 39 A7E1S40f HPV 45 PCR Moy Ct Moy RFU Moy Ct Moy RFUs Moy Ct Moy RFUs Ecart-type Moy RFUs 106 cop/PCR 22.7 165 21.7 125 22.1 240 24.6 305 105 cop/PCR 25.95 170 24.6 95 25.0 310 27.45 320 104 cop/PCR 29.15 180 27.1 125 28.3 320 30.6 310 103 cop/PCR 32.6 180 31.0 105 31.1 350 33.85 272.5 102 cop/PCR 35.2 170 33.95 70 34.15 290 36.9 282.5 H2O sample ND ND ND ND ND ND ND ND ADN sample ND ND ND ND ND ND ND ND r2/slope/efficiency PCR 0.997/-3.16/107% 0.993/-3.1/110% 0.996/-3.19/106% 0.995/-3.27/102% copy number HPV plasmid/ A7E1ZBS74f HPV 68 A7E1ZBS74f HPV 39 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 24.2 597.585 22.5 1095.195 105 cop/PCR 26.85 611.52 25.25 1182.205 104 cop/PCR 31.15 557.525 28.05 1062.505 103 cop/PCR 35.35 496.425 32.45 1005.26 102 cop/PCR 39.5 473.395 40.6 804 H2O sample ND ND ND ND ADN sample ND ND ND ND r2/slope/efficiency PCR 0.995/-3.919/80% 0.972/-3.271/102.2% ND: no Detection NT: no test
TABLE-US-00072 TABLE 72 A7 System B. sensitivity A7E1ZBS26f A7E1ZBS26f A7E1ZBS74f A7E1ZBS74f copy number HPV plasmid/ HPV 18 HPV 45 HPV 68 HPV 39 PCR Moy Ct Moy RFU Moy Ct Moy RFUs Moy Ct Moy RFUs Ecart-type Moy RFUs 106 cop/PCR 21.35 222.5 22.1 115 21.2 705 24.85 892.5 105 cop/PCR 23.05 252.5 24.75 130 24.7 690 27.0 852.5 104 cop/PCR 26.5 225 28.05 115 28.15 645 31.2 632.5 103 cop/PCR 28.6 180 29.7 112.5 30.85 540 32.65 445 102 cop/PCR 31.35 155 30.85 112.5 33.25 390 31.85 660.5 H2O sample ND ND ND ND 42.5 64 42.5 64 ADN sample ND ND ND ND ND 23 ND 23 r2/slope/efficiency PCR 0.987/-2.55/146% 0.970/-2.24/179% 0.995/-3.02/114% 0.887/-1.96/223% A7E1ZBS80f A7E1ZBS79f A7E1ZBS27f A7E1ZBS27f copy number HPV plasmid/ HPV 59 HPV 59 HPV 45 HPV 18 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 19.65 952.5 18.85 387.5 20.3 675 20.9 112.5 105 cop/PCR 21.85 1025 21.5 427.5 23.25 595 24.35 117.5 104 cop/PCR 23.75 997.5 24.1 405 26.3 557.5 28 122.5 103 cop/PCR 27.1 952.5 26.25 412.5 27.8 502.5 31.7 137.5 102 cop/PCR 31.7 907.5 29.0 377.5 33.05 440 31.05 157.5 H2O sample ND ND ND ND ND ND ND ND ADN sample ND ND ND ND ND ND ND ND r2/slope/efficiency PCR 0.981/-2.94/119% 0.976/-2.51/150% 0.973/-3.01/115% 0.934/-2.718/133.3% ND: no Detection NT: no test
TABLE-US-00073 TABLE 73 A7 System C. sensitivity A7E1ZCS11f/ A7E1ZCS45f/ A7E1ZCS63f/ A7E1ZCS90f/ copy number HPV plasmid/ HPV 45 HPV 39 HPV 59 HPV 68 PCR Moy Ct Moy RFU Moy Ct Moy RFUs Moy Ct Moy RFUs Ecart-type Moy RFUs 106 cop/PCR 21.95 349.45 20.35 649.815 23.1 256.71 24.05 234.305 105 cop/PCR 24.7 344.81 23.4 623.445 26.4 224.625 27.0 200 104 cop/PCR 28.35 274.81 26.95 502.52 28.9 178.505 30.5 140.205 103 cop/PCR 31.6 154.565 30.35 364.095 33.0 107.145 33.4 92.505 102 cop/PCR 35.1 48.72 33.45 173.17 35.3 49.965 37.15 46.65 H2O sample ND ND ND ND ND ND ND ND ADN sample ND ND ND ND ND ND ND ND r2/slope/efficiency PCR 0.997/-3.321/100% 0.998/-3.322/100% 0.993/-3.111/109.9% 0.998/-3.255/102.9% A7E1ZCS11f/ A7E1ZCS40f/ A7E1ZCS40f/ A7E1ZCS40f/ copy number HPV plasmid/ HPV 18 HPV 18 HPV 45 HPV 59 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 22.05 247.645 23.6 65.31 23.65 161.135 22.25 9.985 105 cop/PCR 24.45 230.285 26.25 79.255 27.5 138.725 22.65 27.19 104 cop/PCR 27.1 197.085 29.95 56.015 29.85 107.025 28.7 11.595 103 cop/PCR 31.35 94.76 34.2 29.31 37.9 14 N/A ND 102 cop/PCR 35.0 12.61 N/A ND N/A ND N/A ND H2O sample ND ND ND ND ND ND ND ND ADN sample ND ND ND ND ND ND ND ND r2/slope/efficiency PCR 0.993/-3.275/102% 0.986/-3.55/91.3% 0.988/-3.079/111.3% 0.922/-4.269/71.5% ND: no Detection NT: no test
TABLE-US-00074 TABLE 74 A7 System D. sensitivity A7E1ZDS36f A7E1ZDS37f A7E1ZDS38f A7E1ZDS38f copy number HPV plasmid/ HPV 45 HPV 18 HPV 59 HPV 39 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 26.0 705 21.9 305 21.05 525 24.2 190 105 cop/PCR 29.5 645 25.55 302.5 25.35 487.5 27.8 192.5 104 cop/PCR 33.25 537.5 27.1 292.5 29.2 402.5 32.25 155 103 cop/PCR 36.95 440 30.95 265 32.5 335 35.95 147.5 102 cop/PCR 40.0 332.5 32.45 247.5 33.7 342.5 39.2 140 H2O sample ND ND ND ND ND ND ND ND ADN sample ND ND ND ND ND ND ND ND r2/slope/efficiency PCR 0.998/-3.622/88.8% 0.978/-2.652/138.3% 0.981/-3.253/103% 0.995/-3.805/83.2% copy number HPV plasmid/ A7E1ZDS2f HPV 68 A7E1ZDS2f HPV 39 A7E1ZDS3f HPV 45 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 23.1 942 21.15 113.5 21.85 2075 105 cop/PCR 26.8 898.5 25.55 97.5 24.9 1875 104 cop/PCR 30.5 842.5 28.8 87.5 27.75 1617.5 103 cop/PCR 33.15 677.5 32.25 79 31.05 1250 102 cop/PCR 36.65 635 31.75 80 34.2 1007.5 H2O sample ND ND ND ND ND ND ADN sample ND ND 36.1 ND ND ND r2/slope/efficiency PCR 0.995/-3.334/99.5% 0.941/-2.797/127.8% 0.999/-3.086/110.9% ND: no Detection NT: no test
TABLE-US-00075 TABLE 75 A9 System C, sensitivity copy number HPV plasmid/ A9E1S10a/HPV 16 A9E1S10a/HPV 31 A9E1S10a/HPV 33 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 22.4 457.5 22.15 477 22.5 410 105 cop/PCR 27.2 402.5 26.45 360 28.2 344 104 cop/PCR 30.85 341 29.9 342 31.0 306.5 103 cop/PCR 34.3 322.5 33.2 316.5 34.35 272 102 cop/PCR 37.35 320 36.7 259.5 37.1 227.5 H2O sample ND ND ND ND ND ND ADN sample ND ND ND ND ND ND r2/slope/efficiency PCR 0.996/-3.705/86.2% 0.998/-3.586/90.0% 0.987/-3.536/91.8% copy number HPV plasmid/ A9E1S10a/HPV 35 A9E1S10a/HPV 52 A9E1S10a/HPV 58 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 24.4 233.5 21.85 650 23.65 620 105 cop/PCR 29.0 202 26.4 507 28.3 558.5 104 cop/PCR 32.65 192 29.9 474.5 32.3 484 103 cop/PCR 36.25 167 33.55 429.5 35.95 422.5 102 cop/PCR 39.45 135.5 36.7 350.5 39.35 271.5 H2O sample ND ND ND ND ND ND ADN sample ND ND ND ND ND ND r2/slope/efficiency PCR 0.997/-3.735/85.2% 0.997/-3.680/87.0% 0.997/-3.915/80.1% copy number HPV plasmid/ A9E1S10a/HPV 67 A9E1S12a/HPV 31 A9E1S12a/HPV 35 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 22.0 351 26.45 61 22.45 504 105 cop/PCR 25.95 339 31.3 53.5 27.6 469.5 104 cop/PCR 29.75 304 32.2 67 31.3 452 103 cop/PCR 33.05 261.5 36.25 56 34.25 419.5 102 cop/PCR 36.45 222.5 39.45 51 37.7 356.5 H2O sample ND ND ND ND ND ND ADN sample ND ND ND ND ND ND r2/slope/efficiency PCR 0.999/-3.594/89.8% 0.971/-3.099/110.2% 0.994/-3.719/85.7% ND: not detected NT: not tested
TABLE-US-00076 TABLE 76 A9 System E2, sensitivity A9E2Z7S1/HPV 16 A9E2Z7S1/HPV 31 A9E2Z7S1/HPV 33 A9E2Z7S1/HPV 52 copy number HPV plasmid/PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 19.8 795 23.05 485 31.35 88.5 24.25 86 105 cop/PCR 24.1 765 26.5 425 34.4 83.5 27.05 82.5 104 cop/PCR 27.3 705 29.8 385 38.1 65 30.8 78.5 103 cop/PCR 31.5 610 33.0 342.5 42.8 35 33.85 77.5 102 cop/PCR 34.95 287.5 37.25 177.5 38.9 41.5 36.2 82.5 H2O sample ND ND ND ND ND ND ND ND ADN sample ND ND ND ND ND ND ND ND r2/slope/efficiency PCR 0.996/-3.767/84.3% 0.998/-3.492/93.4% 0.869/-2.762/130.2% 0.996/-3.069/111.7% A9E2Z7S1/HPV 58 A9E2Z7S1/HPV 67 A9E1Z7S2/HPV 33 A9E1Z7S2/HPV 58 copy number HPV plasmid/PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 23.4 145 29.35 120.5 26.4 1257.5 20.95 485 105 cop/PCR 26.4 140 32.85 105 30.0 1120 24.35 395 104 cop/PCR 30.45 125 36.9 77.5 33.6 877.5 28.15 340 103 cop/PCR 34.35 95 42.4 37.5 37.05 520 31.85 310 102 cop/PCR 37.05 91 ND ND 40.0 107.5 34.7 257.5 H2O sample ND ND ND ND ND ND ND ND ADN sample ND ND ND ND ND ND ND ND r2/slope/efficiency PCR 0.99/-3.525/90.2% 0.991/-4.333/70.1% 0.993/-3.431/95.7% 0.999/-3.508/92.8% A9E1Z7S2/HPV 52 A9E1Z7S2/HPV 67 A9E1Z7S3a/HPV 35 copy number HPV plasmid/PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 21.1 182.5 26.6 473 27.25 825 105 cop/PCR 24.65 197.5 30.4 430 30.85 807.5 104 cop/PCR 28.15 192.5 33.2 390 34.5 505 103 cop/PCR 31.85 182.5 35.7 200 37.9 82.5 102 cop/PCR 34.95 162.5 40.3 115 40.4 47.5 H2O sample ND ND ND ND ND ND ADN sample ND ND ND ND ND ND r2/slope/efficiency PCR 0.999/-3.480/92.8% 0.989/-3.279/101.8% 0.990/-3.396/97% A9E2Z7S4a/HPV 31 A9E2Z7S4a/HPV 52 A9E2Z7S4a/HPV 16 copy number HPV plasmid/PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 23.2 460 21.45 485 21.85 182.5 105 cop/PCR 26.5 452.5 24.5 425 25.6 177.5 104 cop/PCR 29.85 435 28.35 385 29.8 147.5 103 cop/PCR 34.05 322.5 31.65 340 33.75 135 102 cop/PCR 38.0 165 35.55 280 36.2 145 H2O sample ND ND ND ND ND ND ADN sample ND ND ND ND ND ND r2/slope/efficiency PCR 0.998/-3.720/85.7% 0.996/-3.517/92.5% 0.996/-3.687/86.7% A9E2Z7S4a/HPV 33 A9E2Z7S4a/HPV 58 A9E2Z7S4a/HPV 67 copy number HPV plasmid/PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 32.0 57.5 23.6 115 28.45 177.5 105 cop/PCR 35.0 57.5 27.2 122.5 32.0 140 104 cop/PCR 43.6 31 31.5 87.5 36.3 107.5 103 cop/PCR ND ND 34.1 90 42.8 42.5 102 cop/PCR ND ND 40.4 50 46.7 20 H2O sample ND ND ND ND ND ND ADN sample ND ND ND ND ND ND r2/slope/efficiency PCR 0.938/-5.797/48..8% 0.980/-4.047/76.6% 0.981/-4.736/62.6% ND: not detected NT: not tested
TABLE-US-00077 TABLE 77 A9 System E3, sensitivity copy number HPV plasmid/ A9E2Z7S1/HPV 16 A9E2Z7S1/HPV 31 A9E2Z7S1/HPV 33 A9E2Z7S1/HPV 52 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 18.0 725 19.7 457 22.8 69 20.3 59 105 cop/PCR 20.3 754 23.7 428 26.9 58 22.7 77 104 cop/PCR 23.3 692 25.5 390 30.2 55 24.7 97 103 cop/PCR 26.2 611 29.4 322 34.1 48 28.4 73 102 cop/PCR 30.0 476 32.6 208 37.2 29 32.2 65 H2O sample ND ND ND ND ND ND ND ND ADN sample ND ND ND ND ND ND ND ND r2/slope/efficiency PCR 0.994/-2.994/115.8% 0.994/-3.148/107.8% 0.988/-3.647/88% 0.987/-2.952/118.2% copy number HPV plasmid/ A9E2Z7S1/HPV 58 A9E2Z7S1/HPV 67 A9E1Z7S2/HPV 33 A9E1Z7S2/HPV 58 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 20.8 117 27.5 111 16.7 1741 20.8 636 105 cop/PCR 22.5 113 29.4 110 19.2 1767 22.5 537 104 cop/PCR 24.9 123 33.1 99 22.7 1574 24.9 693 103 cop/PCR 28.4 117 36.9 70 26.9 1473 28.4 465 102 cop/PCR 31.3 104 41.3 30 29.6 1172 31.3 357 H2O sample ND ND ND ND ND ND ND ND ADN sample ND ND ND ND ND ND ND ND r2/slope/efficiency PCR 0.987/-2.296/134.9% 0.990/-3.509/92.7% 0.995/-3.318/100.1% 0.772/-2.474/153.6% copy number HPV plasmid/ A9E1Z7S2/HPV 52 A9E1Z7S2/HPV67 A9E1Z7S3a/HPV 35 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 18.6 393 25.3 433 25.3 869 105 cop/PCR 21.1 303 28.8 375 27.6 611 104 cop/PCR 25.1 274 31.8 299 31.6 509 103 cop/PCR 28.0 260 35.4 214 34.7 294 102 cop/PCR 32.4 152 ND ND ND ND H2O sample ND ND ND ND ND ND ADN sample ND ND ND ND ND ND r2/slope/efficiency PCR 0.994/-3.523/92.3% 0.997/-3.323/99.9% 0.993/-3.328/104.1% copy number HPV plasmid/ A9E2Z7S4a/HPV 31 A9E2Z7S4a/HPV 52 A9E2Z7S4a/HPV 16 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 19.2 494 18.1 427 18.9 79 105 cop/PCR 22.8 451 20.2 473 21.0 199 104 cop/PCR 26.0 360 23.7 460 23.7 170 103 cop/PCR 29.5 283 27.5 419 27.2 166 102 cop/PCR 33.4 82 31.0 273 31.3 37 H2O sample ND ND ND ND ND ND ADN sample ND ND ND ND ND ND r2/slope/efficiency PCR 0.998/-3.510/92.7% 0.995/-3.312/100.4% 0.989/-3.006/115.1% copy number HPV plasmid/ A9E2Z7S4a/HPV 33 A9E2Z7S4a/HPV 58 A9E2Z7S4a/HPV 67 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 21.0 66 19.7 105 27.2 494 105 cop/PCR 24.2 62 22.8 108 30.5 451 104 cop/PCR 27.5 56 25.8 108 36.1 360 103 cop/PCR 30.8 53 30.3 78 45.4 283 102 cop/PCR ND 22 35.6 57 ND ND H2O sample ND ND ND ND ND ND ADN sample ND ND ND ND ND ND r2/slope/efficiency PCR 0.994/-3.257/102.8% 0.976/-3.920/79.9% 0.959/-5.655/50.3% ND: not detected NT: not tested
TABLE-US-00078 TABLE 78 A9 System E4, sensitivity copy number HPV A9E2Z7S1/HPV 16 A9E2Z7S1/HPV 31 A9E2Z7S1/HPV 52 A9E2Z7S1/HPV 33 plasmid/PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 19.8 915 21.45 795 24.25 65 24.35 105 105 cop/PCR 23.25 940 24.3 717.5 31.1 47.5 28.65 90 104 cop/PCR 26.75 840 28.25 540 37.8 27 37.8 83 103 cop/PCR 30.85 615 32.5 412.5 35.15 40 36.15 75 102 cop/PCR 34.95 507.5 35.0 272.5 37.3 37.5 38.95 47.5 H2O sample ND ND ND ND ND ND ND ND ADN sample ND ND ND ND ND ND ND ND r2/slope/efficiency PCR 0.993/-3.789/83.7% 0.996/-3.509/92.8% 0.889/-3.017/114.5% 0.996/-3.664/87.5% copy number HPV A9E2Z7S1/HPV 58 A9E2Z7S1/HPV 67 A9E1Z7S2/HPV 33 A9E1Z7S2/HPV 58 plasmid/PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 23.8 157.5 22.9 207.5 22.0 2871.625 22.75 903.92 105 cop/PCR 27.6 167.5 26.45 190 25.7 2916.84 25.95 822.335 104 cop/PCR 37.8 128 37.8 160 29.95 2525.075 29.55 731.815 103 cop/PCR 36.0 90 34.25 122.5 33.55 1574.41 33.95 614.88 102 cop/PCR 39.8 45 39.8 52.5 37.45 1675.46 37.35 155.27 H2O sample ND ND ND ND ND ND ND ND ADN sample ND ND ND ND ND ND ND ND r2/slope/efficiency PCR 0.999/-4.075/75.9% 0.996/-4.075/75.9% 0.998/-3.866/81.4% 0.998/-3.725/85.5% copy number HPV plasmid/ A9E1Z7S2/HPV 52 A9E1Z7S2/HPV67 A9E1Z7S3a/HPV 35 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 20.4 372.5 21.3 1225 22.6 1085.81 105 cop/PCR 23.6 360 24.35 1157.5 26.1 1037.5 104 cop/PCR 27.2 345 27.9 1055 29.6 932.32 103 cop/PCR 30.85 347.5 31.75 935 33.75 730.08 102 cop/PCR 34.65 310 35.85 757.5 38.55 501.76 H2O sample ND ND ND ND ND ND ADN sample ND ND ND ND ND ND r2/slope/efficiency PCR 0.997/-3.586/90.1% 0.998/-3.641/88.2% 0.997/-3.960/78.9% copy number HPV plasmid/ A9E2Z7S4a/HPV 31 A9E2Z7S4a/HPV 52 A9E2Z7S4a/HPV 16 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 21.8 800 20.45 640 22.35 267.5 105 cop/PCR 25.2 747.5 24.0 600 25.0 260 104 cop/PCR 28.4 665 27.5 562.5 29.55 240 103 cop/PCR 33.3 505 30.95 532.5 32.75 210 102 cop/PCR 37.2 335 34.4 422.5 33.55 207.5 H2O sample ND ND ND ND ND ND ADN sample ND ND ND ND ND ND r2/slope/efficiency PCR 0.996/-3.872/81.2% 1/-3.476/94% 0.976/-3.010/114.9% copy number HPV plasmid/ A9E2Z7S4a/HPV 33 A9E2Z7S4a/HPV 58 A9E2Z7S4a/HPV 67 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 24.45 212.5 24.2 340 23.25 415 105 cop/PCR 27.3 230 27.45 305 25.55 407.5 104 cop/PCR 31.1 205 31.2 250 30.5 312.5 103 cop/PCR 35.1 162.5 34.35 187.5 33.75 277.5 102 cop/PCR 36.8 127.5 38.9 117.5 38.2 145 H2O sample ND ND ND ND ND ND ADN sample ND ND ND ND ND ND r2/slope/efficiency PCR 0.991/-3.264/102.5% 0.998/-3.632/88.5% 0.989/-3.810/83% ND: not detected NT: not tested
TABLE-US-00079 TABLE 79 A9 System F, sensitivity copy number HPV plasmid/ A9E2Z7S1/HPV 16 A9E2Z7S1/HPV 31 A9E2Z7S1/HPV 33 A9E2Z7S1/HPV 52 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 19.45 1815 19.85 1227.5 23.85 63 25.25 40 105 cop/PCR 22.25 1727.5 22.95 1215 27.1 63 28.55 41.5 104 cop/PCR 26.1 1665 26.75 1150 30.55 62.5 31.6 37.5 103 cop/PCR 26.65 1535 29.6 1055 33.9 62 35.4 41 102 cop/PCR 33.15 1312.5 35.2 753.5 37.8 47.5 38.25 34 H2O sample ND ND ND ND ND ND ND ND ADN sample ND ND ND ND ND ND ND ND r2/slope/efficiency PCR 0.969/-3.202/105.2% 0.990/-3.739/85.1% 0.999/-3.487/93.5% 0.998/-3.651/87.9% copy number HPV plasmid/ A9E2Z7S1/HPV 58 A9E2Z7S1/HPV 67 A9E1Z7S2/HPV 33 A9E1Z7S2/HPV 58 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 22.8 132.5 22.85 138 20.2 3013.235 21.75 1330.945 105 cop/PCR 26.1 125 25.95 127.5 23.4 3085.8 24.85 1292.96 104 cop/PCR 29.55 120 29.6 120 26.7 2967.135 28.35 1266.585 103 cop/PCR 33.45 107 33.65 96 30.45 2499.875 32.25 973.095 102 cop/PCR 37.4 100 35.85 100 33.8 2129.57 35.55 841.57 H2O sample ND ND ND ND ND ND ND ND ADN sample ND ND ND ND ND ND ND ND r2/slope/efficiency PCR 0.998/-3.651/87.9% 0.993/-3.366/98.20% 0.999/-3.435/95.5% 0.999/-3.502/93% copy number HPV plasmid/ A9E1Z7S3a/HPV 35 A9E2Z7S4a/HPV 31 A9E2Z7S4a/HPV 52 A9E2Z7S4a/HPV 58 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 22.1 1337.995 21.85 705 21.75 1022.5 22.1 522.5 105 cop/PCR 25.05 1354.145 24.1 730 24.25 992.5 24.55 460 104 cop/PCR 29.4 1254.22 27.9 665 27.65 1002.5 28.9 455 103 cop/PCR 33.25 1018.5 30.5 560 31.05 957.5 31.5 465 102 cop/PCR 37.0 678.815 35.25 430 34.7 650 35.2 382.5 H2O sample ND ND ND ND ND ND ND ND ADN sample ND ND ND ND ND ND ND ND r2/slope/efficiency PCR 0.996/-3.799/83.3% 0.989/-3.332/99.6% 0.996/-3.273/102.1% 0.994/-3.317/100.2% copy number HPV A9E2Z7S4a/HPV 67 A9E2Z7S4a/HPV 16 A9E2Z7S4a/HPV 33 plasmid/PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 22.15 570 21.95 195 22.45 240 105 cop/PCR 24.2 670 24.65 227.5 25.15 245 104 cop/PCR 28.75 555 29.2 196 29.7 255 103 cop/PCR 31.2 460 32.6 187.5 32.55 187.5 102 cop/PCR 32.7 447.5 35.7 185 36.45 165 H2O sample ND ND ND ND ND ND ADN sample ND ND ND ND ND ND r2/slope/efficiency PCR 0.964/-2.805/127.3% 0.994/-3.487/93.5% 0.995/-3.538/91.7% ND: not detected NT: not tested
TABLE-US-00080 TABLE 80 A9 System G Z7, sensitivity copy number HPV plasmid/ A9E2Z7S1/HPV 16 A9E2Z7S1/HPV 31 A9E2Z7S1/HPV 33 A9E2Z7S1/HPV 52 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 20.25 771 20.85 468 22.85 113 23.2 82 105 cop/PCR 23.55 713.5 24.5 419.5 26.4 119 26.45 75 104 cop/PCR 27.0 654 27.6 375.5 30.8 79.5 29.65 65 103 cop/PCR 30.75 527 31.15 289 33.6 71 33.35 48.5 102 cop/PCR 34.45 296.5 35.1 186 37.3 44.5 37.05 30.5 H2O sample ND ND ND ND ND ND ND ND ADN sample ND ND ND ND ND ND ND ND r2/slope/efficiency PCR 0.999/-3.557/91% 0.998/-3.520/92.3% 0.996/-3.612/89.2% 0.998/-3.452/94.9% copy number HPV plasmid/ A9E2Z7S1/HPV 58 A9E2Z7S1/HPV 67 A9E1Z7S2a/HPV 33 A9E1Z7S2a/HPV 58 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 22.15 187.5 21.8 207 19.8 1165 20.65 717 105 cop/PCR 25.75 165.5 24.9 199 23.1 1080.5 23.75 682 104 cop/PCR 28.8 147 27.35 182.5 26.3 1015.5 27.35 603.5 103 cop/PCR 32.45 100 32.05 128.5 30.05 844 30.9 426 102 cop/PCR 35.35 63 35.4 78.5 33.65 605.5 34.8 234 H2O sample ND ND ND ND ND ND ND ND ADN sample ND ND ND ND ND ND ND ND r2/slope/efficiency PCR 0.998/-3.313/100.4% 0.993/-3.425/95.9% 0.998/-3.469/94.2% 0.998/-3.558/91% copy number HPV plasmid/ A9E1Z7S3a/HPV 35 A9E2Z7S4a/HPV 31 A9E2Z7S4a/HPV 52 A9E2Z7S4a/HPV 58 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 22.15 883.5 21.7 187.5 21.65 257 22.35 145 105 cop/PCR 25.3 795 25.95 180.5 26.45 268 26.05 136.5 104 cop/PCR 29.0 674.5 29.7 157.5 29.8 220 29.3 116 103 cop/PCR 32.2 546 33.4 128.5 33.6 155 33.65 80 102 cop/PCR 35.2 300 36.65 71 37.9 69 37.3 40 H2O sample ND ND ND ND ND ND ND ND ADN sample ND ND ND ND ND ND ND ND r2/slope/efficiency PCR 0.999/-3.656/87.7% 0.999/-3.727/85.5% 0.997/-3.967/78.7% 0.998/-3.751/84.7% copy number HPV plasmid/ A9E2Z7S4a/HPV 67 A9E2Z7S4a/HPV 16 A9E2Z7S4a/HPV 33 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 22.4 159 22.4 67 22.65 69.5 105 cop/PCR 26.5 155.5 27.7 63 27.0 60 104 cop/PCR 30.1 134 31.0 60 30.25 58.5 103 cop/PCR 34.35 90.5 34.6 46 33.4 51.5 102 cop/PCR 38.55 33 38.4 23.5 37.8 32.5 H2O sample ND ND ND ND ND ND ADN sample ND ND ND ND ND ND r2/slope/efficiency PCR 0.996/-4.035/76.9% 0.996/-3.894/80.6% 0.996/-3.670/87.3% ND: not detected NT: not tested
TABLE-US-00081 TABLE 81 A9 System G Z8, sensitivity copy number HPV plasmid/ A9E2Z8S2f/HPV16 A9E2Z8S61f/HPV 31 A9E2Z8S127f/HPV 33 A9E2Z8S156f/HPV35 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 20.9 275 20.8 439.5 20.4 357 21.85 347.5 105 cop/PCR 24.65 274.5 25.25 382 24.95 322 25.75 334.5 104 cop/PCR 27.85 270 29.1 328 28.75 300.5 29.25 331.5 103 cop/PCR 31.55 217 32.3 242 31.6 261.5 32.8 243 102 cop/PCR 35.3 107.5 36.3 86 37.0 98 36.45 121 H2O sample ND ND ND ND ND ND ND ND ADN sample ND ND ND ND ND ND ND ND r2/slope/efficiency PCR 0.995/-3.587/90% 0.995/-3.799/83.3% 0.995/-3.990/78.1% 0.997/-3.639/88.3% copy number HPV plasmid/ A9E2Z8S210f/HPV52 A9E2AZ8S250f/HPV58 A9E2AZ8S250f/HPV67 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 22.05 32 19.3 728 21.2 173 105 cop/PCR 25.65 57 22.6 663 26.2 152 104 cop/PCR 27.45 54.5 26.0 728 29.6 157 103 cop/PCR 32.7 31 29.7 627 32.6 149 102 cop/PCR 37.75 14 32.9 457 36.6 98 H2O sample ND ND ND ND ND ND ADN sample ND ND ND ND ND ND r2/slope/efficiency PCR 0.976/-3.880/81% 0.999/-3.425/95.9% 0.994/-3.701/86.3% ND: not detected NT: not tested
TABLE-US-00082 TABLE 82 A9 System H, sensitivity A9E2Z8S61f/ A9E2Z8S127f/ A9E2Z8S156f/ copy number HPV plasmid/ A9E2Z8S2f/HPV16 HPV 31 HPV 33 HPV35 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 20.55 567.5 20.55 570 20.25 550 21.2 435 105 cop/PCR 23.7 530 23.25 530 23.7 490 24.55 437.5 104 cop/PCR 27.2 465 27.05 507.5 27.4 482.5 28.1 375 103 cop/PCR 31.85 395 29.8 400 31.5 450 32.95 250 102 cop/PCR 34.3 220 34.05 247.5 35.35 212.5 37.05 172.5 H2O sample ND ND ND ND ND ND ND ND ADN sample ND ND ND ND ND ND ND ND r2/slope/efficiency PCR 0.99/-3.570/90.6% 0.995/-3.352/98.8% 0.988/-3.805/83.2% 0.995/-4.011/77.5% A9E2Z8S210f/ A9E2AZ8S250f/ A9E2AZ8S250f/ copy number HPV plasmid/ HPV52 HPV58 HPV67 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 21.65 240 20.15 2300 27.5 150 105 cop/PCR 25.95 225 23.0 2405 32.3 100 104 cop/PCR 30.2 170 26.6 2350 35.2 62.5 103 cop/PCR 34.3 100 30.55 1800 37.55 82.5 102 cop/PCR 36.65 75 33.45 1387.5 40.2 52.5 H2O sample ND ND ND ND ND ND ADN sample ND ND ND ND ND ND r2/slope/efficiency PCR 0.988/-3.837/82.2% 0.993/-3.425/95.9% 0.976/-3.131/108.6% A9E2AZ8S231f/ A9E2AZ8S231f/ copy number HPV plasmid/ HPV58 HPV67 PCR Moy Ct Moy RFUs Moy Ct Moy RFUs 106 cop/PCR 19.75 295 25.45 47.5 105 cop/PCR 22.95 287.5 29.4 47.5 104 cop/PCR 26.4 272.5 33.1 38.5 103 cop/PCR 30.35 210 35.8 28.5 102 cop/PCR 33.65 147.5 36.15 28.5 H2O sample ND ND ND ND ADN sample ND ND ND ND r2/slope/efficiency PCR 0.996/-3.525/92.2% 0.945/-2.778/129.1% ND: not detected NT: not tested
TABLE-US-00083 TABLE 83 Megaplex A5 E A6 A A7 A A9 H Kit Kit Quantitect probe PCR MgCl2 5 mM Plasmid concentration 106 cop/PCR Thermoprofile 52° C. Taq 7U/well Cycling 42x forward primer reverse primer probes Name μM Name μM Name μM A5 System A5E6f5 0.4 A5E6r5 0.4 A5E6s4 0.2 E A6 System A6E6f1 0.4 A6E6r1 0.4 A6E6s1 0.2 A A7 System A7E1-6f1a 0.3 A7E1-6r1b 0.3 A7E1ZCS40f 0.2 A A7E1-6f2a 0.3 A7E1-6r2b 0.3 A7E1ZAS61f 0.2 A7E1-6f3a 0.3 A7E1-6r3b 0.3 A7E1ZAS63f 0.2 A7E1ZBS74f 0.2 A9 System A9E2f6 0.4 A9E2r10 0.6 A9E2Z8S2f 0.2 H A9E2f8 0.4 A9E2r12B 0.4 A9E2Z8S61f 0.2 A9E2f9 0.6 A9E2r15 0.4 A9E2Z8S127f 0.2 A9E2r16 0.4 A9E2Z8S156f 0.2 A9E2Z8S210f 0.2 A9E2Z8S250f 0.1
TABLE-US-00084 TABLE 84 specificity of megaplex EAAH Megaplex NoHPV Group CT RFU 51 A5 21.9 226 26 ND ND 69 NT NT 82 ND ND 56 A6 24.4 220 30 ND ND 53 ND ND 66 ND ND 18 A7 23.3 148 39 22.1 182 45 23.1 215 59 24.8 194 68 24.1 169 85 ND ND 70 NT NT 16 A9 24.0 136 16 24.0 136 31 22.5 121 33 22.6 173 35 23.6 94 52 24.1 102 58 21.7 268 67 32.7 25 DNA sample ND ND H2O sample ND ND ND: no detection NT: not tested
TABLE-US-00085 TABLE 85 Megaplex A5 E A6 B A7 A A9 C Kit Kit Quantitect probe PCR MgCl2 5 mM Plasmid concentration 106 cop/PCR Thermoprofile 52° C. Taq 7U/well Cycling 42x Name μM Name μM Name μM A5 System E A5E6f5 0.4 A5E6r5 0.4 A5E6s4 0.2 A6 System B A6E6f1 0.6 A6E6r1 0.6 A6E6s1 0.4 A7 System A7E1-6f1a 0.5 A7E1-6r1b 0.3 A7E1ZCS40f 0.2 A A7E1-6f2a 0.3 A7E1-6r2b 0.5 A7E1ZAS61f 0.2 A7E1-6f3a 0.3 A7E1-6r3b 0.3 A7E1ZAS63f 0.2 A7E1ZBS74f 0.2 A9 System C A9E1-f8 0.6 A9E1-r5 0.6 A9E1s10a 0.2 A9E1-f10 0.6 A9E1-r6 0.6 A9E1s12a 0.2 A9E1-f12 0.2 A9E1-f13 0.4
TABLE-US-00086 TABLE 86 specificity of megaplex EBAC Megaplex No HPV Group CT RFU 51 A5 23.3 229 26 ND ND 69 NT NT 82 ND ND 56 A6 24 458 30 ND ND 53 36 170 66 ND ND 18 A7 23.7 110 39 23.8 185 45 23.8 205 59 29 47 68 28.3 107 85 ND ND 70 NT NT 16 A9 24.0 333 16 24.0 333 31 24.1 321 33 23.3 364 35 24.6 347 52 22.7 390 58 22 395 67 22.8 303 DNA sample ND ND H2O sample ND ND ND: no Detection NT: not tested
TABLE-US-00087 TABLE 87 Megaplex A5 E/A6 A/A7 A/A9 H; HPV16 and 18 sensitivity copy number HPV plasmid/ HPV 16 HPV 18 PCR Moy Ct Moy RFU Moy Ct Moy RFUs 106 cop/PCR 25.5 50 25.2 33 105 cop/PCR 28.1 87 27.9 79 104 cop/PCR 31.3 106 31.1 72 103 cop/PCR 35.0 98 34.3 53 102 cop/PCR 37.9 51 37.9 27 H2O sample ND ND ND ND ADN sample ND ND ND ND r2/slope/efficiency PCR 0.989/-3.16/107% 0.989/-3.17/107% ND: not detected NT: not tested
TABLE-US-00088 TABLE 88 Megaplex A5 E/A6 B/A7 A/A9 C; HPV16 and 18 sensitivity copy number HPV plasmid/ HPV 16 HPV 18 PCR Moy Ct Moy RFU Moy Ct Moy RFUs 106 cop/PCR 24.3 278 24.3 55 105 cop/PCR 26.8 475 28.1 154 104 cop/PCR 29.9 410 31.5 190 103 cop/PCR 31.2 412 34.3 271 102 cop/PCR 35.8 277 38.0 148 H2O sample ND ND ND ND ADN sample ND ND ND ND r2/slope/efficiency PCR 0.984/-2.76/130% 0.995/-3.36/98.5% ND: not detected NT: not tested
TABLE-US-00089 TABLE 89 list of HPV sequences Organism Type Accession number human 1 a NC_001356 human 2 a NC_001352 human 3 NC_001588 human 4 NC_001457 human 5 NC_001531 human 5 b NC_001444 human 6 NC_000904 human 6 a NC_001668 human 6 b NC_001355 human 7 NC_001595 human 8 NC_001532 human 9 NC_001596 human 10 NC_001576 human 11 NC_001525 human 12 NC_001577 human 13 NC_001349 human 14 D NC_001578 human 15 NC_001579 human 16 AF472509 human 16 NC_001526 human 17 NC_001580 human 18 NC_001357 human 19 NC_001581 human 20 NC_001679 human 21 NC_001680 human 22 NC_001681 human 23 NC_001682 human 24 NC_001683 human 25 NC_001582 human 26 NC_001583 human 27 NC_001584 human 28 NC_001684 human 29 NC_001685 human 30 NC_001585 human 31 NC_001527 human 32 NC_001586 human 33 NC_001528 human 34 NC_001587 human 35 NC_001529 human 36 NC_001686 human 37 NC_001687 human 38 NC_001688 human 39 NC_001535 human 40 NC_001589 human 41 NC_001354 human 42 NC_001534 human 44 NC_001689 human 45 NC_001590 human 47 NC_001530 human 48 NC_001690 human 49 NC_001591 human 50 NC_001691 human 51 NC_001533 human 52 NC_001592 human 53 NC_001593 human 54 NC_001676 human 55 NC_001692 human 56 NC_001594 human 57 NC_001353 human 57 b HPU37537 human 58 NC_001443 human 59 NC_001635 human 60 NC_001693 human 61 NC_001694 human 63 NC_001458 human 65 NC_001459 human 66 NC_001695 human 67 D21208 human 68 M73258 human 69 NC_002171 human 70 NC_001711 human 71 NC_002644 human 72 X94164 partial E6;7;1;2;4;L2;1 human 73 X94165 partial E6;7;1;2;4;L2;1 human 74 NC_004501 human 82 NC_002172 human 83 NC_000856 human 84 NC_002676 human 85 AF131950 human 86 NC_003115 human 87 NC_002627 human 89 NC_004103 human 90 NC_004104 human 91 NC_004085 human 92 NC_004500 Accession Organism Type number bovine BPV NC_001522 bovine BPV2 NC_001521 bovine BPV3 NC_004197 bovine BPV4 X05817 D00146 X59063 bovine BPV5 NC_004195 canine Canine oral papillomavirus NC_001619 chimpanzee Common chimpanzee NC_001838 papillomavirus rabbit Cottontail rabbit papillomavirus NC_001541 Deer Deer papillomavirus NC_001523 Equinus Equinus papillomavirus NC_004194 Equus Equus caballus papillomavirus NC_003748 type 1 elk European elk papillomavirus NC_001524 Felis Felis domesticus papillomavirus AF480454 type 1 coelebs Fringilla coelebs papillomavirus NC_004068 Hamster Hamster papovavirus NC_001663 Monkey Monkey B-lymphotropic NC_001536 papovavirus rat Multimammate rat papillomavirus NC_001605 Ovine Ovine papillomavirus 2 NC_001790 Ovine Ovine papillomavirus1 NC_001789 Phocoena Phocoena spinipinnis NC_003348 papillomavirus Psittacus Psittacus erithacus papillomavirus NC_003973 Chimpanzee Pygmy Chimpanzee papilloma X62844 S43934 virus type 1 Rabbit Rabbit oral papillomavirus NC_002232 Reindeer Reindeer papillomavirus NC_004196
TABLE-US-00090 Sequences of the reference template sequences: <SEQ25; DNA; Human papillomavirus> tggaccgggtcatgttt ggggtgctgg agacaaacat ctagagaacc tagagaatct acagtataat catgcatggt aaagtaccaa cgctgcaaga cgt <SEQ334; DNA; Human papillomavirus> tggaccgggtcatgttt ggggtgctgg agacaaacat ctagagaacc tagagaatct acagtataat catgcatggt aaagtaccaa cgctgcaaga cgttgtatta gaactaacac ctcaaacaga aattgaccta cagtgcaatg agcaattgga cagctcagag gatgaggatg aggatgaagt agaccatttg caggagcggc cacagcaagc tagacaagct aaacaacata cgtgttacct aatacacgta ccttgttgtg agtgtaagtt tgtggtgcag t <SEQ26; DNA; Human papillomavirus> ctaatagcacat ggttggaccg ggtcatgttt ggggtgctgg agacaaacat ctagagaacc tagagaatct acagtataat catgcatggt aaagtaccaa cgctgcaaga cgt <SEQ335; DNA; Human papillomavirus> ctaatagcacat ggttggaccg ggtcatgttt ggggtgctgg agacaaacat ctagagaacc tagagaatct acagtataat catgcatggt aaagtaccaa cgctgcaaga cgttgtatta gaactaacac ctcaaacaga aattgaccta cagtgcaatg agcaattgga cagctcagag gatgaggatg aggatgaagt agaccatttg caggagcggc cacagcaagc tagacaagct aaacaacata cgtgttacct aatacacgta ccttgttgtg agtgtaagtt tgtggtgcag t <SEQ27; DNA; Human papillomavirus> aaggtgctacagatgtca aagtccgtta actccggagg aaaagcaatt gcattgtgac agaaaaagac gatttcatct aatagcacat ggttggaccg ggtcatgttt ggggtgctgg agacaaacat ctagagaacc <SEQ336; DNA; Human papillomavirus> aaggtgctacagatgtca aagtccgtta actccggagg aaaagcaatt gcattgtgac agaaaaagac gatttcatct aatagcacat ggttggaccg ggtcatgttt ggggtgctgg agacaaacat ctagagaacc tagagaatct acagtataat catgcatggt aaagtaccaa cgctgcaaga cgt <SEQ337; DNA; Human papillomavirus> aaggtgctacagatgtca aagtccgtta actccggagg aaaagcaatt gcattgtgac agaaaaagac gatttcatct aatagcacat ggttggaccg ggtcatgttt ggggtgctgg agacaaacat ctagagaacc tagagaatct acagtataat catgcatggt aaagtaccaa cgctgcaaga cgttgtatta gaactaacac ctcaaacaga aattgaccta cagtgcaatg agcaattgga cagctcagag gatgaggatg aggatgaagt agaccatttg caggagcggc cacagcaagc tagacaagct aaacaacata cgtgttacct aatacacgta ccttgttgtg agtgtaagtt tgtggtgcag t <SEQ28; DNA; Human papillomavirus> gttggaccgggtcatgttt ggggtgctgg agacaaacat ctagagaacc tagagaatct acagtataat catgcatggt aaagtaccaa cgctgcaaga cgt <SEQ338; DNA; Human papillomavirus> gttggaccg ggtcatgttt ggggtgctgg agacaaacat ctagagaacc tagagaatct acagtataat catgcatggt aaagtaccaa cgctgcaaga cgttgtatta gaactaacac ctcaaacaga aattgaccta cagtgcaatg agcaattgga cagctcagag gatgaggatg aggatgaagt agaccatttg caggagcggc cacagcaagc tagacaagct aaacaacata cgtgttacct aatacacgta ccttgttgtg agtgtaagtt tgtggtgcag t <SEQ29; DNA; Human papillomavirus> tcagaggatgaggatg aggatgaagt agaccatttg caggagcggc cacagcaagc tagacaagct aaacaacata cgtgttacct aatacacgta ccttgttgtg agtgtaagtt tgtggtgcag t <SEQ1; DNA; Human papillomavirus> ggcagtggaaagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt ttgcccgtgt tgtgcgaaca actagcaacg gcgatgg <SEQ320; DNA; Human papillomavirus> ggcagtggaaagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt ttgcccgtgt tgtgcgaaca actagcaacg gcgatggact <SEQ321; DNA; Human papillomavirus> ggcagtggaaagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt ttgcccgtgt tgtgcgaaca actagcaacg gcgatggact gtgaaggtac agaggatgag gg <SEQ2; DNA; Human papillomavirus> agctccgtgttgcag gtgttcaagt gtagtacaac tggcagtgga aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt ttgcccgtgt tgtgcgaaca actagcaacg gcgatggact <SEQ322; DNA; Human papillomavirus> agctccgtgttgcag gtgttcaagt gtagtacaac tggcagtgga aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt ttgcccgtgt tgtgcgaaca actagcaacg gcgatgg <SEQ323; DNA; Human papillomavirus> agctccgtgttgcag gtgttcaagt gtagtacaac tggcagtgga aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt ttgcccgtgt tgtgcgaaca actagcaacg gcgatggact gtgaaggtac agaggatgag gg <SEQ3; DNA; Human papillomavirus> atatgcgtgacca gctaccagaa agacgggctg gacaggctac gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga aagcagtgga gaca <SEQ324; DNA; Human papillomavirus> atatgcgtgacca gctaccagaa agacgggctg gacaggctac gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt ttgcccgtgt tgtgcgaaca actagcaacg gcgatgg <SEQ325; DNA; Human papillomavirus> atatgcgtgacca gctaccagaa agacgggctg gacaggctac gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt ttgcccgtgt tgtgcgaaca actagcaacg gcgatggact <SEQ326; DNA; Human papillomavirus> atatgcgtgacca gctaccagaa agacgggctg gacaggctac gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt ttgcccgtgt tgtgcgaaca actagcaacg gcgatggact gtgaaggtac agaggatgag gg <SEQ327; DNA; Human papillomavirus> atatgcgtgacca gctaccagaa agacgggctg gacaggctac gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcga <SEQ4; DNA; Human papillomavirus> gacaggctacgtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt ttgcccgtgt tgtgcgaaca actagcaacg gcgatggact gtgaaggtac agaggatgag gg <SEQ328; DNA; Human papillomavirus> gacaggctac gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt ttgcccgtgt tgtgcgaaca actagcaacg gcgatgg <SEQ329; DNA; Human papillomavirus> gacaggctac gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt ttgcccgtgt tgtgcgaaca actagcaacg gcgatggact <SEQ330; DNA; Human papillomavirus> gacaggctac gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcga <SEQ5; DNA; Human papillomavirus> cgggctggacaggctac gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcga <SEQ331; DNA; Human papillomavirus> cgggctggacaggctac gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt ttgcccgtgt tgtgcgaaca actagcaacg gcgatgg <SEQ332; DNA; Human papillomavirus> cgggctggacaggctac gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt ttgcccgtgt tgtgcgaaca actagcaacg gcgatggact <SEQ333; DNA; Human papillomavirus> cgggctggacaggctac gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt ttgcccgtgt tgtgcgaaca actagcaacg gcgatggact gtgaaggtac agaggatgag gg <SEQ122; DNA; Human papillomavirus> ggacgtggtccaga ttaagtttgc acgaggacga ggacaaggaa aacgatggag actctttgcc aacgtttaaa tgtgtgtcag gaca <SEQ123; DNA; Human papillomavirus> tagtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat <SEQ124; DNA; Human papillomavirus> tagtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttt <SEQ125; DNA; Human papillomavirus> tagtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat t <SEQ126; DNA; Human papillomavirus> tagtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtc <SEQ127; DNA; Human papillomavirus> tagtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttg <SEQ128; DNA; Human papillomavirus> agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat <SEQ129; DNA; Human papillomavirus> agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttt <SEQ130; DNA; Human papillomavirus> agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat t <SEQ131; DNA; Human papillomavirus> agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtc <SEQ132; DNA; Human papillomavirus> agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttg <SEQ133; DNA; Human papillomavirus> tagtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgacca
<SEQ134; DNA; Human papillomavirus> tagtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat tt <SEQ135; DNA; Human papillomavirus> tagtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat <SEQ136; DNA; Human papillomavirus> agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgacca <SEQ137; DNA; Human papillomavirus> agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat tt <SEQ138; DNA; Human papillomavirus> agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat <SEQ139; DNA; Human papillomavirus> actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgacca <SEQ140; DNA; Human papillomavirus> actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat tt <SEQ141; DNA; Human papillomavirus> actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat <SEQ142; DNA; Human papillomavirus> acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgacca <SEQ143; DNA; Human papillomavirus> acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat tt <SEQ144; DNA; Human papillomavirus> acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat <SEQ145; DNA; Human papillomavirus> tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgacca <SEQ146; DNA; Human papillomavirus> tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat tt <SEQ147; DNA; Human papillomavirus> tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat <SEQ359; DNA; Human papillomavirus> actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat t <SEQ360; DNA; Human papillomavirus> actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttt <SEQ361; DNA; Human papillomavirus> actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttg <SEQ362; DNA; Human papillomavirus> actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtc <SEQ363; DNA; Human papillomavirus> tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat <SEQ364; DNA; Human papillomavirus> tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat t <SEQ365; DNA; Human papillomavirus> tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttt <SEQ366; DNA; Human papillomavirus> tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttg <SEQ367; DNA; Human papillomavirus> tacacccatagt acatttaaaa ggtgatgcta atctttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtc <SEQ144; DNA; Human papillomavirus> acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat <SEQ368; DNA; Human papillomavirus> acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat t <SEQ369; DNA; Human papillomavirus> acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttt <SEQ370; DNA; Human papillomavirus> acacccatagt acatttbaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttg <SEQ371; DNA; Human papillomavirus> acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtc <SEQ372; DNA; Human papillomavirus> t agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc <SEQ373; DNA; Human papillomavirus> t agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t <SEQ374; DNA; Human papillomavirus> t agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga <SEQ375; DNA; Human papillomavirus> t agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat <SEQ376; DNA; Human papillomavirus> t agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt <SEQ377; DNA; Human papillomavirus> t agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt <SEQ378; DNA; Human papillomavirus> agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc <SEQ379; DNA; Human papillomavirus> agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t <SEQ380; DNA; Human papillomavirus> agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga <SEQ381; DNA; Human papillomavirus> agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat <SEQ382; DNA; Human papillomavirus> agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt <SEQ383; DNA; Human papillomavirus> agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt <SEQ384; DNA; Human papillomavirus> actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc
<SEQ385; DNA; Human papillomavirus> actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggca cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t <SEQ386; DNA; Human papillomavirus> actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca aattaaaata ccaaaaacta ttacagtgtc tactgga <SEQ387; DNA; Human papillomavirus> actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtggaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat <SEQ388; DNA; Human papillomavirus> actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactagatt <SEQ389; DNA; Human papillomavirus> actacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt <SEQ390; DNA; Human papillomavirus> tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc <SEQ391; DNA; Human papillomavirus> tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t <SEQ392; DNA; Human papillomavirus> tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtggaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga <SEQ393; DNA; Human papillomavirus> tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat <SEQ394; DNA; Human papillomavirus> tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt <SEQ395; DNA; Human papillomavirus> tacacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt <SEQ396; DNA; Human papillomavirus> acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc <SEQ397; DNA; Human papillomavirus> acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t <SEQ398; DNA; Human papillomavirus> acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga <SEQ399; DNA; Human papillomavirus> acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat <SEQ400; DNA; Human papillomavirus> acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt <SEQ401; DNA; Human papillomavirus> acacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt <SEQ148; DNA; Human papillomavirus> taaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgacca <SEQ149; DNA; Human papillomavirus> taaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat tt <SEQ150; DNA; Human papillomavirus> taaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat <SEQ151; DNA; Human papillomavirus> acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgacca <SEQ152; DNA; Human papillomavirus> acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat tt <SEQ153; DNA; Human papillomavirus> acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat <SEQ154; DNA; Human papillomavirus> ttaaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgacca <SEQ155; DNA; Human papillomavirus> ttaaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat tt <SEQ156; DNA; Human papillomavirus> ttaaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat <SEQ402; DNA; Human papillomavirus> acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat t <SEQ403; DNA; Human papillomavirus> acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttt <SEQ404; DNA; Human papillomavirus> acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttg <SEQ405; DNA; Human papillomavirus> acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtc <SEQ406; DNA; Human papillomavirus> ttaaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat t <SEQ407; DNA; Human papillomavirus> ttaaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttt <SEQ408; DNA; Human papillomavirus> ttaaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttg <SEQ409; DNA; Human papillomavirus> ttaaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtc <SEQ410; DNA; Human papillomavirus> taaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat t <SEQ411; DNA; Human papillomavirus> taaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttt <SEQ412; DNA; Human papillomavirus> taaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttg <SEQ413; DNA; Human papillomavirus> taaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtc <SEQ163; DNA; Human papillomavirus> acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc <SEQ162; DNA; Human papillomavirus> acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t <SEQ164; DNA; Human papillomavirus> acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga <SEQ414; DNA; Human papillomavirus> acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat <SEQ415; DNA; Human papillomavirus> acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt <SEQ161; DNA; Human papillomavirus> acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt <SEQ167; DNA; Human papillomavirus> ttaaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc <SEQ166; DNA; Human papillomavirus> ttaaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t <SEQ168; DNA; Human papillomavirus> ttaaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga <SEQ416; DNA; Human papillomavirus> ttaaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat <SEQ417; DNA; Human papillomavirus> ttaaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt <SEQ165; DNA; Human papillomavirus> ttaaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt <SEQ159; DNA; Human papillomavirus> taaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc <SEQ158; DNA; Human papillomavirus> taaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t <SEQ160; DNA; Human papillomavirus> taaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga <SEQ418; DNA; Human papillomavirus> taaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat <SEQ419; DNA; Human papillomavirus> taaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt <SEQ157; DNA; Human papillomavirus> taaaaggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt <SEQ169; DNA; Human papillomavirus> gtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat <SEQ170; DNA; Human papillomavirus> gtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t <SEQ171; DNA; Human papillomavirus> gtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc <SEQ172; DNA; Human papillomavirus> gtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt <SEQ173; DNA; Human papillomavirus> gtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt <SEQ174; DNA; Human papillomavirus> gtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga <SEQ175; DNA; Human papillomavirus> actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat <SEQ176; DNA; Human papillomavirus> actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t <SEQ177; DNA; Human papillomavirus> actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc <SEQ178; DNA; Human papillomavirus> actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt <SEQ179; DNA; Human papillomavirus> actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt <SEQ180; DNA; Human papillomavirus> actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga <SEQ181; DNA; Human papillomavirus> tgcagtgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat <SEQ182; DNA; Human papillomavirus> tgcagtgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t <SEQ183; DNA; Human papillomavirus> tgcagtgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc <SEQ184; DNA; Human papillomavirus> tgcagtgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt <SEQ185; DNA; Human papillomavirus> tgcagtgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt <SEQ186; DNA; Human papillomavirus> tgcagtgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga <SEQ187; DNA; Human papillomavirus> agtgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat <SEQ188; DNA; Human papillomavirus> agtgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t <SEQ189; DNA; Human papillomavirus> agtgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc <SEQ190; DNA; Human papillomavirus> agtgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt <SEQ191; DNA; Human papillomavirus> agtgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt <SEQ192; DNA; Human papillomavirus> agtgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga <SEQ193; DNA; Human papillomavirus> cagtgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat <SEQ194; DNA; Human papillomavirus> cagtgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t <SEQ195; DNA; Human papillomavirus> cagtgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc <SEQ196; DNA; Human papillomavirus> cagtgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt <SEQ197; DNA; Human papillomavirus> cagtgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt <SEQ198; DNA; Human papillomavirus> cagtgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga <SEQ199; DNA; Human papillomavirus> tgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat <SEQ200; DNA; Human papillomavirus> tgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t <SEQ201; DNA; Human papillomavirus> tgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc
<SEQ202; DNA; Human papillomavirus> tgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt <SEQ203; DNA; Human papillomavirus> tgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt <SEQ204; DNA; Human papillomavirus> tgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga <SEQ205; DNA; Human papillomavirus> gtgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat <SEQ206; DNA; Human papillomavirus> gtgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t <SEQ207; DNA; Human papillomavirus> gtgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc <SEQ208; DNA; Human papillomavirus> gtgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt <SEQ209; DNA; Human papillomavirus> gtgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggatt <SEQ210; DNA; Human papillomavirus> gtgtcgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactgga <SEQ46; DNA; Human papillomavirus> tggtatagaacaggaa tatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatg <SEQ47; DNA; Human papillomavirus> tggtatagaacaggaa tatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc ag <SEQ48; DNA; Human papillomavirus> tggtatagaacaggaa tatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc agc <SEQ49; DNA; Human papillomavirus> gaacaggaatatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatg <SEQ50; DNA; Human papillomavirus> gaacaggaatatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc ag <SEQ51; DNA; Human papillomavirus> gaacaggaatatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc agc <SEQ52; DNA; Human papillomavirus> tggtatagaacaggaa tatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg ca <SEQ53; DNA; Human papillomavirus> tggtatagaacaggaa tatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg cattt <SEQ339; DNA; Human papillomavirus> gaacaggaa tatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg ca <SEQ340; DNA; Human papillomavirus> gaacaggaatatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg cattt <SEQ341; DNA; Human papillomavirus> tggtatagaacaggaa tatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc <SEQ342; DNA; Human papillomavirus> gaacaggaatatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc <SEQ54; DNA; Human papillomavirus> ggtatagaacaggaa tatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg ca <SEQ55; DNA; Human papillomavirus> ggtatagaacaggaa tatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg cattt <SEQ56; DNA; Human papillomavirus> gtatagaacaggaa tatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg ca <SEQ57; DNA; Human papillomavirus> gtatagaacaggaa tatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg cattt <SEQ343; DNA; Human papillomavirus> ggtatagaacaggaa tatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct acagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatg <SEQ344; DNA; Human papillomavirus> ggtatagaacaggaa tatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc ag <SEQ345; DNA; Human papillomavirus> ggtatagaacaggaa tatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc agc <SEQ346; DNA; Human papillomavirus> gtatagaacaggaa tatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatg <SEQ347; DNA; Human papillomavirus> gtatagaacaggaa tatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc ag <SEQ348; DNA; Human papillomavirus> gtatagaacaggaa tatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc agc <SEQ349; DNA; Human papillomavirus> tggtatagaacaggaa tatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc <SEQ350; DNA; Human papillomavirus> ggtatagaacaggaa tatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc <SEQ345; DNA; Human papillomavirus> ggtatagaacaggaa tatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc agc <SEQ351; DNA; Human papillomavirus> gtatagaacaggaa tatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc <SEQ352; DNA; Human papillomavirus> gtatagaacaggaa tatcaaatat tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc agc <SEQ58; DNA; Human papillomavirus> tgatagcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc <SEQ59; DNA; Human papillomavirus> tgatagcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc agc <SEQ60; DNA; Human papillomavirus> gatagcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc <SEQ61; DNA; Human papillomavirus> gatagcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc agc <SEQ62; DNA; Human papillomavirus> ggaatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc <SEQ63; DNA; Human papillomavirus> ggaatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc agc <SEQ353; DNA; Human papillomavirus> ggaatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatg <SEQ354; DNA; Human papillomavirus> ggaatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
ag <SEQ355; DNA; Human papillomavirus> tgatagcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatg <SEQ356; DNA; Human papillomavirus> tgatagcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc ag <SEQ59; DNA; Human papillomavirus> tgatagcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc agc <SEQ357; DNA; Human papillomavirus> gatagcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatg <SEQ358; DNA; Human papillomavirus> gatagcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc ag <SEQ64; DNA; Human papillomavirus> ggctgatccagaagg tacagacggg gagggcacgg gttgtaacgg ctggttttat gtacaagcta ttgtagacaa aaaaacagga gatgtaatat cagatgacga ggacgaaaat gc <SEQ65; DNA; Human papillomavirus> ggctgatccagaagg tacagacggg gagggcacgg gttgtaacgg ctggttttat gtacaagcta ttgtagacaa aaaaacagga gatgtaatat cagatgacga ggacgaaaat gcaacagaca cagg <SEQ66; DNA; Human papillomavirus> gatccagaagg tacagacggg gagggcacgg gttgtaacgg ctggttttat gtacaagcta ttgtagacaa aaaaacagga gatgtaatat cagatgacga ggacgaaaat gc <SEQ67; DNA; Human papillomavirus> gatccagaagg tacagacggg gagggcacgg gttgtaacgg ctggttttat gtacaagcta ttgtagacaa aaaaacagga gatgtaatat cagatgacga ggacgaaaat gcaacagaca cagg
Sequence CWU
1
1
4521106DNAHuman papillomavirus 1ggcagtggaa agcagtggag acacccttcg
cgttgtacag cagatgttaa tgggcgaact 60aagcctggtt tgcccgtgtt gtgcgaacaa
ctagcaacgg cgatgg 1062145DNAHuman papillomavirus
2agctccgtgt tgcaggtgtt caagtgtagt acaactggca gtggaaagca gtggagacac
60ccttcgcgtt gtacagcaga tgttaatggg cgaactaagc ctggtttgcc cgtgttgtgc
120gaacaactag caacggcgat ggact
1453117DNAHuman papillomavirus 3atatgcgtga ccagctacca gaaagacggg
ctggacaggc tacgtgttac agaattgaag 60ctccgtgttg caggtgttca agtgtagtac
aactggcagt ggaaagcagt ggagaca 1174192DNAHuman papillomavirus
4gacaggctac gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac
60tggcagtgga aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac
120taagcctggt ttgcccgtgt tgtgcgaaca actagcaacg gcgatggact gtgaaggtac
180agaggatgag gg
1925125DNAHuman papillomavirus 5cgggctggac aggctacgtg ttacagaatt
gaagctccgt gttgcaggtg ttcaagtgta 60gtacaactgg cagtggaaag cagtggagac
acccttcgcg ttgtacagca gatgttaatg 120ggcga
125622DNAArtificialgroup-targeted HPV
primer or probe 6ggcagtggaa agcagtggag ac
22721DNAArtificialgroup-targeted HPV primer or probe
7agctccgtgt tgcaggtgtt c
21821DNAArtificialgroup-targeted HPV primer or probe 8atatgcgtga
ccagctacca g
21921DNAArtificialgroup-targeted HPV primer or probe 9gacaggctac
gtgttacaga a
211018DNAArtificialgroup-targeted HPV primer or probe 10cgggctggac
aggctacg
181122DNAArtificialgroup-targeted HPV primer or probe 11ccatcgccgt
tgctagttgt tc
221222DNAArtificialgroup-targeted HPV primer or probe 12agtccatcgc
cgttgctagt tg
221321DNAArtificialgroup-targeted HPV primer or probe 13tgtctccact
gctttccact g
211420DNAArtificialgroup-targeted HPV primer or probe 14ccctcatcct
ctgtaccttc
201521DNAArtificialgroup-targeted HPV primer or probe 15tcgcccatta
acatctgctg t
211627DNAArtificialgroup-targeted HPV primer or probe 16gcttagttcg
cccattaaca tctgctg
271725DNAArtificialgroup-targeted HPV primer or probe 17cgaagggtgt
ctccactgct ttcca
251826DNAArtificialgroup-targeted HPV primer or probe 18acacggagct
tcaattctgt aacacg
261926DNAArtificialgroup-targeted HPV primer or probe 19tagtacaact
ggcagtggaa agcagt
262041DNAArtificialgroup-targeted HPV primer or probe 20ccccctcgct
tagttcgccc attaacatct gctggagggg g
412139DNAArtificialgroup-targeted HPV primer or probe 21cgctgcgctt
agttcgccca ttaacatctg ctggcagcg
392239DNAArtificialgroup-targeted HPV primer or probe 22cgcgatccga
agggtgtctc cactgctttc cagatcgcg
392340DNAArtificialgroup-targeted HPV primer or probe 23cgcgatcaca
cggagcttca attctgtaac acggatcgcg
402440DNAArtificialgroup-targeted HPV primer or probe 24cgcgatctag
tacaactggc agtggaaagc agtgatcgcg
4025100DNAHuman papillomavirus 25tggaccgggt catgtttggg gtgctggaga
caaacatcta gagaacctag agaatctaca 60gtataatcat gcatggtaaa gtaccaacgc
tgcaagacgt 10026115DNAHuman papillomavirus
26ctaatagcac atggttggac cgggtcatgt ttggggtgct ggagacaaac atctagagaa
60cctagagaat ctacagtata atcatgcatg gtaaagtacc aacgctgcaa gacgt
11527138DNAHuman papillomavirus 27aaggtgctac agatgtcaaa gtccgttaac
tccggaggaa aagcaattgc attgtgacag 60aaaaagacga tttcatctaa tagcacatgg
ttggaccggg tcatgtttgg ggtgctggag 120acaaacatct agagaacc
13828102DNAHuman papillomavirus
28gttggaccgg gtcatgtttg gggtgctgga gacaaacatc tagagaacct agagaatcta
60cagtataatc atgcatggta aagtaccaac gctgcaagac gt
10229127DNAHuman papillomavirus 29tcagaggatg aggatgagga tgaagtagac
catttgcagg agcggccaca gcaagctaga 60caagctaaac aacatacgtg ttacctaata
cacgtacctt gttgtgagtg taagtttgtg 120gtgcagt
1273020DNAArtificialgroup-targeted HPV
primer or probe 30tggaccgggt catgtttggg
203122DNAArtificialgroup-targeted HPV primer or probe
31ctaatagcac atggttggac cg
223221DNAArtificialgroup-targeted HPV primer or probe 32aaggtgctac
agatgtcaaa g
213321DNAArtificialgroup-targeted HPV primer or probe 33gttggaccgg
gtcatgtttg g
213422DNAArtificialgroup-targeted HPV primer or probe 34tcagaggatg
aggatgagga tg
223520DNAArtificialgroup-targeted HPV primer or probe 35acgtcttgca
gcgttggtac
203622DNAArtificialgroup-targeted HPV primer or probe 36ggttctctag
atgtttgtct cc
223722DNAArtificialgroup-targeted HPV primer or probe 37actgcaccac
aaacttacac tc
223830DNAArtificialgroup-targeted HPV primer or probe 38acatctagag
aacctagaga atctacagta
303926DNAArtificialgroup-targeted HPV primer or probe 39ggtccaacca
tgtgctatta gatgaa
264020DNAArtificialgroup-targeted HPV primer or probe 40cggccacagc
aagctagaca
204144DNAArtificialgroup-targeted HPV primer or probe 41cgcgatcaca
tctagagaac ctagagaatc tacagtagat cgcg
444240DNAArtificialgroup-targeted HPV primer or probe 42cgcgatcggt
ccaaccatgt gctattagat gaagatcgcg
404338DNAArtificialgroup-targeted HPV primer or probe 43cgcctcggtc
caaccatgtg ctattagatg aagaggcg
384430DNAArtificialgroup-targeted HPV primer or probe 44cgcgacggcc
acagcaagct agacatcgcg
304532DNAArtificialgroup-targeted HPV primer or probe 45cgcctccggc
cacagcaagc tagacagagg cg
3246205DNAHuman papillomavirus 46tggtatagaa caggaatatc aaatattagt
gaagtaatgg gagacacacc tgagtggata 60caaagactta ctattataca acatggaata
gatgatagca attttgattt gtcagaaatg 120gtacaatggg catttgataa tgagctgaca
gatgaaagcg atatggcatt tgaatatgcc 180ttattagcag acagcaacag caatg
20547208DNAHuman papillomavirus
47tggtatagaa caggaatatc aaatattagt gaagtaatgg gagacacacc tgagtggata
60caaagactta ctattataca acatggaata gatgatagca attttgattt gtcagaaatg
120gtacaatggg catttgataa tgagctgaca gatgaaagcg atatggcatt tgaatatgcc
180ttattagcag acagcaacag caatgcag
20848209DNAHuman papillomavirus 48tggtatagaa caggaatatc aaatattagt
gaagtaatgg gagacacacc tgagtggata 60caaagactta ctattataca acatggaata
gatgatagca attttgattt gtcagaaatg 120gtacaatggg catttgataa tgagctgaca
gatgaaagcg atatggcatt tgaatatgcc 180ttattagcag acagcaacag caatgcagc
20949198DNAHuman papillomavirus
49gaacaggaat atcaaatatt agtgaagtaa tgggagacac acctgagtgg atacaaagac
60ttactattat acaacatgga atagatgata gcaattttga tttgtcagaa atggtacaat
120gggcatttga taatgagctg acagatgaaa gcgatatggc atttgaatat gccttattag
180cagacagcaa cagcaatg
19850201DNAHuman papillomavirus 50gaacaggaat atcaaatatt agtgaagtaa
tgggagacac acctgagtgg atacaaagac 60ttactattat acaacatgga atagatgata
gcaattttga tttgtcagaa atggtacaat 120gggcatttga taatgagctg acagatgaaa
gcgatatggc atttgaatat gccttattag 180cagacagcaa cagcaatgca g
20151202DNAHuman papillomavirus
51gaacaggaat atcaaatatt agtgaagtaa tgggagacac acctgagtgg atacaaagac
60ttactattat acaacatgga atagatgata gcaattttga tttgtcagaa atggtacaat
120gggcatttga taatgagctg acagatgaaa gcgatatggc atttgaatat gccttattag
180cagacagcaa cagcaatgca gc
20252168DNAHuman papillomavirus 52tggtatagaa caggaatatc aaatattagt
gaagtaatgg gagacacacc tgagtggata 60caaagactta ctattataca acatggaata
gatgatagca attttgattt gtcagaaatg 120gtacaatggg catttgataa tgagctgaca
gatgaaagcg atatggca 16853171DNAHuman papillomavirus
53tggtatagaa caggaatatc aaatattagt gaagtaatgg gagacacacc tgagtggata
60caaagactta ctattataca acatggaata gatgatagca attttgattt gtcagaaatg
120gtacaatggg catttgataa tgagctgaca gatgaaagcg atatggcatt t
17154167DNAHuman papillomavirus 54ggtatagaac aggaatatca aatattagtg
aagtaatggg agacacacct gagtggatac 60aaagacttac tattatacaa catggaatag
atgatagcaa ttttgatttg tcagaaatgg 120tacaatgggc atttgataat gagctgacag
atgaaagcga tatggca 16755170DNAHuman papillomavirus
55ggtatagaac aggaatatca aatattagtg aagtaatggg agacacacct gagtggatac
60aaagacttac tattatacaa catggaatag atgatagcaa ttttgatttg tcagaaatgg
120tacaatgggc atttgataat gagctgacag atgaaagcga tatggcattt
17056166DNAHuman papillomavirus 56gtatagaaca ggaatatcaa atattagtga
agtaatggga gacacacctg agtggataca 60aagacttact attatacaac atggaataga
tgatagcaat tttgatttgt cagaaatggt 120acaatgggca tttgataatg agctgacaga
tgaaagcgat atggca 16657169DNAHuman papillomavirus
57gtatagaaca ggaatatcaa atattagtga agtaatggga gacacacctg agtggataca
60aagacttact attatacaac atggaataga tgatagcaat tttgatttgt cagaaatggt
120acaatgggca tttgataatg agctgacaga tgaaagcgat atggcattt
16958114DNAHuman papillomavirus 58tgatagcaat tttgatttgt cagaaatggt
acaatgggca tttgataatg agctgacaga 60tgaaagcgat atggcatttg aatatgcctt
attagcagac agcaacagca atgc 11459117DNAHuman papillomavirus
59tgatagcaat tttgatttgt cagaaatggt acaatgggca tttgataatg agctgacaga
60tgaaagcgat atggcatttg aatatgcctt attagcagac agcaacagca atgcagc
11760113DNAHuman papillomavirus 60gatagcaatt ttgatttgtc agaaatggta
caatgggcat ttgataatga gctgacagat 60gaaagcgata tggcatttga atatgcctta
ttagcagaca gcaacagcaa tgc 11361116DNAHuman papillomavirus
61gatagcaatt ttgatttgtc agaaatggta caatgggcat ttgataatga gctgacagat
60gaaagcgata tggcatttga atatgcctta ttagcagaca gcaacagcaa tgcagc
11662122DNAHuman papillomavirus 62ggaatagatg atagcaattt tgatttgtca
gaaatggtac aatgggcatt tgataatgag 60ctgacagatg aaagcgatat ggcatttgaa
tatgccttat tagcagacag caacagcaat 120gc
12263125DNAHuman papillomavirus
63ggaatagatg atagcaattt tgatttgtca gaaatggtac aatgggcatt tgataatgag
60ctgacagatg aaagcgatat ggcatttgaa tatgccttat tagcagacag caacagcaat
120gcagc
12564117DNAHuman papillomavirus 64ggctgatcca gaaggtacag acggggaggg
cacgggttgt aacggctggt tttatgtaca 60agctattgta gacaaaaaaa caggagatgt
aatatcagat gacgaggacg aaaatgc 11765129DNAHuman papillomavirus
65ggctgatcca gaaggtacag acggggaggg cacgggttgt aacggctggt tttatgtaca
60agctattgta gacaaaaaaa caggagatgt aatatcagat gacgaggacg aaaatgcaac
120agacacagg
12966113DNAHuman papillomavirus 66gatccagaag gtacagacgg ggagggcacg
ggttgtaacg gctggtttta tgtacaagct 60attgtagaca aaaaaacagg agatgtaata
tcagatgacg aggacgaaaa tgc 11367125DNAHuman papillomavirus
67gatccagaag gtacagacgg ggagggcacg ggttgtaacg gctggtttta tgtacaagct
60attgtagaca aaaaaacagg agatgtaata tcagatgacg aggacgaaaa tgcaacagac
120acagg
1256824DNAArtificialgroup-targeted HPV primer or probe 68tggtatagaa
caggaatatc aaat
246924DNAArtificialgroup-targeted HPV primer or probe 69gaacaggtat
atccaatatt agtg
247022DNAArtificialgroup-targeted HPV primer or probe 70gaacaggaat
gtccaatatt ag
227126DNAArtificialgroup-targeted HPV primer or probe 71tggtatagaa
caggaatatc aaatat
267221DNAArtificialgroup-targeted HPV primer or probe 72gtacagaaca
ggaatgtcca a
217320DNAArtificialgroup-targeted HPV primer or probe 73ggtatcgcac
aggtatatcc
207423DNAArtificialgroup-targeted HPV primer or probe 74tgatagcaat
tttgatttgt cag
237522DNAArtificialgroup-targeted HPV primer or probe 75gatagcgtat
ttgacctatc ag
227625DNAArtificialgroup-targeted HPV primer or probe 76ggaatagatg
atagtgtatt tgatc
257722DNAArtificialgroup-targeted HPV primer or probe 77ggccgatcca
gaaggtacag ac
227821DNAArtificialgroup-targeted HPV primer or probe 78caatcgtgaa
ggtacagatg g
217918DNAArtificialgroup-targeted HPV primer or probe 79cattgctgtt
gcagtctg
188020DNAArtificialgroup-targeted HPV primer or probe 80gcagcattac
tgttacaatc
208121DNAArtificialgroup-targeted HPV primer or probe 81cggcgttact
attactatct g
218220DNAArtificialgroup-targeted HPV primer or probe 82tgccatatcg
ctttcatctg
208323DNAArtificialgroup-targeted HPV primer or probe 83aaatgctata
tcactttcat ctg
238419DNAArtificialgroup-targeted HPV primer or probe 84gcattactgt
tgctgtctg
198522DNAArtificialgroup-targeted HPV primer or probe 85gcggcattac
tattacaatc tg
228622DNAArtificialgroup-targeted HPV primer or probe 86gcattttcat
cctcatcctc tg
228720DNAArtificialgroup-targeted HPV primer or probe 87cctgtgtctg
ttgcattttc
208822DNAArtificialgroup-targeted HPV primer or probe 88cagatgaaag
cgatatggca tt
228923DNAArtificialgroup-targeted HPV primer or probe 89cagatgaaag
tgatattgca tat
239023DNAArtificialgroup-targeted HPV primer or probe 90ctgatgaaag
tgacatagca ttt
239123DNAArtificialgroup-targeted HPV primer or probe 91cagatgaaag
tgatatggca ttt
239225DNAArtificialgroup-targeted HPV primer or probe 92tggaatagat
gatagtgtat ttgat
259323DNAArtificialgroup-targeted HPV primer or probe 93gatagcaatt
ttgatttgtc aga
239422DNAArtificialgroup-targeted HPV primer or probe 94agttgatgat
agcgtgtttg ac
229524DNAArtificialgroup-targeted HPV primer or probe 95cgatagtaat
tttgatttgt caga
249623DNAArtificialgroup-targeted HPV primer or probe 96aatgagttaa
cagatgaaag tga
239727DNAArtificialgroup-targeted HPV primer or probe 97gtaatggctg
gttctttgta gaaacaa
279827DNAArtificialgroup-targeted HPV primer or probe 98gtaacggctg
gttttatgta caagcta
279928DNAArtificialgroup-targeted HPV primer or probe 99gtaatggatg
gttttttgta caggcaat
2810028DNAArtificialgroup-targeted HPV primer or probe 100gtaacggatg
gttttttgta caagcaat
2810125DNAArtificialgroup-targeted HPV primer or probe 101ggtgtaatgg
ctggttcttt gtaga
2510234DNAArtificialgroup-targeted HPV primer or probe 102cgacgtcaga
tgaaagcgat atggcattac gtcg
3410335DNAArtificialgroup-targeted HPV primer or probe 103cgacgtcaga
tgaaagtgat attgcatata cgtcg
3510435DNAArtificialgroup-targeted HPV primer or probe 104cgacgtctga
tgaaagtgac atagcattta cgtcg
3510535DNAArtificialgroup-targeted HPV primer or probe 105ccgagtcaga
tgaaagtgat atggcattta ctcgg
3510637DNAArtificialgroup-targeted HPV primer or probe 106acgtcgtgga
atagatgata gtgtatttga tcgacgt
3710735DNAArtificialgroup-targeted HPV primer or probe 107cgcagtgata
gcaattttga tttgtcagaa ctgcg
3510834DNAArtificialgroup-targeted HPV primer or probe 108acgtcgagtt
gatgatagcg tgtttgaccg acgt
3410934DNAArtificialgroup-targeted HPV primer or probe 109ccggctagtt
gatgatagcg tgtttgacag ccgg
3411036DNAArtificialgroup-targeted HPV primer or probe 110cgcagtcgat
agtaattttg atttgtcaga actgcg
3611135DNAArtificialgroup-targeted HPV primer or probe 111cgcagtcaga
tgaaagtgat atggcattta ctgcg
3511235DNAArtificialgroup-targeted HPV primer or probe 112cgtcgtctga
tgaaagtgac atagcattta cgacg
3511335DNAArtificialgroup-targeted HPV primer or probe 113cgaggtcaga
tgaaagtgat attgcatata cctcg
3511435DNAArtificialgroup-targeted HPV primer or probe 114ccacgtaatg
agttaacaga tgaaagtgaa cgtgg
3511539DNAArtificialgroup-targeted HPV primer or probe 115cgcgacgtaa
tggctggttc tttgtagaaa caagtcgcg
3911641DNAArtificialgroup-targeted HPV primer or probe 116cgcgatcgta
acggctggtt ttatgtacaa gctagatcgc g
4111742DNAArtificialgroup-targeted HPV primer or probe 117cgcgatcgta
atggatggtt ttttgtacag gcaatgatcg cg
4211840DNAArtificialgroup-targeted HPV primer or probe 118cgcgctgtaa
cggatggttt tttgtacaag caatagcgcg
4011937DNAArtificialgroup-targeted HPV primer or probe 119cgcgatggtg
taatggctgg ttctttgtag aatcgcg
3712039DNAArtificialgroup-targeted HPV primer or probe 120cgcgatcggt
gtaatggctg gttctttgta gagatcgcg
3912139DNAArtificialgroup-targeted HPV primer or probe 121ctcgctcggt
gtaatggctg gttctttgta gagagcgag
3912288DNAHuman papillomavirus 122ggacgtggtc cagattaagt ttgcacgagg
acgaggacaa ggaaaacgat ggagactctt 60tgccaacgtt taaatgtgtg tcaggaca
88123191DNAHuman papillomavirus
123tagtaacact acacccatag tacatttaaa aggtgatgct aatactttaa aatgtttaag
60atatagattt aaaaagcatt gtacattgta tactgcagtg tcgtctacat ggcattggac
120aggacataat gtaaaacata aaagtgcaat tgttacactt acatatgata gtgaatggca
180acgtgaccaa t
191124194DNAHuman papillomavirus 124tagtaacact acacccatag tacatttaaa
aggtgatgct aatactttaa aatgtttaag 60atatagattt aaaaagcatt gtacattgta
tactgcagtg tcgtctacat ggcattggac 120aggacataat gtaaaacata aaagtgcaat
tgttacactt acatatgata gtgaatggca 180acgtgaccaa tttt
194125192DNAHuman papillomavirus
125tagtaacact acacccatag tacatttaaa aggtgatgct aatactttaa aatgtttaag
60atatagattt aaaaagcatt gtacattgta tactgcagtg tcgtctacat ggcattggac
120aggacataat gtaaaacata aaagtgcaat tgttacactt acatatgata gtgaatggca
180acgtgaccaa tt
192126198DNAHuman papillomavirus 126tagtaacact acacccatag tacatttaaa
aggtgatgct aatactttaa aatgtttaag 60atatagattt aaaaagcatt gtacattgta
tactgcagtg tcgtctacat ggcattggac 120aggacataat gtaaaacata aaagtgcaat
tgttacactt acatatgata gtgaatggca 180acgtgaccaa tttttgtc
198127196DNAHuman papillomavirus
127tagtaacact acacccatag tacatttaaa aggtgatgct aatactttaa aatgtttaag
60atatagattt aaaaagcatt gtacattgta tactgcagtg tcgtctacat ggcattggac
120aggacataat gtaaaacata aaagtgcaat tgttacactt acatatgata gtgaatggca
180acgtgaccaa tttttg
196128190DNAHuman papillomavirus 128agtaacacta cacccatagt acatttaaaa
ggtgatgcta atactttaaa atgtttaaga 60tatagattta aaaagcattg tacattgtat
actgcagtgt cgtctacatg gcattggaca 120ggacataatg taaaacataa aagtgcaatt
gttacactta catatgatag tgaatggcaa 180cgtgaccaat
190129193DNAHuman papillomavirus
129agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
60tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
120ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
180cgtgaccaat ttt
193130191DNAHuman papillomavirus 130agtaacacta cacccatagt acatttaaaa
ggtgatgcta atactttaaa atgtttaaga 60tatagattta aaaagcattg tacattgtat
actgcagtgt cgtctacatg gcattggaca 120ggacataatg taaaacataa aagtgcaatt
gttacactta catatgatag tgaatggcaa 180cgtgaccaat t
191131197DNAHuman papillomavirus
131agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
60tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
120ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
180cgtgaccaat ttttgtc
197132195DNAHuman papillomavirus 132agtaacacta cacccatagt acatttaaaa
ggtgatgcta atactttaaa atgtttaaga 60tatagattta aaaagcattg tacattgtat
actgcagtgt cgtctacatg gcattggaca 120ggacataatg taaaacataa aagtgcaatt
gttacactta catatgatag tgaatggcaa 180cgtgaccaat ttttg
195133189DNAHuman papillomavirus
133tagtaacact acacccatag tacatttaaa aggtgatgct aatactttaa aatgtttaag
60atatagattt aaaaagcatt gtacattgta tactgcagtg tcgtctacat ggcattggac
120aggacataat gtaaaacata aaagtgcaat tgttacactt acatatgata gtgaatggca
180acgtgacca
189134193DNAHuman papillomavirus 134tagtaacact acacccatag tacatttaaa
aggtgatgct aatactttaa aatgtttaag 60atatagattt aaaaagcatt gtacattgta
tactgcagtg tcgtctacat ggcattggac 120aggacataat gtaaaacata aaagtgcaat
tgttacactt acatatgata gtgaatggca 180acgtgaccaa ttt
193135191DNAHuman papillomavirus
135tagtaacact acacccatag tacatttaaa aggtgatgct aatactttaa aatgtttaag
60atatagattt aaaaagcatt gtacattgta tactgcagtg tcgtctacat ggcattggac
120aggacataat gtaaaacata aaagtgcaat tgttacactt acatatgata gtgaatggca
180acgtgaccaa t
191136188DNAHuman papillomavirus 136agtaacacta cacccatagt acatttaaaa
ggtgatgcta atactttaaa atgtttaaga 60tatagattta aaaagcattg tacattgtat
actgcagtgt cgtctacatg gcattggaca 120ggacataatg taaaacataa aagtgcaatt
gttacactta catatgatag tgaatggcaa 180cgtgacca
188137192DNAHuman papillomavirus
137agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
60tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
120ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
180cgtgaccaat tt
192138190DNAHuman papillomavirus 138agtaacacta cacccatagt acatttaaaa
ggtgatgcta atactttaaa atgtttaaga 60tatagattta aaaagcattg tacattgtat
actgcagtgt cgtctacatg gcattggaca 120ggacataatg taaaacataa aagtgcaatt
gttacactta catatgatag tgaatggcaa 180cgtgaccaat
190139182DNAHuman papillomavirus
139actacaccca tagtacattt aaaaggtgat gctaatactt taaaatgttt aagatataga
60tttaaaaagc attgtacatt gtatactgca gtgtcgtcta catggcattg gacaggacat
120aatgtaaaac ataaaagtgc aattgttaca cttacatatg atagtgaatg gcaacgtgac
180ca
182140186DNAHuman papillomavirus 140actacaccca tagtacattt aaaaggtgat
gctaatactt taaaatgttt aagatataga 60tttaaaaagc attgtacatt gtatactgca
gtgtcgtcta catggcattg gacaggacat 120aatgtaaaac ataaaagtgc aattgttaca
cttacatatg atagtgaatg gcaacgtgac 180caattt
186141184DNAHuman papillomavirus
141actacaccca tagtacattt aaaaggtgat gctaatactt taaaatgttt aagatataga
60tttaaaaagc attgtacatt gtatactgca gtgtcgtcta catggcattg gacaggacat
120aatgtaaaac ataaaagtgc aattgttaca cttacatatg atagtgaatg gcaacgtgac
180caat
184142179DNAHuman papillomavirus 142acacccatag tacatttaaa aggtgatgct
aatactttaa aatgtttaag atatagattt 60aaaaagcatt gtacattgta tactgcagtg
tcgtctacat ggcattggac aggacataat 120gtaaaacata aaagtgcaat tgttacactt
acatatgata gtgaatggca acgtgacca 179143183DNAHuman papillomavirus
143acacccatag tacatttaaa aggtgatgct aatactttaa aatgtttaag atatagattt
60aaaaagcatt gtacattgta tactgcagtg tcgtctacat ggcattggac aggacataat
120gtaaaacata aaagtgcaat tgttacactt acatatgata gtgaatggca acgtgaccaa
180ttt
183144181DNAHuman papillomavirus 144acacccatag tacatttaaa aggtgatgct
aatactttaa aatgtttaag atatagattt 60aaaaagcatt gtacattgta tactgcagtg
tcgtctacat ggcattggac aggacataat 120gtaaaacata aaagtgcaat tgttacactt
acatatgata gtgaatggca acgtgaccaa 180t
181145180DNAHuman papillomavirus
145tacacccata gtacatttaa aaggtgatgc taatacttta aaatgtttaa gatatagatt
60taaaaagcat tgtacattgt atactgcagt gtcgtctaca tggcattgga caggacataa
120tgtaaaacat aaaagtgcaa ttgttacact tacatatgat agtgaatggc aacgtgacca
180146184DNAHuman papillomavirus 146tacacccata gtacatttaa aaggtgatgc
taatacttta aaatgtttaa gatatagatt 60taaaaagcat tgtacattgt atactgcagt
gtcgtctaca tggcattgga caggacataa 120tgtaaaacat aaaagtgcaa ttgttacact
tacatatgat agtgaatggc aacgtgacca 180attt
184147182DNAHuman papillomavirus
147tacacccata gtacatttaa aaggtgatgc taatacttta aaatgtttaa gatatagatt
60taaaaagcat tgtacattgt atactgcagt gtcgtctaca tggcattgga caggacataa
120tgtaaaacat aaaagtgcaa ttgttacact tacatatgat agtgaatggc aacgtgacca
180at
182148163DNAHuman papillomavirus 148taaaaggtga tgctaatact ttaaaatgtt
taagatatag atttaaaaag cattgtacat 60tgtatactgc agtgtcgtct acatggcatt
ggacaggaca taatgtaaaa cataaaagtg 120caattgttac acttacatat gatagtgaat
ggcaacgtga cca 163149167DNAHuman papillomavirus
149taaaaggtga tgctaatact ttaaaatgtt taagatatag atttaaaaag cattgtacat
60tgtatactgc agtgtcgtct acatggcatt ggacaggaca taatgtaaaa cataaaagtg
120caattgttac acttacatat gatagtgaat ggcaacgtga ccaattt
167150165DNAHuman papillomavirus 150taaaaggtga tgctaatact ttaaaatgtt
taagatatag atttaaaaag cattgtacat 60tgtatactgc agtgtcgtct acatggcatt
ggacaggaca taatgtaaaa cataaaagtg 120caattgttac acttacatat gatagtgaat
ggcaacgtga ccaat 165151168DNAHuman papillomavirus
151acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg
60tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa
120aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgacca
168152172DNAHuman papillomavirus 152acatttaaaa ggtgatgcta atactttaaa
atgtttaaga tatagattta aaaagcattg 60tacattgtat actgcagtgt cgtctacatg
gcattggaca ggacataatg taaaacataa 120aagtgcaatt gttacactta catatgatag
tgaatggcaa cgtgaccaat tt 172153170DNAHuman papillomavirus
153acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg
60tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa
120aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat
170154164DNAHuman papillomavirus 154ttaaaaggtg atgctaatac tttaaaatgt
ttaagatata gatttaaaaa gcattgtaca 60ttgtatactg cagtgtcgtc tacatggcat
tggacaggac ataatgtaaa acataaaagt 120gcaattgtta cacttacata tgatagtgaa
tggcaacgtg acca 164155168DNAHuman papillomavirus
155ttaaaaggtg atgctaatac tttaaaatgt ttaagatata gatttaaaaa gcattgtaca
60ttgtatactg cagtgtcgtc tacatggcat tggacaggac ataatgtaaa acataaaagt
120gcaattgtta cacttacata tgatagtgaa tggcaacgtg accaattt
168156166DNAHuman papillomavirus 156ttaaaaggtg atgctaatac tttaaaatgt
ttaagatata gatttaaaaa gcattgtaca 60ttgtatactg cagtgtcgtc tacatggcat
tggacaggac ataatgtaaa acataaaagt 120gcaattgtta cacttacata tgatagtgaa
tggcaacgtg accaat 166157215DNAHuman papillomavirus
157taaaaggtga tgctaatact ttaaaatgtt taagatatag atttaaaaag cattgtacat
60tgtatactgc agtgtcgtct acatggcatt ggacaggaca taatgtaaaa cataaaagtg
120caattgttac acttacatat gatagtgaat ggcaacgtga ccaatttttg tctcaagtta
180aaataccaaa aactattaca gtgtctactg gattt
215158206DNAHuman papillomavirus 158taaaaggtga tgctaatact ttaaaatgtt
taagatatag atttaaaaag cattgtacat 60tgtatactgc agtgtcgtct acatggcatt
ggacaggaca taatgtaaaa cataaaagtg 120caattgttac acttacatat gatagtgaat
ggcaacgtga ccaatttttg tctcaagtta 180aaataccaaa aactattaca gtgtct
206159205DNAHuman papillomavirus
159taaaaggtga tgctaatact ttaaaatgtt taagatatag atttaaaaag cattgtacat
60tgtatactgc agtgtcgtct acatggcatt ggacaggaca taatgtaaaa cataaaagtg
120caattgttac acttacatat gatagtgaat ggcaacgtga ccaatttttg tctcaagtta
180aaataccaaa aactattaca gtgtc
205160212DNAHuman papillomavirus 160taaaaggtga tgctaatact ttaaaatgtt
taagatatag atttaaaaag cattgtacat 60tgtatactgc agtgtcgtct acatggcatt
ggacaggaca taatgtaaaa cataaaagtg 120caattgttac acttacatat gatagtgaat
ggcaacgtga ccaatttttg tctcaagtta 180aaataccaaa aactattaca gtgtctactg
ga 212161220DNAHuman papillomavirus
161acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg
60tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa
120aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca
180agttaaaata ccaaaaacta ttacagtgtc tactggattt
220162211DNAHuman papillomavirus 162acatttaaaa ggtgatgcta atactttaaa
atgtttaaga tatagattta aaaagcattg 60tacattgtat actgcagtgt cgtctacatg
gcattggaca ggacataatg taaaacataa 120aagtgcaatt gttacactta catatgatag
tgaatggcaa cgtgaccaat ttttgtctca 180agttaaaata ccaaaaacta ttacagtgtc t
211163210DNAHuman papillomavirus
163acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg
60tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa
120aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca
180agttaaaata ccaaaaacta ttacagtgtc
210164217DNAHuman papillomavirus 164acatttaaaa ggtgatgcta atactttaaa
atgtttaaga tatagattta aaaagcattg 60tacattgtat actgcagtgt cgtctacatg
gcattggaca ggacataatg taaaacataa 120aagtgcaatt gttacactta catatgatag
tgaatggcaa cgtgaccaat ttttgtctca 180agttaaaata ccaaaaacta ttacagtgtc
tactgga 217165216DNAHuman papillomavirus
165ttaaaaggtg atgctaatac tttaaaatgt ttaagatata gatttaaaaa gcattgtaca
60ttgtatactg cagtgtcgtc tacatggcat tggacaggac ataatgtaaa acataaaagt
120gcaattgtta cacttacata tgatagtgaa tggcaacgtg accaattttt gtctcaagtt
180aaaataccaa aaactattac agtgtctact ggattt
216166207DNAHuman papillomavirus 166ttaaaaggtg atgctaatac tttaaaatgt
ttaagatata gatttaaaaa gcattgtaca 60ttgtatactg cagtgtcgtc tacatggcat
tggacaggac ataatgtaaa acataaaagt 120gcaattgtta cacttacata tgatagtgaa
tggcaacgtg accaattttt gtctcaagtt 180aaaataccaa aaactattac agtgtct
207167206DNAHuman papillomavirus
167ttaaaaggtg atgctaatac tttaaaatgt ttaagatata gatttaaaaa gcattgtaca
60ttgtatactg cagtgtcgtc tacatggcat tggacaggac ataatgtaaa acataaaagt
120gcaattgtta cacttacata tgatagtgaa tggcaacgtg accaattttt gtctcaagtt
180aaaataccaa aaactattac agtgtc
206168213DNAHuman papillomavirus 168ttaaaaggtg atgctaatac tttaaaatgt
ttaagatata gatttaaaaa gcattgtaca 60ttgtatactg cagtgtcgtc tacatggcat
tggacaggac ataatgtaaa acataaaagt 120gcaattgtta cacttacata tgatagtgaa
tggcaacgtg accaattttt gtctcaagtt 180aaaataccaa aaactattac agtgtctact
gga 213169140DNAHuman papillomavirus
169gtcgtctaca tggcattgga caggacataa tgtaaaacat aaaagtgcaa ttgttacact
60tacatatgat agtgaatggc aacgtgacca atttttgtct caagttaaaa taccaaaaac
120tattacagtg tctactggat
140170133DNAHuman papillomavirus 170gtcgtctaca tggcattgga caggacataa
tgtaaaacat aaaagtgcaa ttgttacact 60tacatatgat agtgaatggc aacgtgacca
atttttgtct caagttaaaa taccaaaaac 120tattacagtg tct
133171132DNAHuman papillomavirus
171gtcgtctaca tggcattgga caggacataa tgtaaaacat aaaagtgcaa ttgttacact
60tacatatgat agtgaatggc aacgtgacca atttttgtct caagttaaaa taccaaaaac
120tattacagtg tc
132172142DNAHuman papillomavirus 172gtcgtctaca tggcattgga caggacataa
tgtaaaacat aaaagtgcaa ttgttacact 60tacatatgat agtgaatggc aacgtgacca
atttttgtct caagttaaaa taccaaaaac 120tattacagtg tctactggat tt
142173141DNAHuman papillomavirus
173gtcgtctaca tggcattgga caggacataa tgtaaaacat aaaagtgcaa ttgttacact
60tacatatgat agtgaatggc aacgtgacca atttttgtct caagttaaaa taccaaaaac
120tattacagtg tctactggat t
141174139DNAHuman papillomavirus 174gtcgtctaca tggcattgga caggacataa
tgtaaaacat aaaagtgcaa ttgttacact 60tacatatgat agtgaatggc aacgtgacca
atttttgtct caagttaaaa taccaaaaac 120tattacagtg tctactgga
139175148DNAHuman papillomavirus
175actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt
60gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata
120ccaaaaacta ttacagtgtc tactggat
148176141DNAHuman papillomavirus 176actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt 60gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata 120ccaaaaacta ttacagtgtc t
141177140DNAHuman papillomavirus
177actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt
60gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata
120ccaaaaacta ttacagtgtc
140178150DNAHuman papillomavirus 178actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt 60gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata 120ccaaaaacta ttacagtgtc tactggattt
150179149DNAHuman papillomavirus
179actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa aagtgcaatt
60gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca agttaaaata
120ccaaaaacta ttacagtgtc tactggatt
149180147DNAHuman papillomavirus 180actgcagtgt cgtctacatg gcattggaca
ggacataatg taaaacataa aagtgcaatt 60gttacactta catatgatag tgaatggcaa
cgtgaccaat ttttgtctca agttaaaata 120ccaaaaacta ttacagtgtc tactgga
147181146DNAHuman papillomavirus
181tgcagtgtcg tctacatggc attggacagg acataatgta aaacataaaa gtgcaattgt
60tacacttaca tatgatagtg aatggcaacg tgaccaattt ttgtctcaag ttaaaatacc
120aaaaactatt acagtgtcta ctggat
146182139DNAHuman papillomavirus 182tgcagtgtcg tctacatggc attggacagg
acataatgta aaacataaaa gtgcaattgt 60tacacttaca tatgatagtg aatggcaacg
tgaccaattt ttgtctcaag ttaaaatacc 120aaaaactatt acagtgtct
139183138DNAHuman papillomavirus
183tgcagtgtcg tctacatggc attggacagg acataatgta aaacataaaa gtgcaattgt
60tacacttaca tatgatagtg aatggcaacg tgaccaattt ttgtctcaag ttaaaatacc
120aaaaactatt acagtgtc
138184148DNAHuman papillomavirus 184tgcagtgtcg tctacatggc attggacagg
acataatgta aaacataaaa gtgcaattgt 60tacacttaca tatgatagtg aatggcaacg
tgaccaattt ttgtctcaag ttaaaatacc 120aaaaactatt acagtgtcta ctggattt
148185147DNAHuman papillomavirus
185tgcagtgtcg tctacatggc attggacagg acataatgta aaacataaaa gtgcaattgt
60tacacttaca tatgatagtg aatggcaacg tgaccaattt ttgtctcaag ttaaaatacc
120aaaaactatt acagtgtcta ctggatt
147186145DNAHuman papillomavirus 186tgcagtgtcg tctacatggc attggacagg
acataatgta aaacataaaa gtgcaattgt 60tacacttaca tatgatagtg aatggcaacg
tgaccaattt ttgtctcaag ttaaaatacc 120aaaaactatt acagtgtcta ctgga
145187143DNAHuman papillomavirus
187agtgtcgtct acatggcatt ggacaggaca taatgtaaaa cataaaagtg caattgttac
60acttacatat gatagtgaat ggcaacgtga ccaatttttg tctcaagtta aaataccaaa
120aactattaca gtgtctactg gat
143188136DNAHuman papillomavirus 188agtgtcgtct acatggcatt ggacaggaca
taatgtaaaa cataaaagtg caattgttac 60acttacatat gatagtgaat ggcaacgtga
ccaatttttg tctcaagtta aaataccaaa 120aactattaca gtgtct
136189135DNAHuman papillomavirus
189agtgtcgtct acatggcatt ggacaggaca taatgtaaaa cataaaagtg caattgttac
60acttacatat gatagtgaat ggcaacgtga ccaatttttg tctcaagtta aaataccaaa
120aactattaca gtgtc
135190145DNAHuman papillomavirus 190agtgtcgtct acatggcatt ggacaggaca
taatgtaaaa cataaaagtg caattgttac 60acttacatat gatagtgaat ggcaacgtga
ccaatttttg tctcaagtta aaataccaaa 120aactattaca gtgtctactg gattt
145191144DNAHuman papillomavirus
191agtgtcgtct acatggcatt ggacaggaca taatgtaaaa cataaaagtg caattgttac
60acttacatat gatagtgaat ggcaacgtga ccaatttttg tctcaagtta aaataccaaa
120aactattaca gtgtctactg gatt
144192142DNAHuman papillomavirus 192agtgtcgtct acatggcatt ggacaggaca
taatgtaaaa cataaaagtg caattgttac 60acttacatat gatagtgaat ggcaacgtga
ccaatttttg tctcaagtta aaataccaaa 120aactattaca gtgtctactg ga
142193144DNAHuman papillomavirus
193cagtgtcgtc tacatggcat tggacaggac ataatgtaaa acataaaagt gcaattgtta
60cacttacata tgatagtgaa tggcaacgtg accaattttt gtctcaagtt aaaataccaa
120aaactattac agtgtctact ggat
144194137DNAHuman papillomavirus 194cagtgtcgtc tacatggcat tggacaggac
ataatgtaaa acataaaagt gcaattgtta 60cacttacata tgatagtgaa tggcaacgtg
accaattttt gtctcaagtt aaaataccaa 120aaactattac agtgtct
137195136DNAHuman papillomavirus
195cagtgtcgtc tacatggcat tggacaggac ataatgtaaa acataaaagt gcaattgtta
60cacttacata tgatagtgaa tggcaacgtg accaattttt gtctcaagtt aaaataccaa
120aaactattac agtgtc
136196146DNAHuman papillomavirus 196cagtgtcgtc tacatggcat tggacaggac
ataatgtaaa acataaaagt gcaattgtta 60cacttacata tgatagtgaa tggcaacgtg
accaattttt gtctcaagtt aaaataccaa 120aaactattac agtgtctact ggattt
146197145DNAHuman papillomavirus
197cagtgtcgtc tacatggcat tggacaggac ataatgtaaa acataaaagt gcaattgtta
60cacttacata tgatagtgaa tggcaacgtg accaattttt gtctcaagtt aaaataccaa
120aaactattac agtgtctact ggatt
145198143DNAHuman papillomavirus 198cagtgtcgtc tacatggcat tggacaggac
ataatgtaaa acataaaagt gcaattgtta 60cacttacata tgatagtgaa tggcaacgtg
accaattttt gtctcaagtt aaaataccaa 120aaactattac agtgtctact gga
143199141DNAHuman papillomavirus
199tgtcgtctac atggcattgg acaggacata atgtaaaaca taaaagtgca attgttacac
60ttacatatga tagtgaatgg caacgtgacc aatttttgtc tcaagttaaa ataccaaaaa
120ctattacagt gtctactgga t
141200134DNAHuman papillomavirus 200tgtcgtctac atggcattgg acaggacata
atgtaaaaca taaaagtgca attgttacac 60ttacatatga tagtgaatgg caacgtgacc
aatttttgtc tcaagttaaa ataccaaaaa 120ctattacagt gtct
134201133DNAHuman papillomavirus
201tgtcgtctac atggcattgg acaggacata atgtaaaaca taaaagtgca attgttacac
60ttacatatga tagtgaatgg caacgtgacc aatttttgtc tcaagttaaa ataccaaaaa
120ctattacagt gtc
133202143DNAHuman papillomavirus 202tgtcgtctac atggcattgg acaggacata
atgtaaaaca taaaagtgca attgttacac 60ttacatatga tagtgaatgg caacgtgacc
aatttttgtc tcaagttaaa ataccaaaaa 120ctattacagt gtctactgga ttt
143203142DNAHuman papillomavirus
203tgtcgtctac atggcattgg acaggacata atgtaaaaca taaaagtgca attgttacac
60ttacatatga tagtgaatgg caacgtgacc aatttttgtc tcaagttaaa ataccaaaaa
120ctattacagt gtctactgga tt
142204140DNAHuman papillomavirus 204tgtcgtctac atggcattgg acaggacata
atgtaaaaca taaaagtgca attgttacac 60ttacatatga tagtgaatgg caacgtgacc
aatttttgtc tcaagttaaa ataccaaaaa 120ctattacagt gtctactgga
140205142DNAHuman papillomavirus
205gtgtcgtcta catggcattg gacaggacat aatgtaaaac ataaaagtgc aattgttaca
60cttacatatg atagtgaatg gcaacgtgac caatttttgt ctcaagttaa aataccaaaa
120actattacag tgtctactgg at
142206135DNAHuman papillomavirus 206gtgtcgtcta catggcattg gacaggacat
aatgtaaaac ataaaagtgc aattgttaca 60cttacatatg atagtgaatg gcaacgtgac
caatttttgt ctcaagttaa aataccaaaa 120actattacag tgtct
135207134DNAHuman papillomavirus
207gtgtcgtcta catggcattg gacaggacat aatgtaaaac ataaaagtgc aattgttaca
60cttacatatg atagtgaatg gcaacgtgac caatttttgt ctcaagttaa aataccaaaa
120actattacag tgtc
134208144DNAHuman papillomavirus 208gtgtcgtcta catggcattg gacaggacat
aatgtaaaac ataaaagtgc aattgttaca 60cttacatatg atagtgaatg gcaacgtgac
caatttttgt ctcaagttaa aataccaaaa 120actattacag tgtctactgg attt
144209143DNAHuman papillomavirus
209gtgtcgtcta catggcattg gacaggacat aatgtaaaac ataaaagtgc aattgttaca
60cttacatatg atagtgaatg gcaacgtgac caatttttgt ctcaagttaa aataccaaaa
120actattacag tgtctactgg att
143210141DNAHuman papillomavirus 210gtgtcgtcta catggcattg gacaggacat
aatgtaaaac ataaaagtgc aattgttaca 60cttacatatg atagtgaatg gcaacgtgac
caatttttgt ctcaagttaa aataccaaaa 120actattacag tgtctactgg a
14121123DNAArtificialgroup-targeted HPV
primer or probe 211aggacgtggt ccagattaag ttt
2321220DNAArtificialgroup-targeted HPV primer or probe
212aggacgtggt gcagattaag
2021323DNAArtificialgroup-targeted HPV primer or probe 213aggacgtggt
gcaaattaag ttt
2321423DNAArtificialgroup-targeted HPV primer or probe 214aggacgtggt
gcagattaaa ttt
2321523DNAArtificialgroup-targeted HPV primer or probe 215aggacgtggt
gcagattagg ttt
2321623DNAArtificialgroup-targeted HPV primer or probe 216aggacgtggt
gcaaattaaa ttt
2321723DNAArtificialgroup-targeted HPV primer or probe 217aggacgtggt
gcaaattagg ttt
2321825DNAArtificialgroup-targeted HPV primer or probe 218tagtaacact
acacccatag tacat
2521921DNAArtificialgroup-targeted HPV primer or probe 219tctaacgttg
cacctatcgt g
2122024DNAArtificialgroup-targeted HPV primer or probe 220tccttctact
gcacctataa taca
2422125DNAArtificialgroup-targeted HPV primer or probe 221tagtaccact
acacccatag tacat
2522224DNAArtificialgroup-targeted HPV primer or probe 222tctaacgttg
cacctatcgt gcat
2422325DNAArtificialgroup-targeted HPV primer or probe 223tccttctact
gcacctataa tacac
2522426DNAArtificialgroup-targeted HPV primer or probe 224actacaccta
tagtacattt aaaagg
2622522DNAArtificialgroup-targeted HPV primer or probe 225gcacctatag
tgcatttaaa ag
2222623DNAArtificialgroup-targeted HPV primer or probe 226tgcacctata
atacacctaa aag
2322725DNAArtificialgroup-targeted HPV primer or probe 227taaaaggtga
tgctaatact ttaaa
2522825DNAArtificialgroup-targeted HPV primer or probe 228taaaaggtga
tgcaaataca ttaaa
2522924DNAArtificialgroup-targeted HPV primer or probe 229gcatttaaaa
ggtgaatcaa atag
2423026DNAArtificialgroup-targeted HPV primer or probe 230ctaaaaggtg
atcctaatag tttaaa
2623120DNAArtificialgroup-targeted HPV primer or probe 231gtcgtctaca
tggcattgga
2023223DNAArtificialgroup-targeted HPV primer or probe 232caagatgctt
catctacatg gag
2323321DNAArtificialgroup-targeted HPV primer or probe 233agaagcgtca
tctacatgga g
2123421DNAArtificialgroup-targeted HPV primer or probe 234agtgtcgtct
acatggcatt g
2123523DNAArtificialgroup-targeted HPV primer or probe 235atatgtcatc
tacatggcat tgg
2323620DNAArtificialgroup-targeted HPV primer or probe 236tgtcatccac
atggcattgg
2023720DNAArtificialgroup-targeted HPV primer or probe 237atgtcatcca
catggcattg
2023821DNAArtificialgroup-targeted HPV primer or probe 238ttcatctacc
tggagttgga c
2123922DNAArtificialgroup-targeted HPV primer or probe 239tttcatctac
atggagttgg ac
2224022DNAArtificialgroup-targeted HPV primer or probe 240tgtcctgaca
cacatttaaa cg
2224121DNAArtificialgroup-targeted HPV primer or probe 241tgtcctgcac
tgcatttaaa c
2124219DNAArtificialgroup-targeted HPV primer or probe 242attggtcacg
ttgccattc
1924322DNAArtificialgroup-targeted HPV primer or probe 243aaaattgttg
acgttgtgtt tc
2224420DNAArtificialgroup-targeted HPV primer or probe 244aactgttgac
gttgtgtttc
2024519DNAArtificialgroup-targeted HPV primer or probe 245acatttgtcg
ttgcggttc
1924626DNAArtificialgroup-targeted HPV primer or probe 246gtctctttgt
gatgtactta tatatg
2624724DNAArtificialgroup-targeted HPV primer or probe 247ccctttgata
ttctgttgtg taag
2424817DNAArtificialgroup-targeted HPV primer or probe 248tggtcacgtt
gccattc
1724921DNAArtificialgroup-targeted HPV primer or probe 249aaaatcgtct
ctttgtgatg t
2125021DNAArtificialgroup-targeted HPV primer or probe 250aaacatttgt
tgttgctgtt c
2125124DNAArtificialgroup-targeted HPV primer or probe 251atttatccct
ttgatattct gttg
2425221DNAArtificialgroup-targeted HPV primer or probe 252aaacagttga
cgttgtgttt c
2125321DNAArtificialgroup-targeted HPV primer or probe 253aaactgttga
cgttgtgttt c
2125421DNAArtificialgroup-targeted HPV primer or probe 254aaattgttga
cgttgtgttt c
2125519DNAArtificialgroup-targeted HPV primer or probe 255acagttgtcg
ttgtgtttc
1925624DNAArtificialgroup-targeted HPV primer or probe 256aaatcctgta
gacactgtaa cagt
2425722DNAArtificialgroup-targeted HPV primer or probe 257acttatttgc
acagtaggtg gt
2225822DNAArtificialgroup-targeted HPV primer or probe 258cttacttgca
cagtagttgg ta
2225922DNAArtificialgroup-targeted HPV primer or probe 259atcctgttga
cactgatact gt
2226024DNAArtificialgroup-targeted HPV primer or probe 260tatcctgtag
acactgaaac tgtg
2426125DNAArtificialgroup-targeted HPV primer or probe 261aaatccagta
gacactgtaa tagtt
2526223DNAArtificialgroup-targeted HPV primer or probe 262atcctgtaga
cactgtaaca gtt
2326322DNAArtificialgroup-targeted HPV primer or probe 263cttacttgca
cagtaggtgg ta
2226424DNAArtificialgroup-targeted HPV primer or probe 264tatcctgtag
acactgaaac tgtg
2426521DNAArtificialgroup-targeted HPV primer or probe 265accgtactta
tttgcacagt g
2126622DNAArtificialgroup-targeted HPV primer or probe 266tccatcgttt
tccttgtcct ct
2226722DNAArtificialgroup-targeted HPV primer or probe 267tccatcgttt
tctttgacct ct
2226822DNAArtificialgroup-targeted HPV primer or probe 268tccatcattt
tctttgacct ct
2226924DNAArtificialgroup-targeted HPV primer or probe 269tctccatcat
tttctttgtc ctct
2427022DNAArtificialgroup-targeted HPV primer or probe 270ctccatcgtt
ttctttgtcc tc
2227124DNAArtificialgroup-targeted HPV primer or probe 271ctccatcatt
ttctttgacc tctc
2427224DNAArtificialgroup-targeted HPV primer or probe 272agtgtcgtct
acatggcatt ggac
2427325DNAArtificialgroup-targeted HPV primer or probe 273atatgtcatc
cacctggcat tggac
2527424DNAArtificialgroup-targeted HPV primer or probe 274atatgtcatc
cacctggcat tgga
2427525DNAArtificialgroup-targeted HPV primer or probe 275atgcttcatc
tacatggaga tggac
2527626DNAArtificialgroup-targeted HPV primer or probe 276caagtttcat
ctacatggca ttggac
2627720DNAArtificialgroup-targeted HPV primer or probe 277gatagtgaat
ggcaacgtga
2027823DNAArtificialgroup-targeted HPV primer or probe 278ataagtacat
cacaaagaga cga
2327923DNAArtificialgroup-targeted HPV primer or probe 279taactgaaca
gcaacaacaa atg
2328027DNAArtificialgroup-targeted HPV primer or probe 280cacaacagaa
tatcaaaggg ataaatt
2728121DNAArtificialgroup-targeted HPV primer or probe 281cgtacagtga
tgaaacacaa c
2128220DNAArtificialgroup-targeted HPV primer or probe 282aacggaaaca
caacgacaac
2028334DNAArtificialgroup-targeted HPV primer or probe 283cgcgattcca
tcgttttcct tgtcctctat cgcg
3428432DNAArtificialgroup-targeted HPV primer or probe 284cgcgatccat
cgttttcctt gtcctcttcg cg
3228534DNAArtificialgroup-targeted HPV primer or probe 285cgcgattcca
tcgttttctt tgacctctat cgcg
3428632DNAArtificialgroup-targeted HPV primer or probe 286cgcgatccat
cgttttcttt gacctcttcg cg
3228734DNAArtificialgroup-targeted HPV primer or probe 287cgcgattcca
tcattttctt tgacctctat cgcg
3428832DNAArtificialgroup-targeted HPV primer or probe 288cgcgatccat
cattttcttt gacctcttcg cg
3228932DNAArtificialgroup-targeted HPV primer or probe 289cgctgtccat
cattttcttt gacctctcag cg
3229034DNAArtificialgroup-targeted HPV primer or probe 290cgcgttctcc
atcattttct ttgtcctcta cgcg
3429134DNAArtificialgroup-targeted HPV primer or probe 291cgccgtctcc
atcattttct ttgtcctctc ggcg
3429236DNAArtificialgroup-targeted HPV primer or probe 292cgcgattctc
catcattttc tttgtcctct atcgcg
3629334DNAArtificialgroup-targeted HPV primer or probe 293cgcgatctcc
atcgttttct ttgtcctcat cgcg
3429434DNAArtificialgroup-targeted HPV primer or probe 294cgccgctcca
tcattttctt tgacctctcc ggcg
3429536DNAArtificialgroup-targeted HPV primer or probe 295cgcgatctcc
atcattttct ttgacctctc atcgcg
3629634DNAArtificialgroup-targeted HPV primer or probe 296cgcgaagtgt
cgtctacatg gcattggact cgcg
3429737DNAArtificialgroup-targeted HPV primer or probe 297cgctcgatat
gtcatccacc tggcattgga ccgagcg
3729837DNAArtificialgroup-targeted HPV primer or probe 298cgcatgatat
gtcatccacc tggcattgga ccatgcg
3729936DNAArtificialgroup-targeted HPV primer or probe 299cgcatgatat
gtcatccacc tggcattgga catgcg
3630036DNAArtificialgroup-targeted HPV primer or probe 300cgcatgatat
gtcatccacc tggcattgga catgcg
3630137DNAArtificialgroup-targeted HPV primer or probe 301ccgacgatgc
ttcatctaca tggagatgga ccgtcgg
3730238DNAArtificialgroup-targeted HPV primer or probe 302cgcgatcaag
tttcatctac atggcattgg acatcgcg
3830338DNAArtificialgroup-targeted HPV primer or probe 303cgcgagcaag
tttcatctac atggcattgg acctcgcg
3830432DNAArtificialgroup-targeted HPV primer or probe 304cagcgtgata
gtgaatggca acgtgaacgc tg
3230532DNAArtificialgroup-targeted HPV primer or probe 305cggactgata
gtgaatggca acgtgaagtc cg
3230632DNAArtificialgroup-targeted HPV primer or probe 306ctcgctgata
gtgaatggca acgtgaagcg ag
3230735DNAArtificialgroup-targeted HPV primer or probe 307cgagctataa
gtacatcaca aagagacgaa gctcg
3530835DNAArtificialgroup-targeted HPV primer or probe 308cgcagtataa
gtacatcaca aagagacgaa ctgcg
3530935DNAArtificialgroup-targeted HPV primer or probe 309cgcgttataa
gtacatcaca aagagacgaa acgcg
3531035DNAArtificialgroup-targeted HPV primer or probe 310cgaggttaac
tgaacagcaa caacaaatga cctcg
3531135DNAArtificialgroup-targeted HPV primer or probe 311cgcgattaac
tgaacagcaa caacaaatga tcgcg
3531235DNAArtificialgroup-targeted HPV primer or probe 312ccggcttaac
tgaacagcaa caacaaatga gccgg
3531339DNAArtificialgroup-targeted HPV primer or probe 313cgcgatcaca
acagaatatc aaagggataa attatcgcg
3931439DNAArtificialgroup-targeted HPV primer or probe 314cgcacgcaca
acagaatatc aaagggataa attcgtgcg
3931539DNAArtificialgroup-targeted HPV primer or probe 315ccggctcaca
acagaatatc aaagggataa attagccgg
3931633DNAArtificialgroup-targeted HPV primer or probe 316ccggctcgta
cagtgatgaa acacaacagc cgg
3331732DNAArtificialgroup-targeted HPV primer or probe 317cgaggtaacg
gaaacacaac gacaacacct cg
3231832DNAArtificialgroup-targeted HPV primer or probe 318cgcgttaacg
gaaacacaac gacaacaacg cg
3231932DNAArtificialgroup-targeted HPV primer or probe 319cgatgcaacg
gaaacacaac gacaacgcat cg
32320109DNAHuman papillomavirus 320ggcagtggaa agcagtggag acacccttcg
cgttgtacag cagatgttaa tgggcgaact 60aagcctggtt tgcccgtgtt gtgcgaacaa
ctagcaacgg cgatggact 109321131DNAHuman papillomavirus
321ggcagtggaa agcagtggag acacccttcg cgttgtacag cagatgttaa tgggcgaact
60aagcctggtt tgcccgtgtt gtgcgaacaa ctagcaacgg cgatggactg tgaaggtaca
120gaggatgagg g
131322142DNAHuman papillomavirus 322agctccgtgt tgcaggtgtt caagtgtagt
acaactggca gtggaaagca gtggagacac 60ccttcgcgtt gtacagcaga tgttaatggg
cgaactaagc ctggtttgcc cgtgttgtgc 120gaacaactag caacggcgat gg
142323167DNAHuman papillomavirus
323agctccgtgt tgcaggtgtt caagtgtagt acaactggca gtggaaagca gtggagacac
60ccttcgcgtt gtacagcaga tgttaatggg cgaactaagc ctggtttgcc cgtgttgtgc
120gaacaactag caacggcgat ggactgtgaa ggtacagagg atgaggg
167324200DNAHuman papillomavirus 324atatgcgtga ccagctacca gaaagacggg
ctggacaggc tacgtgttac agaattgaag 60ctccgtgttg caggtgttca agtgtagtac
aactggcagt ggaaagcagt ggagacaccc 120ttcgcgttgt acagcagatg ttaatgggcg
aactaagcct ggtttgcccg tgttgtgcga 180acaactagca acggcgatgg
200325203DNAHuman papillomavirus
325atatgcgtga ccagctacca gaaagacggg ctggacaggc tacgtgttac agaattgaag
60ctccgtgttg caggtgttca agtgtagtac aactggcagt ggaaagcagt ggagacaccc
120ttcgcgttgt acagcagatg ttaatgggcg aactaagcct ggtttgcccg tgttgtgcga
180acaactagca acggcgatgg act
203326225DNAHuman papillomavirus 326atatgcgtga ccagctacca gaaagacggg
ctggacaggc tacgtgttac agaattgaag 60ctccgtgttg caggtgttca agtgtagtac
aactggcagt ggaaagcagt ggagacaccc 120ttcgcgttgt acagcagatg ttaatgggcg
aactaagcct ggtttgcccg tgttgtgcga 180acaactagca acggcgatgg actgtgaagg
tacagaggat gaggg 225327151DNAHuman papillomavirus
327atatgcgtga ccagctacca gaaagacggg ctggacaggc tacgtgttac agaattgaag
60ctccgtgttg caggtgttca agtgtagtac aactggcagt ggaaagcagt ggagacaccc
120ttcgcgttgt acagcagatg ttaatgggcg a
151328167DNAHuman papillomavirus 328gacaggctac gtgttacaga attgaagctc
cgtgttgcag gtgttcaagt gtagtacaac 60tggcagtgga aagcagtgga gacacccttc
gcgttgtaca gcagatgtta atgggcgaac 120taagcctggt ttgcccgtgt tgtgcgaaca
actagcaacg gcgatgg 167329170DNAHuman papillomavirus
329gacaggctac gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac
60tggcagtgga aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac
120taagcctggt ttgcccgtgt tgtgcgaaca actagcaacg gcgatggact
170330118DNAHuman papillomavirus 330gacaggctac gtgttacaga attgaagctc
cgtgttgcag gtgttcaagt gtagtacaac 60tggcagtgga aagcagtgga gacacccttc
gcgttgtaca gcagatgtta atgggcga 118331174DNAHuman papillomavirus
331cgggctggac aggctacgtg ttacagaatt gaagctccgt gttgcaggtg ttcaagtgta
60gtacaactgg cagtggaaag cagtggagac acccttcgcg ttgtacagca gatgttaatg
120ggcgaactaa gcctggtttg cccgtgttgt gcgaacaact agcaacggcg atgg
174332177DNAHuman papillomavirus 332cgggctggac aggctacgtg ttacagaatt
gaagctccgt gttgcaggtg ttcaagtgta 60gtacaactgg cagtggaaag cagtggagac
acccttcgcg ttgtacagca gatgttaatg 120ggcgaactaa gcctggtttg cccgtgttgt
gcgaacaact agcaacggcg atggact 177333199DNAHuman papillomavirus
333cgggctggac aggctacgtg ttacagaatt gaagctccgt gttgcaggtg ttcaagtgta
60gtacaactgg cagtggaaag cagtggagac acccttcgcg ttgtacagca gatgttaatg
120ggcgaactaa gcctggtttg cccgtgttgt gcgaacaact agcaacggcg atggactgtg
180aaggtacaga ggatgaggg
199334288DNAHuman papillomavirus 334tggaccgggt catgtttggg gtgctggaga
caaacatcta gagaacctag agaatctaca 60gtataatcat gcatggtaaa gtaccaacgc
tgcaagacgt tgtattagaa ctaacacctc 120aaacagaaat tgacctacag tgcaatgagc
aattggacag ctcagaggat gaggatgagg 180atgaagtaga ccatttgcag gagcggccac
agcaagctag acaagctaaa caacatacgt 240gttacctaat acacgtacct tgttgtgagt
gtaagtttgt ggtgcagt 288335303DNAHuman papillomavirus
335ctaatagcac atggttggac cgggtcatgt ttggggtgct ggagacaaac atctagagaa
60cctagagaat ctacagtata atcatgcatg gtaaagtacc aacgctgcaa gacgttgtat
120tagaactaac acctcaaaca gaaattgacc tacagtgcaa tgagcaattg gacagctcag
180aggatgagga tgaggatgaa gtagaccatt tgcaggagcg gccacagcaa gctagacaag
240ctaaacaaca tacgtgttac ctaatacacg taccttgttg tgagtgtaag tttgtggtgc
300agt
303336191DNAHuman papillomavirus 336aaggtgctac agatgtcaaa gtccgttaac
tccggaggaa aagcaattgc attgtgacag 60aaaaagacga tttcatctaa tagcacatgg
ttggaccggg tcatgtttgg ggtgctggag 120acaaacatct agagaaccta gagaatctac
agtataatca tgcatggtaa agtaccaacg 180ctgcaagacg t
191337379DNAHuman papillomavirus
337aaggtgctac agatgtcaaa gtccgttaac tccggaggaa aagcaattgc attgtgacag
60aaaaagacga tttcatctaa tagcacatgg ttggaccggg tcatgtttgg ggtgctggag
120acaaacatct agagaaccta gagaatctac agtataatca tgcatggtaa agtaccaacg
180ctgcaagacg ttgtattaga actaacacct caaacagaaa ttgacctaca gtgcaatgag
240caattggaca gctcagagga tgaggatgag gatgaagtag accatttgca ggagcggcca
300cagcaagcta gacaagctaa acaacatacg tgttacctaa tacacgtacc ttgttgtgag
360tgtaagtttg tggtgcagt
379338290DNAHuman papillomavirus 338gttggaccgg gtcatgtttg gggtgctgga
gacaaacatc tagagaacct agagaatcta 60cagtataatc atgcatggta aagtaccaac
gctgcaagac gttgtattag aactaacacc 120tcaaacagaa attgacctac agtgcaatga
gcaattggac agctcagagg atgaggatga 180ggatgaagta gaccatttgc aggagcggcc
acagcaagct agacaagcta aacaacatac 240gtgttaccta atacacgtac cttgttgtga
gtgtaagttt gtggtgcagt 290339161DNAHuman papillomavirus
339gaacaggaat atcaaatatt agtgaagtaa tgggagacac acctgagtgg atacaaagac
60ttactattat acaacatgga atagatgata gcaattttga tttgtcagaa atggtacaat
120gggcatttga taatgagctg acagatgaaa gcgatatggc a
161340164DNAHuman papillomavirus 340gaacaggaat atcaaatatt agtgaagtaa
tgggagacac acctgagtgg atacaaagac 60ttactattat acaacatgga atagatgata
gcaattttga tttgtcagaa atggtacaat 120gggcatttga taatgagctg acagatgaaa
gcgatatggc attt 164341206DNAHuman papillomavirus
341tggtatagaa caggaatatc aaatattagt gaagtaatgg gagacacacc tgagtggata
60caaagactta ctattataca acatggaata gatgatagca attttgattt gtcagaaatg
120gtacaatggg catttgataa tgagctgaca gatgaaagcg atatggcatt tgaatatgcc
180ttattagcag acagcaacag caatgc
206342199DNAHuman papillomavirus 342gaacaggaat atcaaatatt agtgaagtaa
tgggagacac acctgagtgg atacaaagac 60ttactattat acaacatgga atagatgata
gcaattttga tttgtcagaa atggtacaat 120gggcatttga taatgagctg acagatgaaa
gcgatatggc atttgaatat gccttattag 180cagacagcaa cagcaatgc
199343203DNAHuman papillomavirus
343ggtatagaac aggaatatca aatattagtg aagtaatggg agacacacct gagtggatac
60aaagacttac tattatacaa catggaatag atgatagcaa ttttgatttg tcagaaatgg
120tacaatgggc atttgataat gagctacaga tgaaagcgat atggcatttg aatatgcctt
180attagcagac agcaacagca atg
203344207DNAHuman papillomavirus 344ggtatagaac aggaatatca aatattagtg
aagtaatggg agacacacct gagtggatac 60aaagacttac tattatacaa catggaatag
atgatagcaa ttttgatttg tcagaaatgg 120tacaatgggc atttgataat gagctgacag
atgaaagcga tatggcattt gaatatgcct 180tattagcaga cagcaacagc aatgcag
207345208DNAHuman papillomavirus
345ggtatagaac aggaatatca aatattagtg aagtaatggg agacacacct gagtggatac
60aaagacttac tattatacaa catggaatag atgatagcaa ttttgatttg tcagaaatgg
120tacaatgggc atttgataat gagctgacag atgaaagcga tatggcattt gaatatgcct
180tattagcaga cagcaacagc aatgcagc
208346203DNAHuman papillomavirus 346gtatagaaca ggaatatcaa atattagtga
agtaatggga gacacacctg agtggataca 60aagacttact attatacaac atggaataga
tgatagcaat tttgatttgt cagaaatggt 120acaatgggca tttgataatg agctgacaga
tgaaagcgat atggcatttg aatatgcctt 180attagcagac agcaacagca atg
203347206DNAHuman papillomavirus
347gtatagaaca ggaatatcaa atattagtga agtaatggga gacacacctg agtggataca
60aagacttact attatacaac atggaataga tgatagcaat tttgatttgt cagaaatggt
120acaatgggca tttgataatg agctgacaga tgaaagcgat atggcatttg aatatgcctt
180attagcagac agcaacagca atgcag
206348207DNAHuman papillomavirus 348gtatagaaca ggaatatcaa atattagtga
agtaatggga gacacacctg agtggataca 60aagacttact attatacaac atggaataga
tgatagcaat tttgatttgt cagaaatggt 120acaatgggca tttgataatg agctgacaga
tgaaagcgat atggcatttg aatatgcctt 180attagcagac agcaacagca atgcagc
207349206DNAHuman papillomavirus
349tggtatagaa caggaatatc aaatattagt gaagtaatgg gagacacacc tgagtggata
60caaagactta ctattataca acatggaata gatgatagca attttgattt gtcagaaatg
120gtacaatggg catttgataa tgagctgaca gatgaaagcg atatggcatt tgaatatgcc
180ttattagcag acagcaacag caatgc
206350205DNAHuman papillomavirus 350ggtatagaac aggaatatca aatattagtg
aagtaatggg agacacacct gagtggatac 60aaagacttac tattatacaa catggaatag
atgatagcaa ttttgatttg tcagaaatgg 120tacaatgggc atttgataat gagctgacag
atgaaagcga tatggcattt gaatatgcct 180tattagcaga cagcaacagc aatgc
205351204DNAHuman papillomavirus
351gtatagaaca ggaatatcaa atattagtga agtaatggga gacacacctg agtggataca
60aagacttact attatacaac atggaataga tgatagcaat tttgatttgt cagaaatggt
120acaatgggca tttgataatg agctgacaga tgaaagcgat atggcatttg aatatgcctt
180attagcagac agcaacagca atgc
204352207DNAHuman papillomavirus 352gtatagaaca ggaatatcaa atattagtga
agtaatggga gacacacctg agtggataca 60aagacttact attatacaac atggaataga
tgatagcaat tttgatttgt cagaaatggt 120acaatgggca tttgataatg agctgacaga
tgaaagcgat atggcatttg aatatgcctt 180attagcagac agcaacagca atgcagc
207353121DNAHuman papillomavirus
353ggaatagatg atagcaattt tgatttgtca gaaatggtac aatgggcatt tgataatgag
60ctgacagatg aaagcgatat ggcatttgaa tatgccttat tagcagacag caacagcaat
120g
121354124DNAHuman papillomavirus 354ggaatagatg atagcaattt tgatttgtca
gaaatggtac aatgggcatt tgataatgag 60ctgacagatg aaagcgatat ggcatttgaa
tatgccttat tagcagacag caacagcaat 120gcag
124355113DNAHuman papillomavirus
355tgatagcaat tttgatttgt cagaaatggt acaatgggca tttgataatg agctgacaga
60tgaaagcgat atggcatttg aatatgcctt attagcagac agcaacagca atg
113356116DNAHuman papillomavirus 356tgatagcaat tttgatttgt cagaaatggt
acaatgggca tttgataatg agctgacaga 60tgaaagcgat atggcatttg aatatgcctt
attagcagac agcaacagca atgcag 116357112DNAHuman papillomavirus
357gatagcaatt ttgatttgtc agaaatggta caatgggcat ttgataatga gctgacagat
60gaaagcgata tggcatttga atatgcctta ttagcagaca gcaacagcaa tg
112358115DNAHuman papillomavirus 358gatagcaatt ttgatttgtc agaaatggta
caatgggcat ttgataatga gctgacagat 60gaaagcgata tggcatttga atatgcctta
ttagcagaca gcaacagcaa tgcag 115359185DNAHuman papillomavirus
359actacaccca tagtacattt aaaaggtgat gctaatactt taaaatgttt aagatataga
60tttaaaaagc attgtacatt gtatactgca gtgtcgtcta catggcattg gacaggacat
120aatgtaaaac ataaaagtgc aattgttaca cttacatatg atagtgaatg gcaacgtgac
180caatt
185360187DNAHuman papillomavirus 360actacaccca tagtacattt aaaaggtgat
gctaatactt taaaatgttt aagatataga 60tttaaaaagc attgtacatt gtatactgca
gtgtcgtcta catggcattg gacaggacat 120aatgtaaaac ataaaagtgc aattgttaca
cttacatatg atagtgaatg gcaacgtgac 180caatttt
187361189DNAHuman papillomavirus
361actacaccca tagtacattt aaaaggtgat gctaatactt taaaatgttt aagatataga
60tttaaaaagc attgtacatt gtatactgca gtgtcgtcta catggcattg gacaggacat
120aatgtaaaac ataaaagtgc aattgttaca cttacatatg atagtgaatg gcaacgtgac
180caatttttg
189362191DNAHuman papillomavirus 362actacaccca tagtacattt aaaaggtgat
gctaatactt taaaatgttt aagatataga 60tttaaaaagc attgtacatt gtatactgca
gtgtcgtcta catggcattg gacaggacat 120aatgtaaaac ataaaagtgc aattgttaca
cttacatatg atagtgaatg gcaacgtgac 180caatttttgt c
191363182DNAHuman papillomavirus
363tacacccata gtacatttaa aaggtgatgc taatacttta aaatgtttaa gatatagatt
60taaaaagcat tgtacattgt atactgcagt gtcgtctaca tggcattgga caggacataa
120tgtaaaacat aaaagtgcaa ttgttacact tacatatgat agtgaatggc aacgtgacca
180at
182364183DNAHuman papillomavirus 364tacacccata gtacatttaa aaggtgatgc
taatacttta aaatgtttaa gatatagatt 60taaaaagcat tgtacattgt atactgcagt
gtcgtctaca tggcattgga caggacataa 120tgtaaaacat aaaagtgcaa ttgttacact
tacatatgat agtgaatggc aacgtgacca 180att
183365185DNAHuman papillomavirus
365tacacccata gtacatttaa aaggtgatgc taatacttta aaatgtttaa gatatagatt
60taaaaagcat tgtacattgt atactgcagt gtcgtctaca tggcattgga caggacataa
120tgtaaaacat aaaagtgcaa ttgttacact tacatatgat agtgaatggc aacgtgacca
180atttt
185366187DNAHuman papillomavirus 366tacacccata gtacatttaa aaggtgatgc
taatacttta aaatgtttaa gatatagatt 60taaaaagcat tgtacattgt atactgcagt
gtcgtctaca tggcattgga caggacataa 120tgtaaaacat aaaagtgcaa ttgttacact
tacatatgat agtgaatggc aacgtgacca 180atttttg
187367189DNAHuman papillomavirus
367tacacccata gtacatttaa aaggtgatgc taatacttta aaatgtttaa gatatagatt
60taaaaagcat tgtacattgt atactgcagt gtcgtctaca tggcattgga caggacataa
120tgtaaaacat aaaagtgcaa ttgttacact tacatatgat agtgaatggc aacgtgacca
180atttttgtc
189368182DNAHuman papillomavirus 368acacccatag tacatttaaa aggtgatgct
aatactttaa aatgtttaag atatagattt 60aaaaagcatt gtacattgta tactgcagtg
tcgtctacat ggcattggac aggacataat 120gtaaaacata aaagtgcaat tgttacactt
acatatgata gtgaatggca acgtgaccaa 180tt
182369184DNAHuman papillomavirus
369acacccatag tacatttaaa aggtgatgct aatactttaa aatgtttaag atatagattt
60aaaaagcatt gtacattgta tactgcagtg tcgtctacat ggcattggac aggacataat
120gtaaaacata aaagtgcaat tgttacactt acatatgata gtgaatggca acgtgaccaa
180tttt
184370186DNAHuman papillomavirus 370acacccatag tacatttaaa aggtgatgct
aatactttaa aatgtttaag atatagattt 60aaaaagcatt gtacattgta tactgcagtg
tcgtctacat ggcattggac aggacataat 120gtaaaacata aaagtgcaat tgttacactt
acatatgata gtgaatggca acgtgaccaa 180tttttg
186371188DNAHuman papillomavirus
371acacccatag tacatttaaa aggtgatgct aatactttaa aatgtttaag atatagattt
60aaaaagcatt gtacattgta tactgcagtg tcgtctacat ggcattggac aggacataat
120gtaaaacata aaagtgcaat tgttacactt acatatgata gtgaatggca acgtgaccaa
180tttttgtc
188372231DNAHuman papillomavirus 372tagtaacact acacccatag tacatttaaa
aggtgatgct aatactttaa aatgtttaag 60atatagattt aaaaagcatt gtacattgta
tactgcagtg tcgtctacat ggcattggac 120aggacataat gtaaaacata aaagtgcaat
tgttacactt acatatgata gtgaatggca 180acgtgaccaa tttttgtctc aagttaaaat
accaaaaact attacagtgt c 231373232DNAHuman papillomavirus
373tagtaacact acacccatag tacatttaaa aggtgatgct aatactttaa aatgtttaag
60atatagattt aaaaagcatt gtacattgta tactgcagtg tcgtctacat ggcattggac
120aggacataat gtaaaacata aaagtgcaat tgttacactt acatatgata gtgaatggca
180acgtgaccaa tttttgtctc aagttaaaat accaaaaact attacagtgt ct
232374238DNAHuman papillomavirus 374tagtaacact acacccatag tacatttaaa
aggtgatgct aatactttaa aatgtttaag 60atatagattt aaaaagcatt gtacattgta
tactgcagtg tcgtctacat ggcattggac 120aggacataat gtaaaacata aaagtgcaat
tgttacactt acatatgata gtgaatggca 180acgtgaccaa tttttgtctc aagttaaaat
accaaaaact attacagtgt ctactgga 238375239DNAHuman papillomavirus
375tagtaacact acacccatag tacatttaaa aggtgatgct aatactttaa aatgtttaag
60atatagattt aaaaagcatt gtacattgta tactgcagtg tcgtctacat ggcattggac
120aggacataat gtaaaacata aaagtgcaat tgttacactt acatatgata gtgaatggca
180acgtgaccaa tttttgtctc aagttaaaat accaaaaact attacagtgt ctactggat
239376240DNAHuman papillomavirus 376tagtaacact acacccatag tacatttaaa
aggtgatgct aatactttaa aatgtttaag 60atatagattt aaaaagcatt gtacattgta
tactgcagtg tcgtctacat ggcattggac 120aggacataat gtaaaacata aaagtgcaat
tgttacactt acatatgata gtgaatggca 180acgtgaccaa tttttgtctc aagttaaaat
accaaaaact attacagtgt ctactggatt 240377241DNAHuman papillomavirus
377tagtaacact acacccatag tacatttaaa aggtgatgct aatactttaa aatgtttaag
60atatagattt aaaaagcatt gtacattgta tactgcagtg tcgtctacat ggcattggac
120aggacataat gtaaaacata aaagtgcaat tgttacactt acatatgata gtgaatggca
180acgtgaccaa tttttgtctc aagttaaaat accaaaaact attacagtgt ctactggatt
240t
241378230DNAHuman papillomavirus 378agtaacacta cacccatagt acatttaaaa
ggtgatgcta atactttaaa atgtttaaga 60tatagattta aaaagcattg tacattgtat
actgcagtgt cgtctacatg gcattggaca 120ggacataatg taaaacataa aagtgcaatt
gttacactta catatgatag tgaatggcaa 180cgtgaccaat ttttgtctca agttaaaata
ccaaaaacta ttacagtgtc 230379231DNAHuman papillomavirus
379agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
60tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
120ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
180cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc t
231380237DNAHuman papillomavirus 380agtaacacta cacccatagt acatttaaaa
ggtgatgcta atactttaaa atgtttaaga 60tatagattta aaaagcattg tacattgtat
actgcagtgt cgtctacatg gcattggaca 120ggacataatg taaaacataa aagtgcaatt
gttacactta catatgatag tgaatggcaa 180cgtgaccaat ttttgtctca agttaaaata
ccaaaaacta ttacagtgtc tactgga 237381238DNAHuman papillomavirus
381agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
60tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
120ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
180cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggat
238382239DNAHuman papillomavirus 382agtaacacta cacccatagt acatttaaaa
ggtgatgcta atactttaaa atgtttaaga 60tatagattta aaaagcattg tacattgtat
actgcagtgt cgtctacatg gcattggaca 120ggacataatg taaaacataa aagtgcaatt
gttacactta catatgatag tgaatggcaa 180cgtgaccaat ttttgtctca agttaaaata
ccaaaaacta ttacagtgtc tactggatt 239383240DNAHuman papillomavirus
383agtaacacta cacccatagt acatttaaaa ggtgatgcta atactttaaa atgtttaaga
60tatagattta aaaagcattg tacattgtat actgcagtgt cgtctacatg gcattggaca
120ggacataatg taaaacataa aagtgcaatt gttacactta catatgatag tgaatggcaa
180cgtgaccaat ttttgtctca agttaaaata ccaaaaacta ttacagtgtc tactggattt
240384224DNAHuman papillomavirus 384actacaccca tagtacattt aaaaggtgat
gctaatactt taaaatgttt aagatataga 60tttaaaaagc attgtacatt gtatactgca
gtgtcgtcta catggcattg gacaggacat 120aatgtaaaac ataaaagtgc aattgttaca
cttacatatg atagtgaatg gcaacgtgac 180caatttttgt ctcaagttaa aataccaaaa
actattacag tgtc 224385225DNAHuman papillomavirus
385actacaccca tagtacattt aaaaggtgat gctaatactt taaaatgttt aagatataga
60tttaaaaagc attgtacatt gtatactgca gtgtcgtcta catggcattg gacaggacat
120aatgtaaaac ataaaagtgc aattgttaca cttacatatg atagtgaatg gcaacgtgac
180caatttttgt ctcaagttaa aataccaaaa actattacag tgtct
225386231DNAHuman papillomavirus 386actacaccca tagtacattt aaaaggtgat
gctaatactt taaaatgttt aagatataga 60tttaaaaagc attgtacatt gtatactgca
gtgtcgtcta catggcattg gacaggacat 120aatgtaaaac ataaaagtgc aattgttaca
cttacatatg atagtgaatg gcaacgtgac 180caatttttgt ctcaagttaa aataccaaaa
actattacag tgtctactgg a 231387232DNAHuman papillomavirus
387actacaccca tagtacattt aaaaggtgat gctaatactt taaaatgttt aagatataga
60tttaaaaagc attgtacatt gtatactgca gtgtcgtcta catggcattg gacaggacat
120aatgtaaaac ataaaagtgc aattgttaca cttacatatg atagtgaatg gcaacgtgac
180caatttttgt ctcaagttaa aataccaaaa actattacag tgtctactgg at
232388233DNAHuman papillomavirus 388actacaccca tagtacattt aaaaggtgat
gctaatactt taaaatgttt aagatataga 60tttaaaaagc attgtacatt gtatactgca
gtgtcgtcta catggcattg gacaggacat 120aatgtaaaac ataaaagtgc aattgttaca
cttacatatg atagtgaatg gcaacgtgac 180caatttttgt ctcaagttaa aataccaaaa
actattacag tgtctactgg att 233389234DNAHuman papillomavirus
389actacaccca tagtacattt aaaaggtgat gctaatactt taaaatgttt aagatataga
60tttaaaaagc attgtacatt gtatactgca gtgtcgtcta catggcattg gacaggacat
120aatgtaaaac ataaaagtgc aattgttaca cttacatatg atagtgaatg gcaacgtgac
180caatttttgt ctcaagttaa aataccaaaa actattacag tgtctactgg attt
234390222DNAHuman papillomavirus 390tacacccata gtacatttaa aaggtgatgc
taatacttta aaatgtttaa gatatagatt 60taaaaagcat tgtacattgt atactgcagt
gtcgtctaca tggcattgga caggacataa 120tgtaaaacat aaaagtgcaa ttgttacact
tacatatgat agtgaatggc aacgtgacca 180atttttgtct caagttaaaa taccaaaaac
tattacagtg tc 222391223DNAHuman papillomavirus
391tacacccata gtacatttaa aaggtgatgc taatacttta aaatgtttaa gatatagatt
60taaaaagcat tgtacattgt atactgcagt gtcgtctaca tggcattgga caggacataa
120tgtaaaacat aaaagtgcaa ttgttacact tacatatgat agtgaatggc aacgtgacca
180atttttgtct caagttaaaa taccaaaaac tattacagtg tct
223392229DNAHuman papillomavirus 392tacacccata gtacatttaa aaggtgatgc
taatacttta aaatgtttaa gatatagatt 60taaaaagcat tgtacattgt atactgcagt
gtcgtctaca tggcattgga caggacataa 120tgtaaaacat aaaagtgcaa ttgttacact
tacatatgat agtgaatggc aacgtgacca 180atttttgtct caagttaaaa taccaaaaac
tattacagtg tctactgga 229393230DNAHuman papillomavirus
393tacacccata gtacatttaa aaggtgatgc taatacttta aaatgtttaa gatatagatt
60taaaaagcat tgtacattgt atactgcagt gtcgtctaca tggcattgga caggacataa
120tgtaaaacat aaaagtgcaa ttgttacact tacatatgat agtgaatggc aacgtgacca
180atttttgtct caagttaaaa taccaaaaac tattacagtg tctactggat
230394231DNAHuman papillomavirus 394tacacccata gtacatttaa aaggtgatgc
taatacttta aaatgtttaa gatatagatt 60taaaaagcat tgtacattgt atactgcagt
gtcgtctaca tggcattgga caggacataa 120tgtaaaacat aaaagtgcaa ttgttacact
tacatatgat agtgaatggc aacgtgacca 180atttttgtct caagttaaaa taccaaaaac
tattacagtg tctactggat t 231395232DNAHuman papillomavirus
395tacacccata gtacatttaa aaggtgatgc taatacttta aaatgtttaa gatatagatt
60taaaaagcat tgtacattgt atactgcagt gtcgtctaca tggcattgga caggacataa
120tgtaaaacat aaaagtgcaa ttgttacact tacatatgat agtgaatggc aacgtgacca
180atttttgtct caagttaaaa taccaaaaac tattacagtg tctactggat tt
232396221DNAHuman papillomavirus 396acacccatag tacatttaaa aggtgatgct
aatactttaa aatgtttaag atatagattt 60aaaaagcatt gtacattgta tactgcagtg
tcgtctacat ggcattggac aggacataat 120gtaaaacata aaagtgcaat tgttacactt
acatatgata gtgaatggca acgtgaccaa 180tttttgtctc aagttaaaat accaaaaact
attacagtgt c 221397222DNAHuman papillomavirus
397acacccatag tacatttaaa aggtgatgct aatactttaa aatgtttaag atatagattt
60aaaaagcatt gtacattgta tactgcagtg tcgtctacat ggcattggac aggacataat
120gtaaaacata aaagtgcaat tgttacactt acatatgata gtgaatggca acgtgaccaa
180tttttgtctc aagttaaaat accaaaaact attacagtgt ct
222398228DNAHuman papillomavirus 398acacccatag tacatttaaa aggtgatgct
aatactttaa aatgtttaag atatagattt 60aaaaagcatt gtacattgta tactgcagtg
tcgtctacat ggcattggac aggacataat 120gtaaaacata aaagtgcaat tgttacactt
acatatgata gtgaatggca acgtgaccaa 180tttttgtctc aagttaaaat accaaaaact
attacagtgt ctactgga 228399229DNAHuman papillomavirus
399acacccatag tacatttaaa aggtgatgct aatactttaa aatgtttaag atatagattt
60aaaaagcatt gtacattgta tactgcagtg tcgtctacat ggcattggac aggacataat
120gtaaaacata aaagtgcaat tgttacactt acatatgata gtgaatggca acgtgaccaa
180tttttgtctc aagttaaaat accaaaaact attacagtgt ctactggat
229400230DNAHuman papillomavirus 400acacccatag tacatttaaa aggtgatgct
aatactttaa aatgtttaag atatagattt 60aaaaagcatt gtacattgta tactgcagtg
tcgtctacat ggcattggac aggacataat 120gtaaaacata aaagtgcaat tgttacactt
acatatgata gtgaatggca acgtgaccaa 180tttttgtctc aagttaaaat accaaaaact
attacagtgt ctactggatt 230401231DNAHuman papillomavirus
401acacccatag tacatttaaa aggtgatgct aatactttaa aatgtttaag atatagattt
60aaaaagcatt gtacattgta tactgcagtg tcgtctacat ggcattggac aggacataat
120gtaaaacata aaagtgcaat tgttacactt acatatgata gtgaatggca acgtgaccaa
180tttttgtctc aagttaaaat accaaaaact attacagtgt ctactggatt t
231402171DNAHuman papillomavirus 402acatttaaaa ggtgatgcta atactttaaa
atgtttaaga tatagattta aaaagcattg 60tacattgtat actgcagtgt cgtctacatg
gcattggaca ggacataatg taaaacataa 120aagtgcaatt gttacactta catatgatag
tgaatggcaa cgtgaccaat t 171403173DNAHuman papillomavirus
403acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg
60tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa
120aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttt
173404175DNAHuman papillomavirus 404acatttaaaa ggtgatgcta atactttaaa
atgtttaaga tatagattta aaaagcattg 60tacattgtat actgcagtgt cgtctacatg
gcattggaca ggacataatg taaaacataa 120aagtgcaatt gttacactta catatgatag
tgaatggcaa cgtgaccaat ttttg 175405177DNAHuman papillomavirus
405acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg
60tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa
120aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtc
177406167DNAHuman papillomavirus 406ttaaaaggtg atgctaatac tttaaaatgt
ttaagatata gatttaaaaa gcattgtaca 60ttgtatactg cagtgtcgtc tacatggcat
tggacaggac ataatgtaaa acataaaagt 120gcaattgtta cacttacata tgatagtgaa
tggcaacgtg accaatt 167407169DNAHuman papillomavirus
407ttaaaaggtg atgctaatac tttaaaatgt ttaagatata gatttaaaaa gcattgtaca
60ttgtatactg cagtgtcgtc tacatggcat tggacaggac ataatgtaaa acataaaagt
120gcaattgtta cacttacata tgatagtgaa tggcaacgtg accaatttt
169408171DNAHuman papillomavirus 408ttaaaaggtg atgctaatac tttaaaatgt
ttaagatata gatttaaaaa gcattgtaca 60ttgtatactg cagtgtcgtc tacatggcat
tggacaggac ataatgtaaa acataaaagt 120gcaattgtta cacttacata tgatagtgaa
tggcaacgtg accaattttt g 171409173DNAHuman papillomavirus
409ttaaaaggtg atgctaatac tttaaaatgt ttaagatata gatttaaaaa gcattgtaca
60ttgtatactg cagtgtcgtc tacatggcat tggacaggac ataatgtaaa acataaaagt
120gcaattgtta cacttacata tgatagtgaa tggcaacgtg accaattttt gtc
173410166DNAHuman papillomavirus 410taaaaggtga tgctaatact ttaaaatgtt
taagatatag atttaaaaag cattgtacat 60tgtatactgc agtgtcgtct acatggcatt
ggacaggaca taatgtaaaa cataaaagtg 120caattgttac acttacatat gatagtgaat
ggcaacgtga ccaatt 166411168DNAHuman papillomavirus
411taaaaggtga tgctaatact ttaaaatgtt taagatatag atttaaaaag cattgtacat
60tgtatactgc agtgtcgtct acatggcatt ggacaggaca taatgtaaaa cataaaagtg
120caattgttac acttacatat gatagtgaat ggcaacgtga ccaatttt
168412170DNAHuman papillomavirus 412taaaaggtga tgctaatact ttaaaatgtt
taagatatag atttaaaaag cattgtacat 60tgtatactgc agtgtcgtct acatggcatt
ggacaggaca taatgtaaaa cataaaagtg 120caattgttac acttacatat gatagtgaat
ggcaacgtga ccaatttttg 170413172DNAHuman papillomavirus
413taaaaggtga tgctaatact ttaaaatgtt taagatatag atttaaaaag cattgtacat
60tgtatactgc agtgtcgtct acatggcatt ggacaggaca taatgtaaaa cataaaagtg
120caattgttac acttacatat gatagtgaat ggcaacgtga ccaatttttg tc
172414218DNAHuman papillomavirus 414acatttaaaa ggtgatgcta atactttaaa
atgtttaaga tatagattta aaaagcattg 60tacattgtat actgcagtgt cgtctacatg
gcattggaca ggacataatg taaaacataa 120aagtgcaatt gttacactta catatgatag
tgaatggcaa cgtgaccaat ttttgtctca 180agttaaaata ccaaaaacta ttacagtgtc
tactggat 218415219DNAHuman papillomavirus
415acatttaaaa ggtgatgcta atactttaaa atgtttaaga tatagattta aaaagcattg
60tacattgtat actgcagtgt cgtctacatg gcattggaca ggacataatg taaaacataa
120aagtgcaatt gttacactta catatgatag tgaatggcaa cgtgaccaat ttttgtctca
180agttaaaata ccaaaaacta ttacagtgtc tactggatt
219416214DNAHuman papillomavirus 416ttaaaaggtg atgctaatac tttaaaatgt
ttaagatata gatttaaaaa gcattgtaca 60ttgtatactg cagtgtcgtc tacatggcat
tggacaggac ataatgtaaa acataaaagt 120gcaattgtta cacttacata tgatagtgaa
tggcaacgtg accaattttt gtctcaagtt 180aaaataccaa aaactattac agtgtctact
ggat 214417215DNAHuman papillomavirus
417ttaaaaggtg atgctaatac tttaaaatgt ttaagatata gatttaaaaa gcattgtaca
60ttgtatactg cagtgtcgtc tacatggcat tggacaggac ataatgtaaa acataaaagt
120gcaattgtta cacttacata tgatagtgaa tggcaacgtg accaattttt gtctcaagtt
180aaaataccaa aaactattac agtgtctact ggatt
215418213DNAHuman papillomavirus 418taaaaggtga tgctaatact ttaaaatgtt
taagatatag atttaaaaag cattgtacat 60tgtatactgc agtgtcgtct acatggcatt
ggacaggaca taatgtaaaa cataaaagtg 120caattgttac acttacatat gatagtgaat
ggcaacgtga ccaatttttg tctcaagtta 180aaataccaaa aactattaca gtgtctactg
gat 213419214DNAHuman papillomavirus
419taaaaggtga tgctaatact ttaaaatgtt taagatatag atttaaaaag cattgtacat
60tgtatactgc agtgtcgtct acatggcatt ggacaggaca taatgtaaaa cataaaagtg
120caattgttac acttacatat gatagtgaat ggcaacgtga ccaatttttg tctcaagtta
180aaataccaaa aactattaca gtgtctactg gatt
2144207844DNAHuman papillomavirus 420gaaagtttca atcatacttt tatatattgg
gagtgaccga aaagggttta agaccgaaaa 60cggtacatat aaaaggcagc ttattctgtg
tggacatatc catggagcca caattcaaca 120atccacagga acgtccacga agcctgcacc
acttgagtga ggtattagaa atacctttaa 180ttgatcttag attatcatgt gtatattgca
aaaaagaact aacacgtgct gaggtatata 240attttgcatg cactgaatta aaattagtgt
atagggatga ttttccttat gcagtgtgca 300gagtatgttt attgttttat agtaaagtta
gaaaatatag gtattatgac tattcagtgt 360atggagctac actagaaagt ataactaaaa
aacagttatg tgatttatta ataaggtgct 420acagatgtca aagtccgtta actccggagg
aaaagcaatt gcattgtgac agaaaaagac 480gatttcatct aatagcacat ggttggaccg
ggtcatgttt ggggtgctgg agacaaacat 540ctagagaacc tagagaatct acagtataat
catgcatggt aaagtaccaa cgctgcaaga 600cgttgtatta gaactaacac ctcaaacaga
aattgaccta cagtgcaatg agcaattgga 660cagctcagag gatgaggatg aggatgaagt
agaccatttg caggagcggc cacagcaagc 720tagacaagct aaacaacata cgtgttacct
aatacacgta ccttgttgtg agtgtaagtt 780tgtggtgcag ttggacattc agagtaccaa
agaggacctg cgtgttgtac aacagctgct 840tatgggtgcg ttaacagtaa cgtgcccact
ctgcgcatca agtaactaac tgcaatggcg 900tcacctgaag gtacagatgg ggaggggaag
ggatgttgtg gatggtttga agtagaggca 960attgtagaaa aaaaaacagg agataaaata
tcagatgatg aaagtgacga ggaggatgaa 1020atagatacag atttagatgg atttatagac
gattcatata tacaaaatat acaggcagac 1080gcagaaacag tcaacaattg ttgcaagtac
aaacagcaca tgcagataaa cagacgttgc 1140aaaaactaaa acgaaagtat atagctagtc
cattaaggga tattagtaat cagcaaactg 1200tgtgccggga aggagtaaaa cggaggctta
ttttatcaga cctacaagac agcgggtatg 1260gcaatacatt ggaaactctg gaaacaccag
aacaggtaga tgaagaggta cagggacgtg 1320ggtgcgggaa tacacaaaat ggaggctcac
aaaacagtac ctatagtaac aatagtgagg 1380actctgtaat acatatggat attgatagaa
acaatgaaac gccaacacaa caattgcagg 1440acttgtttaa aagtagcaat ttacaaggta
aattatatta taaatttaaa gaagtgtatg 1500gtattccatt ttcagaattg gtgcgtacgt
ttaaaagtga tagtacatgt tgcaatgatt 1560ggatatgtgc tatatttggt gttaatgaaa
cattagccga ggcactaaaa actataataa 1620aaccacactg tatgtattat catatgcaat
gtttaacatg tacatggggg gttatagtaa 1680tgatgctaat tagatataca tgtggcaaaa
acagaaaaac aattgcaaaa gcattaagct 1740caatattaaa tgtaccacag gagcaaatgt
taattcaacc accaaaaata cgaagtcctg 1800ctgtagcttt atatttttat aaaacagcaa
tgtcaaatat tagtgatgtg tatggagaca 1860caccagaatg gatacaaaga caaacacaat
tgcaacacag tttacaggat agtcaatttg 1920aattatctaa aatggtgcag tgggcatttg
ataatgaagt aacagatgat agccaaattg 1980cgtttcaata tgcacaatta gcagatgtag
acagcaatgc acaagccttt ttaaaaagca 2040atatgcaggc aaaatatgta aaggattgtg
gaataatgtg tagacattat aaaagggcac 2100aacagcaaca aatgaatatg tgccagtgga
taaagcacat atgtagtaaa acagatgaag 2160ggggtgattg gaaacccatt gtacaatttt
taagatatca aggggtcgat ttcatttcat 2220ttctaagtta ctttaaatta tttctacaag
gaacacctaa acataactgt ttggtacttt 2280gtggaccgcc aaatacaggt aaatcatgct
ttgctatgag tcttataaag ttttttcaag 2340ggtctgtcat ttcatttgtg aattcacaaa
gccacttttg gttgcagcca ttagacaatg 2400ctaaacttgg gttgttggat gatgcaacag
aaatatgttg gaaatatata gacgattatt 2460taaggaattt ggtagatgga aatcctataa
gtttagatag aaaacataaa caattagtac 2520aaataaaatg tccaccatta ctaattacaa
ccaatataaa tcctatgcta gatgctaaat 2580tacgatattt acacagtaga atgttagtgt
ttcagtttca aaatccattt ccattagata 2640ataatggtaa tcctgtatat gaattaagta
atgtaaactg gaaatgtttc tttacaagga 2700cgtggtccag attaaatttg gataacgacg
aggacaaaga aaacaatgga gacgctttcc 2760caacgtttaa atgcgtgcca gaacaaaata
ctagactgtt ttgaaaaaag atagtagatg 2820tattgcagat catatagaat attggaaagc
tgtgcgacat gaaaatgtgc tatactataa 2880agcaagagaa aatgacatta ctgtactaaa
ccaccagatg gtgccttgtt tacaagtatg 2940taaagcaaaa gcatgtagtg caatagaagt
gcaaatagca ctggaatcat taagtacaac 3000aatatataac aatgaagagt ggacattaag
agacacatgc gaggaactat ggcttactga 3060acctaaaaaa tgctttaaaa aagaaggaca
acatatagaa gtatggtttg atggtagtaa 3120aaacaattgt atgcaatatg tagcctggaa
atatatatat tacaatggag attgtgggtg 3180gcaaaaagtg tgttctgggg tagactatag
aggtatatat tatgtacatg atggccacaa 3240aacatactac acagactttg aacaagaggc
caaaaaattt gggtgtaaaa acatatggga 3300agtacatatg gaaaatgaga gtatttattg
tcctgactct gtgtctagta cctgtagata 3360caacgtatcc cctgttgaaa ctgttaacga
atacaacacc cacaagacca ccaccaccac 3420ctccacgtcc gtgggcaacc aagacgccgc
agtatcccac agaccaggaa aacgacccag 3480actacgggaa tcagaatttg actcctccag
agagtcccac gcaaagtgtg tcacaacaca 3540cacacacatc agcgacacag acaataccga
cagtagaagt agaagtatca acaacaacaa 3600ccaccctggt gataagacta cgcctgtagt
acatttaaaa ggtgaaccta acagattaaa 3660atgttgtaga tatcgatttc aaaaatataa
aacattgttt gtggatgtaa catcaacata 3720tcattggaca agtacagaca ataaaaatta
tagcataatt acaattatat ataaggatga 3780aacacaacga aacagctttt taagtcatgt
aaaaattcca gtagtgtaca ggttagtttg 3840ggacaaatga gttttccata aagtgctgta
tatattgtat atacatttgt gttattgtaa 3900cacacaaata cgtgaagtgt acctgccata
cattgctgct acgcatatat attgcaacca 3960ttgatttttg tgttattggt gtgtttgcgc
tttgcttttg tgtttgtttg cttgtgtgtc 4020atgttgtccc gcttttgcta tctgcctctg
tgttttccag ttgtatatta ttaataatat 4080tgttttggtt tgttatagcc acatcctttt
ttaatacatt tataatattt ttgatatttt 4140tttactgtcc tgtgctgtgt atatatttac
atgctttgtg gataataaat aatatgtaaa 4200tgtagtagta ctgttactac tatggttgcc
caccgtgcca cacgacgcaa acgcgcatct 4260gcaacacaac tatataaaac atgtaagttg
tctggtacat gtccagagga tgttgttaat 4320aaaatagagc aaaaaacatg ggctgataaa
atattgcaat ggggaagttt atttacatat 4380tttggaggcc ttggcattgg tacaggaact
gggtctgggg gtcgtgcagg ctatgttcca 4440ttggggtcta ggccttccac aatagttgat
gtaactccgg cgcgaccacc tattgttgtg 4500gaatccgtag ggcctacaga cccttccatt
gttacattag ttgaggagtc cagtgttata 4560gaatctggtg cagggattcc taattttact
gggtctgggg gatttgaaat tacatcctca 4620tcaacaacta cacctgccgt gttggatatt
acaccaacct ctagtactgt acatgtcagt 4680agtacccata taaccaatcc gttatttatt
gatccccctg ttattgaggc cccacaaaca 4740ggcgaggtgt ctggcaatat tttaattagc
acacccacat ctggtataca tagctatgaa 4800gaaataccta tgcaaacatt tgctgttcac
ggttctggta cagaacctat tagtagtact 4860cctattccag gctttaggcg tattgcagct
cctagattat atagaaaagc atttcagcag 4920gttaaggtaa ctgaccctgc atttcttgat
agacctgcaa cattagtatc tgctgataat 4980ccactttttg aaggtactga cacatcttta
gctttttctc cgtcgggtgt ggctcctgac 5040cctgatttta tgaatatagt agcattacat
aggcctgcat ttactacacg taggggtggt 5100gtacgtttta gtaggcttgg cagaaaggct
actatacaaa cacgtagagg cacacaaata 5160ggtgcccgtg tgcattatta ttatgatata
agtcctattg cacaggctga ggaaattgaa 5220atgcagccat tattgtctgc aaataattca
tttgatggcc tatatgatat ttatgcaaat 5280atagatgatg aagcacctgg tttgtctagc
cagtcagttg ctacaccttc tgcacactta 5340cctataaagc cttccacatt gtcttttgct
agtaacacca ctaatgtaac tgccccttta 5400ggtaatgtgt gggaaacacc attttattca
ggtcctgaca tagtgttgcc tacaggcccc 5460agtacgtggc cctttgttcc tcagtctcct
tatgatgtta cccatgatgt atatatacag 5520ggatcctcct ttgcattatg gcctgtgtat
ttttttagac gtaggcgccg taaacgtatt 5580ccctattttt ttgcagatgg cgacgtggcg
gcctagtgaa aataaggtgt atctacctcc 5640aacacctgtt tcaaaggttg tggcaacgga
ttcctatgta aaacgcacta gtatatttta 5700tcatgcaggc agttcacgat tgcttgccgt
aggacatccc tattactctg tgactaagga 5760caataccaaa acaaacattc ccaaagttag
tgcatatcaa tatagggtat ttagggtacg 5820gttgcccgac cctaataagt ttgggcttcc
agatactaat atttataatc cggaccagga 5880acggttagtg tgggcatgtg taggtttgga
ggtaggccgc ggacagcctt taggtgctgg 5940gctaagtggc catccattgt ttaataggct
ggatgatact gaaagttcca atttagcaaa 6000taataatgtt atagaagata gtagggacaa
tatatcagtt gatggcaagc aaacacagtt 6060gtgtattgtt ggatgtactc ccgctatggg
tgaacattgg actaaaggtg ctgtgtgtaa 6120gtccacacaa gttaccacag gggactgccc
gcctcttgca ttaattaata cacctataga 6180ggatggggac atgatagaca caggatttgg
cgctatggac tttaaggtgt tgcaggaatc 6240taaggctgag gtacctttag acattgtaca
atccacctgt aaatatcctg actatttaaa 6300aatgtctgca gatgcctatg gtgattctat
gtggttttac ttacgcaggg aacaattatt 6360tgccagacat tattttaata gggctggtaa
agttggggaa acaatacctg cagagttata 6420tttaaagggt agcaatggta gagaaccccc
tccgagttct gtatatgttg ctacgcctag 6480tgggtctatg attacgtctg aggcacagtt
atttaataaa ccttattggt tgcaacgtgc 6540ccaaggccat aataatggca tttgctgggg
taatcaatta tttgttactg tagtagatac 6600tactagaagt actaacatga ctattagtac
tgctacagaa cagttaagta aatatgatgc 6660acgaaaaatt aatcagtacc ttagacatgt
ggaggaatat gaattacaat ttgtttttca 6720attatgcaaa attactttgt ctgcagaggt
tatggcatat ttacataata tgaatgctaa 6780cctactggag gactggaata ttgggttatc
cccgccagtg gccaccagcc tagaagataa 6840atatagatat gttagaagca cagctataac
atgtcaacgg gaacagccac caacagaaaa 6900acaggaccca ttagctaaat ataaattttg
ggatgttaac ttacaggaca gtttttctac 6960agacctggat caatttccac tgggtagaaa
atttttaatg caactgggca ctaggtcaaa 7020gcctgctgta gctacctcta aaaagcgatc
tgctcctacc tccacctcta caccagcaaa 7080acgtaaaagg cggtagtgtg ttgttgtgtg
tttgtgtaac tgtgtttgtg tgttgtatat 7140atggtatgtt tgtgtatgtg ctttatttta
tactttgtat gtgtatgttg tgtttgtgta 7200aatgtttgtg tgaaatgttt gtgtgtgtat
tcattgtatg tatgactgta tatatgtgta 7260atgtttgtgt gtctgtaata aacatgaatg
agtgctttta cgcgtggttg cataaactaa 7320ggtgtgtcat tattgtggct tttgttttgt
aagttattgt gtacagtgta ctatgtgtat 7380tgtgcataca tatatatacc ataacatact
ccattttgtt gtttttccgc cattttgtac 7440atgcaaccga attcggttgc atggcctagt
gccattattt aaactaaaag gaattcggtt 7500gcatggccta gtgccattat ttaaaccaaa
aggccctttt cagcagaaca gttaatcctt 7560tggcatattg ccgtttcctg tgttttatac
ttgaattatg tacagtaccg caccctgtat 7620tactcacagg tactatgact gccaactatg
cttttatctg catactttag tgctgttggg 7680cacacatttt tatacatgtg tctgcaactt
tggtgttttg gcttgcagaa tacactatgt 7740aggccaagta tctgtcagta tctgttttgc
aaacatgtaa catacaatta ctcatttttt 7800aaaaccgttt acggtcgtgc aaaaacaggt
ttcttttaat tgtt 78444217808DNAHuman papillomavirus
421aacaattatc ttgtaaaaac tagggtgtaa ccgaaaaggg ttatgaccga aaacggtgca
60tataaaagtg cagtggtaaa agtatagaag aacaccatgt tcgaagacaa gagggaaaga
120ccacgaacgc tgcatgaatt atgtgaagct ttgaacgttt ctatgcacaa tatacaggta
180gtgtgtgtgt attgtaaaaa ggaattatgt agagcagatg tatataatgt agcatttact
240gaaattaaga ttgtatatag ggataataat ccatatgcag tatgcaaaca atgtttactg
300ttttattcaa aaattagaga gtatagacgt tatagcaggt ctgtgtatgg tactacatta
360gaggcaatta ctaaaaaaag cttatatgat ttatcgataa ggtgtcatag atgtcaaaga
420ccacttgggc ctgaagaaaa gcaaaaattg gtggacgaaa aaaaaaggtt ccatgaaata
480gcgggacgtt ggacggggca atgcgctaat tgctggcaac gtacacgaca acgtaacgaa
540acccaagtgt aataaagcca tgcgtggtaa tgtaccacaa ttaaaagatg tagtattgca
600tttaacacca cagactgaaa ttgacttgca atgctacgag caatttgaca gctcagagga
660ggaggatgaa gtagataata tgcgtgacca gctaccagaa agacgggctg gacaggctac
720gtgttacaga attgaagctc cgtgttgcag gtgttcaagt gtagtacaac tggcagtgga
780aagcagtgga gacacccttc gcgttgtaca gcagatgtta atgggcgaac taagcctggt
840ttgcccgtgt tgtgcgaaca actagcaacg gcgatggact gtgaaggtac agaggatgag
900ggggcggggt gtaatgggtg gttttttgtt gaagcaatag tagaaaaaaa aacaggagat
960aatgtttcgg atgatgagga tgaaaatgca gatgatacag gatctgattt aataaacttt
1020atagatagtg aaactagtat ttgcagtcag gcggaacagg agacagcacg ggcgttgttt
1080caggcccaag aattacaggc aaacaaagag gctgtgcatc agttaaaacg aaagtttcta
1140gtcagcccgc gaagcagccc attaggagac attacaaatc aaaacaacac acacagccat
1200agtcaggcaa acgagtcaca agttaaaagg agattactgg acagttatcc ggacagcgga
1260tatggcaata cacaagtgga aactgtggaa gcaacgttgc aggtagatgg gcaacatggc
1320ggttcacaga acagtgtgtg tagtagcggg gggggcagtg ttatggatgt ggaaacaaca
1380gaaagctgtg caaatgtaga actaaacagt atatgtgaag tattaaaaag cagtaatgca
1440aaagcaacgt taatggcaaa atttaaagag ttgtatggta ttagttataa tgagttggta
1500cgggtgttta aaagtgataa aacatgttgt atagattggg tttgtgcatt gtttggcgtt
1560tccccaatgg tagcagaaaa tttaaaaaca ctaattaagc cattttgcat gtactaccat
1620atacaatgtt tatcatgtga ttggggcacc attgtattaa tgctaattag gttttcatgt
1680gcaaaaaaca gaacaacaat tgctaagtgt ttaagtacat tagtaaatat cccacaatca
1740caaatgttta tagaaccacc aaaattacgt agtacacctg tggcattata tttttataga
1800acaggcatat caaacattag caatacatat ggagagacac ctgaatggat tacacgacaa
1860acgcaactac aacatagttt tgaggatagt acctttgaat tatcacaaat ggtgcaatgg
1920gcatttgacc atgaagtatt agatgatagt gaaatagcat ttcattatgc acaattagca
1980gatatagata gtaatgctgc agcgttttta aagagtaatt gccaagcaaa atatgtaaaa
2040gattgtggga ccatggcacg gcattacaaa cgagcacaaa gaaaatcatt atctatgtca
2100gcctggataa ggtatagatg tgatagagca aaggatggag gcaactggag agaaattgct
2160aaatttttaa gatatcaagg tgtaaacttt atgtccttta ttcaaatgtt taaacagttt
2220ttaaaaggaa caccaaaaca caattgcata gtcatatatg gcccaccaaa cacaggcaag
2280tcattatttg caatgagcct aatgaagttt atgcaagggt ccattatttc atatgtaaac
2340tctggtagtc atttttggtt acagccacta gaggatgcta aaatagcatt gttagatgat
2400gctacgtatg ggtgttggac atatattgat cagtatttaa gaaacttttt agatggtaat
2460ccatgtagta tagatagaaa acataggagt ttaatacaat tagtatgtcc accattacta
2520ataacgtcaa acataaatcc acaagaggat gcaaacctaa tgtatttaca tacaagggta
2580acagtattaa agtttttaaa tacatttcca tttgataaca atgggaatgc tgtgtataca
2640ttgaatgatg aaaattggaa aaattttttt tccaccacat ggtccagatt agatttggag
2700gaggaagagg acaaagaaaa tggagaccct atgccaccgt ttaaatgtgt gccaggagaa
2760aatactagac tgttatgaac tggacagtga taaattagta gatcaaatta actattggac
2820attgttacga tatgaagctg ctatgtttta tgcagcacgg gaaagaaact tacgaacaat
2880caatcaccag gtagtaccag caacaacagt atcaaaacaa aaggcctgtc aagcaattga
2940aatgcacatg gccttacaat cgcttaacaa atcagactat aacatggaac catggacaat
3000gcgggagaca tgttatgaac tatggtgtgt ggctcccaag caatgtttca aaaagggggg
3060cataactgta acagttatat ttgatggaaa taaggacaat gcaatggact atacaagctg
3120gaaatttata tatatatatg ataatgataa gtgggtaaag acaaatggaa atgtggacta
3180tacgggtata tattacactg taaattcaaa aaaagaatat tatgtacagt ttaaagatga
3240agccaaaata tatggggcac aacagtggga ggtctatatg tatggtactg taataacatg
3300tcctgaatat gtatctagta cctgcagcga cgcgttatcc actactacaa ctgttgaaca
3360actatcaaac accccaacga ccaatcccct taccacctgc gtgggcgcca aagaagccca
3420gacacaacag cgaaaacgac agcgacttac tgagcccgac tcctccacaa tctccccact
3480gtccgtggac aatacaaaca accaaataca ctgtggaagt ggaagcacta acactggagg
3540gcaccaaagt gcaactcaga ctgcgtttat agtgcattta aaaggtgata caaattgttt
3600aaaatgtttt agatacagat ttacaaaaca caaagggtta tataaaaacg tatcctcaac
3660ctggcattgg accagtaata ctaaaacagg cattgttacc attgtgtttg acagtgcaca
3720tcaacgggaa acatttataa aaaccattaa agtaccccca agtgtaacac tgtcattggg
3780aattatgaca ctgtaactag tgtaatatat gtattgtaca tatatactgt cacaagccaa
3840tatgtgctgc taattgtata gacatattgt aaccattgca gtgtttatta ttttgctatt
3900tgtgctttgc ttgtgtgtgt gtcttgtgtt gtgttgtttg ttgccgctac tgctgtccca
3960atacgtgttt gcagctgcct tattattaat tttatgtttt tggtttgttg ttgcaacatc
4020ccaattaact acattttttg tatatttgat ttttttttac ttaccttgtt tacttttaca
4080tctatataca tttttacttt tgcaataaac ttgttatatt tttgtgatta aatatggtgg
4140ctacacgtgc acggcgtcgg aagcgagcat ctgtaacaca attatattct acatgcaaag
4200ctgctggtac atgtcctcct gatgttgtga ataaggttga aggtactaca ttggccgata
4260aaatattaca gtggagtggg ttgggtatat ttttgggtgg cctaggtatt ggtactgggt
4320ctggatctgg ggggcgtact ggatatatcc ctttaggtgg tgggggtcgc ccaggcgtgg
4380tggatattgc tcctgcaagg ccacctatta taattgacct atggcaccat actgaacctt
4440ctatagtaaa tttggttgag gactctagta ttattcagtc tgggtctcct atacctacct
4500ttactggtac cgatggcttt gaaattactt catcttccac aacaacccct gctgtgttgg
4560acatcacccc atctgctggt actgtacatg tttctagtac taacattgaa aatcctttat
4620atattgaacc tccatccatt gaggctccac aatctggaga agtgtcagat atatatttac
4680tagtacacta ctctggtact catgggtatg aagaaatacc tatggaagtg tttgcatcca
4740atgtcagtac tggtactgaa cctattagca gcacacctac tccaggggtt agtcgcatag
4800ctgctccccg cttgtatagt aagtcctaca cacaggttaa agttacaaat cctgatttta
4860ttagtaagcc atccacattt gttacattta ataatcctgc ttttgagcct attgacacat
4920ccataacttt tgaggaacct gatgctgttg cacctgatcc tgattttctg gatattatta
4980cactgcaccg ccctgccctt acatctcgta gaggcacagt acgctttagt aggttaggtc
5040aaaaggccac catgcgcact cgtagtggca aacaaattgg tgctcgtgta cattattatc
5100atgatattag tagaattgca ccagctgatg aacttgaaat gcagccttta ctttcacctt
5160ctaataatta tagttatgac atttatgctg atttagatga agctgaaaca ggttttatac
5220agcccacaca caccacacct atgtcacact cctctttgtc taggcagttg ccctccttat
5280cttcatctat gtcttcatct tatgcaaatg ttactattcc attttcaact acatattctg
5340ttcctattca tacagggcct gatgtggtat tgcccacatc tcctacagta tggccttatg
5400ttccccacac ttccattgac accaagcatt ctattgttat actaggtggg gattactatt
5460tgtggcccta tacacattta ctacgcaaac gccgtaaacg tataccctat ttttttacag
5520atggcattgt ggcgcactaa tgacagcaag gtgtatttgc cacctgcacc tgtgtctcga
5580attgtgaata cagaagaata tatcacacgc accggcatat attactatgc aggcagttcc
5640agactaataa cattaggaca tccctatttt ccaataccta aaacctcaac gcgtgctgct
5700attcctaaag tatctgcatt tcaatacagg gtatttaggg tacagttacc agatcctaac
5760aagtttggac tcccggatcc aaatttatat aatccagaca cagataggtt ggtgtggggt
5820tgtgtgggcg ttgaggtggg cagaggacag ccccttggtg ttggccttag tggtcatccc
5880ttatttaata aatatgatga cacagaaaat tcacgcatag caaatggcaa tgcacaacaa
5940gatgttagag ataacacatc tgttgacaac aaacagactc agttatgtat aataggctgt
6000gctccaccta ttggggaaca ctggggtatt ggcactacat gcaaaaacac acctgtacct
6060ccaggagact gcccccccct ggaacttgta tcctctgtca ttcaggatgg cgatatgatt
6120gatacagggt ttggagctat ggatttcgct gccctacagg ccaccaaatc agacgtccct
6180ttggatattt cacagtctgt ttgtaaatat cctgattatt taaaaatgtc tgcagacaca
6240tatggtaatt ccatgttttt tcatttacgc agggagcaaa tctttgctag gcactattat
6300aataaacttg taggtgttgg ggaagacatt cctaacgatt attatattaa gggtagtggt
6360aatggccgtg accctataga aagttatata tactctgcta ctcccagtgg gtctatgata
6420acatctgatt ctcaaatttt taataagcct tattggctcc accgtgcgca gggtcacaat
6480aatggcattt gctggaacaa tcagcttttt attacctgtg ttgatactac cagaagtaca
6540aatttaacta ttagcactgc cactgctgcg gtttccccaa catttactcc aagtaacttt
6600aagcaatata ttaggcatgg ggaagagtat gaattgcaat ttatttttca attatgtaaa
6660attactttaa ctacagaggt aatggcttat ttacacacaa tggatcctac cattcttgaa
6720cagtggaatt ttggattaac attacctccg tctgctagtt tggaggatgc atataggttt
6780gttagaaatg cagctactag ctgtcaaaag gacacccctc cacaggctaa gccagatcct
6840ttggccaaat ataaattttg ggatgttgat ttaaaggaac gattttcttt agatttagac
6900caatttgcat tgggtcgcaa gtttttgttg caggttggcg tacaacgcaa gcccagacca
6960ggccttaaac gcccggcctc atcggcatcc tcttcctctt cctcttcagc caaacgtaaa
7020cgtgttaaaa agtaatgtat gttagttttt gtatgcttgt gcacactgtt gtatgcctgt
7080atgtatatgt ttgtgtatgt actgtatgtg tttttgtgtg tgtgtgtgtt gttgttcctg
7140tatgtatgag ttatgtatgt ttattattaa taaactatgt ggtgtgtgtg tgtgtgtttt
7200tgcatgactg catttgtatg acatgtacgg gtgtatgtgg gtattacatt atccccgtag
7260gtcaagggtg gtgtttcggt ggcgtcccta ttgccctacc cattttttgc agcacaacag
7320tttatatttg tgctatttag ttatactttg tagcttccat tttgttacag ctgcagccat
7380tttgagtgca accgatttcg gttcgtgtac ttttagtata tttgccaagt tttaaaccac
7440aactgccagt tgtttttggc ataaaccatc atttttttat gacatagtgc atacatccgc
7500ccgcccacgc cttgtacttg gcgcgcctta ccggcgctag tcatacaacc tattagtcat
7560ttgtacttta acaattgttg gcacactgtt ttccgcccta taataattta actgcttata
7620ggcatgtatt ttttggcata ttttatctta ctaattgcat agttggcagg tcaaatacta
7680tgtttttagt gccaagtttc tatcctactt ataaaccatc ttactcatat gcaggtgtgc
7740tacacaaatg tgttacctaa ccgatttgtg ttctgcctat gcttgcaaca ttttttctta
7800taacattt
78084227904DNAHuman papillomavirus 422actacaataa ttcatgtata aaactaaggg
cgtaaccgaa atcggttgaa ccgaaaccgg 60ttagtataaa agcagacatt ttatgcacca
aaagagaact gcaatgtttc aggacccaca 120ggagcgaccc agaaagttac cacagttatg
cacagagctg caaacaacta tacatgatat 180aatattagaa tgtgtgtact gcaagcaaca
gttactgcga cgtgaggtat atgactttgc 240ttttcgggat ttatgcatag tatatagaga
tgggaatcca tatgctgtat gtgataaatg 300tttaaagttt tattctaaaa ttagtgagta
tagacattat tgttatagtt tgtatggaac 360aacattagaa cagcaataca acaaaccgtt
gtgtgatttg ttaattaggt gtattaactg 420tcaaaagcca ctgtgtcctg aagaaaagca
aagacatctg gacaaaaagc aaagattcca 480taatataagg ggtcggtgga ccggtcgatg
tatgtcttgt tgcagatcat caagaacacg 540tagagaaacc cagctgtaat catgcatgga
gatacaccta cattgcatga atatatgtta 600gatttgcaac cagagacaac tgatctctac
tgttatgagc aattaaatga cagctcagag 660gaggaggatg aaatagatgg tccagctgga
caagcagaac cggacagagc ccattacaat 720attgtaacct tttgttgcaa gtgtgactct
acgcttcggt tgtgcgtaca aagcacacac 780gtagacattc gtactttgga agacctgtta
atgggcacac taggaattgt gtgccccatc 840tgttctcaga aaccataatc taccatggct
gatcctgcag gtaccaatgg ggaagagggt 900acgggatgta atggatggtt ttatgtagag
gctgtagtgg aaaaaaaaac aggggatgct 960atatcagatg acgagaacga aaatgacagt
gatacaggtg aagatttggt agattttata 1020gtaaatgata atgattattt aacacaggca
gaaacagaga cagcacatgc gttgtttact 1080gcacaggaag caaaacaaca tagagatgca
gtacaggttc taaaacgaaa gtatttggta 1140gtccacttag tgatattagt ggatgtgtag
acaataatat tagtcctaga ttaaaagcta 1200tatgtataga aaaacaaagt agagctgcaa
aaaggagatt atttgaaagc gaagacagcg 1260ggtatggcaa tactgaagtg gaaactcagc
agatgttaca ggtagaaggg cgccatgaga 1320ctgaaacacc atgtagtcag tatagtggtg
gaagtggggg tggttgcagt cagtacagta 1380gtggaagtgg gggagagggt gttagtgaaa
gacacactat atgccaaaca ccacttacaa 1440atattttaaa tgtactaaaa actagtaatg
caaaggcagc aatgttagca aaatttaaag 1500agttatacgg ggtgagtttt tcagaattag
taagaccatt taaaagtaat aaatcaacgt 1560gttgcgattg gtgtattgct gcatttggac
ttacacccag tatagctgac agtataaaaa 1620cactattaca acaatattgt ttatatttac
acattcaaag tttagcatgt tcatggggaa 1680tggttgtgtt actattagta agatataaat
gtggaaaaaa tagagaaaca attgaaaaat 1740tgctgtctaa actattatgt gtgtctccaa
tgtgtatgat gatagagcct ccaaaattgc 1800gtagtacagc agcagcatta tattggtata
aaacaggtat atcaaatatt agtgaagtgt 1860atggagacac gccagaatgg atacaaagac
aaacagtatt acaacatagt tttaatgatt 1920gtacatttga attatcacag atggtacaat
gggcctacga taatgacata gtagacgata 1980gtgaaattgc atataaatat gcacaattgg
cagacactaa tagtaatgca agtgcctttc 2040taaaaagtaa ttcacaggca aaaattgtaa
aggattgtgc aacaatgtgt agacattata 2100aacgagcaga aaaaaaacaa atgagtatga
gtcaatggat aaaatataga tgtgataggg 2160tagatgatgg aggtgattgg aagcaaattg
ttatgttttt aaggtatcaa ggtgtagagt 2220ttatgtcatt tttaactgca ttaaaaagat
ttttgcaagg catacctaaa aaaaattgca 2280tattactata tggtgcagct aacacaggta
aatcattatt tggtatgagt ttaatgaaat 2340ttctgcaagg gtctgtaata tgttttgtaa
attctaaaag ccatttttgg ttacaaccat 2400tagcagatgc caaaataggt atgttagatg
atgctacagt gccctgttgg aactacatag 2460atgacaattt aagaaatgca ttggatggaa
atttagtttc tatggatgta aagcatagac 2520cattggtaca actaaaatgc cctccattat
taattacatc taacattaat gctggtacag 2580attctaggtg gccttattta cataatagat
tggtggtgtt tacatttcct aatgagtttc 2640catttgacga aaacggaaat ccagtgtatg
agcttaatga taagaactgg aaatcctttt 2700tctcaaggac gtggtccaga ttaagtttgc
acgaggacga ggacaaggaa aacgatggag 2760actctttgcc aacgtttaaa tgtgtgtcag
gacaaaatac taacacatta tgaaaatgat 2820agtacagacc tacgtgacca tatagactat
tggaaacaca tgcgcctaga atgtgctatt 2880tattacaagg ccagagaaat gggatttaaa
catattaacc accaagtggt gccaacactg 2940gctgtatcaa agaataaagc attacaagca
attgaactgc aactaacgtt agaaacaata 3000tataactcac aatatagtaa tgaaaagtgg
acattacaag acgttagcct tgaagtgtat 3060ttaactgcac caacaggatg tataaaaaaa
catggatata cagtggaagt gcagtttgat 3120ggagacatat gcaatacaat gcattataca
aactggacac atatatatat ttgtgaagaa 3180gcatcagtaa ctgtggtaga gggtcaagtt
gactattatg gtttatatta tgttcatgaa 3240ggaatacgaa catattttgt gcagtttaaa
gatgatgcag aaaaatatag taaaaataaa 3300gtatgggaag ttcatgcggg tggtcaggta
atattatgtc ctacatctgt gtttagcagc 3360aacgaagtat cctctcctga aattattagg
cagcacttgg ccaaccaccc cgccgcgacc 3420cataccaaag ccgtcgcctt gggcaccgaa
gaaacacaga cgactatcca gcgaccaaga 3480tcagagccag acaccggaaa cccctgccac
accactaagt tgttgcacag agactcagtg 3540gacagtgctc caatcctcac tgcatttaac
agctcacaca aaggacggat taactgtaat 3600agtaacacta cacccatagt acatttaaaa
ggtgatgcta atactttaaa atgtttaaga 3660tatagattta aaaagcattg tacattgtat
actgcagtgt cgtctacatg gcattggaca 3720ggacataatg taaaacataa aagtgcaatt
gttacactta catatgatag tgaatggcaa 3780cgtgaccaat ttttgtctca agttaaaata
ccaaaaacta ttacagtgtc tactggattt 3840atgtctatat gacaaatctt gatactgcat
ccacaacatt actggcgtgc tttttgcttt 3900gctttgtgtg cttttgtgtg tctgcctatt
aatacgtccg ctgcttttgt ctgtgtctac 3960atacacatca ttaataatat tggtattact
attgtggata acagcagcct ctgcgtttag 4020gtgttttatt gtatatatta tatttgttta
tataccatta tttttaatac atacacatgc 4080acgcttttta attacataat gtatatgtac
ataatgtaat tgttacatat aattgttgta 4140taccataact tactattttt tcttttttat
tttcatatat aatttttttt tttgtttgtt 4200tgtttgtttt ttaataaact gttattactt
aacaatgcga cacaaacgtt ctgcaaaacg 4260cacaaaacgt gcatcggcta cccaacttta
taaaacatgc aaacaggcag gtacatgtcc 4320acctgacatt atacctaagg ttgaaggcaa
aactattgct gaacaaatat tacaatatgg 4380aagtatgggt gtattttttg gtgggttagg
aattggaaca gggtcgggta caggcggacg 4440cactgggtat attccattgg gaacaaggcc
tcccacagct acagatacac ttgctcctgt 4500aagaccccct ttaacagtag atcctgtggg
cccttctgat ccttctatag tttctttagt 4560ggaagaaact agttttattg atgctggtgc
accaacatct gtaccttcca ttcccccaga 4620tgtatcagga tttagtatta ctacttcaac
tgataccaca cctgctatat tagatattaa 4680taatactgtt actactgtta ctacacataa
taatcccact ttcactgacc catctgtatt 4740gcagcctcca acacctgcag aaactggagg
gcattttaca ctttcatcat ccactattag 4800tacacataat tatgaagaaa ttcctatgga
tacatttatt gttagcacaa accctaacac 4860agtaactagt agcacaccca taccagggtc
tcgcccagtg gcacgcctag gattatatag 4920tcgcacaaca caacaggtta aagttgtaga
ccctgctttt gtaaccactc ccactaaact 4980tattacatat gataatcctg catatgaagg
tatagatgtg gataatacat tatatttttc 5040tagtaatgat aatagtatta atatagctcc
agatcctgac tttttggata tagttgcttt 5100acataggcca gcattaacct ctaggcgtac
tggcattagg tacagtagaa ttggtaataa 5160acaaacacta cgtactcgta gtggaaaatc
tataggtgct aaggtacatt attattatga 5220tttaagtact attgatcctg cagaagaaat
agaattacaa actataacac cttctacata 5280tactaccact tcacatgcag cctcacctac
ttctattaat aatggattat atgatattta 5340tgcagatgac tttattacag atacttctac
aaccccggta ccatctgtac cctctacatc 5400tttatcaggt tatattcctg caaatacaac
aattcctttt ggtggtgcat acaatattcc 5460tttagtatca ggtcctgata tacccattaa
tataactgac caagctcctt cattaattcc 5520tatagttcca gggtctccac aatatacaat
tattgctgat gcaggtgact tttatttaca 5580tcctagttat tacatgttac gaaaacgacg
taaacgttta ccatattttt tttcagatgt 5640ctctttggct gcctagtgag gccactgtct
acttgcctcc tgtcccagta tctaaggttg 5700taagcacgga tgaatatgtt gcacgcacaa
acatatatta tcatgcagga acatccagac 5760tacttgcagt tggacatccc tattttccta
ttaaaaaacc taacaataac aaaatattag 5820ttcctaaagt atcaggatta caatacaggg
tatttagaat acatttacct gaccccaata 5880agtttggttt tcctgacacc tcattttata
atccagatac acagcggctg gtttgggcct 5940gtgtaggtgt tgaggtaggt cgtggtcagc
cattaggtgt gggcattagt ggccatcctt 6000tattaaataa attggatgac acagaaaatg
ctagtgctta tgcagcaaat gcaggtgtgg 6060ataatagaga atgtatatct atggattaca
aacaaacaca attgtgttta attggttgca 6120aaccacctat aggggaacac tggggcaaag
gatccccatg taccaatgtt gcagtaaatc 6180caggtgattg tccaccatta gagttaataa
acacagttat tcaggatggt gatatggttc 6240atactggctt tggtgctatg gactttacta
cattacaggc taacaaaagt gaagttccac 6300tggatatttg tacatctatt tgcaaatatc
cagattatat taaaatggtg tcagaaccat 6360atggcgacag cttatttttt tatttacgaa
gggaacaaat gtttgttaga catttattta 6420atagggctgg tactgttggt gaaaatgtac
cagacgattt atacattaaa ggctctgggt 6480ctactgcaaa tttagccagt tcaaattatt
ttcctacacc tagtggttct atggttacct 6540ctgatgccca aatattcaat aaaccttatt
ggttacaacg agcacagggc cacaataatg 6600gcatttgttg gggtaaccaa ctatttgtta
ctgttgttga tactacacgc agtacaaata 6660tgtcattatg tgctgccata tctacttcag
aaactacata taaaaatact aactttaagg 6720agtacctacg acatggggag gaatatgatt
tacagtttat ttttcaactg tgcaaaataa 6780ccttaactgc agacgttatg acatacatac
attctatgaa ttccactatt ttggaggact 6840ggaattttgg tctacaacct cccccaggag
gcacactaga agatacttat aggtttgtaa 6900cccaggcaat tgcttgtcaa aaacatacac
ctccagcacc taaagaagat gatcccctta 6960aaaaatacac tttttgggaa gtaaatttaa
aggaaaagtt ttctgcagac ctagatcagt 7020ttcctttagg acgcaaattt ttactacaag
caggattgaa ggccaaacca aaatttacat 7080taggaaaacg aaaagctaca cccaccacct
catctacctc tacaactgct aaacgcaaaa 7140aacgtaagct gtaagtattg tatgtatgtt
gaattagtgt tgtttgttgt gtatatgttt 7200gtatgtgctt gtatgtgctt gtaaatatta
agttgtatgt gtgtttgtat gtatggtata 7260ataaacacgt gtgtatgtgt ttttaaatgc
ttgtgtaact attgtgtcat gcaacataaa 7320taaacttatt gtttcaacac ctactaattg
tgttgtggtt attcattgta tataaactat 7380atttgctaca tcctgttttt gttttatata
tactatattt tgtagcgcca ggcccatttt 7440gtagcttcaa ccgaattcgg ttgcatgctt
tttggcacaa aatgtgtttt tttaaatagt 7500tctatgtcag caactatggt ttaaacttgt
acgtttcctg cttgccatgc gtgccaaatc 7560cctgttttcc tgacctgcac tgcttgccaa
ccattccatt gttttttaca ctgcactatg 7620tgcaactact gaatcactat gtacattgtg
tcatataaaa taaatcacta tgcgccaacg 7680ccttacatac cgctgttagg cacatatttt
tggcttgttt taactaacct aattgcatat 7740ttggcataag gtttaaactt ctaaggccaa
ctaaatgtca ccctagttca tacatgaact 7800gtgtaaaggt tagtcataca ttgttcattt
gtaaaactgc acatgggtgt gtgcaaaccg 7860attttgggtt acacatttac aagcaactta
tataataata ctaa 79044237857DNAHuman papillomavirus
423attaatactt ttaacaattg tagtatataa aaaagggagt aaccgaaaac ggtcgggacc
60gaaaacggtg tatataaaag atgtgagaaa cacaccacaa tactatggcg cgctttgagg
120atccaacacg gcgaccctac aagctacctg atctgtgcac ggaactgaac acttcactgc
180aagacataga aataacctgt gtatattgca agacagtatt ggaacttaca gaggtatttg
240aatttgcatt taaagattta tttgtggtgt atagagacag tataccccat gctgcatgcc
300ataaatgtat agatttttat tctagaatta gagaattaag acattattca gactctgtgt
360atggagacac attggaaaaa ctaactaaca ctgggttata caatttatta ataaggtgcc
420tgcggtgcca gaaaccgttg aatccagcag aaaaacttag acaccttaat gaaaaacgac
480gatttcacaa catagctggg cactatagag gccagtgcca ttcgtgctgc aaccgagcac
540gacaggaacg actccaacga cgcagagaaa cacaagtata atattaagta tgcatggacc
600taaggcaaca ttgcaagaca ttgtattgca tttagagccc caaaatgaaa ttccggttga
660ccttctatgt cacgagcaat taagcgactc agaggaagaa aacgatgaaa tagatggagt
720taatcatcaa catttaccag cccgacgagc cgaaccacaa cgtcacacaa tgttgtgtat
780gtgttgtaag tgtgaagcca gaattgagct agtagtagaa agctcagcag acgaccttcg
840agcattccag cagctgtttc tgaacaccct gtcctttgtg tgtccgtggt gtgcatccca
900gcagtaagca acaatggctg atccagaagg tacagacggg gagggcacgg gttgtaacgg
960ctggttttat gtacaagcta ttgtagacaa aaaaacagga gatgtaatat cagatgacga
1020ggacgaaaat gcaacagaca cagggtcgga tatggtagat tttattgata cacaaggaac
1080attttgtgaa caggcagagc tagagacagc acaggcattg ttccatgcgc aggaggtcca
1140caatgatgca caagtgttgc atgttttaaa acgaaagttt gcaggaggca gcacagaaaa
1200cagtccatta ggggagcggc tggaggtgga tacagagtta agtccacggt tacaagaaat
1260atctttaaat agtgggcaga aaaaggcaaa aaggcggctg tttacaatat cagatagtgg
1320ctatggctgt tctgaagtgg aagcaacaca gattcaggta actacaaatg gcgaacatgg
1380cggcaatgta tgtagtggcg gcagtacgga ggctatagac aacgggggca cagagggcaa
1440caacagcagt gtagacggta caagtgacaa tagcaatata gaaaatgtaa atccacaatg
1500taccatagca caattaaaag acttgttaaa agtaaacaat aaacaaggag ctatgttagc
1560agtatttaaa gacacatatg ggctatcatt tacagattta gttagaaatt ttaaaagtga
1620taaaaccacg tgtacagatt gggttacagc tatatttgga gtaaacccaa caatagcaga
1680aggatttaaa acactaatac agccatttat attatatgcc catattcaat gtctagactg
1740taaatgggga gtattaatat tagccctgtt gcgttacaaa tgtggtaaga gtagactaac
1800agttgctaaa ggtttaagta cgttgttaca cgtacctgaa acttgtatgt taattcaacc
1860accaaaattg cgaagtagtg ttgcagcact atattggtat agaacaggaa tatcaaatat
1920tagtgaagta atgggagaca cacctgagtg gatacaaaga cttactatta tacaacatgg
1980aatagatgat agcaattttg atttgtcaga aatggtacaa tgggcatttg ataatgagct
2040gacagatgaa agcgatatgg catttgaata tgccttatta gcagacagca acagcaatgc
2100agctgccttt ttaaaaagca attgccaagc taaatattta aaagattgtg ccacaatgtg
2160caaacattat aggcgagccc aaaaacgaca aatgaatatg tcacagtgga tacgatttag
2220atgttcaaaa atagatgaag ggggagattg gagaccaata gtgcaattcc tgcgatacca
2280acaaatagag tttataacat ttttaggagc cttaaaatca tttttaaaag gaacccccaa
2340aaaaaattgt ttagtatttt gtggaccagc aaatacagga aaatcatatt ttggaatgag
2400ttttatacac tttatacaag gagcagtaat atcatttgtg aattccacta gtcatttttg
2460gttggaaccg ttaacagata ctaaggtggc catgttagat gatgcaacga ccacgtgttg
2520gacatacttt gatacctata tgagaaatgc gttagatggc aatccaataa gtattgatag
2580aaagcacaaa ccattaatac aactaaaatg tcctccaata ctactaacca caaatataca
2640tccagcaaag gataatagat ggccatattt agaaagtaga ataacagtat ttgaatttcc
2700aaatgcattt ccatttgata aaaatggcaa tccagtatat gaaataaatg acaaaaattg
2760gaaatgtttt tttgaaagga catggtccag attagatttg cacgaggaag aggaagatgc
2820agacaccgaa ggaaaccctt tcggaacgtt taagttgcgt gcaggacaaa atcatagacc
2880actatgaaaa tgacagtaaa gacatagaca gccaaataca gtattggcaa ctaatacgtt
2940gggaaaatgc aatattcttt gcagcaaggg aacatggcat acagacatta aaccaccagg
3000tggtgccagc ctataacatt tcaaaaagta aagcacataa agctattgaa ctgcaaatgg
3060ccctacaagg ccttgcacaa agtcgataca aaaccgagga ttggacactg caagacacat
3120gcgaggaact atggaataca gaacctactc actgctttaa aaaaggtggc caaacagtac
3180aagtatattt tgatggcaac aaagacaatt gtatgaccta tgtagcatgg gacagtgtgt
3240attatatgac tgatgcagga acatgggaca aaaccgctac ctgtgtaagt cacaggggat
3300tgtattatgt aaaggaaggg tacaacacgt tttatataga atttaaaagt gaatgtgaaa
3360aatatgggaa cacaggtacg tgggaagtac attttgggaa taatgtaatt gattgtaatg
3420actctatgtg cagtaccagt gacgacacgg tatccgctac tcagcttgtt aaacagctac
3480agcacacccc ctcaccgtat tccagcaccg tgtccgtggg caccgcaaag acctacggcc
3540agacgtcggc tgctacacga cctggacact gtggactcgc ggagaagcag cattgtggac
3600ctgtcaaccc acttctcggt gcagctacac ctacaggcaa caacaaaaga cggaaactct
3660gtagtggtaa cactacgcct ataatacatt taaaaggtga cagaaacagt ttaaaatgtt
3720tacggtacag attgcgaaaa catagcgacc actatagaga tatatcatcc acctggcatt
3780ggacaggtgc aggcaatgaa aaaacaggaa tactgactgt aacataccat agtgaaacac
3840aaagaacaaa atttttaaat actgttgcaa ttccagatag tgtacaaata ttggtgggat
3900acatgacaat gtaatacata tgctgtagta ccaatatgtt atcacttatt tttttatttt
3960gcttttgtgt atgcatgtat gtgtgctgcc atgtcccgct tttgccatct gtctgtatgt
4020gtgcgtatgc atgggtattg gtatttgtgt atattgtggt aataacgtcc cctgccacag
4080cattcacagt atatgtattt tgttttttat tgcccatgtt actattgcat atacatgcta
4140tattgtcttt acagtaattg tataggttgt tttatacagt gtattgtaca ttgtatattt
4200tgttttatac cttttatgct ttttgtattt ttgtaataaa agtatggtat cccaccgtgc
4260cgcacgacgc aaacgggctt cggtaactga cttatataaa acatgtaaac aatctggtac
4320atgtccacct gatgttgttc ctaaggtgga gggcaccacg ttagcagata aaatattgca
4380atggtcaagc cttggtatat ttttgggtgg acttggcata ggtactggca gtggtacagg
4440gggtcgtaca gggtacattc cattgggtgg gcgttccaat acagtggtgg atgttggtcc
4500tacacgtccc ccagtggtta ttgaacctgt gggccccaca gacccatcta ttgttacatt
4560aatagaggac tccagtgtgg ttacatcagg tgcacctagg cctacgttta ctggcacgtc
4620tgggtttgat ataacatctg cgggtacaac tacacctgcg gttttggata tcacaccttc
4680gtctacctct gtgtctattt ccacaaccaa ttttaccaat cctgcatttt ctgatccgtc
4740cattattgaa gttccacaaa ctggggaggt ggcaggtaat gtatttgttg gtacccctac
4800atctggaaca catgggtatg aggaaatacc tttacaaaca tttgcttctt ctggtacggg
4860ggaggaaccc attagtagta ccccattgcc tactgtgcgg cgtgtagcag gtccccgcct
4920ttacagtagg gcctaccaac aagtgtcagt ggctaaccct gagtttctta cacgtccatc
4980ctctttaatt acatatgaca acccggcctt tgagcctgtg gacactacat taacatttga
5040tcctcgtagt gatgttcctg attcagattt tatggatatt atccgtctac ataggcctgc
5100tttaacatcc aggcgtggga ctgttcgctt tagtagatta ggtcaacggg caactatgtt
5160tacccgcagc ggtacacaaa taggtgctag ggttcacttt tatcatgata taagtcctat
5220tgcaccttcc ccagaatata ttgaactgca gcctttagta tctgccacgg aggacaatga
5280cttgtttgat atatatgcag atgacatgga ccctgcagtg cctgtaccat cgcgttctac
5340tacctccttt gcatttttta aatattcgcc cactatatct tctgcctctt cctatagtaa
5400tgtaacggtc cctttaacct cctcttggga tgtgcctgta tacacgggtc ctgatattac
5460attaccatct actacctctg tatggcccat tgtatcaccc acggcccctg cctctacaca
5520gtatattggt atacatggta cacattatta tttgtggcca ttatattatt ttattcctaa
5580gaaacgtaaa cgtgttccct atttttttgc agatggcttt gtggcggcct agtgacaata
5640ccgtatatct tccacctcct tctgtggcaa gagttgtaaa taccgatgat tatgtgactc
5700ccacaagcat attttatcat gctggcagct ctagattatt aactgttggt aatccatatt
5760ttagggttcc tgcaggtggt ggcaataagc aggatattcc taaggtttct gcataccaat
5820atagagtatt tagggtgcag ttacctgacc caaataaatt tggtttacct gatactagta
5880tttataatcc tgaaacacaa cgtttagtgt gggcctgtgc tggagtggaa attggccgtg
5940gtcagccttt aggtgttggc cttagtgggc atccatttta taataaatta gatgacactg
6000aaagttccca tgccgccacg tctaatgttt ctgaggacgt tagggacaat gtgtctgtag
6060attataagca gacacagtta tgtattttgg gctgtgcccc tgctattggg gaacactggg
6120ctaaaggcac tgcttgtaaa tcgcgtcctt tatcacaggg cgattgcccc cctttagaac
6180ttaaaaacac agttttggaa gatggtgata tggtagatac tggatatggt gccatggact
6240ttagtacatt gcaagatact aaatgtgagg taccattgga tatttgtcag tctatttgta
6300aatatcctga ttatttacaa atgtctgcag atccttatgg ggattccatg tttttttgct
6360tacggcgtga gcagcttttt gctaggcatt tttggaatag agcaggtact atgggtgaca
6420ctgtgcctca atccttatat attaaaggca caggtatgcc tgcttcacct ggcagctgtg
6480tgtattctcc ctctccaagt ggctctattg ttacctctga ctcccagttg tttaataaac
6540catattggtt acataaggca cagggtcata acaatggtgt ttgctggcat aatcaattat
6600ttgttactgt ggtagatacc actcccagta ccaatttaac aatatgtgct tctacacagt
6660ctcctgtacc tgggcaatat gatgctacca aatttaagca gtatagcaga catgttgagg
6720aatatgattt gcagtttatt tttcagttgt gtactattac tttaactgca gatgttatgt
6780cctatattca tagtatgaat agcagtattt tagaggattg gaactttggt gttccccccc
6840ccccaactac tagtttggtg gatacatatc gttttgtaca atctgttgct attacctgtc
6900aaaaggatgc tgcaccggct gaaaataagg atccctatga taagttaaag ttttggaatg
6960tggatttaaa ggaaaagttt tctttagact tagatcaata tccccttgga cgtaaatttt
7020tggttcaggc tggattgcgt cgcaagccca ccataggccc tcgcaaacgt tctgctccat
7080ctgccactac gtcttctaaa cctgccaagc gtgtgcgtgt acgtgccagg aagtaatatg
7140tgtgtgtgta tatatatata catctattgt tgtgtttgta tgtcctgtgt ttgtgtttgt
7200tgtatgattg cattgtatgg tatgtatggt tgttgttgta tgttgtatgt tactatattt
7260gttggtatgt ggcattaaat aaaatatgtt ttgtggttct gtgtgttatg tggttgcgcc
7320ctagtgagta acaactgtat ttgtgtttgt ggtatgggtg ttgcttgttg ggctatatat
7380tgtcctgtat ttcaagttat aaaactgcac accttacagc atccatttta tcctacaatc
7440ctccattttg ctgtgcaacc gatttcggtt gcctttggct tatgtctgtg gttttctgca
7500caatacagta cgctggcact attgcaaact ttaatctttt gggcactgct cctacatatt
7560ttgaacaatt ggcgcgcctc tttggcgcat ataaggcgca cctggtatta gtcattttcc
7620tgtccaggtg cgctacaaca attgcttgca taactatatc cactccctaa gtaataaaac
7680tgcttttagg cacatatttt agtttgtttt tacttaagct aattgcatac ttggcttgta
7740caactacttt catgtccaac attctgtcta cccttaacat gaactataat atgactaagc
7800tgtgcataca tagtttatgc aaccgaaata ggttgggcag cacatactat acttttc
7857424155PRTHuman papilloma virus 424Met Glu Pro Gln Phe Asn Asn Pro Gln
Glu Arg Pro Arg Ser Leu His 1 5 10
15 His Leu Ser Glu Val Leu Glu Ile Pro Leu Ile Asp Leu Arg
Leu Ser 20 25 30
Cys Val Tyr Cys Lys Lys Glu Leu Thr Arg Ala Glu Val Tyr Asn Phe
35 40 45 Ala Cys Thr Glu
Leu Lys Leu Val Tyr Arg Asp Asp Phe Pro Tyr Ala 50
55 60 Val Cys Arg Val Cys Leu Leu Phe
Tyr Ser Lys Val Arg Lys Tyr Arg 65 70
75 80 Tyr Tyr Asp Tyr Ser Val Tyr Gly Ala Thr Leu Glu
Ser Ile Thr Lys 85 90
95 Lys Gln Leu Cys Asp Leu Leu Ile Arg Cys Tyr Arg Cys Gln Ser Pro
100 105 110 Leu Thr Pro
Glu Glu Lys Gln Leu His Cys Asp Arg Lys Arg Arg Phe 115
120 125 His Leu Ile Ala His Gly Trp Thr
Gly Ser Cys Leu Gly Cys Trp Arg 130 135
140 Gln Thr Ser Arg Glu Pro Arg Glu Ser Thr Val 145
150 155 425105PRTHuman papilloma virus 425Met
His Gly Lys Val Pro Thr Leu Gln Asp Val Val Leu Glu Leu Thr 1
5 10 15 Pro Gln Thr Glu Ile Asp
Leu Gln Cys Asn Glu Gln Leu Asp Ser Ser 20
25 30 Glu Asp Glu Asp Glu Asp Glu Val Asp His
Leu Gln Glu Arg Pro Gln 35 40
45 Gln Ala Arg Gln Ala Lys Gln His Thr Cys Tyr Leu Ile His
Val Pro 50 55 60
Cys Cys Glu Cys Lys Phe Val Val Gln Leu Asp Ile Gln Ser Thr Lys 65
70 75 80 Glu Asp Leu Arg Val
Val Gln Gln Leu Leu Met Gly Ala Leu Thr Val 85
90 95 Thr Cys Pro Leu Cys Ala Ser Ser Asn
100 105 426636PRTHuman papilloma virus 426Met Ala
Ser Pro Glu Gly Thr Asp Gly Glu Gly Lys Gly Cys Cys Gly 1 5
10 15 Trp Phe Glu Val Glu Ala Ile
Val Glu Lys Lys Thr Gly Asp Lys Ile 20 25
30 Ser Asp Asp Glu Ser Asp Glu Glu Asp Glu Ile Asp
Thr Asp Leu Asp 35 40 45
Gly Phe Ile Asp Asp Ser Tyr Ile Gln Asn Ile Gln Ala Asp Ala Glu
50 55 60 Thr Ser Gln
Gln Leu Leu Gln Val Gln Thr Ala His Ala Asp Lys Gln 65
70 75 80 Thr Leu Gln Lys Leu Lys Arg
Lys Tyr Ile Ala Ser Pro Leu Arg Asp 85
90 95 Ile Ser Asn Gln Gln Thr Val Cys Arg Glu Gly
Val Lys Arg Arg Leu 100 105
110 Ile Leu Ser Asp Leu Gln Asp Ser Gly Tyr Gly Asn Thr Leu Glu
Thr 115 120 125 Leu
Glu Thr Pro Glu Gln Val Asp Glu Glu Val Gln Gly Arg Gly Cys 130
135 140 Gly Asn Thr Gln Asn Gly
Gly Ser Gln Asn Ser Thr Tyr Ser Asn Asn 145 150
155 160 Ser Glu Asp Ser Val Ile His Met Asp Ile Asp
Arg Asn Asn Glu Thr 165 170
175 Pro Thr Gln Gln Leu Gln Asp Leu Phe Lys Ser Ser Asn Leu Gln Gly
180 185 190 Lys Leu
Tyr Tyr Lys Phe Lys Glu Val Tyr Gly Ile Pro Phe Ser Glu 195
200 205 Leu Val Arg Thr Phe Lys Ser
Asp Ser Thr Cys Cys Asn Asp Trp Ile 210 215
220 Cys Ala Ile Phe Gly Val Asn Glu Thr Leu Ala Glu
Ala Leu Lys Thr 225 230 235
240 Ile Ile Lys Pro His Cys Met Tyr Tyr His Met Gln Cys Leu Thr Cys
245 250 255 Thr Trp Gly
Val Ile Val Met Met Leu Ile Arg Tyr Thr Cys Gly Lys 260
265 270 Asn Arg Lys Thr Ile Ala Lys Ala
Leu Ser Ser Ile Leu Asn Val Pro 275 280
285 Gln Glu Gln Met Leu Ile Gln Pro Pro Lys Ile Arg Ser
Pro Ala Val 290 295 300
Ala Leu Tyr Phe Tyr Lys Thr Ala Met Ser Asn Ile Ser Asp Val Tyr 305
310 315 320 Gly Asp Thr Pro
Glu Trp Ile Gln Arg Gln Thr Gln Leu Gln His Ser 325
330 335 Leu Gln Asp Ser Gln Phe Glu Leu Ser
Lys Met Val Gln Trp Ala Phe 340 345
350 Asp Asn Glu Val Thr Asp Asp Ser Gln Ile Ala Phe Gln Tyr
Ala Gln 355 360 365
Leu Ala Asp Val Asp Ser Asn Ala Gln Ala Phe Leu Lys Ser Asn Met 370
375 380 Gln Ala Lys Tyr Val
Lys Asp Cys Gly Ile Met Cys Arg His Tyr Lys 385 390
395 400 Arg Ala Gln Gln Gln Gln Met Asn Met Cys
Gln Trp Ile Lys His Ile 405 410
415 Cys Ser Lys Thr Asp Glu Gly Gly Asp Trp Lys Pro Ile Val Gln
Phe 420 425 430 Leu
Arg Tyr Gln Gly Val Asp Phe Ile Ser Phe Leu Ser Tyr Phe Lys 435
440 445 Leu Phe Leu Gln Gly Thr
Pro Lys His Asn Cys Leu Val Leu Cys Gly 450 455
460 Pro Pro Asn Thr Gly Lys Ser Cys Phe Ala Met
Ser Leu Ile Lys Phe 465 470 475
480 Phe Gln Gly Ser Val Ile Ser Phe Val Asn Ser Gln Ser His Phe Trp
485 490 495 Leu Gln
Pro Leu Asp Asn Ala Lys Leu Gly Leu Leu Asp Asp Ala Thr 500
505 510 Glu Ile Cys Trp Lys Tyr Ile
Asp Asp Tyr Leu Arg Asn Leu Val Asp 515 520
525 Gly Asn Pro Ile Ser Leu Asp Arg Lys His Lys Gln
Leu Val Gln Ile 530 535 540
Lys Cys Pro Pro Leu Leu Ile Thr Thr Asn Ile Asn Pro Met Leu Asp 545
550 555 560 Ala Lys Leu
Arg Tyr Leu His Ser Arg Met Leu Val Phe Gln Phe Gln 565
570 575 Asn Pro Phe Pro Leu Asp Asn Asn
Gly Asn Pro Val Tyr Glu Leu Ser 580 585
590 Asn Val Asn Trp Lys Cys Phe Phe Thr Arg Thr Trp Ser
Arg Leu Asn 595 600 605
Leu Asp Asn Asp Glu Asp Lys Glu Asn Asn Gly Asp Ala Phe Pro Thr 610
615 620 Phe Lys Cys Val
Pro Glu Gln Asn Thr Arg Leu Phe 625 630
635 427310PRTHuman papilloma virus 427Met Val Pro Cys Leu Gln Val Cys
Lys Ala Lys Ala Cys Ser Ala Ile 1 5 10
15 Glu Val Gln Ile Ala Leu Glu Ser Leu Ser Thr Thr Ile
Tyr Asn Asn 20 25 30
Glu Glu Trp Thr Leu Arg Asp Thr Cys Glu Glu Leu Trp Leu Thr Glu
35 40 45 Pro Lys Lys Cys
Phe Lys Lys Glu Gly Gln His Ile Glu Val Trp Phe 50
55 60 Asp Gly Ser Lys Asn Asn Cys Met
Gln Tyr Val Ala Trp Lys Tyr Ile 65 70
75 80 Tyr Tyr Asn Gly Asp Cys Gly Trp Gln Lys Val Cys
Ser Gly Val Asp 85 90
95 Tyr Arg Gly Ile Tyr Tyr Val His Asp Gly His Lys Thr Tyr Tyr Thr
100 105 110 Asp Phe Glu
Gln Glu Ala Lys Lys Phe Gly Cys Lys Asn Ile Trp Glu 115
120 125 Val His Met Glu Asn Glu Ser Ile
Tyr Cys Pro Asp Ser Val Ser Ser 130 135
140 Thr Cys Arg Tyr Asn Val Ser Pro Val Glu Thr Val Asn
Glu Tyr Asn 145 150 155
160 Thr His Lys Thr Thr Thr Thr Thr Ser Thr Ser Val Gly Asn Gln Asp
165 170 175 Ala Ala Val Ser
His Arg Pro Gly Lys Arg Pro Arg Leu Arg Glu Ser 180
185 190 Glu Phe Asp Ser Ser Arg Glu Ser His
Ala Lys Cys Val Thr Thr His 195 200
205 Thr His Ile Ser Asp Thr Asp Asn Thr Asp Ser Arg Ser Arg
Ser Ile 210 215 220
Asn Asn Asn Asn His Pro Gly Asp Lys Thr Thr Pro Val Val His Leu 225
230 235 240 Lys Gly Glu Pro Asn
Arg Leu Lys Cys Cys Arg Tyr Arg Phe Gln Lys 245
250 255 Tyr Lys Thr Leu Phe Val Asp Val Thr Ser
Thr Tyr His Trp Thr Ser 260 265
270 Thr Asp Asn Lys Asn Tyr Ser Ile Ile Thr Ile Ile Tyr Lys Asp
Glu 275 280 285 Thr
Gln Arg Asn Ser Phe Leu Ser His Val Lys Ile Pro Val Val Tyr 290
295 300 Arg Leu Val Trp Asp Lys
305 310 428464PRTHuman papilloma virus 428Met Val Ala His
Arg Ala Thr Arg Arg Lys Arg Ala Ser Ala Thr Gln 1 5
10 15 Leu Tyr Lys Thr Cys Lys Leu Ser Gly
Thr Cys Pro Glu Asp Val Val 20 25
30 Asn Lys Ile Glu Gln Lys Thr Trp Ala Asp Lys Ile Leu Gln
Trp Gly 35 40 45
Ser Leu Phe Thr Tyr Phe Gly Gly Leu Gly Ile Gly Thr Gly Thr Gly 50
55 60 Ser Gly Gly Arg Ala
Gly Tyr Val Pro Leu Gly Ser Arg Pro Ser Thr 65 70
75 80 Ile Val Asp Val Thr Pro Ala Arg Pro Pro
Ile Val Val Glu Ser Val 85 90
95 Gly Pro Thr Asp Pro Ser Ile Val Thr Leu Val Glu Glu Ser Ser
Val 100 105 110 Ile
Glu Ser Gly Ala Gly Ile Pro Asn Phe Thr Gly Ser Gly Gly Phe 115
120 125 Glu Ile Thr Ser Ser Ser
Thr Thr Thr Pro Ala Val Leu Asp Ile Thr 130 135
140 Pro Thr Ser Ser Thr Val His Val Ser Ser Thr
His Ile Thr Asn Pro 145 150 155
160 Leu Phe Ile Asp Pro Pro Val Ile Glu Ala Pro Gln Thr Gly Glu Val
165 170 175 Ser Gly
Asn Ile Leu Ile Ser Thr Pro Thr Ser Gly Ile His Ser Tyr 180
185 190 Glu Glu Ile Pro Met Gln Thr
Phe Ala Val His Gly Ser Gly Thr Glu 195 200
205 Pro Ile Ser Ser Thr Pro Ile Pro Gly Phe Arg Arg
Ile Ala Ala Pro 210 215 220
Arg Leu Tyr Arg Lys Ala Phe Gln Gln Val Lys Val Thr Asp Pro Ala 225
230 235 240 Phe Leu Asp
Arg Pro Ala Thr Leu Val Ser Ala Asp Asn Pro Leu Phe 245
250 255 Glu Gly Thr Asp Thr Ser Leu Ala
Phe Ser Pro Ser Gly Val Ala Pro 260 265
270 Asp Pro Asp Phe Met Asn Ile Val Ala Leu His Arg Pro
Ala Phe Thr 275 280 285
Thr Arg Arg Gly Gly Val Arg Phe Ser Arg Leu Gly Arg Lys Ala Thr 290
295 300 Ile Gln Thr Arg
Arg Gly Thr Gln Ile Gly Ala Arg Val His Tyr Tyr 305 310
315 320 Tyr Asp Ile Ser Pro Ile Ala Gln Ala
Glu Glu Ile Glu Met Gln Pro 325 330
335 Leu Leu Ser Ala Asn Asn Ser Phe Asp Gly Leu Tyr Asp Ile
Tyr Ala 340 345 350
Asn Ile Asp Asp Glu Ala Pro Gly Leu Ser Ser Gln Ser Val Ala Thr
355 360 365 Pro Ser Ala His
Leu Pro Ile Lys Pro Ser Thr Leu Ser Phe Ala Ser 370
375 380 Asn Thr Thr Asn Val Thr Ala Pro
Leu Gly Asn Val Trp Glu Thr Pro 385 390
395 400 Phe Tyr Ser Gly Pro Asp Ile Val Leu Pro Thr Gly
Pro Ser Thr Trp 405 410
415 Pro Phe Val Pro Gln Ser Pro Tyr Asp Val Thr His Asp Val Tyr Ile
420 425 430 Gln Gly Ser
Ser Phe Ala Leu Trp Pro Val Tyr Phe Phe Arg Arg Arg 435
440 445 Arg Arg Lys Arg Ile Pro Tyr Phe
Phe Ala Asp Gly Asp Val Ala Ala 450 455
460 429534PRTHuman papilloma virus 429Met Met Leu Pro
Met Met Tyr Ile Tyr Arg Asp Pro Pro Leu His Tyr 1 5
10 15 Gly Leu Cys Ile Phe Leu Asp Val Gly
Ala Val Asn Val Phe Pro Ile 20 25
30 Phe Leu Gln Met Ala Thr Trp Arg Pro Ser Glu Asn Lys Val
Tyr Leu 35 40 45
Pro Pro Thr Pro Val Ser Lys Val Val Ala Thr Asp Ser Tyr Val Lys 50
55 60 Arg Thr Ser Ile Phe
Tyr His Ala Gly Ser Ser Arg Leu Leu Ala Val 65 70
75 80 Gly His Pro Tyr Tyr Ser Val Thr Lys Asp
Asn Thr Lys Thr Asn Ile 85 90
95 Pro Lys Val Ser Ala Tyr Gln Tyr Arg Val Phe Arg Val Arg Leu
Pro 100 105 110 Asp
Pro Asn Lys Phe Gly Leu Pro Asp Thr Asn Ile Tyr Asn Pro Asp 115
120 125 Gln Glu Arg Leu Val Trp
Ala Cys Val Gly Leu Glu Val Gly Arg Gly 130 135
140 Gln Pro Leu Gly Ala Gly Leu Ser Gly His Pro
Leu Phe Asn Arg Leu 145 150 155
160 Asp Asp Thr Glu Ser Ser Asn Leu Ala Asn Asn Asn Val Ile Glu Asp
165 170 175 Ser Arg
Asp Asn Ile Ser Val Asp Gly Lys Gln Thr Gln Leu Cys Ile 180
185 190 Val Gly Cys Thr Pro Ala Met
Gly Glu His Trp Thr Lys Gly Ala Val 195 200
205 Cys Lys Ser Thr Gln Val Thr Thr Gly Asp Cys Pro
Pro Leu Ala Leu 210 215 220
Ile Asn Thr Pro Ile Glu Asp Gly Asp Met Ile Asp Thr Gly Phe Gly 225
230 235 240 Ala Met Asp
Phe Lys Val Leu Gln Glu Ser Lys Ala Glu Val Pro Leu 245
250 255 Asp Ile Val Gln Ser Thr Cys Lys
Tyr Pro Asp Tyr Leu Lys Met Ser 260 265
270 Ala Asp Ala Tyr Gly Asp Ser Met Trp Phe Tyr Leu Arg
Arg Glu Gln 275 280 285
Leu Phe Ala Arg His Tyr Phe Asn Arg Ala Gly Lys Val Gly Glu Thr 290
295 300 Ile Pro Ala Glu
Leu Tyr Leu Lys Gly Ser Asn Gly Arg Glu Pro Pro 305 310
315 320 Pro Ser Ser Val Tyr Val Ala Thr Pro
Ser Gly Ser Met Ile Thr Ser 325 330
335 Glu Ala Gln Leu Phe Asn Lys Pro Tyr Trp Leu Gln Arg Ala
Gln Gly 340 345 350
His Asn Asn Gly Ile Cys Trp Gly Asn Gln Leu Phe Val Thr Val Val
355 360 365 Asp Thr Thr Arg
Ser Thr Asn Met Thr Ile Ser Thr Ala Thr Glu Gln 370
375 380 Leu Ser Lys Tyr Asp Ala Arg Lys
Ile Asn Gln Tyr Leu Arg His Val 385 390
395 400 Glu Glu Tyr Glu Leu Gln Phe Val Phe Gln Leu Cys
Lys Ile Thr Leu 405 410
415 Ser Ala Glu Val Met Ala Tyr Leu His Asn Met Asn Ala Asn Leu Leu
420 425 430 Glu Asp Trp
Asn Ile Gly Leu Ser Pro Pro Val Ala Thr Ser Leu Glu 435
440 445 Asp Lys Tyr Arg Tyr Val Arg Ser
Thr Ala Ile Thr Cys Gln Arg Glu 450 455
460 Gln Pro Pro Thr Glu Lys Gln Asp Pro Leu Ala Lys Tyr
Lys Phe Trp 465 470 475
480 Asp Val Asn Leu Gln Asp Ser Phe Ser Thr Asp Leu Asp Gln Phe Pro
485 490 495 Leu Gly Arg Lys
Phe Leu Met Gln Leu Gly Thr Arg Ser Lys Pro Ala 500
505 510 Val Ala Thr Ser Lys Lys Arg Ser Ala
Pro Thr Ser Thr Ser Thr Pro 515 520
525 Ala Lys Arg Lys Arg Arg 530
430151PRTHuman papilloma virus 430Met Phe Glu Asp Lys Arg Glu Arg Pro Arg
Thr Leu His Glu Leu Cys 1 5 10
15 Glu Ala Leu Asn Val Ser Met His Asn Ile Gln Val Val Cys Val
Tyr 20 25 30 Cys
Lys Lys Glu Leu Cys Arg Ala Asp Val Tyr Asn Val Ala Phe Thr 35
40 45 Glu Ile Lys Ile Val Tyr
Arg Asp Asn Asn Pro Tyr Ala Val Cys Lys 50 55
60 Gln Cys Leu Leu Phe Tyr Ser Lys Ile Arg Glu
Tyr Arg Arg Tyr Ser 65 70 75
80 Arg Ser Val Tyr Gly Thr Thr Leu Glu Ala Ile Thr Lys Lys Ser Leu
85 90 95 Tyr Asp
Leu Ser Ile Arg Cys His Arg Cys Gln Arg Pro Leu Gly Pro 100
105 110 Glu Glu Lys Gln Lys Leu Val
Asp Glu Lys Lys Arg Phe His Glu Ile 115 120
125 Ala Gly Arg Trp Thr Gly Gln Cys Ala Asn Cys Trp
Gln Arg Thr Arg 130 135 140
Gln Arg Asn Glu Thr Gln Val 145 150
431101PRTHuman papilloma virus 431Met Arg Gly Asn Val Pro Gln Leu Lys Asp
Val Val Leu His Leu Thr 1 5 10
15 Pro Gln Thr Glu Ile Asp Leu Gln Cys Tyr Glu Gln Phe Asp Ser
Ser 20 25 30 Glu
Glu Glu Asp Glu Val Asp Asn Met Arg Asp Gln Leu Pro Glu Arg 35
40 45 Arg Ala Gly Gln Ala Thr
Cys Tyr Arg Ile Glu Ala Pro Cys Cys Arg 50 55
60 Cys Ser Ser Val Val Gln Leu Ala Val Glu Ser
Ser Gly Asp Thr Leu 65 70 75
80 Arg Val Val Gln Gln Met Leu Met Gly Glu Leu Ser Leu Val Cys Pro
85 90 95 Cys Cys
Ala Asn Asn 100 432634PRTHuman papilloma virus 432Met Asp
Cys Glu Gly Thr Glu Asp Glu Gly Ala Gly Cys Asn Gly Trp 1 5
10 15 Phe Phe Val Glu Ala Ile Val
Glu Lys Lys Thr Gly Asp Asn Val Ser 20 25
30 Asp Asp Glu Asp Glu Asn Ala Asp Asp Thr Gly Ser
Asp Leu Ile Asn 35 40 45
Phe Ile Asp Ser Glu Thr Ser Ile Cys Ser Gln Ala Glu Gln Glu Thr
50 55 60 Ala Arg Ala
Leu Phe Gln Ala Gln Glu Leu Gln Ala Asn Lys Glu Ala 65
70 75 80 Val His Gln Leu Lys Arg Lys
Phe Leu Val Ser Pro Arg Ser Ser Pro 85
90 95 Leu Gly Asp Ile Thr Asn Gln Asn Asn Thr His
Ser His Ser Gln Ala 100 105
110 Asn Glu Ser Gln Val Lys Arg Arg Leu Leu Asp Ser Tyr Pro Asp
Ser 115 120 125 Gly
Tyr Gly Asn Thr Gln Val Glu Thr Val Glu Ala Thr Leu Gln Val 130
135 140 Asp Gly Gln His Gly Gly
Ser Gln Asn Ser Val Cys Ser Ser Gly Gly 145 150
155 160 Gly Ser Val Met Asp Val Glu Thr Thr Glu Ser
Cys Ala Asn Val Glu 165 170
175 Leu Asn Ser Ile Cys Glu Val Leu Lys Ser Ser Asn Ala Lys Ala Thr
180 185 190 Leu Met
Ala Lys Phe Lys Glu Leu Tyr Gly Ile Ser Tyr Asn Glu Leu 195
200 205 Val Arg Val Phe Lys Ser Asp
Lys Thr Cys Cys Ile Asp Trp Val Cys 210 215
220 Ala Leu Phe Gly Val Ser Pro Met Val Ala Glu Asn
Leu Lys Thr Leu 225 230 235
240 Ile Lys Pro Phe Cys Met Tyr Tyr His Ile Gln Cys Leu Ser Cys Asp
245 250 255 Trp Gly Thr
Ile Val Leu Met Leu Ile Arg Phe Ser Cys Ala Lys Asn 260
265 270 Arg Thr Thr Ile Ala Lys Cys Leu
Ser Thr Leu Val Asn Ile Pro Gln 275 280
285 Ser Gln Met Phe Ile Glu Pro Pro Lys Leu Arg Ser Thr
Pro Val Ala 290 295 300
Leu Tyr Phe Tyr Arg Thr Gly Ile Ser Asn Ile Ser Asn Thr Tyr Gly 305
310 315 320 Glu Thr Pro Glu
Trp Ile Thr Arg Gln Thr Gln Leu Gln His Ser Phe 325
330 335 Glu Asp Ser Thr Phe Glu Leu Ser Gln
Met Val Gln Trp Ala Phe Asp 340 345
350 His Glu Val Leu Asp Asp Ser Glu Ile Ala Phe His Tyr Ala
Gln Leu 355 360 365
Ala Asp Ile Asp Ser Asn Ala Ala Ala Phe Leu Lys Ser Asn Cys Gln 370
375 380 Ala Lys Tyr Val Lys
Asp Cys Gly Thr Met Ala Arg His Tyr Lys Arg 385 390
395 400 Ala Gln Arg Lys Ser Leu Ser Met Ser Ala
Trp Ile Arg Tyr Arg Cys 405 410
415 Asp Arg Ala Lys Asp Gly Gly Asn Trp Arg Glu Ile Ala Lys Phe
Leu 420 425 430 Arg
Tyr Gln Gly Val Asn Phe Met Ser Phe Ile Gln Met Phe Lys Gln 435
440 445 Phe Leu Lys Gly Thr Pro
Lys His Asn Cys Ile Val Ile Tyr Gly Pro 450 455
460 Pro Asn Thr Gly Lys Ser Leu Phe Ala Met Ser
Leu Met Lys Phe Met 465 470 475
480 Gln Gly Ser Ile Ile Ser Tyr Val Asn Ser Gly Ser His Phe Trp Leu
485 490 495 Gln Pro
Leu Glu Asp Ala Lys Ile Ala Leu Leu Asp Asp Ala Thr Tyr 500
505 510 Gly Cys Trp Thr Tyr Ile Asp
Gln Tyr Leu Arg Asn Phe Leu Asp Gly 515 520
525 Asn Pro Cys Ser Ile Asp Arg Lys His Arg Ser Leu
Ile Gln Leu Val 530 535 540
Cys Pro Pro Leu Leu Ile Thr Ser Asn Ile Asn Pro Gln Glu Asp Ala 545
550 555 560 Asn Leu Met
Tyr Leu His Thr Arg Val Thr Val Leu Lys Phe Leu Asn 565
570 575 Thr Phe Pro Phe Asp Asn Asn Gly
Asn Ala Val Tyr Thr Leu Asn Asp 580 585
590 Glu Asn Trp Lys Asn Phe Phe Ser Thr Thr Trp Ser Arg
Leu Asp Leu 595 600 605
Glu Glu Glu Glu Asp Lys Glu Asn Gly Asp Pro Met Pro Pro Phe Lys 610
615 620 Cys Val Pro Gly
Glu Asn Thr Arg Leu Leu 625 630
433358PRTHuman papilloma virus 433Met Glu Thr Leu Cys His Arg Leu Asn Val
Cys Gln Glu Lys Ile Leu 1 5 10
15 Asp Cys Tyr Glu Leu Asp Ser Asp Lys Leu Val Asp Gln Ile Asn
Tyr 20 25 30 Trp
Thr Leu Leu Arg Tyr Glu Ala Ala Met Phe Tyr Ala Ala Arg Glu 35
40 45 Arg Asn Leu Arg Thr Ile
Asn His Gln Val Val Pro Ala Thr Thr Val 50 55
60 Ser Lys Gln Lys Ala Cys Gln Ala Ile Glu Met
His Met Ala Leu Gln 65 70 75
80 Ser Leu Asn Lys Ser Asp Tyr Asn Met Glu Pro Trp Thr Met Arg Glu
85 90 95 Thr Cys
Tyr Glu Leu Trp Cys Val Ala Pro Lys Gln Cys Phe Lys Lys 100
105 110 Gly Gly Ile Thr Val Thr Val
Ile Phe Asp Gly Asn Lys Asp Asn Ala 115 120
125 Met Asp Tyr Thr Ser Trp Lys Phe Ile Tyr Ile Tyr
Asp Asn Asp Lys 130 135 140
Trp Val Lys Thr Asn Gly Asn Val Asp Tyr Thr Gly Ile Tyr Tyr Thr 145
150 155 160 Val Asn Ser
Lys Lys Glu Tyr Tyr Val Gln Phe Lys Asp Glu Ala Lys 165
170 175 Ile Tyr Gly Ala Gln Gln Trp Glu
Val Tyr Met Tyr Gly Thr Val Ile 180 185
190 Thr Cys Pro Glu Tyr Val Ser Ser Thr Cys Ser Asp Ala
Leu Ser Thr 195 200 205
Thr Thr Thr Val Glu Gln Leu Ser Asn Thr Pro Thr Thr Asn Pro Leu 210
215 220 Thr Thr Cys Val
Gly Ala Lys Glu Ala Gln Thr Gln Gln Arg Lys Arg 225 230
235 240 Gln Arg Leu Thr Glu Pro Asp Ser Ser
Thr Ile Ser Pro Leu Ser Val 245 250
255 Asp Asn Thr Asn Asn Gln Ile His Cys Gly Ser Gly Ser Thr
Asn Thr 260 265 270
Gly Gly His Gln Ser Ala Thr Gln Thr Ala Phe Ile Val His Leu Lys
275 280 285 Gly Asp Thr Asn
Cys Leu Lys Cys Phe Arg Tyr Arg Phe Thr Lys His 290
295 300 Lys Gly Leu Tyr Lys Asn Val Ser
Ser Thr Trp His Trp Thr Ser Asn 305 310
315 320 Thr Lys Thr Gly Ile Val Thr Ile Val Phe Asp Ser
Ala His Gln Arg 325 330
335 Glu Thr Phe Ile Lys Thr Ile Lys Val Pro Pro Ser Val Thr Leu Ser
340 345 350 Leu Gly Ile
Met Thr Leu 355 43487PRTHuman papilloma virus 434Met
Tyr Leu Val Pro Ala Ala Thr Arg Tyr Pro Leu Leu Gln Leu Leu 1
5 10 15 Asn Asn Tyr Gln Thr Pro
Gln Arg Pro Ile Pro Leu Pro Pro Ala Trp 20
25 30 Ala Pro Lys Lys Pro Arg His Asn Ser Glu
Asn Asp Ser Asp Leu Leu 35 40
45 Ser Pro Thr Pro Pro Gln Ser Pro His Cys Pro Trp Thr Ile
Gln Thr 50 55 60
Thr Lys Tyr Thr Val Glu Val Glu Ala Leu Thr Leu Glu Gly Thr Lys 65
70 75 80 Val Gln Leu Arg Leu
Arg Leu 85 435468PRTHuman papilloma virus 435Met
Val Ala Thr Arg Ala Arg Arg Arg Lys Arg Ala Ser Val Thr Gln 1
5 10 15 Leu Tyr Ser Thr Cys Lys
Ala Ala Gly Thr Cys Pro Pro Asp Val Val 20
25 30 Asn Lys Val Glu Gly Thr Thr Leu Ala Asp
Lys Ile Leu Gln Trp Ser 35 40
45 Gly Leu Gly Ile Phe Leu Gly Gly Leu Gly Ile Gly Thr Gly
Ser Gly 50 55 60
Ser Gly Gly Arg Thr Gly Tyr Ile Pro Leu Gly Gly Gly Gly Arg Pro 65
70 75 80 Gly Val Val Asp Ile
Ala Pro Ala Arg Pro Pro Ile Ile Ile Asp Leu 85
90 95 Trp His His Thr Glu Pro Ser Ile Val Asn
Leu Val Glu Asp Ser Ser 100 105
110 Ile Ile Gln Ser Gly Ser Pro Ile Pro Thr Phe Thr Gly Thr Asp
Gly 115 120 125 Phe
Glu Ile Thr Ser Ser Ser Thr Thr Thr Pro Ala Val Leu Asp Ile 130
135 140 Thr Pro Ser Ala Gly Thr
Val His Val Ser Ser Thr Asn Ile Glu Asn 145 150
155 160 Pro Leu Tyr Ile Glu Pro Pro Ser Ile Glu Ala
Pro Gln Ser Gly Glu 165 170
175 Val Ser Asp Ile Tyr Leu Leu Val His Tyr Ser Gly Thr His Gly Tyr
180 185 190 Glu Glu
Ile Pro Met Glu Val Phe Ala Ser Asn Val Ser Thr Gly Thr 195
200 205 Glu Pro Ile Ser Ser Thr Pro
Thr Pro Gly Val Ser Arg Ile Ala Ala 210 215
220 Pro Arg Leu Tyr Ser Lys Ser Tyr Thr Gln Val Lys
Val Thr Asn Pro 225 230 235
240 Asp Phe Ile Ser Lys Pro Ser Thr Phe Val Thr Phe Asn Asn Pro Ala
245 250 255 Phe Glu Pro
Ile Asp Thr Ser Ile Thr Phe Glu Glu Pro Asp Ala Val 260
265 270 Ala Pro Asp Pro Asp Phe Leu Asp
Ile Ile Thr Leu His Arg Pro Ala 275 280
285 Leu Thr Ser Arg Arg Gly Thr Val Arg Phe Ser Arg Leu
Gly Gln Lys 290 295 300
Ala Thr Met Arg Thr Arg Ser Gly Lys Gln Ile Gly Ala Arg Val His 305
310 315 320 Tyr Tyr His Asp
Ile Ser Arg Ile Ala Pro Ala Asp Glu Leu Glu Met 325
330 335 Gln Pro Leu Leu Ser Pro Ser Asn Asn
Tyr Ser Tyr Asp Ile Tyr Ala 340 345
350 Asp Leu Asp Glu Ala Glu Thr Gly Phe Ile Gln Pro Thr His
Thr Thr 355 360 365
Pro Met Ser His Ser Ser Leu Ser Arg Gln Leu Pro Ser Leu Ser Ser 370
375 380 Ser Met Ser Ser Ser
Tyr Ala Asn Val Thr Ile Pro Phe Ser Thr Thr 385 390
395 400 Tyr Ser Val Pro Ile His Thr Gly Pro Asp
Val Val Leu Pro Thr Ser 405 410
415 Pro Thr Val Trp Pro Tyr Val Pro His Thr Ser Ile Asp Thr Lys
His 420 425 430 Ser
Ile Val Ile Leu Gly Gly Asp Tyr Tyr Leu Trp Pro Tyr Thr His 435
440 445 Leu Leu Arg Lys Arg Arg
Lys Arg Ile Pro Tyr Phe Phe Thr Asp Gly 450 455
460 Ile Val Ala His 465
436504PRTHuman papilloma virus 436Met Ala Leu Trp Arg Thr Asn Asp Ser Lys
Val Tyr Leu Pro Pro Ala 1 5 10
15 Pro Val Ser Arg Ile Val Asn Thr Glu Glu Tyr Ile Thr Arg Thr
Gly 20 25 30 Ile
Tyr Tyr Tyr Ala Gly Ser Ser Arg Leu Ile Thr Leu Gly His Pro 35
40 45 Tyr Phe Pro Ile Pro Lys
Thr Ser Thr Arg Ala Ala Ile Pro Lys Val 50 55
60 Ser Ala Phe Gln Tyr Arg Val Phe Arg Val Gln
Leu Pro Asp Pro Asn 65 70 75
80 Lys Phe Gly Leu Pro Asp Pro Asn Leu Tyr Asn Pro Asp Thr Asp Arg
85 90 95 Leu Val
Trp Gly Cys Val Gly Val Glu Val Gly Arg Gly Gln Pro Leu 100
105 110 Gly Val Gly Leu Ser Gly His
Pro Leu Phe Asn Lys Tyr Asp Asp Thr 115 120
125 Glu Asn Ser Arg Ile Ala Asn Gly Asn Ala Gln Gln
Asp Val Arg Asp 130 135 140
Asn Thr Ser Val Asp Asn Lys Gln Thr Gln Leu Cys Ile Ile Gly Cys 145
150 155 160 Ala Pro Pro
Ile Gly Glu His Trp Gly Ile Gly Thr Thr Cys Lys Asn 165
170 175 Thr Pro Val Pro Pro Gly Asp Cys
Pro Pro Leu Glu Leu Val Ser Ser 180 185
190 Val Ile Gln Asp Gly Asp Met Ile Asp Thr Gly Phe Gly
Ala Met Asp 195 200 205
Phe Ala Ala Leu Gln Ala Thr Lys Ser Asp Val Pro Leu Asp Ile Ser 210
215 220 Gln Ser Val Cys
Lys Tyr Pro Asp Tyr Leu Lys Met Ser Ala Asp Thr 225 230
235 240 Tyr Gly Asn Ser Met Phe Phe His Leu
Arg Arg Glu Gln Ile Phe Ala 245 250
255 Arg His Tyr Tyr Asn Lys Leu Val Gly Val Gly Glu Asp Ile
Pro Asn 260 265 270
Asp Tyr Tyr Ile Lys Gly Ser Gly Asn Gly Arg Asp Pro Ile Glu Ser
275 280 285 Tyr Ile Tyr Ser
Ala Thr Pro Ser Gly Ser Met Ile Thr Ser Asp Ser 290
295 300 Gln Ile Phe Asn Lys Pro Tyr Trp
Leu His Arg Ala Gln Gly His Asn 305 310
315 320 Asn Gly Ile Cys Trp Asn Asn Gln Leu Phe Ile Thr
Cys Val Asp Thr 325 330
335 Thr Arg Ser Thr Asn Leu Thr Ile Ser Thr Ala Thr Ala Ala Val Ser
340 345 350 Pro Thr Phe
Thr Pro Ser Asn Phe Lys Gln Tyr Ile Arg His Gly Glu 355
360 365 Glu Tyr Glu Leu Gln Phe Ile Phe
Gln Leu Cys Lys Ile Thr Leu Thr 370 375
380 Thr Glu Val Met Ala Tyr Leu His Thr Met Asp Pro Thr
Ile Leu Glu 385 390 395
400 Gln Trp Asn Phe Gly Leu Thr Leu Pro Pro Ser Ala Ser Leu Glu Asp
405 410 415 Ala Tyr Arg Phe
Val Arg Asn Ala Ala Thr Ser Cys Gln Lys Asp Thr 420
425 430 Pro Pro Gln Ala Lys Pro Asp Pro Leu
Ala Lys Tyr Lys Phe Trp Asp 435 440
445 Val Asp Leu Lys Glu Arg Phe Ser Leu Asp Leu Asp Gln Phe
Ala Leu 450 455 460
Gly Arg Lys Phe Leu Leu Gln Val Gly Val Gln Arg Lys Pro Arg Pro 465
470 475 480 Gly Leu Lys Arg Pro
Ala Ser Ser Ala Ser Ser Ser Ser Ser Ser Ser 485
490 495 Ala Lys Arg Lys Arg Val Lys Lys
500 437158PRTHuman papilloma virus 437Met His Gln Lys
Arg Thr Ala Met Phe Gln Asp Pro Gln Glu Arg Pro 1 5
10 15 Arg Lys Leu Pro Gln Leu Cys Thr Glu
Leu Gln Thr Thr Ile His Asp 20 25
30 Ile Ile Leu Glu Cys Val Tyr Cys Lys Gln Gln Leu Leu Arg
Arg Glu 35 40 45
Val Tyr Asp Phe Ala Phe Arg Asp Leu Cys Ile Val Tyr Arg Asp Gly 50
55 60 Asn Pro Tyr Ala Val
Cys Asp Lys Cys Leu Lys Phe Tyr Ser Lys Ile 65 70
75 80 Ser Glu Tyr Arg His Tyr Cys Tyr Ser Leu
Tyr Gly Thr Thr Leu Glu 85 90
95 Gln Gln Tyr Asn Lys Pro Leu Cys Asp Leu Leu Ile Arg Cys Ile
Asn 100 105 110 Cys
Gln Lys Pro Leu Cys Pro Glu Glu Lys Gln Arg His Leu Asp Lys 115
120 125 Lys Gln Arg Phe His Asn
Ile Arg Gly Arg Trp Thr Gly Arg Cys Met 130 135
140 Ser Cys Cys Arg Ser Ser Arg Thr Arg Arg Glu
Thr Gln Leu 145 150 155
43898PRTHuman papilloma virus 438Met His Gly Asp Thr Pro Thr Leu His Glu
Tyr Met Leu Asp Leu Gln 1 5 10
15 Pro Glu Thr Thr Asp Leu Tyr Cys Tyr Glu Gln Leu Asn Asp Ser
Ser 20 25 30 Glu
Glu Glu Asp Glu Ile Asp Gly Pro Ala Gly Gln Ala Glu Pro Asp 35
40 45 Arg Ala His Tyr Asn Ile
Val Thr Phe Cys Cys Lys Cys Asp Ser Thr 50 55
60 Leu Arg Leu Cys Val Gln Ser Thr His Val Asp
Ile Arg Thr Leu Glu 65 70 75
80 Asp Leu Leu Met Gly Thr Leu Gly Ile Val Cys Pro Ile Cys Ser Gln
85 90 95 Lys Pro
439649PRTHuman papilloma virus 439Met Ala Asp Pro Ala Gly Thr Asn Gly Glu
Glu Gly Thr Gly Cys Asn 1 5 10
15 Gly Trp Phe Tyr Val Glu Ala Val Val Glu Lys Lys Thr Gly Asp
Ala 20 25 30 Ile
Ser Asp Asp Glu Asn Glu Asn Asp Ser Asp Thr Gly Glu Asp Leu 35
40 45 Val Asp Phe Ile Val Asn
Asp Asn Asp Tyr Leu Thr Gln Ala Glu Thr 50 55
60 Glu Thr Ala His Ala Leu Phe Thr Ala Gln Glu
Ala Lys Gln His Arg 65 70 75
80 Asp Ala Val Gln Val Leu Lys Arg Lys Tyr Leu Val Ser Pro Leu Ser
85 90 95 Asp Ile
Ser Gly Cys Val Asp Asn Asn Ile Ser Pro Arg Leu Lys Ala 100
105 110 Ile Cys Ile Glu Lys Gln Ser
Arg Ala Ala Lys Arg Arg Leu Phe Glu 115 120
125 Ser Glu Asp Ser Gly Tyr Gly Asn Thr Glu Val Glu
Thr Gln Gln Met 130 135 140
Leu Gln Val Glu Gly Arg His Glu Thr Glu Thr Pro Cys Ser Gln Tyr 145
150 155 160 Ser Gly Gly
Ser Gly Gly Gly Cys Ser Gln Tyr Ser Ser Gly Ser Gly 165
170 175 Gly Glu Gly Val Ser Glu Arg His
Thr Ile Cys Gln Thr Pro Leu Thr 180 185
190 Asn Ile Leu Asn Val Leu Lys Thr Ser Asn Ala Lys Ala
Ala Met Leu 195 200 205
Ala Lys Phe Lys Glu Leu Tyr Gly Val Ser Phe Ser Glu Leu Val Arg 210
215 220 Pro Phe Lys Ser
Asn Lys Ser Thr Cys Cys Asp Trp Cys Ile Ala Ala 225 230
235 240 Phe Gly Leu Thr Pro Ser Ile Ala Asp
Ser Ile Lys Thr Leu Leu Gln 245 250
255 Gln Tyr Cys Leu Tyr Leu His Ile Gln Ser Leu Ala Cys Ser
Trp Gly 260 265 270
Met Val Val Leu Leu Leu Val Arg Tyr Lys Cys Gly Lys Asn Arg Glu
275 280 285 Thr Ile Glu Lys
Leu Leu Ser Lys Leu Leu Cys Val Ser Pro Met Cys 290
295 300 Met Met Ile Glu Pro Pro Lys Leu
Arg Ser Thr Ala Ala Ala Leu Tyr 305 310
315 320 Trp Tyr Lys Thr Gly Ile Ser Asn Ile Ser Glu Val
Tyr Gly Asp Thr 325 330
335 Pro Glu Trp Ile Gln Arg Gln Thr Val Leu Gln His Ser Phe Asn Asp
340 345 350 Cys Thr Phe
Glu Leu Ser Gln Met Val Gln Trp Ala Tyr Asp Asn Asp 355
360 365 Ile Val Asp Asp Ser Glu Ile Ala
Tyr Lys Tyr Ala Gln Leu Ala Asp 370 375
380 Thr Asn Ser Asn Ala Ser Ala Phe Leu Lys Ser Asn Ser
Gln Ala Lys 385 390 395
400 Ile Val Lys Asp Cys Ala Thr Met Cys Arg His Tyr Lys Arg Ala Glu
405 410 415 Lys Lys Gln Met
Ser Met Ser Gln Trp Ile Lys Tyr Arg Cys Asp Arg 420
425 430 Val Asp Asp Gly Gly Asp Trp Lys Gln
Ile Val Met Phe Leu Arg Tyr 435 440
445 Gln Gly Val Glu Phe Met Ser Phe Leu Thr Ala Leu Lys Arg
Phe Leu 450 455 460
Gln Gly Ile Pro Lys Lys Asn Cys Ile Leu Leu Tyr Gly Ala Ala Asn 465
470 475 480 Thr Gly Lys Ser Leu
Phe Gly Met Ser Leu Met Lys Phe Leu Gln Gly 485
490 495 Ser Val Ile Cys Phe Val Asn Ser Lys Ser
His Phe Trp Leu Gln Pro 500 505
510 Leu Ala Asp Ala Lys Ile Gly Met Leu Asp Asp Ala Thr Val Pro
Cys 515 520 525 Trp
Asn Tyr Ile Asp Asp Asn Leu Arg Asn Ala Leu Asp Gly Asn Leu 530
535 540 Val Ser Met Asp Val Lys
His Arg Pro Leu Val Gln Leu Lys Cys Pro 545 550
555 560 Pro Leu Leu Ile Thr Ser Asn Ile Asn Ala Gly
Thr Asp Ser Arg Trp 565 570
575 Pro Tyr Leu His Asn Arg Leu Val Val Phe Thr Phe Pro Asn Glu Phe
580 585 590 Pro Phe
Asp Glu Asn Gly Asn Pro Val Tyr Glu Leu Asn Asp Lys Asn 595
600 605 Trp Lys Ser Phe Phe Ser Arg
Thr Trp Ser Arg Leu Ser Leu His Glu 610 615
620 Asp Glu Asp Lys Glu Asn Asp Gly Asp Ser Leu Pro
Thr Phe Lys Cys 625 630 635
640 Val Ser Gly Gln Asn Thr Asn Thr Leu 645
440365PRTHuman papilloma virus 440Met Glu Thr Leu Cys Gln Arg Leu Asn
Val Cys Gln Asp Lys Ile Leu 1 5 10
15 Thr His Tyr Glu Asn Asp Ser Thr Asp Leu Arg Asp His Ile
Asp Tyr 20 25 30
Trp Lys His Met Arg Leu Glu Cys Ala Ile Tyr Tyr Lys Ala Arg Glu
35 40 45 Met Gly Phe Lys
His Ile Asn His Gln Val Val Pro Thr Leu Ala Val 50
55 60 Ser Lys Asn Lys Ala Leu Gln Ala
Ile Glu Leu Gln Leu Thr Leu Glu 65 70
75 80 Thr Ile Tyr Asn Ser Gln Tyr Ser Asn Glu Lys Trp
Thr Leu Gln Asp 85 90
95 Val Ser Leu Glu Val Tyr Leu Thr Ala Pro Thr Gly Cys Ile Lys Lys
100 105 110 His Gly Tyr
Thr Val Glu Val Gln Phe Asp Gly Asp Ile Cys Asn Thr 115
120 125 Met His Tyr Thr Asn Trp Thr His
Ile Tyr Ile Cys Glu Glu Ala Ser 130 135
140 Val Thr Val Val Glu Gly Gln Val Asp Tyr Tyr Gly Leu
Tyr Tyr Val 145 150 155
160 His Glu Gly Ile Arg Thr Tyr Phe Val Gln Phe Lys Asp Asp Ala Glu
165 170 175 Lys Tyr Ser Lys
Asn Lys Val Trp Glu Val His Ala Gly Gly Gln Val 180
185 190 Ile Leu Cys Pro Thr Ser Val Phe Ser
Ser Asn Glu Val Ser Ser Pro 195 200
205 Glu Ile Ile Arg Gln His Leu Ala Asn His Pro Ala Ala Thr
His Thr 210 215 220
Lys Ala Val Ala Leu Gly Thr Glu Glu Thr Gln Thr Thr Ile Gln Arg 225
230 235 240 Pro Arg Ser Glu Pro
Asp Thr Gly Asn Pro Cys His Thr Thr Lys Leu 245
250 255 Leu His Arg Asp Ser Val Asp Ser Ala Pro
Ile Leu Thr Ala Phe Asn 260 265
270 Ser Ser His Lys Gly Arg Ile Asn Cys Asn Ser Asn Thr Thr Pro
Ile 275 280 285 Val
His Leu Lys Gly Asp Ala Asn Thr Leu Lys Cys Leu Arg Tyr Arg 290
295 300 Phe Lys Lys His Cys Thr
Leu Tyr Thr Ala Val Ser Ser Thr Trp His 305 310
315 320 Trp Thr Gly His Asn Val Lys His Lys Ser Ala
Ile Val Thr Leu Thr 325 330
335 Tyr Asp Ser Glu Trp Gln Arg Asp Gln Phe Leu Ser Gln Val Lys Ile
340 345 350 Pro Lys
Thr Ile Thr Val Ser Thr Gly Phe Met Ser Ile 355
360 365 44195PRTHuman papilloma virus 441Tyr Tyr Val Leu
His Leu Cys Leu Ala Ala Thr Lys Tyr Pro Leu Leu 1 5
10 15 Lys Leu Leu Gly Ser Thr Trp Pro Thr
Thr Pro Pro Arg Pro Ile Pro 20 25
30 Lys Pro Ser Pro Trp Ala Pro Lys Lys His Arg Arg Leu Ser
Ser Asp 35 40 45
Gln Asp Gln Ser Gln Thr Pro Glu Thr Pro Ala Thr Pro Leu Ser Cys 50
55 60 Cys Thr Glu Thr Gln
Trp Thr Val Leu Gln Ser Ser Leu His Leu Thr 65 70
75 80 Ala His Thr Lys Asp Gly Leu Thr Val Ile
Val Thr Leu His Pro 85 90
95 44278PRTHuman papilloma virus 442Tyr Cys Ile His Asn Ile Thr Gly
Val Leu Phe Ala Leu Leu Cys Val 1 5 10
15 Leu Leu Cys Val Cys Leu Leu Ile Arg Pro Leu Leu Leu
Ser Val Ser 20 25 30
Thr Tyr Thr Ser Leu Ile Ile Leu Val Leu Leu Leu Trp Ile Thr Ala
35 40 45 Ala Ser Ala Phe
Arg Cys Phe Ile Val Tyr Ile Ile Phe Val Tyr Ile 50
55 60 Pro Leu Phe Leu Ile His Thr His
Ala Arg Phe Leu Ile Thr 65 70 75
443473PRTHuman papilloma virus 443Met Arg His Lys Arg Ser Ala Lys
Arg Thr Lys Arg Ala Ser Ala Thr 1 5 10
15 Gln Leu Tyr Lys Thr Cys Lys Gln Ala Gly Thr Cys Pro
Pro Asp Ile 20 25 30
Ile Pro Lys Val Glu Gly Lys Thr Ile Ala Glu Gln Ile Leu Gln Tyr
35 40 45 Gly Ser Met Gly
Val Phe Phe Gly Gly Leu Gly Ile Gly Thr Gly Ser 50
55 60 Gly Thr Gly Gly Arg Thr Gly Tyr
Ile Pro Leu Gly Thr Arg Pro Pro 65 70
75 80 Thr Ala Thr Asp Thr Leu Ala Pro Val Arg Pro Pro
Leu Thr Val Asp 85 90
95 Pro Val Gly Pro Ser Asp Pro Ser Ile Val Ser Leu Val Glu Glu Thr
100 105 110 Ser Phe Ile
Asp Ala Gly Ala Pro Thr Ser Val Pro Ser Ile Pro Pro 115
120 125 Asp Val Ser Gly Phe Ser Ile Thr
Thr Ser Thr Asp Thr Thr Pro Ala 130 135
140 Ile Leu Asp Ile Asn Asn Thr Val Thr Thr Val Thr Thr
His Asn Asn 145 150 155
160 Pro Thr Phe Thr Asp Pro Ser Val Leu Gln Pro Pro Thr Pro Ala Glu
165 170 175 Thr Gly Gly His
Phe Thr Leu Ser Ser Ser Thr Ile Ser Thr His Asn 180
185 190 Tyr Glu Glu Ile Pro Met Asp Thr Phe
Ile Val Ser Thr Asn Pro Asn 195 200
205 Thr Val Thr Ser Ser Thr Pro Ile Pro Gly Ser Arg Pro Val
Ala Arg 210 215 220
Leu Gly Leu Tyr Ser Arg Thr Thr Gln Gln Val Lys Val Val Asp Pro 225
230 235 240 Ala Phe Val Thr Thr
Pro Thr Lys Leu Ile Thr Tyr Asp Asn Pro Ala 245
250 255 Tyr Glu Gly Ile Asp Val Asp Asn Thr Leu
Tyr Phe Ser Ser Asn Asp 260 265
270 Asn Ser Ile Asn Ile Ala Pro Asp Pro Asp Phe Leu Asp Ile Val
Ala 275 280 285 Leu
His Arg Pro Ala Leu Thr Ser Arg Arg Thr Gly Ile Arg Tyr Ser 290
295 300 Arg Ile Gly Asn Lys Gln
Thr Leu Arg Thr Arg Ser Gly Lys Ser Ile 305 310
315 320 Gly Ala Lys Val His Tyr Tyr Tyr Asp Leu Ser
Thr Ile Asp Pro Ala 325 330
335 Glu Glu Ile Glu Leu Gln Thr Ile Thr Pro Ser Thr Tyr Thr Thr Thr
340 345 350 Ser His
Ala Ala Ser Pro Thr Ser Ile Asn Asn Gly Leu Tyr Asp Ile 355
360 365 Tyr Ala Asp Asp Phe Ile Thr
Asp Thr Ser Thr Thr Pro Val Pro Ser 370 375
380 Val Pro Ser Thr Ser Leu Ser Gly Tyr Ile Pro Ala
Asn Thr Thr Ile 385 390 395
400 Pro Phe Gly Gly Ala Tyr Asn Ile Pro Leu Val Ser Gly Pro Asp Ile
405 410 415 Pro Ile Asn
Ile Thr Asp Gln Ala Pro Ser Leu Ile Pro Ile Val Pro 420
425 430 Gly Ser Pro Gln Tyr Thr Ile Ile
Ala Asp Ala Gly Asp Phe Tyr Leu 435 440
445 His Pro Ser Tyr Tyr Met Leu Arg Lys Arg Arg Lys Arg
Leu Pro Tyr 450 455 460
Phe Phe Ser Asp Val Ser Leu Ala Ala 465 470
444531PRTHuman papilloma virus 444Met Gln Val Thr Phe Ile Tyr Ile Leu Val
Ile Thr Cys Tyr Glu Asn 1 5 10
15 Asp Val Asn Val Tyr His Ile Phe Phe Gln Met Ser Leu Trp Leu
Pro 20 25 30 Ser
Glu Ala Thr Val Tyr Leu Pro Pro Val Pro Val Ser Lys Val Val 35
40 45 Ser Thr Asp Glu Tyr Val
Ala Arg Thr Asn Ile Tyr Tyr His Ala Gly 50 55
60 Thr Ser Arg Leu Leu Ala Val Gly His Pro Tyr
Phe Pro Ile Lys Lys 65 70 75
80 Pro Asn Asn Asn Lys Ile Leu Val Pro Lys Val Ser Gly Leu Gln Tyr
85 90 95 Arg Val
Phe Arg Ile His Leu Pro Asp Pro Asn Lys Phe Gly Phe Pro 100
105 110 Asp Thr Ser Phe Tyr Asn Pro
Asp Thr Gln Arg Leu Val Trp Ala Cys 115 120
125 Val Gly Val Glu Val Gly Arg Gly Gln Pro Leu Gly
Val Gly Ile Ser 130 135 140
Gly His Pro Leu Leu Asn Lys Leu Asp Asp Thr Glu Asn Ala Ser Ala 145
150 155 160 Tyr Ala Ala
Asn Ala Gly Val Asp Asn Arg Glu Cys Ile Ser Met Asp 165
170 175 Tyr Lys Gln Thr Gln Leu Cys Leu
Ile Gly Cys Lys Pro Pro Ile Gly 180 185
190 Glu His Trp Gly Lys Gly Ser Pro Cys Thr Asn Val Ala
Val Asn Pro 195 200 205
Gly Asp Cys Pro Pro Leu Glu Leu Ile Asn Thr Val Ile Gln Asp Gly 210
215 220 Asp Met Val His
Thr Gly Phe Gly Ala Met Asp Phe Thr Thr Leu Gln 225 230
235 240 Ala Asn Lys Ser Glu Val Pro Leu Asp
Ile Cys Thr Ser Ile Cys Lys 245 250
255 Tyr Pro Asp Tyr Ile Lys Met Val Ser Glu Pro Tyr Gly Asp
Ser Leu 260 265 270
Phe Phe Tyr Leu Arg Arg Glu Gln Met Phe Val Arg His Leu Phe Asn
275 280 285 Arg Ala Gly Thr
Val Gly Glu Asn Val Pro Asp Asp Leu Tyr Ile Lys 290
295 300 Gly Ser Gly Ser Thr Ala Asn Leu
Ala Ser Ser Asn Tyr Phe Pro Thr 305 310
315 320 Pro Ser Gly Ser Met Val Thr Ser Asp Ala Gln Ile
Phe Asn Lys Pro 325 330
335 Tyr Trp Leu Gln Arg Ala Gln Gly His Asn Asn Gly Ile Cys Trp Gly
340 345 350 Asn Gln Leu
Phe Val Thr Val Val Asp Thr Thr Arg Ser Thr Asn Met 355
360 365 Ser Leu Cys Ala Ala Ile Ser Thr
Ser Glu Thr Thr Tyr Lys Asn Thr 370 375
380 Asn Phe Lys Glu Tyr Leu Arg His Gly Glu Glu Tyr Asp
Leu Gln Phe 385 390 395
400 Ile Phe Gln Leu Cys Lys Ile Thr Leu Thr Ala Asp Val Met Thr Tyr
405 410 415 Ile His Ser Met
Asn Ser Thr Ile Leu Glu Asp Trp Asn Phe Gly Leu 420
425 430 Gln Pro Pro Pro Gly Gly Thr Leu Glu
Asp Thr Tyr Arg Phe Val Thr 435 440
445 Gln Ala Ile Ala Cys Gln Lys His Thr Pro Pro Ala Pro Lys
Glu Asp 450 455 460
Asp Pro Leu Lys Lys Tyr Thr Phe Trp Glu Val Asn Leu Lys Glu Lys 465
470 475 480 Phe Ser Ala Asp Leu
Asp Gln Phe Pro Leu Gly Arg Lys Phe Leu Leu 485
490 495 Gln Ala Gly Leu Lys Ala Lys Pro Lys Phe
Thr Leu Gly Lys Arg Lys 500 505
510 Ala Thr Pro Thr Thr Ser Ser Thr Ser Thr Thr Ala Lys Arg Lys
Lys 515 520 525 Arg
Lys Leu 530 445158PRTHuman papilloma virus 445Met Ala Arg Phe Glu
Asp Pro Thr Arg Arg Pro Tyr Lys Leu Pro Asp 1 5
10 15 Leu Cys Thr Glu Leu Asn Thr Ser Leu Gln
Asp Ile Glu Ile Thr Cys 20 25
30 Val Tyr Cys Lys Thr Val Leu Glu Leu Thr Glu Val Phe Glu Phe
Ala 35 40 45 Phe
Lys Asp Leu Phe Val Val Tyr Arg Asp Ser Ile Pro His Ala Ala 50
55 60 Cys His Lys Cys Ile Asp
Phe Tyr Ser Arg Ile Arg Glu Leu Arg His 65 70
75 80 Tyr Ser Asp Ser Val Tyr Gly Asp Thr Leu Glu
Lys Leu Thr Asn Thr 85 90
95 Gly Leu Tyr Asn Leu Leu Ile Arg Cys Leu Arg Cys Gln Lys Pro Leu
100 105 110 Asn Pro
Ala Glu Lys Leu Arg His Leu Asn Glu Lys Arg Arg Phe His 115
120 125 Asn Ile Ala Gly His Tyr Arg
Gly Gln Cys His Ser Cys Cys Asn Arg 130 135
140 Ala Arg Gln Glu Arg Leu Gln Arg Arg Arg Glu Thr
Gln Val 145 150 155
446105PRTHuman papilloma virus 446Met His Gly Pro Lys Ala Thr Leu Gln Asp
Ile Val Leu His Leu Glu 1 5 10
15 Pro Gln Asn Glu Ile Pro Val Asp Leu Leu Cys His Glu Gln Leu
Ser 20 25 30 Asp
Ser Glu Glu Glu Asn Asp Glu Ile Asp Gly Val Asn His Gln His 35
40 45 Leu Pro Ala Arg Arg Ala
Glu Pro Gln Arg His Thr Met Leu Cys Met 50 55
60 Cys Cys Lys Cys Glu Ala Arg Ile Glu Leu Val
Val Glu Ser Ser Ala 65 70 75
80 Asp Asp Leu Arg Ala Phe Gln Gln Leu Phe Leu Asn Thr Leu Ser Phe
85 90 95 Val Cys
Pro Trp Cys Ala Ser Gln Gln 100 105
447657PRTHuman papilloma virus 447Met Ala Asp Pro Glu Gly Thr Asp Gly Glu
Gly Thr Gly Cys Asn Gly 1 5 10
15 Trp Phe Tyr Val Gln Ala Ile Val Asp Lys Lys Thr Gly Asp Val
Ile 20 25 30 Ser
Asp Asp Glu Asp Glu Asn Ala Thr Asp Thr Gly Ser Asp Met Val 35
40 45 Asp Phe Ile Asp Thr Gln
Gly Thr Phe Cys Glu Gln Ala Glu Leu Glu 50 55
60 Thr Ala Gln Ala Leu Phe His Ala Gln Glu Val
His Asn Asp Ala Gln 65 70 75
80 Val Leu His Val Leu Lys Arg Lys Phe Ala Gly Gly Ser Thr Glu Asn
85 90 95 Ser Pro
Leu Gly Glu Arg Leu Glu Val Asp Thr Glu Leu Ser Pro Arg 100
105 110 Leu Gln Glu Ile Ser Leu Asn
Ser Gly Gln Lys Lys Ala Lys Arg Arg 115 120
125 Leu Phe Thr Ile Ser Asp Ser Gly Tyr Gly Cys Ser
Glu Val Glu Ala 130 135 140
Thr Gln Ile Gln Val Thr Thr Asn Gly Glu His Gly Gly Asn Val Cys 145
150 155 160 Ser Gly Gly
Ser Thr Glu Ala Ile Asp Asn Gly Gly Thr Glu Gly Asn 165
170 175 Asn Ser Ser Val Asp Gly Thr Ser
Asp Asn Ser Asn Ile Glu Asn Val 180 185
190 Asn Pro Gln Cys Thr Ile Ala Gln Leu Lys Asp Leu Leu
Lys Val Asn 195 200 205
Asn Lys Gln Gly Ala Met Leu Ala Val Phe Lys Asp Thr Tyr Gly Leu 210
215 220 Ser Phe Thr Asp
Leu Val Arg Asn Phe Lys Ser Asp Lys Thr Thr Cys 225 230
235 240 Thr Asp Trp Val Thr Ala Ile Phe Gly
Val Asn Pro Thr Ile Ala Glu 245 250
255 Gly Phe Lys Thr Leu Ile Gln Pro Phe Ile Leu Tyr Ala His
Ile Gln 260 265 270
Cys Leu Asp Cys Lys Trp Gly Val Leu Ile Leu Ala Leu Leu Arg Tyr
275 280 285 Lys Cys Gly Lys
Ser Arg Leu Thr Val Ala Lys Gly Leu Ser Thr Leu 290
295 300 Leu His Val Pro Glu Thr Cys Met
Leu Ile Gln Pro Pro Lys Leu Arg 305 310
315 320 Ser Ser Val Ala Ala Leu Tyr Trp Tyr Arg Thr Gly
Ile Ser Asn Ile 325 330
335 Ser Glu Val Met Gly Asp Thr Pro Glu Trp Ile Gln Arg Leu Thr Ile
340 345 350 Ile Gln His
Gly Ile Asp Asp Ser Asn Phe Asp Leu Ser Glu Met Val 355
360 365 Gln Trp Ala Phe Asp Asn Glu Leu
Thr Asp Glu Ser Asp Met Ala Phe 370 375
380 Glu Tyr Ala Leu Leu Ala Asp Ser Asn Ser Asn Ala Ala
Ala Phe Leu 385 390 395
400 Lys Ser Asn Cys Gln Ala Lys Tyr Leu Lys Asp Cys Ala Thr Met Cys
405 410 415 Lys His Tyr Arg
Arg Ala Gln Lys Arg Gln Met Asn Met Ser Gln Trp 420
425 430 Ile Arg Phe Arg Cys Ser Lys Ile Asp
Glu Gly Gly Asp Trp Arg Pro 435 440
445 Ile Val Gln Phe Leu Arg Tyr Gln Gln Ile Glu Phe Ile Thr
Phe Leu 450 455 460
Gly Ala Leu Lys Ser Phe Leu Lys Gly Thr Pro Lys Lys Asn Cys Leu 465
470 475 480 Val Phe Cys Gly Pro
Ala Asn Thr Gly Lys Ser Tyr Phe Gly Met Ser 485
490 495 Phe Ile His Phe Ile Gln Gly Ala Val Ile
Ser Phe Val Asn Ser Thr 500 505
510 Ser His Phe Trp Leu Glu Pro Leu Thr Asp Thr Lys Val Ala Met
Leu 515 520 525 Asp
Asp Ala Thr Thr Thr Cys Trp Thr Tyr Phe Asp Thr Tyr Met Arg 530
535 540 Asn Ala Leu Asp Gly Asn
Pro Ile Ser Ile Asp Arg Lys His Lys Pro 545 550
555 560 Leu Ile Gln Leu Lys Cys Pro Pro Ile Leu Leu
Thr Thr Asn Ile His 565 570
575 Pro Ala Lys Asp Asn Arg Trp Pro Tyr Leu Glu Ser Arg Ile Thr Val
580 585 590 Phe Glu
Phe Pro Asn Ala Phe Pro Phe Asp Lys Asn Gly Asn Pro Val 595
600 605 Tyr Glu Ile Asn Asp Lys Asn
Trp Lys Cys Phe Phe Glu Arg Thr Trp 610 615
620 Ser Arg Leu Asp Leu His Glu Glu Glu Glu Asp Ala
Asp Thr Glu Gly 625 630 635
640 Asn Pro Phe Gly Thr Phe Lys Leu Arg Ala Gly Gln Asn His Arg Pro
645 650 655 Leu
448365PRTHuman papilloma virus 448Met Gln Thr Pro Lys Glu Thr Leu Ser Glu
Arg Leu Ser Cys Val Gln 1 5 10
15 Asp Lys Ile Ile Asp His Tyr Glu Asn Asp Ser Lys Asp Ile Asp
Ser 20 25 30 Gln
Ile Gln Tyr Trp Gln Leu Ile Arg Trp Glu Asn Ala Ile Phe Phe 35
40 45 Ala Ala Arg Glu His Gly
Ile Gln Thr Leu Asn His Gln Val Val Pro 50 55
60 Ala Tyr Asn Ile Ser Lys Ser Lys Ala His Lys
Ala Ile Glu Leu Gln 65 70 75
80 Met Ala Leu Gln Gly Leu Ala Gln Ser Arg Tyr Lys Thr Glu Asp Trp
85 90 95 Thr Leu
Gln Asp Thr Cys Glu Glu Leu Trp Asn Thr Glu Pro Thr His 100
105 110 Cys Phe Lys Lys Gly Gly Gln
Thr Val Gln Val Tyr Phe Asp Gly Asn 115 120
125 Lys Asp Asn Cys Met Thr Tyr Val Ala Trp Asp Ser
Val Tyr Tyr Met 130 135 140
Thr Asp Ala Gly Thr Trp Asp Lys Thr Ala Thr Cys Val Ser His Arg 145
150 155 160 Gly Leu Tyr
Tyr Val Lys Glu Gly Tyr Asn Thr Phe Tyr Ile Glu Phe 165
170 175 Lys Ser Glu Cys Glu Lys Tyr Gly
Asn Thr Gly Thr Trp Glu Val His 180 185
190 Phe Gly Asn Asn Val Ile Asp Cys Asn Asp Ser Met Cys
Ser Thr Ser 195 200 205
Asp Asp Thr Val Ser Ala Thr Gln Leu Val Lys Gln Leu Gln His Thr 210
215 220 Pro Ser Pro Tyr
Ser Ser Thr Val Ser Val Gly Thr Ala Lys Thr Tyr 225 230
235 240 Gly Gln Thr Ser Ala Ala Thr Arg Pro
Gly His Cys Gly Leu Ala Glu 245 250
255 Lys Gln His Cys Gly Pro Val Asn Pro Leu Leu Gly Ala Ala
Thr Pro 260 265 270
Thr Gly Asn Asn Lys Arg Arg Lys Leu Cys Ser Gly Asn Thr Thr Pro
275 280 285 Ile Ile His Leu
Lys Gly Asp Arg Asn Ser Leu Lys Cys Leu Arg Tyr 290
295 300 Arg Leu Arg Lys His Ser Asp His
Tyr Arg Asp Ile Ser Ser Thr Trp 305 310
315 320 His Trp Thr Gly Ala Gly Asn Glu Lys Thr Gly Ile
Leu Thr Val Thr 325 330
335 Tyr His Ser Glu Thr Gln Arg Thr Lys Phe Leu Asn Thr Val Ala Ile
340 345 350 Pro Asp Ser
Val Gln Ile Leu Val Gly Tyr Met Thr Met 355 360
365 44988PRTHuman papilloma virus 449Met Thr Leu Cys Ala
Val Pro Val Thr Thr Arg Tyr Pro Leu Leu Ser 1 5
10 15 Leu Leu Asn Ser Tyr Ser Thr Pro Pro His
Arg Ile Pro Ala Pro Cys 20 25
30 Pro Trp Ala Pro Gln Arg Pro Thr Ala Arg Arg Arg Leu Leu His
Asp 35 40 45 Leu
Asp Thr Val Asp Ser Arg Arg Ser Ser Ile Val Asp Leu Ser Thr 50
55 60 His Phe Ser Val Gln Leu
His Leu Gln Ala Thr Thr Lys Asp Gly Asn 65 70
75 80 Ser Val Val Val Thr Leu Arg Leu
85 45073PRTHuman papilloma virus 450Met Leu Ser Leu Ile
Phe Leu Phe Cys Phe Cys Val Cys Met Tyr Val 1 5
10 15 Cys Cys His Val Pro Leu Leu Pro Ser Val
Cys Met Cys Ala Tyr Ala 20 25
30 Trp Val Leu Val Phe Val Tyr Ile Val Val Ile Thr Ser Pro Ala
Thr 35 40 45 Ala
Phe Thr Val Tyr Val Phe Cys Phe Leu Leu Pro Met Leu Leu Leu 50
55 60 His Ile His Ala Ile Leu
Ser Leu Gln 65 70 451462PRTHuman papilloma
virus 451Met Val Ser His Arg Ala Ala Arg Arg Lys Arg Ala Ser Val Thr Asp
1 5 10 15 Leu Tyr
Lys Thr Cys Lys Gln Ser Gly Thr Cys Pro Pro Asp Val Val 20
25 30 Pro Lys Val Glu Gly Thr Thr
Leu Ala Asp Lys Ile Leu Gln Trp Ser 35 40
45 Ser Leu Gly Ile Phe Leu Gly Gly Leu Gly Ile Gly
Thr Gly Ser Gly 50 55 60
Thr Gly Gly Arg Thr Gly Tyr Ile Pro Leu Gly Gly Arg Ser Asn Thr 65
70 75 80 Val Val Asp
Val Gly Pro Thr Arg Pro Pro Val Val Ile Glu Pro Val 85
90 95 Gly Pro Thr Asp Pro Ser Ile Val
Thr Leu Ile Glu Asp Ser Ser Val 100 105
110 Val Thr Ser Gly Ala Pro Arg Pro Thr Phe Thr Gly Thr
Ser Gly Phe 115 120 125
Asp Ile Thr Ser Ala Gly Thr Thr Thr Pro Ala Val Leu Asp Ile Thr 130
135 140 Pro Ser Ser Thr
Ser Val Ser Ile Ser Thr Thr Asn Phe Thr Asn Pro 145 150
155 160 Ala Phe Ser Asp Pro Ser Ile Ile Glu
Val Pro Gln Thr Gly Glu Val 165 170
175 Ala Gly Asn Val Phe Val Gly Thr Pro Thr Ser Gly Thr His
Gly Tyr 180 185 190
Glu Glu Ile Pro Leu Gln Thr Phe Ala Ser Ser Gly Thr Gly Glu Glu
195 200 205 Pro Ile Ser Ser
Thr Pro Leu Pro Thr Val Arg Arg Val Ala Gly Pro 210
215 220 Arg Leu Tyr Ser Arg Ala Tyr Gln
Gln Val Ser Val Ala Asn Pro Glu 225 230
235 240 Phe Leu Thr Arg Pro Ser Ser Leu Ile Thr Tyr Asp
Asn Pro Ala Phe 245 250
255 Glu Pro Val Asp Thr Thr Leu Thr Phe Asp Pro Arg Ser Asp Val Pro
260 265 270 Asp Ser Asp
Phe Met Asp Ile Ile Arg Leu His Arg Pro Ala Leu Thr 275
280 285 Ser Arg Arg Gly Thr Val Arg Phe
Ser Arg Leu Gly Gln Arg Ala Thr 290 295
300 Met Phe Thr Arg Ser Gly Thr Gln Ile Gly Ala Arg Val
His Phe Tyr 305 310 315
320 His Asp Ile Ser Pro Ile Ala Pro Ser Pro Glu Tyr Ile Glu Leu Gln
325 330 335 Pro Leu Val Ser
Ala Thr Glu Asp Asn Asp Leu Phe Asp Ile Tyr Ala 340
345 350 Asp Asp Met Asp Pro Ala Val Pro Val
Pro Ser Arg Ser Thr Thr Ser 355 360
365 Phe Ala Phe Phe Lys Tyr Ser Pro Thr Ile Ser Ser Ala Ser
Ser Tyr 370 375 380
Ser Asn Val Thr Val Pro Leu Thr Ser Ser Trp Asp Val Pro Val Tyr 385
390 395 400 Thr Gly Pro Asp Ile
Thr Leu Pro Ser Thr Thr Ser Val Trp Pro Ile 405
410 415 Val Ser Pro Thr Ala Pro Ala Ser Thr Gln
Tyr Ile Gly Ile His Gly 420 425
430 Thr His Tyr Tyr Leu Trp Pro Leu Tyr Tyr Phe Ile Pro Lys Lys
Arg 435 440 445 Lys
Arg Val Pro Tyr Phe Phe Ala Asp Gly Phe Val Ala Ala 450
455 460 452568PRTHuman papilloma virus 452Met
Cys Leu Tyr Thr Arg Val Leu Ile Leu His Tyr His Leu Leu Pro 1
5 10 15 Leu Tyr Gly Pro Leu Tyr
His Pro Arg Pro Leu Pro Leu His Ser Ile 20
25 30 Leu Val Tyr Met Val His Ile Ile Ile Cys
Gly His Tyr Ile Ile Leu 35 40
45 Phe Leu Arg Asn Val Asn Val Phe Pro Ile Phe Leu Gln Met
Ala Leu 50 55 60
Trp Arg Pro Ser Asp Asn Thr Val Tyr Leu Pro Pro Pro Ser Val Ala 65
70 75 80 Arg Val Val Asn Thr
Asp Asp Tyr Val Thr Pro Thr Ser Ile Phe Tyr 85
90 95 His Ala Gly Ser Ser Arg Leu Leu Thr Val
Gly Asn Pro Tyr Phe Arg 100 105
110 Val Pro Ala Gly Gly Gly Asn Lys Gln Asp Ile Pro Lys Val Ser
Ala 115 120 125 Tyr
Gln Tyr Arg Val Phe Arg Val Gln Leu Pro Asp Pro Asn Lys Phe 130
135 140 Gly Leu Pro Asp Thr Ser
Ile Tyr Asn Pro Glu Thr Gln Arg Leu Val 145 150
155 160 Trp Ala Cys Ala Gly Val Glu Ile Gly Arg Gly
Gln Pro Leu Gly Val 165 170
175 Gly Leu Ser Gly His Pro Phe Tyr Asn Lys Leu Asp Asp Thr Glu Ser
180 185 190 Ser His
Ala Ala Thr Ser Asn Val Ser Glu Asp Val Arg Asp Asn Val 195
200 205 Ser Val Asp Tyr Lys Gln Thr
Gln Leu Cys Ile Leu Gly Cys Ala Pro 210 215
220 Ala Ile Gly Glu His Trp Ala Lys Gly Thr Ala Cys
Lys Ser Arg Pro 225 230 235
240 Leu Ser Gln Gly Asp Cys Pro Pro Leu Glu Leu Lys Asn Thr Val Leu
245 250 255 Glu Asp Gly
Asp Met Val Asp Thr Gly Tyr Gly Ala Met Asp Phe Ser 260
265 270 Thr Leu Gln Asp Thr Lys Cys Glu
Val Pro Leu Asp Ile Cys Gln Ser 275 280
285 Ile Cys Lys Tyr Pro Asp Tyr Leu Gln Met Ser Ala Asp
Pro Tyr Gly 290 295 300
Asp Ser Met Phe Phe Cys Leu Arg Arg Glu Gln Leu Phe Ala Arg His 305
310 315 320 Phe Trp Asn Arg
Ala Gly Thr Met Gly Asp Thr Val Pro Gln Ser Leu 325
330 335 Tyr Ile Lys Gly Thr Gly Met Pro Ala
Ser Pro Gly Ser Cys Val Tyr 340 345
350 Ser Pro Ser Pro Ser Gly Ser Ile Val Thr Ser Asp Ser Gln
Leu Phe 355 360 365
Asn Lys Pro Tyr Trp Leu His Lys Ala Gln Gly His Asn Asn Gly Val 370
375 380 Cys Trp His Asn Gln
Leu Phe Val Thr Val Val Asp Thr Thr Pro Ser 385 390
395 400 Thr Asn Leu Thr Ile Cys Ala Ser Thr Gln
Ser Pro Val Pro Gly Gln 405 410
415 Tyr Asp Ala Thr Lys Phe Lys Gln Tyr Ser Arg His Val Glu Glu
Tyr 420 425 430 Asp
Leu Gln Phe Ile Phe Gln Leu Cys Thr Ile Thr Leu Thr Ala Asp 435
440 445 Val Met Ser Tyr Ile His
Ser Met Asn Ser Ser Ile Leu Glu Asp Trp 450 455
460 Asn Phe Gly Val Pro Pro Pro Pro Thr Thr Ser
Leu Val Asp Thr Tyr 465 470 475
480 Arg Phe Val Gln Ser Val Ala Ile Thr Cys Gln Lys Asp Ala Ala Pro
485 490 495 Ala Glu
Asn Lys Asp Pro Tyr Asp Lys Leu Lys Phe Trp Asn Val Asp 500
505 510 Leu Lys Glu Lys Phe Ser Leu
Asp Leu Asp Gln Tyr Pro Leu Gly Arg 515 520
525 Lys Phe Leu Val Gln Ala Gly Leu Arg Arg Lys Pro
Thr Ile Gly Pro 530 535 540
Arg Lys Arg Ser Ala Pro Ser Ala Thr Thr Ser Ser Lys Pro Ala Lys 545
550 555 560 Arg Val Arg
Val Arg Ala Arg Lys 565
User Contributions:
Comment about this patent or add new information about this topic:
People who visited this patent also read: | |
Patent application number | Title |
---|---|
20210246048 | DEVELOPMENT OF LOW-COST ACTIVATED CARBON FOR REMOVAL OF VOCS AND PHARMACEUTICALS FROM RESIDENTIAL DRINKING WATER |
20210246047 | ELECTROMAGNETIC IONIC LIQUID AND PREPARATION METHOD THEREFOR |
20210246046 | POLYCRYSTALLINE 18H HEXAFERRITE, METHOD OF MANUFACTURE, AND USES THEREOF |
20210246045 | SYNTHESIS OF AEROSOL GELS IN A BUOYANCY-OPPOSED FLAME REACTOR |
20210246044 | SEMICONDUCTOR DEVICE COMPRISING WORK FUNCTION METAL PATTERN IN BOUNDRY REGION AND METHOD FOR FABRICATING THE SAME |