Patent application title: METHODS OF DEVELOPING TERPENE SYNTHASE VARIANTS
Inventors:
Lishan Zhao (Emeryville, CA, US)
Lishan Zhao (Emeryville, CA, US)
Lan Xu (San Diego, CA, US)
Patrick Westfall (Novato, CA, US)
Andrew Main (Berkeley, CA, US)
Assignees:
Amyris, Inc.
IPC8 Class: AC12Q102FI
USPC Class:
435 29
Class name: Chemistry: molecular biology and microbiology measuring or testing process involving enzymes or micro-organisms; composition or test strip therefore; processes of forming such composition or test strip involving viable micro-organism
Publication date: 2012-08-02
Patent application number: 20120196315
Abstract:
The present disclosure relates to methods of developing terpene synthase
variants through engineered host cells. Particularly, the disclosure
provides methods of developing terpene synthase variants with improved in
vivo performance that are useful in the commercial production of terpene
products. Further encompassed in the present disclosure are superior
terpene synthase variants and host cells comprising such terpene synthase
variants.Claims:
1. A method of testing a terpene synthase variant for improved in vivo
performance, comprising the steps of: (a) dividing a population of host
cells into a control population and a test population; (b) expressing in
the control population a control terpene synthase and a comparison
terpene synthase, wherein the control terpene synthase can convert a
polyprenyl diphosphate to a first terpene, and wherein the comparison
terpene synthase can convert the polyprenyl diphosphate to a second
terpene; (c) expressing in the test population a test terpene synthase
and the comparison terpene synthase, wherein the test terpene synthase is
a variant of the control terpene synthase, and wherein the comparison
terpene synthase is expressed at similar levels in the test population
and in the control population; and (d) measuring a ratio of the first
terpene over the second terpene in both the test population and in the
control population.
2. The method of claim 1, wherein the test population is identified as comprising a terpene synthase variant having improved in vivo performance compared to the control terpene synthase by an increase in the ratio of the first terpene over the second terpene in the test population compared to that in the control population.
3. The method of claim 1, wherein the control terpene synthase, comparison terpene synthase, and the test terpene synthase are sesquiterpene synthases, and the polyprenyl diphosphate is farnesyl diphosphate (FPP).
4. The method of claim 3, wherein the comparison terpene synthase is a trichodiene synthase.
5. The method of claim 3, wherein the control and test terpene synthases are synthases having farnesene synthase activity.
6. The method of claim 1, wherein the control terpene synthase, comparison terpene synthase, and the test terpene synthase are monoterpene synthases, and the polyprenyl diphosphate is geranyl diphosphate (GPP).
7. The method of claim 1, wherein the host cell comprises one or more heterologous enzymes of the MEV pathway.
8. The method of claim 1, wherein the one or more heterologous enzymes of the MEV pathway are selected from the group consisting of ERGS, ERG10, ERG12, ERG13, ERG19, and HMG1.
9. The method of claim 1, wherein the test terpene synthase differs from the control terpene synthase by 1 to 10 amino acids.
10. The method of claim 2, wherein the ratio of the first terpene over the second terpene is at least 1.3.
11. The method of claim 1, wherein test terpene synthase is expressed at a similar level in the test population as the control terpene synthase is expressed in the control population.
12. The method of claim 1, wherein the control terpene synthase and the test terpene synthase are identical but are expressed at different levels in the control population and the test population.
13. The method of claim 1, wherein the population of host cells is a population of yeast cells.
14. A composition comprising two cell subpopulations derived from a common population of host cells, wherein: (a) the first subpopulation comprises a control terpene synthase and a comparison terpene synthase, wherein the control terpene synthase converts a polyprenyl diphosphate to a first terpene, and wherein the comparison sesquiterpene synthase converts the polyprenyl diphosphate to a second terpene; and (b) the second subpopulation comprises a test terpene synthase and the comparison terpene synthase, wherein the test terpene synthase converts the polyprenyl diphosphate to the first terpene, wherein the test terpene synthase is a variant of the control terpene synthase, and wherein the comparison terpene synthase is expressed at similar levels in the first subpopulation and in the second subpopulation.
15. The composition of claim 14, wherein the ratio of the first terpene over the second terpene is greater in the second subpopulation compared to that in the first subpopulation.
16.-20. (canceled)
21. The method of claim 1, wherein the population of host cells is a population of E. coli cells.
22.-23. (canceled)
24. The method of claim 8, wherein the host cell comprises a heterologous isopentyl pyrophosphate (IPP) isomerase.
25. The method of claim 8, wherein the host cell comprises a heterologous FPP synthase.
26.-30. (canceled)
31. The method of claim 8, wherein the host cell comprises a heterologous geranylgeranyl pyrophosphate (GGPP) synthase.
32. The method of claim 31, wherein the control terpene synthase, comparison terpene synthase, and the test terpene synthase are diterpene synthases, and the polyprenyl diphosphate is geranylgeranyl pyrophosphate (GGPP).
33. The method of claim 3, wherein the sesquiterpene synthase is selected from the group consisting of β-farnesene synthase, α-farnesene synthase, trichodiene synthase, patchoulol synthase, amorphadiene synthase, valencene synthase, farnesol synthase, nerolidol synthase, and nootkatone synthase.
34. The method of claim 1, wherein the control terpene synthase, comparison terpene synthase, and the test terpene synthase are each a sesterterpene synthase, a triterpene synthase, a tetraterpene synthase, or a polyterpene synthase.
35. The method of claim 1, wherein the first terpene or the second terpene is selected from the group consisting of β-farnesene, α-farnesene, trichodiene, patchoulol, amorphadiene, valencene, farnesol, nerolidol, and nootkatone.
36. The method of claim 1, wherein the first terpene or the second terpene is limonene or myrcene.
37. The composition of claim 14, wherein the control terpene synthase, comparison terpene synthase, and the test terpene synthase are sesquiterpene synthases, and the polyprenyl diphosphate is farnesyl diphosphate (FPP).
38. The composition of claim 14, wherein the control and test terpene synthases are synthases having farnesene synthase activity.
39. The composition of claim 14, wherein the comparison terpene synthase is a trichodiene synthase.
40. The composition of claim 14, wherein the host cell comprises one or more heterologous enzymes of the MEV pathway.
41. The composition of claim 14, wherein the one or more heterologous enzymes of the MEV pathway are selected from the group consisting of ERGS, ERG10, ERG12, ERG13, ERG19, and HMG1.
42. The composition of claim 14, wherein the host cell comprises a heterologous FPP synthase.
Description:
1. CROSS-REFERENCE TO RELATED APPLICATION
[0001] This application claims the benefit of priority under 35 U.S.C. §119(e) to U.S. Provisional Patent Application Ser. No. 61/438,948 filed Feb. 2, 2011, which is incorporated herein by reference.
2. FIELD OF THE INVENTION
[0002] The present disclosure relates to methods of developing terpene synthase variants through engineered host cells. Particularly, the disclosure provides methods of developing terpene synthase variants with improved in vivo performance that are useful in the commercial production of terpene products. Further encompassed in the present disclosure are superior terpene synthase variants, and host cells comprising such terpene synthase variants.
3. BACKGROUND
[0003] Terpenes are a large class of hydrocarbons that are produced in many organisms. They are derived by linking units of isoprene (C5H8), and are classified by the number of isoprene units present. Hemiterpenes consist of a single isoprene unit. Isoprene itself is considered the only hemiterpene. Monoterpenes are made of two isoprene units, and have the molecular formula C10H16. Examples of monoterpenes are geraniol, limonene, and terpineol.
[0004] Sesquiterpenes are composed of three isoprene units, and have the molecular formula C15H24. Examples of sesquiterpenes are farnesenes, farnesol and patchoulol. Diterpenes are made of four isoprene units, and have the molecular formula C20H32. Examples of diterpenes are cafestol, kahweol, cembrene, and taxadiene. Sesterterpenes are made of five isoprene units, and have the molecular formula C25H40. An example of a sesterterpenes is geranylfarnesol. Triterpenes consist of six isoprene units, and have the molecular formula C30H48. Tetraterpenes contain eight isoprene units, and have the molecular formula C40H64. Biologically important tetraterpenes include the acyclic lycopene, the monocyclic gamma-carotene, and the bicyclic alpha- and beta-carotenes. Polyterpenes consist of long chains of many isoprene units. Natural rubber consists of polyisoprene in which the double bonds are cis.
[0005] When terpenes are chemically modified (e.g., via oxidation or rearrangement of the carbon skeleton) the resulting compounds are generally referred to as terpenoids, which are also known as isoprenoids. Isoprenoids play many important biological roles, for example, as quinones in electron transport chains, as components of membranes, in subcellular targeting and regulation via protein prenylation, as photosynthetic pigments including carotenoids, chlorophyll, as hormones and cofactors, and as plant defense compounds with various monoterpenes, sesquiterpenes, and diterpenes. They are industrially useful as antibiotics, hormones, anticancer drugs, insecticides, and chemicals.
[0006] Terpenes are biosynthesized through condensations of isopentenyl pyrophosphate (isopentenyl diphosphate or IPP) and its isomer dimethylallyl pyrophosphate (dimethylallyl diphosphate or DMAPP). Two pathways are known to generate IPP and DMAPP, namely the mevalonate-dependent (MEV) pathway of eukaryotes, and the mevalonate-independent or deoxyxylulose-5-phosphate (DXP) pathway of prokaryotes. Plants use both the MEV pathway and the DXP pathway. IPP and DMAPP in turn are condensed to polyprenyl diphosphates (e.g., geranyl disphosphate or GPP, farnesyl diphosphate or FPP, and geranylgeranyl diphosphate or GGPP) through the action of prenyl disphosphate synthases (e.g., GPP synthase, FPP synthase, and GGPP synthase, respectively).
[0007] The polyprenyl diphosphate intermediates are converted to more complex isoprenoid structures by terpene synthases. Terpene synthases are organized into large gene families that form multiple products. Examples of terpene synthases include sesquiterpene synthases, which convert FPP into sesquiterpenes. An example of a sesquiterpene synthase is farnesene synthase, which converts FPP to farnesene. The reaction mechanism of terpene synthases has been extensively investigated and is well understood. Overall, three steps are required to convert a diphosphate substrate such as FPP to its isoprenoid product: a) formation of enzyme-substrate complex (ES), b) formation of an enzyme-bound reactive carbocation intermediate, subsequent rearrangements, and the formation of product (EP), and c) release of product from the enzyme-product complex. In vitro kinetic and pre-steady state kinetic studies on terpene synthase catalyzed reactions have shown that the overall rate-limiting step for the reactions is the release of product (Cane et al. (1997) Biochemistry, 36(27):8332-9, and Mathis et al. (1997) Biochemistry 36(27):8340-8). The turnover rates of terpene synthases are low, generally measured at less than 0.5 per second (Cane, D. C. (1990) Chem. Rev. 90:1089-1103).
[0008] Terpene synthases are important in the regulation of pathway flux to an isoprenoid because they operate at metabolic branch points and often compete with other metabolic enzymes for a prenyl diphosphate pool. For example, FPP is the precursor to many cellular molecules including squalene, dolichols, and the cofactor heme. In engineered microbes where the production of sesquiterpenes such as farnesene is desired, the terpene synthases hold the key to high yield production of such terpenes. However, because they are slow enzymes, terpene synthases are often the bottlenecks in the metabolic pathways. In addition, they can suffer from other shortcomings such as substrate inhibition that limit the kinetic capacity required for efficient production of terpenes in engineered microbial hosts (Crock et al. (1997) Proc. Natl. Acad. Sci. USA 94:12833-12838).
[0009] Hence, there are potentially enormous benefits to improving the catalytic efficiency of terpene synthases so that these enzymes would no longer limit the overall metabolic flux to an isoprenoid. Attempts to engineer terpene synthases for altered product specificity as well as the use of rational approaches such as those based on structural guidance or adaptive evolution have been described previously (Greenhagen et al. (2006) Proc. Natl. Acad. Sci. USA 103:9826-9831; O'Maille et al. (2008) Nat. Chem. Biol. 4:617-623; Yoshikuni et al. (2006) Nature 440:1078-1082; Yoshikuni et al. (2008) Chem. Biol. 15:607-618). However, these studies have fallen short of improving the kinetic capacity of terpene synthases while also maintaining their product specificity. In addition, the application of conventional protein engineering strategies, such as directed evolution, has been devoid for terpene synthases primarily because of the lack of available and effective high throughput screening methods (Yoshikuni et al. (2008) (supra)). There thus remains a need for reliable and high throughput methods for improving the catalytic efficiency of terpene synthases, and for terpene synthase variants that have such improved catalytic efficiency.
4. SUMMARY OF THE INVENTION
[0010] The present disclosure relates to methods of developing terpene synthase variants through engineered host cells. Particularly, the disclosure provides methods of developing terpene synthase variants with improved in vivo performance. The methods also allow for the continued improvement of the in vivo performance of these enzymes.
[0011] In one aspect, the present invention provides a screening method for a sesquiterpene synthase variant with improved in vivo performance, comprising the steps of: [0012] a) engineering a host cell expressing a control sesquiterpene synthase to comprise an elevated level of FPP, wherein the elevated level of FPP reduces the viability of the host cell compared to a parent cell not comprising the elevated level of FPP; [0013] b) expressing in the host cell a test sesquiterpene synthase instead of the control sesquiterpene synthase, wherein the test sesquiterpene synthase is a variant of the control sesquiterpene synthase; and [0014] c) identifying the test sesquiterpene synthase as having improved in vivo performance compared to the control sesquiterpene synthase by an increase in viability of the host cell expressing the test sesquiterpene synthase compared to the host cell expressing the control terpene synthase.
[0015] In some embodiments, the host cell is plated on an agar plate, and a host cell comprising a test terpene synthase variant with improved in vivo performance is identified by colony growth. In some embodiments, the method further comprises selecting and/or isolating the test sesquiterpene synthase having improved in vivo performance.
[0016] In some embodiments, a collection of sesquiterpene synthase variants is expressed in a collection of host cells. In some embodiments, the collection of sesquiterpene synthase variants comprises from 2 to 5, from 5 to 10, from 10 to 50, from 50 to 100, from 100 to 500, from 500 to 1,000, from 1,000 to 10,000, from 10,000 to 100,000, from 100,000 to 1,000,000, and more, sesquiterpene synthase variants.
[0017] In some embodiments, the screening method is used in an iterative fashion, wherein the test sesquiterpene synthase identified in an iteration is used as the control sesquiterpene synthase of the next iteration, and wherein the host cell in an iteration comprises such elevated level of FPP that it has reduced viability in the presence of the test sesquiterpene synthase identified in the previous iteration compared to a parent cell not comprising the elevated level of FPP.
[0018] In another aspect, provided herein is a composition comprising two cell subpopulations derived from a common population of host cells comprising an elevated level of FPP, wherein: [0019] a) the first subpopulation comprises a control sesquiterpene synthase, wherein the elevated level of FPP reduces the viability of cells of the first subpopulation compared to the viability of a parent cell not comprising the elevated level of FPP; and [0020] b) the second subpopulation comprises a test sesquiterpene synthase, wherein the test sesquiterpene synthase is a variant of the control sesquiterpene synthase.
[0021] In some embodiments, the viability of the cells of the second subpopulation is greater than the viability of the cells of the first subpopulation.
[0022] In another aspect, the present invention provides a second screening method for identifying terpene synthase variants with improved in vivo performance, comprising the steps of: [0023] a) providing a host cell expressing a control terpene synthase and having a growth rate; [0024] b) expressing in the host cell a test terpene synthase instead of the control terpene synthase, wherein the test terpene synthase is a variant of the control terpene synthase; and [0025] d) identifying the test terpene synthase as having improved in vivo performance compared to the control terpene synthase by a decreased growth rate of the host cell expressing the test terpene synthase compared to the growth rate of the host cell expressing the control terpene synthase.
[0026] In yet another aspect, the present invention provides a competition method for identifying and/or ranking the in vivo performance of terpene synthase variants, comprising the steps of: [0027] a) dividing a population of host cells into a control population and a test population; [0028] b) expressing in the control population a control terpene synthase and a comparison terpene synthase, wherein the control terpene synthase can convert a polyprenyl diphosphate to a first terpene, and wherein the comparison terpene synthase can convert a polyprenyl diphosphate to a second terpene; [0029] c) expressing in the test population the comparison terpene synthase and a test terpene synthase, wherein the test terpene synthase is a variant of the control terpene synthase, and wherein the comparison terpene synthase is expressed at similar levels in the test population and in the control population; and [0030] d) measuring a ratio of the first terpene over the second terpene in the test population and in the control population.
[0031] In separate embodiments, the competition method is applied to identify and/or to rank terpene synthases selected from the group consisting of monoterpene synthases, diterpene synthases, sesquiterpene synthases, sesterterpene synthases, triterpene synthases, tetraterpene synthases, and polyterpene synthases.
[0032] In some embodiments, the competition method is used to screen a library of mutant terpene synthases on the basis that compared to the control terpene synthase, a terpene synthase variant with improved in vivo performance is capable of diverting more flux from a polyprenyl diphosphate substrate to its terpene product, thus, giving a higher ratio of terpene of interest/comparison terpene (i.e., first terpene/second terpene). In such embodiments, it is important that the test terpene synthase is expressed at a similar level in the test population as the control terpene synthase is expressed in the control population.
[0033] In other embodiments, the competition method is used to identify a promoter of a desired strength. In such embodiments, the control terpene synthase and the test terpene synthase are identical, and the control population and test population differ in the expression level of the control terpene synthase.
[0034] In another aspect, provided herein is a composition comprising two cell subpopulations derived from a common population of host cells, wherein:
a) the first subpopulation comprises a control terpene synthase and a comparison terpene synthase, wherein the control terpene synthase converts a polyprenyl diphosphate to a first terpene, and wherein the comparison sesquiterpene synthase converts the polyprenyl diphosphate to a second terpene; and b) the second subpopulation comprises a test terpene synthase and the comparison terpene synthase, wherein the control terpene synthase converts the polyprenyl diphosphate to the first terpene, and wherein the test terpene synthase is a variant of the control terpene synthase.
[0035] In some embodiments, the ratio of the first terpene over the second terpene is greater in the second subpopulation compared to that in the first subpopulation.
[0036] In yet another aspect, provided herein are isolated β-farnesene synthase variants, and isolated nucleic acids comprising a nucleotide sequence encoding such β-farnesene synthase variants, having an amino acid sequence as given in SEQ ID NO: 111 but comprising one or more amino acid substitutions at positions selected from the group consisting of positions 2, 3, 4, 6, 9, 11, 18, 20, 24, 35, 38, 50, 61, 72, 80, 89, 105, 115, 144, 196, 211, 251, 280, 288, 319, 348, 357, 359, 369, 371, 385, 398, 423, 433, 434, 442, 444, 446, 460, 467, 488, 495, 505, 526, 531, 556, 572, and 575 of SEQ ID NO: 111.
[0037] In yet another aspect, the present invention provides a genetically modified host cell that comprises: [0038] (a) a heterologous β-farnesene synthase, wherein the heterologous β-farnesene synthase is a variant of a β-farnesene synthase encoded by SEQ ID NO: 111; and [0039] (b) a MEV pathway or DXP pathway enzyme; wherein the host cell makes at least 15% more of a β-farnesene compared to a parent cell that comprises the MEV pathway or DXP pathway enzyme and the β-farnesene synthase encoded by SEQ ID NO: 111.
[0040] In yet another aspect, provided herein is a method of producing β-farnesene comprising the steps of:
(a) obtaining a plurality of genetically modified host cells comprising: [0041] i) a first heterologous nucleotide sequence encoding a variant of a β-farnesene synthase encoded by SEQ ID NO: 111; and [0042] ii) a second heterologous nucleotide sequence encoding a MEV pathway or DXP pathway enzyme; (b) culturing said genetically modified host cells in a medium comprising a carbon source under conditions suitable for making the β-farnesene; and (c) recovering the β-farnesene from the medium.
5. BRIEF DESCRIPTION OF THE FIGURES
[0043] The present disclosure is best understood when read in conjunction with the accompanying figures, which serve to illustrate the preferred embodiments. It is understood, however, that the disclosure is not limited to the specific embodiments disclosed in the figures.
[0044] FIG. 1A-Z provides maps of several chromosomal integration constructs used in the generation of host cells of the invention.
[0045] FIG. 2 provides an image of several agar plates on which were plated Escherichia coli host cells comprising active and inactive sesquiterpene synthases for FPP starvation-based selection.
[0046] FIG. 3 provides an image of two agar plates on which were plated Escherichia coli host cells comprising active and inactive sesquiterpene synthases for FPP toxicity-based growth selection.
[0047] FIG. 4 provides farnesene titers obtained by GC analysis of Escherichia coli host cells comprising various farnesene synthase coding sequences.
[0048] FIG. 5 provides an image of agar plates on which were plated Saccharomyces cerevisiae host cells comprising active and inactive sesquiterpene synthases for FPP toxicity-based growth selection.
[0049] FIG. 6 provides farnesene titers obtained by Nile Red fluorescence analysis of Saccharomyces cerevisiae host cells comprising either chromosomally intergrated or extrachromosomally maintained farnesene synthase coding sequences.
[0050] FIG. 7 provides farnesene titers obtained by GC analysis of Saccharomyces cerevisiae host cells ranked by sesquiterpene synthase competition.
[0051] FIG. 8 provides farnesene/trichodiene titer ratios obtained by GC analysis of Saccharomyces cerevisiae host cells comprising increasing copy numbers of farnesene synthase coding sequences.
[0052] FIG. 9 provides a comparison of farnesene titers obtained by GC analysis versus Nile Red fluorescence analysis of Escherichia coli host cells of a sesquiterpene synthase library.
[0053] FIG. 10 provides farnesene titers obtained by GC analysis of Escherichia coli host strains identified from a library of FS variants screened by Nile Red fluorescence.
[0054] FIG. 11 provides farnesene titers obtained by Nile Red fluoresence (A) and GC analysis (B) of Saccharomyces cerevisiae host strains identified from a library of FS variants screened by FPP toxicity based growth selection.
[0055] FIG. 12 provides farnesene titers obtained by Nile Red fluourescence analysis of Saccharomyces cerevisiae host strains identified from a library of FS variants by FPP toxicity-based growth selection.
[0056] FIG. 13 provides maps of various expression plasmids used in the generation of host cells of the invention.
[0057] FIG. 14 provides farnesene titers obtained by GC analysis of Saccharomyces cerevisiae host strains comprising single chromosomally integrated copies of FS variant coding sequences.
[0058] FIG. 15 provides a schematic representation of the MEV pathway for the production of IPP and DMAPP.
[0059] FIG. 16 provides a schematic representation of the DXP pathway for the production of IPP and DMAPP.
[0060] FIG. 17 provides amorphadiene/trichodiene titer ratios obtained by GC analysis of Saccharomyces cerevisiae host cells comprising coding sequences for amorphadiene synthase variants.
[0061] FIG. 18 provides limonene/myrcene titer ratios obtained by GC analysis of Saccharomyces cerevisiae host cells comprising coding sequences for limonene synthase variants.
6. DETAILED DESCRIPTION OF THE EMBODIMENTS
6.1 Definitions
[0062] The following terms used herein shall have the meanings as indicated below.
[0063] As used herein, the term "terpene synthase variant" refers to a terpene synthase that compared to a selected terpene synthase has a different nucleotide or amino acid sequence. For example, compared to the wild-type sequence of the selected terpene synthase, the terpene synthase variant may comprise nucleotide additions, deletions, and/or substitutions that may or may not result in changes to the corresponding amino acid sequence. In some embodiments where nucleotide changes do not result in changes to the amino acid sequence, the changes may nonetheless effect improved activity of the synthase, for example, through codon optimization. In other embodiments, the terpene synthase variant comprises amino acid additions, deletions, and/or substitutions. Accordingly, as used herein, the term "sesquiterpene synthase variant" refers to a sesquiterpene synthase that compared to a selected sesquiterpene synthase has a different nucleotide or amino acid sequence. For example, compared to the selected sesquiterpene synthase, the sesquiterpene synthase variant may comprise nucleotide additions, deletions, and/or substitutions that may or may not result in changes to the corresponding amino acid sequence. In other embodiments, the terpene synthase variant comprises amino acid additions, deletions and/or substitutions.
[0064] As used herein, the term "engineered host cell" refers to a host cell that is generated by genetically modifying a parent cell using genetic engineering techniques (i.e., recombinant technology). The engineered host cell may comprise additions, deletions, and/or modifications of nucleotide sequences to the genome of the parent cell.
[0065] As used herein, the term "heterologous" refers to what is not normally found in nature. The term "heterologous nucleotide sequence" refers to a nucleotide sequence not normally found in a given cell in nature. As such, a heterologous nucleotide sequence may be: (a) foreign to its host cell (i.e., is "exogenous" to the cell); (b) naturally found in the host cell (i.e., "endogenous") but present at an unnatural quantity in the cell (i.e., greater or lesser quantity than naturally found in the host cell); or (c) be naturally found in the host cell but positioned outside of its natural locus.
[0066] As used herein, the term "naturally occurring" refers to what is found in nature. For example, a terpene synthase that is present in an organism that can be isolated from a source in nature and that has not been intentionally modified by a human in the laboratory is a naturally occurring terpene synthase. Conversely, as used herein, the term "naturally not occurring" refers to what is not found in nature but is created by human intervention.
[0067] As used herein, the term "biosynthetic enzyme" refers to an enzyme that functions in a biosynthetic pathway leading to the production of a naturally occurring molecule.
[0068] As used herein, the term "in vivo performance" refers to the ability of a terpene synthase to convert a polyprenyl diphosphate substrate to a terpene when expressed in a host cell. Accordingly, the term "improved in vivo performance" refers to an increased ability of a terpene synthase to convert a polyprenyl diphosphate substrate to a terpene when expressed in a host cell.
[0069] As used herein, the term "parent cell" refers to a cell that has an identical genetic background as a host cell disclosed herein except that it does not comprise the elevated intracellular level of FPP or does not comprise a particular heterologous nucleotide sequence, and that serves as the starting point for introducing said elevated intracellular level of FPP or said heterologous nucleotide sequence leading to the generation of a host cell disclosed herein.
6.2 General Overview
[0070] The present disclosure relates to methods of developing terpene synthase variants through engineered host cells. Particularly, the disclosure provides methods of developing terpene synthase variants with improved in vivo performance. The methods also allow for the continued improvement of the in vivo performance of these enzymes.
[0071] In one aspect, the present invention provides a screening method for terpene synthase variants with improved in vivo performance. In some embodiments, terpene synthase variants with improved in vivo performance are identified by their ability to rescue engineered host cells from cell death. The engineered host cells comprise genetic modifications that cause elevated intracellular levels of FPP. Because FPP is highly toxic to cells and thus reduces cell viability (Withers et al. (2007) Appl. Environ. Microbiol. 73:6277-6283), to achieve a viability that is comparable to that of a parent cell that does not comprise the elevated level of intracellular FPP, the engineered host cells require a sufficiently active sesquiterpene synthase to reduce the intracellular levels of FPP.
[0072] The presently provided screening method thus comprises the following steps:
[0073] a) engineering a host cell expressing a control sesquiterpene synthase to comprise an elevated level of FPP, wherein the elevated level of FPP reduces the viability of the host cell compared to a parent cell not comprising the elevated level of FPP;
[0074] b) expressing in the host cell a test sesquiterpene synthase instead of the control sesquiterpene synthase, wherein the test sesquiterpene synthase is a variant of the control sesquiterpene synthase; and
[0075] c) identifying the test sesquiterpene synthase as having improved in vivo performance compared to the control sesquiterpene synthase by an increase in viability of the host cell expressing the test sesquiterpene synthase compared to the host cell expressing the control sesquiterpene synthase.
[0076] In some embodiments, the method further comprises selecting and/or isolating the test sesquiterpene synthase having improved in vivo performance.
[0077] It is most convenient if the elevated level of FPP in the host cell is inducible. Induction may occur in response to an inducing agent or specific growth conditions such as, for example, temperature. The elevated level of FPP in the host cell may range from about 10% to at least about 1,000-fold, or more, higher than the level of FPP of the parent cell.
[0078] The reduced viability of the host cell expressing the control sesquiterpene synthase compared to the parent cell may range from decreased cell growth to lethality. Thus, in some embodiments, the host cell expressing the control sesquiterpene synthase produces a reduced number of progeny cells in a liquid culture or on an agar plate compared to the parent cell. In other embodiments, the host cell expressing the control sesquiterpene synthase produces no progeny cells in a liquid culture or on an agar plate compared to the parent cell. Accordingly, the increase in viability of the host cell expressing the test sesquiterpene synthase instead of the control sesquiterpene synthase may be apparent in liquid culture by a higher number of progeny cells, or on an agar plate by a larger colony size, compared to the number of progeny cells or colony size produced by the host cell expressing the control sesquiterpene synthase.
[0079] The elevated level of FPP in the host cell may be effected by modifying the expression and/or activity of an enzyme involved in the production of FPP or its precursors in the host cell. In some such embodiments, the expression and/or activity of an enzyme of the MEV or DXP pathway is modified. In some such embodiments, the expression and/or activity of a HMG-CoA reductase and/or a mevalonate kinase is modified. Alternatively, the elevated level of FPP in the host cell may be effected by modifying the expression and/or activity of an enzyme involved in the utilization of FPP or its precursors in the host cell. In some such embodiments, the expression and/or activity of a squalene synthase is modified.
[0080] The control sesquiterpene synthase may be a naturally occurring sesquiterpene synthase or a naturally not occurring sesquiterpene synthase. The test sequiterpene synthase may differ from the control sesquiterpene synthase by comprising one or more amino acid substitutions, deletions, and/or additions. In addition or alternatively, the test sequiterpene synthase may comprise identical amino acids as the control sesquiterpene synthase but the codons encoding these amino acids may differ between the test sesquiterpene synthase and the control sesquiterpene synthase. In some such embodiments, the codons are optimized for usage in the host cell.
[0081] In some embodiments, the control sesquiterpene synthase is selected from the group consisting of a β-farnesene synthase, an α-farnesene synthase, a trichodiene synthase, a patchoulol synthase, an amorphadiene synthase, a valencene synthase, a farnesol synthase, a nerolidol synthase, and a nootkatone synthase. In some such embodiments, the control sesquiterpene synthase is a β-farnesene synthase of Artemisia annua. In some such embodiments, the control sesquiterpene synthase has an amino acid sequence as given in SEQ ID NO: 111.
[0082] To be able to compare the viability of the host cell in the presence of the test sesquiterpene synthase to that of the host cell in the presence of the control sesquiterpene synthase, it is necessary to ensure similar expression levels of the control sesquiterpene synthase and the test sesquiterpene synthase in the host cell. This can be accomplished by placing the nucleotide sequences encoding the sesquiterpene synthases in the two host cells under the control of the same regulatory elements.
[0083] To prevent a competitive growth situation in which fast growing false positive host cells comprising a growth promoting mutation rather than an improved sesquiterpene synthase variant take over a host cell culture, one embodiment of the screening method involves an agar-plate based selection system. In this embodiment, the host cell is plated on an agar plate, and a host cell comprising a test sesquiterpene synthase variant with improved in vivo performance is identified by colony growth.
[0084] One major advantage of the presently disclosed screening method is its continued capacity to select for better and better sesquiterpene synthase variants in an iterative fashion, wherein a test sesquiterpene synthase identified in an iteration is used as the control sesquiterpene synthase in a subsequent iteration. Thus, this method can be distinguished from other assays known in the art that aim to identify only whether a particular sesquiterpene synthase may be active in a biosynthetic pathway, and do not seek to identify synthases having improved activity over a control, e.g., parent synthase. In some embodiments, the FPP level in the host cell is checked and potentially increased at each iteration (e.g., by increasing or decreasing expression levels of enzymes, adding or subtracting enzymes, increasing or decreasing copy numbers of genes, replacing promoters controlling expression of enzymes, or altering enzymes by genetic mutation) to a level that causes reduced viability when the host cell expresses the new control sesquiterpene synthase (i.e., the test sesquiterpene synthase of the previous iteration). Alternatively, or in addition, at each iteration, the expression of the control sesquiterpene synthase can be reduced (e.g., by decreasing expression of or by using weaker promoters or by reducing the stability of the control sesquiterpene synthase transcript or polypeptide) to provide reduced control sesquiterpene synthase activity. In the next iteration, a test sequiterpene synthase can then be identified that has yet increased in vivo performance compared to the test sequiterpene synthase of the previous iteration.
[0085] Another major advantage of the presently disclosed screening method is its simplicity and capacity for high-throughput implementation. Sesquiterpene synthase variants that can reduce the intracellular FPP levels in the engineered host cell to non-toxic levels are identified simply based on cell viability, making other costly and time consuming screening methods virtually unnecessary. Thus, in one embodiment, the method is used to screen a collection of sesquiterpene synthase variants (e.g., a library of mutant sesquiterpene synthases) for sesquiterpene synthase variants with improved in vivo performance. In such an embodiment, not a single test sesquiterpene synthase is expressed in a host cell but a collection of test sesquiterpene synthases are expressed in a collection of host cells. The host cells can then be grown on agar plates, and host cells expressing sesquiterpene synthase variants with improved in vivo performance can be identified based on colony growth. In some embodiments, the collection of sesquiterpene synthase variants comprises from 2 to 5, from 5 to 10, from 10 to 50, from 50 to 100, from 100 to 500, from 500 to 1,000, from 1,000 to 10,000, from 10,000 to 100,000, from 100,000 to 1,000,000, and more, sesquiterpene synthase variants.
[0086] Another major advantage of the presently disclosed screening method is that selection for improved sesquiterpene synthases occurs in vivo rather than in vitro. As a result, improvements of multiple enzyme properties that enhance the in vivo performance of the sesquiterpene synthase variant can be obtained.
[0087] In another aspect, the present invention provides a second screening method for identifying terpene synthase variants with improved in vivo performance. In this second screening method, terpene synthase variants with improved in vivo performance are identified by their ability to starve host cells of a polyprenyl diphosphate (e.g., FPP). In the presence of a highly active terpene synthase variant, the intracellular pool of its polyprenyl diphosphate substrate in a host cell may be depleted, causing the cell to not be able to maintain basic cellular processes required for cell survival.
[0088] The presently provided second screening method thus comprises the following steps:
[0089] a) providing a host cell expressing a control terpene synthase and having a growth rate;
[0090] b) expressing in the host cell a test terpene synthase instead of the control terpene synthase, wherein the test terpene synthase is a variant of the control terpene synthase; and
[0091] d) identifying the test terpene synthase as having improved in vivo performance compared to the control terpene synthase by a decreased growth rate of the host cell expressing the test terpene synthase compared to the host cell expressing the control terpene synthase.
[0092] The control terpene synthase may be a monoterpene synthase, a sesquiterpene synthase, a diterpene synthase, a sesterterpene synthase, a triterpene synthase, a tetraterpene synthase, or a polyterpene synthase. In some embodiments, the control terpene synthase is a sesquiterpene synthase. In some such embodiments, the control terpene synthase is a β-farnesene synthase. In some such embodiments, the control terpene synthase is a β-farnesene synthase of Artemisia annua. In some such embodiments, the control terpene synthase has an amino acid sequence as given in SEQ ID NO: 111.
[0093] The polyprenyl diphosphate substrate that becomes depleted in the host cell in the presence of the test terpene synthase may be FPP. Aside from sesquiterpenes, a number of other compounds are synthesized from FPP that are essential for the viability and growth of the host cell. Such compounds include but are not limited to squalene, lanosterol, ergosterol, cycloartenol, cholesterol, steroid hormones, and vitamin D. Thus, in some embodiments, a host cell expressing the test terpene synthase may comprise reduced amounts of cholesterol or ergosterol in its cell membrane. Methods for the quantification of cholesterol or ergosterol in cells are known in the art (e.g., Crockett and Hazel (2005) J. Experimental Zoology, 271(3): 190-195; Arthington-Skaggs et al. (1999) J Clin Microbiol. 37(10): 3332-3337; Seitz et al. (1979) Physiol. Biochem. 69: 1202-1203). In some embodiments, the basic cellular process required for cell survival that cannot be maintained in the host cell in the presence of the test terpene synthase is the production and/or maintenance of a cell membrane. In other embodiments, the polyprenyl diphosphate substrate that becomes depleted in the host cell in the presence of the test terpene synthase is GPP or GGPP.
[0094] In yet another aspect, the present invention provides a competition method for identifying and/or ranking the in vivo performance of terpene synthase variants. The competition method employs a known terpene synthase as the comparison enzyme against which the terpene synthase variants are compared. Both the comparison terpene synthase and each of the terpene synthase variants are co-expressed in a host cell in which they then compete for the same polyprenyl diphosphate substrate (e.g., GPP, FPP, or GGPP) to produce their corresponding terpenes. Since the performance of the comparison enzyme remains constant in the host cells, any changes in the ratios of titers of the terpene products produced by the comparison terpene synthase and the terpene synthase variants are the direct result of the activities of the terpene synthase variants. Consequently, such ratios can be used to identify terpene synthase variants with improved in vivo performance, and/or to rank or quantitatively compare the terpene synthase variants for their in vivo kinetic capacities in diverting polyprenyl diphosphate substrates to the production of terpenes.
[0095] The presently provided competition method thus comprises the following steps:
[0096] a) dividing a population of host cells into a control population and a test population;
[0097] b) expressing in the control population a control terpene synthase and a comparison terpene synthase, wherein the control terpene synthase can convert a polyprenyl diphosphate to a first terpene, and wherein the comparison terpene synthase can convert a polyprenyl diphosphate to a second terpene;
[0098] c) expressing in the test population the comparison terpene synthase and a test terpene synthase, wherein the test terpene synthase is a variant of the control terpene synthase, and wherein the comparison terpene synthase is expressed at similar levels in the test population and in the control population; and
[0099] d) measuring a ratio of the first terpene over the second terpene in the test population and in the control population.
[0100] Notably, the presently disclosed competition method can be applied to a wide variety of terpene synthases. Thus, in separate embodiments, the competition method is applied to identify and/or rank terpene synthases selected from the group consisting of monoterpene synthases, diterpene synthases, sesquiterpene synthases, sesterterpene synthases, triterpene synthases, tetraterpene synthases, and polyterpene synthases. Accordingly, in separate embodiments, the first terpene and the second terpene are selected from the group consisting of monoterpenes, sesquiterpenes, diterpenes, sesterterpenes, triterpenes, tetraterpenes, and polyterpenes. In some such embodiments, the first terpene or the second terpene is selected from the group consisting of a β-farnesene, an α-farnesene, a trichodiene, a patchoulol, an amorphadiene, a valencene, a farnesol, a nerolidol, a limonene, a myrcene, and a nootkatone.
[0101] The control terpene synthase may be a naturally occurring terpene synthase or a naturally not occurring synthase. The test terpene synthase may comprise amino acid substitutions, deletions, or additions compared to the control terpene synthase, or comprise identical amino acids encoded by different codons in the nucleotide sequences encoding the control terpene synthase and test terpene synthase. In some embodiments, the control terpene synthase is a sesquiterpene synthase. In some such embodiments, the sesquiterpene synthase is selected from the group consisting of a β-farnesene synthase, an α-farnesene synthase, a trichodiene synthase, a patchoulol synthase, an amorphadiene synthase, a valencene synthase, a farnesol synthase, a nerolidol synthase, and a nootkatone synthase. In some such embodiments, the control sesquiterpene synthase is a β-farnesene synthase of Artemisia annua. In some such embodiments, the control sesquiterpene synthase has an amino acid sequence as given in SEQ ID NO: 111.
[0102] To be able to compare the ratios of first terpene/second terpene of the control population and the test population, it is necessary to ensure similar expression levels of the comparison terpene synthase. This can be accomplished by placing the nucleotide sequences encoding the comparison terpene synthase in the two host cell populations under the control of the same regulatory elements. In embodiments in which the competition method is used to identify a terpene synthase variant, the expression levels of the control terpene synthase and the test terpene synthase in the two cell populations must also be similar. In other embodiments in which the competition method is used, for example, to identify regulatory elements (e.g., promoters) that provide a desired expression level, the test terpene synthase differs from the control terpene synthase not in nucleotide or amino acid sequence but in expression level. In such embodiments, different regulatory elements are used for the expression of the control terpene synthase and the test terpene synthase.
[0103] There are numerous utilities for the presently disclosed competition method. In some embodiments, the method is used to screen for terpene synthase variants with improved in vivo performance (e.g., from a library of mutant terpene synthases) on the basis that compared to the control terpene synthase, a terpene synthase variant with improved in vivo performance is capable of diverting more flux from a polyprenyl diphosphate substrate to its terpene product, thus, giving a higher ratio of terpene of interest/comparison terpene (i.e., first terpene/second terpene). In such embodiments, it is important that the test terpene synthase is expressed at a similar level in the test population as the control terpene synthase is expressed in the control population.
[0104] A similar assay can be used to rank the strength of a series of promoters (see Example 16, for example, in which such an assay was used to identify promoters suitable for use in expressing the control sesquiterpene synthase in the first screening method disclosed herein). In such an embodiment, the control terpene synthase and the test terpene synthase are actually identical, but they are under regulatory control of different prometers such that the control population and the test population do not differ in the type of test terpene synthase they comprise but in the level of expression of the test terpene synthase. In such an embodiment, comparing the ratio of the first terpene over the second terpene in the test population and in the control population provides information not about the activity of the test terpene synthase but about the strength of the promoter driving the expression of the test terpene synthase.
[0105] In addition, this system can be used to modulate the ratio of two or more terpene products made by various cells so that the combined mixture of the various cells with a defined ratio possesses the desired properties of a commercially useful product.
[0106] Major advantages of the presently disclosed competition method are that it eliminates cell-to-cell variations in enzyme expression and activity, that it is robust, and that it can be used even when the overall pathway flux to the polyprenyl diphosphate substrate is limiting in the host cell. The latter is important because assays that are based on absolute terpene titer measurements may mask improvements in enzyme activities when terpene titers are capped by the overall pathway flux to the polyprenyl disphosphate substrate.
[0107] Enzymes developed using the presently disclosed screening method and/or competition method can be subjected to additional means of optional screening including, but not limited to, a fluorescent screen and/or a direct quantitation of terpene product by gas chromatography. More specifically, this includes a Nile Red-based high throughput fluorescent assay for measuring production of a sesquiterpene such as farnesene, and a gas chromatography (GC)-based direct quantitation method for measuring the titer of a sesquiterpene such as farnesene. The improved enzymes can also be further improved by genetic engineering methods such as induced mutations and the like. As a result, improvements of multiple enzyme properties that enhance the final enzyme performance are successively accomplished, and the most effective enzyme variants are identified.
[0108] The present disclosure also pertains to superior farnesene synthase variants, and host cells comprising such farnesene synthase variants. The farnesene synthase variants were developed using the methods disclosed herein, and show more than a 200% improvement in in vivo performance. The farnesene synthase variants have improved catalytic efficiency, i.e., they are able to catalyze their reaction at a faster rate. As such, they are more suitable for commercial production of sesquiterpene products such as farnesene where high yield production is of major importance.
[0109] Thus, in yet another aspect, provided herein are isolated β-farnesene synthase variants, and isolated nucleic acids comprising a nucleotide sequence encoding such β-farnesene synthase variants, having an amino acid sequence as given in SEQ ID NO: 111 but comprising one or more amino acid substitutions at positions selected from the group consisting of positions 2, 3, 4, 6, 9, 11, 18, 20, 24, 35, 38, 50, 61, 72, 80, 89, 105, 115, 144, 196, 211, 251, 280, 288, 319, 348, 357, 359, 369, 371, 385, 398, 423, 433, 434, 442, 444, 446, 460, 467, 488, 495, 505, 526, 531, 556, 572, and 575 of SEQ ID NO: 111.
[0110] In yet another aspect, the present invention provides a genetically modified host cell that comprises:
[0111] (a) a heterologous β-farnesene synthase, wherein the heterologous β-farnesene synthase is a variant of a β-farnesene synthase encoded by SEQ ID NO: 111; and
[0112] (b) a MEV pathway or DXP pathway enzyme;
[0113] wherein the host cell makes at least 15% more of a β-farnesene compared to a parent cell that comprises the MEV pathway or DXP pathway enzyme and the β-farnesene synthase encoded by SEQ ID NO: 111.
[0114] In some embodiments, the heterologous β-farnesene synthase comprises one or more amino acid substitutions at positions selected from the group consisting of positions 2, 3, 4, 6, 9, 11, 18, 20, 24, 35, 38, 50, 61, 72, 80, 89, 105, 115, 144, 196, 211, 251, 280, 288, 319, 348, 357, 359, 369, 371, 385, 398, 423, 433, 434, 442, 444, 446, 460, 467, 488, 495, 505, 526, 531, 556, 572, and 575 of SEQ ID NO: 111.
[0115] In some embodiments, the MEV pathway enzyme is a HMG-CoA reductase. In some embodiments, the MEV pathway enzyme is a mevalonate kinase. Additional exemplary enzymes of the MEV pathway are provided in Section 5.4 below.
[0116] In yet another aspect, provided herein is a method of producing a β-farnesene comprising the steps of:
[0117] (a) obtaining a plurality of genetically modified host cells comprising: [0118] i) a first heterologous nucleotide sequence encoding a variant of a β-farnesene synthase encoded by SEQ ID NO: 111; and [0119] ii) a second heterologous nucleotide sequence encoding a MEV pathway or DXP pathway enzyme;
[0120] (b) culturing said genetically modified host cells in a medium comprising a carbon source under conditions suitable for making the β-farnesene; and
[0121] (c) recovering the β-farnesene from the medium.
[0122] In some embodiments, the MEV pathway enzyme is a HMG-CoA reductase. In some embodiments, the MEV pathway enzyme is a mevalonate kinase. Additional exemplary enzymes of the MEV pathway are provided in Section 5.4 below.
6.3 Selecting Host Cells
[0123] Host cells useful in the practice of the present invention include archae, prokaryotic, or eukaryotic cells.
[0124] Suitable prokaryotic hosts include but are not limited to any of a variety of gram-positive, gram-negative, or gram-variable bacteria. Examples include but are not limited to cells belonging to the genera: Agrobacterium, Alicyclobacillus, Anabaena, Anacystis, Arthrobacter, Azobacter, Bacillus, Brevibacterium, Chromatium, Clostridium, Corynebacterium, Enterobacter, Erwinia, Escherichia, Lactobacillus, Lactococcus, Mesorhizobium, Methylobacterium, Microbacterium, Phormidium, Pseudomonas, Rhodobacter, Rhodopseudomonas, Rhodospirillum, Rhodococcus, Salmonella, Scenedesmun, Serratia, Shigella, Staphlococcus, Strepromyces, Synnecoccus, and Zymomonas. Examples of prokaryotic strains include but are not limited to: Bacillus subtilis, Bacillus amyloliquefacines, Brevibacterium ammoniagenes, Brevibacterium immariophilum, Clostridium beigerinckii, Enterobacter sakazakii, Escherichia coli, Lactococcus lactis, Mesorhizobium loti, Pseudomonas aeruginosa, Pseudomonas mevalonii, Pseudomonas pudica, Rhodobacter capsulatus, Rhodobacter sphaeroides, Rhodospirillum rubrum, Salmonella enterica, Salmonella typhi, Salmonella typhimurium, Shigella dysenteriae, Shigella flexneri, Shigella sonnei, and Staphylococcus aureus.
[0125] Suitable archae hosts include but are not limited to cells belonging to the genera: Aeropyrum, Archaeglobus, Halobacterium, Methanococcus, Methanobacterium, Pyrococcus, Sulfolobus, and Thermoplasma. Examples of archae strains include but are not limited to: Archaeoglobus fulgidus, Halobacterium sp., Methanococcus jannaschii, Methanobacterium thermoautotrophicum, Thermoplasma acidophilum, Thermoplasma volcanium, Pyrococcus horikoshii, Pyrococcus abyssi, and Aeropyrum pernix.
[0126] Suitable eukaryotic hosts include but are not limited to fungal cells, algal cells, insect cells, and plant cells. Examples include but are not limited to cells belonging to the genera: Aspergillus, Candida, Chrysosporium, Cryotococcus, Fusarium, Kluyveromyces, Neotyphodium, Neurospora, Penicillium, Pichia, Saccharomyces, Trichoderma, Ascomycota, Basidiomycota, Dothideomycetes, and Xanthophyllomyces (formerly Phaffia). Examples of eukaryotic strains include but are not limited to: Pichia pastoris, Pichia finlandica, Pichia trehalophila, Pichia koclamae, Pichia membranaefaciens, Pichia opuntiae, Pichia thermotolerans, Pichia salictaria, Pichia quercuum, Pichia pijperi, Pichia stiptis, Pichia methanolica, Pichia sp., Saccharomyces cerevisiae, Saccharomyces sp., Schizosaccharomyces pombe, Hansenula polymorphs, Kluyveromyces sp., Kluyveromyces lactis, Candida albicans, Aspergillus nidulans, Aspergillus niger, Aspergillus oryzae, Trichoderma reesei, Chrysosporium lucknowense, Fusarium sp., Fusarium gramineum, Fusarium venenatum, Neurospora crassa, and Chlamydomonas reinhardtii.
[0127] In a particular embodiment, the host cell is an Escherichia coli cell. In another particular embodiment, the host cell is a Saccharomyces cerevisiae cell. In some embodiments, the host cell is a Saccharomyces cerevisiae cell selected from the group consisting of Baker's yeast, CBS 7959, CBS 7960, CBS 7961, CBS 7962, CBS 7963, CBS 7964, IZ-1904, TA, BG-1, CR-1, SA-1, M-26, Y-904, PE-2, PE-5, VR-1, BR-1, BR-2, ME-2, VR-2, MA-3, MA-4, CAT-1, CB-1, NR-1, BT-1, and AL-1. In some embodiments, the host cell is a Saccharomyces cerevisiae cell selected from the group consisting of PE-2, CAT-1, VR-1, BG-1, CR-1, and SA-1. In a particular embodiment, the host cell is a Saccharomyces cerevisiae of strain PE-2. In another particular embodiment, the host cell is a Saccharomyces cerevisiae of strain CAT-1. In another particular embodiment, the host cell is a Saccharomyces cerevisiae of strain BG-1.
[0128] In some embodiments, the host cell is a cell that is suitable for industrial fermentation, e.g., bioethanol fermentation. In particular embodiments, the host cell is conditioned to subsist under high solvent concentration, high temperature, expanded substrate utilization, nutrient limitation, osmotic stress, acidity, sulfite and bacterial contamination, or combinations thereof, which are recognized stress conditions of the industrial fermentation environment.
6.4 Host Cells with Elevated Intracellular FPP Levels
[0129] In some embodiments, compared to a parent cell, a host cell comprises an elevated intracellular level of FPP, wherein the elevated intracellular level of FPP decreases the viability of the host cell.
[0130] In some embodiments, the host cell comprises an intracellular level of FPP that is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 2-fold, at least about 2.5-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, or at least about 1,000-fold, or more, higher than the intracellular level of FPP of the parent cell, on a per unit volume of cell culture basis.
[0131] In some embodiments, the host cell comprises an intracellular level of FPP that is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 2-fold, at least about 2.5-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, or at least about 1,000-fold, or more, higher than the intracellular level of FPP of the parent cell, on a per unit dry cell weight basis.
[0132] In some embodiments, the host cell comprises an intracellular level of FPP that is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 2-fold, at least about 2.5-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, or at least about 1,000-fold, or more, higher than the intracellular level of FPP of the parent cell, on a per unit volume of cell culture per unit time basis.
[0133] In some embodiments, the host cell comprises an intracellular level of FPP that is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 2-fold, at least about 2.5-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, or at least about 1,000-fold, or more, higher than the intracellular level of FPP of the parent cell, on a per unit dry cell weight per unit time basis.
[0134] In most embodiments, the elevated intracellular level of FPP in the host cell is inducible by an inducing compound. Such a host cell can be manipulated with ease in the absence of the inducing compound. The inducing compound is then added to induce the elevated level of FPP in the host cell. In other embodiments, the elevated intracellular level of FPP in the host cell is inducible by changing culture conditions, such as, for example, the growth temperature. The inducible elevation of intracellular FPP level thus provides a molecular on and off switch for the reduced viability phenotype of the host cell.
[0135] The elevation of intracellular FPP level can be effected through targeted genetic engineering of the host cell. A number of enzymes are known to function in the production or utilization of FPP and its precursors, and any one of these enzymes can be manipulated to change the level of FPP in a host cell.
[0136] In some embodiments, the production of FPP in the host cell is increased by increasing production of cellular acetyl-CoA in the host cell.
[0137] In some embodiments, the production of FPP in the host cell is increased by increasing the production of IPP and/or DMAPP in the host cell. In some such embodiments, the production of IPP and DMAPP in the host cell is increased by increasing the activity of one or more enzymes of the MEV pathway. A schematic representation of the MEV pathway is described in FIG. 15. In general, the pathway comprises six steps:
[0138] In the first step, two molecules of acetyl-coenzyme A are enzymatically combined to form acetoacetyl-CoA. An enzyme known to catalyze this step is, for example, acetyl-CoA thiolase. Illustrative examples of nucleotide sequences include but are not limited to the following GenBank accession numbers and the organism from which the sequences derived: (NC--000913 REGION: 2324131 . . . 2325315; Escherichia coli), (D49362; Paracoccus denitrificans), and (L20428; Saccharomyces cerevisiae).
[0139] In the second step of the MEV pathway, acetoacetyl-CoA is enzymatically condensed with another molecule of acetyl-CoA to form 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA). An enzyme known to catalyze this step is, for example, HMG-CoA synthase. Illustrative examples of nucleotide sequences include but are not limited to: (NC--001145. complement 19061 . . . 20536; Saccharomyces cerevisiae), (X96617; Saccharomyces cerevisiae), (X83882; Arabidopsis thaliana), (AB037907; Kitasatospora griseola), (BT007302; Homo sapiens), and (NC--002758, Locus tag SAV2546, GeneID 1122571; Staphylococcus aureus).
[0140] In the third step, HMG-CoA is enzymatically converted to mevalonate. An enzyme known to catalyze this step is, for example, HMG-CoA reductase. Illustrative examples of nucleotide sequences include but are not limited to: (NM--206548; Drosophila melanogaster), (NC--002758, Locus tag SAV2545, GeneID 1122570; Staphylococcus aureus), (NM 204485; Gallus gallus), (AB015627; Streptomyces sp. KO 3988), (AF542543; Nicotiana attenuata), (AB037907; Kitasatospora griseola), (AX128213, providing the sequence encoding a truncated HMGR; Saccharomyces cerevisiae), and (NC--001145: complement (115734 . . . 118898; Saccharomyces cerevisiae).
[0141] In the fourth step, mevalonate is enzymatically phosphorylated to form mevalonate 5-phosphate. An enzyme known to catalyze this step is, for example, mevalonate kinase. Illustrative examples of nucleotide sequences include but are not limited to: (L77688; Arabidopsis thaliana), and (X55875; Saccharomyces cerevisiae).
[0142] In the fifth step, a second phosphate group is enzymatically added to mevalonate 5-phosphate to form mevalonate 5-pyrophosphate. An enzyme known to catalyze this step is, for example, phosphomevalonate kinase. Illustrative examples of nucleotide sequences include but are not limited to: (AF429385; Hevea brasiliensis), (NM--006556; Homo sapiens), and (NC--001145. complement 712315 . . . 713670; Saccharomyces cerevisiae).
[0143] In the sixth step, mevalonate 5-pyrophosphate is enzymatically converted into IPP. An enzyme known to catalyze this step is, for example, mevalonate pyrophosphate decarboxylase. Illustrative examples of nucleotide sequences include but are not limited to: (X97557; Saccharomyces cerevisiae), (AF290095; Enterococcus faecium), and (U49260; Homo sapiens).
[0144] In other such embodiments, the production of IPP and DMAPP in the host cell is increased by increasing the activity of one or more enzymes of the DXP pathway. A schematic representation of the DXP pathway is described in FIG. 16. In general, the DXP pathway comprises seven steps:
[0145] In the first step, pyruvate is condensed with D-glyceraldehyde 3-phosphate to make 1-deoxy-D-xylulose-5-phosphate. An enzyme known to catalyze this step is, for example, 1-deoxy-D-xylulose-5-phosphate synthase. Illustrative examples of nucleotide sequences include but are not limited to: (AF035440; Escherichia coli), (NC--002947, locus_tag PP0527; Pseudomonas putida KT2440), (CP000026, locus_tag SPA2301; Salmonella enterica Paratyphi, see ATCC 9150), (NC--007493, locus_tag RSP--0254; Rhodobacter sphaeroides 2. 4. 1), (NC--005296, locus_tag RPA0952; Rhodopseudomonas palustris CGA009), (NC--004556, locus_tag PD1293; Xylella fastidiosa Temeculal), and (NC--003076, locus_tag AT5G11380; Arabidopsis thaliana).
[0146] In the second step, 1-deoxy-D-xylulose-5-phosphate is converted to 2C-methyl-D-erythritol-4-phosphate. An enzyme known to catalyze this step is, for example, 1-deoxy-D-xylulose-5-phosphate reductoisomerase. Illustrative examples of nucleotide sequences include but are not limited to: (AB013300; Escherichia coli), (AF148852; Arabidopsis thaliana), (NC--002947, locus_tag PP1597; Pseudomonas putida KT2440), (AL939124, locus tag SCO5694; Streptomyces coelicolor A3(2)), (NC--007493, locus_tag RSP--2709; Rhodobacter sphaeroides 2. 4. 1), and (NC--007492, locus_tag Pfl--1107; Pseudomonas fluorescens NO-1).
[0147] In the third step, 2C-methyl-D-erythritol-4-phosphate is converted to 4-diphosphocytidyl-2C-methyl-D-erythritol. An enzyme known to catalyze this step is, for example, 4-diphosphocytidyl-2C-methyl-D-erythritol synthase. Illustrative examples of nucleotide sequences include but are not limited to: (AF230736; Escherichia coli), (NC--007493, locus_tag RSP--2835; Rhodobacter sphaeroides 2. 4. 1), (NC--003071, locus_tag AT2G02500; Arabidopsis thaliana), and (NC--002947, locus_tag PP1614; Pseudomonas putida KT2440).
[0148] In the fourth step, 4-diphosphocytidyl-2C-methyl-D-erythritol is converted to 4-diphosphocytidyl-2C-methyl-D-erythritol-2-phosphate. An enzyme known to catalyze this step is, for example, 4-diphosphocytidyl-2C-methyl-D-erythritol kinase. Illustrative examples of nucleotide sequences include but are not limited to: (AF216300; Escherichia coli) and (NC--007493, locus_tag RSP--1779; Rhodobacter sphaeroides 2. 4. 1).
[0149] In the fifth step, 4-diphosphocytidyl-2C-methyl-D-erythritol-2-phosphate is converted to 2C-methyl-D-erythritol 2,4-cyclodiphosphate. An enzyme known to catalyze this step is, for example, 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase. Illustrative examples of nucleotide sequences include but are not limited to: (AF230738; Escherichia coli), (NC--007493, locus_tag RSP--6071; Rhodobacter sphaeroides 2. 4. 1), and (NC--002947, locus_tag PP1618; Pseudomonas putida KT2440).
[0150] In the sixth step, 2C-methyl-D-erythritol 2,4-cyclodiphosphate is converted to 1-hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate. An enzyme known to catalyze this step is, for example, 1-hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate synthase. Illustrative examples of nucleotide sequences include but are not limited to: (AY033515; Escherichia coli), (NC--002947, locus_tag PP0853; Pseudomonas putida KT2440), and (NC--007493, locus_tag RSP--2982; Rhodobacter sphaeroides 2. 4. 1).
[0151] In the seventh step, 1-hydroxy-2-methyl-2-(E)-butenyl-4-diphosphate is converted into either IPP or its isomer, DMAPP. An enzyme known to catalyze this step is, for example, isopentyl/dimethylallyl diphosphate synthase. Illustrative examples of nucleotide sequences include but are not limited to: (AY062212; Escherichia coli) and (NC--002947, locus_tag PP0606; Pseudomonas putida KT2440).
[0152] In some embodiments, the production of FPP in the host cell is increased by increasing the isomerization of IPP to DMAPP. In some such embodiments, the isomerization of IPP to DMAPP is increased by increasing the activity of an IPP isomerase. Illustrative examples of nucleotide sequences encoding IPP isomerases include but are not limited to: (NC--000913, 3031087 . . . 3031635; Escherichia coli), and (AF082326; Haematococcus pluvialis).
[0153] In some embodiments, the production of FPP in the host cell is increased by increasing the condensation of IPP and DMAPP to FPP. In some such embodiments, the condensation of IPP and DMAPP or of IPP and geranyl pyrophosphate ("GPP") to FPP is increased by increasing the activity of a FPP synthase. Illustrative examples of nucleotide sequences that encode FPP synthases include but are not limited to: (ATU80605; Arabidopsis thaliana), (ATHFPS2R; Arabidopsis thaliana), (AAU36376; Artemisia annua), (AF461050; Bos taurus), (D00694; Escherichia coli K-12), (AE009951, Locus AAL95523; Fusobacterium nucleatum subsp. nucleatum ATCC 25586), (GFFPPSGEN; Gibberella fujikuroi), (CP000009, Locus AAW60034; Gluconobacter oxydans 621H), (AF019892; Helianthus annuus), (HUMFAPS; Homo sapiens), (KLPFPSQCR; Kluyveromyces lactis), (LAU15777; Lupinus albus), (LAU20771; Lupinus albus), (AF309508; Mus musculus), (NCFPPSGEN; Neurospora crassa), (PAFPS1; Parthenium argentatum), (PAFPS2; Parthenium argentatum), (RATFAPS; Rattus norvegicus), (YSCFPP; Saccharomyces cerevisiae), (D89104; Schizosaccharomyces pombe), (CP000003, Locus AAT87386; Streptococcus pyogenes), (CP000017, Locus AAZ51849; Streptococcus pyogenes), (NC--008022, Locus YP--598856; Streptococcus pyogenes MGAS10270), (NC--008023, Locus YP 600845; Streptococcus pyogenes MGAS2096), (NC--008024, Locus YP 602832; Streptococcus pyogenes MGAS10750), (MZEFPS; Zea mays), (AE000657, Locus AAC06913; Aquifex aeolicus VF5), (NM 202836; Arabidopsis thaliana), (D84432, Locus BAA12575; Bacillus subtilis), (U12678, Locus AAC28894; Bradyrhizobium japonicum USDA 110), (BACFDPS; Geobacillus stearothermophilus), (NC--002940, Locus NP--873754; Haemophilus ducreyi 35000HP), (L42023, Locus AAC23087; Haemophilus influenzae Rd KW20), (J05262; Homo sapiens), (YP--395294; Lactobacillus sakei subsp. sakei 23K), (NC--005823, Locus YP--000273; Leptospira interrogans serovar Copenhageni str. Fiocruz L1-130), (AB003187; Micrococcus luteus), (NC--002946, Locus YP--208768; Neisseria gonorrhoeae FA 1090), (U00090, Locus AAB91752; Rhizobium sp. NGR234), (J05091; Saccharomyces cerevisae), (CP000031, Locus AAV93568; Silicibacter pomeroyi DSS-3), (AE008481, Locus AAK99890; Streptococcus pneumoniae R6), and (NC--004556, Locus NP 779706; Xylella fastidiosa Temeculal).
[0154] In some embodiments, the production of FPP in the host cell is increased by inhibiting reactions that divert intermediates from productive steps towards formation of FPP. Such reactions include but are not limited to side reactions of the TCA cycle that lead to fatty acid biosynthesis, alanine biosynthesis, the aspartate superpathway, gluconeogenesis, heme biosynthesis, glutamate biosynthesis, and conversion of acetyl-CoA to acetate via the action of phosphotransacetylase.
[0155] In some embodiments, a host cell that comprises an elevated intracellular level of FPP is obtained by decreasing the consumption of FPP in the host cell. In some such embodiments, the consumption of FPP in the host cell is decreased by decreasing the activity of a farnesyl-diphosphate farnesyl transferase or squalene synthase that can convert FPP to squalene. In other such embodiments, the consumption of FPP in the host cell is decreased by decreasing the activity of a sesquiterpene synthase in the host cell.
[0156] A host cell comprising an elevated intracellular level of FPP can be generated by genetically modifying a parent cell using genetic engineering techniques (i.e., recombinant technology), classical microbiological techniques, or a combination of such techniques. The host cell may also be a naturally occurring genetic variant that is non-viable under certain growth conditions due to an elevated intracellular level of FPP.
[0157] A host cell that comprises such an elevated intracellular level of FPP that it has reduced cell viability can be identified by comparing the growth of the host cell on a solid medium with that of a parent cell that does not comprise the elevated intracellular level of FPP. A host cell that comprises an elevated level of intracellular FPP should produce fewer or smaller colonies on the solid agar medium compared to its parent cell. A host cell that comprises the elevated intracellular level of FPP only under certain growth conditions can be identified by first growing the host cell under conditions under which the host cell does not comprise an elevated intracellular level of FPP and under which it has the same viability as its parent cell ("permissive growth conditions"), and then replica-plating the host cell and growing it under conditions under which the host cell does comprise the elevated intracellular level of FPP ("restrictive growth condition") to identify host cells that has reduced viability only under restrictive growth conditions but that does not have reduced viability under permissive growth conditions. Such restrictive growth conditions can include but are not limited to the presence of a specific nutrient in the culture medium, the presence of a specific nutrient at a specific level in the culture medium, the presence of an inducing compound in the culture medium, the presence of a repressing compound in the culture medium, and a specific growth temperature.
6.5 Terpene Synthases
[0158] The methods provided herein are focused on developing terpene synthase variants with improved in vivo performance.
[0159] In some embodiments, the terpene synthase variant is a variant of a naturally occurring terpene synthase. In other embodiments, the terpene synthase variant is a variant of a naturally not occurring terpene synthase.
[0160] In some such embodiments, the terpene synthase variant differs from a naturally occurring terpene synthase or from a naturally not occurring terpene synthase by one or more amino acid substitutions, deletions, and/or additions. In some embodiments, the terpene synthase differs from a naturally occurring terpene synthase or from a naturally not occurring terpene synthase by comprising one, two, three, four, five, six, seven, eight, nine, ten, or more additional amino acids. In some embodiments, the terpene synthase variant differs from a naturally occurring terpene synthase or from a naturally not occurring terpene synthase by comprising one, two, three, four, five, six, seven, eight, nine, ten, or more amino acid substitutions. In some embodiments, the terpene synthase variant differs from a naturally occurring terpene synthase or from a naturally not occurring terpene synthase by lacking one, two, three, four, five, six, seven, eight, nine, ten, or more amino acids.
[0161] In some embodiments, the terpene synthase variant has from about 50% to about 55%, from about 55% to about 60%, from about 60% to about 65%, from about 65% to about 70%, from about 70% to about 75%, from about 75% to about 80%, from about 80% to about 85%, from about 85% to about 90%, from about 90% to about 95%, or from about 95% to 99% amino acid sequence identity to the amino acid sequence of a naturally occurring terpene synthase or of a naturally not occurring terpene synthase.
[0162] In some embodiments, the terpene synthase variant comprises a consensus amino acid sequence. A consensus amino acid sequence is derived by aligning three or more amino acid sequences, and identifying amino acids that are shared by at least two of the sequences. In some embodiments, the terpene synthase variant comprises a consensus sequence derived from two or more naturally occurring terpene synthases.
[0163] In some embodiments, the terpene synthase variant is a hybrid terpene synthase. Hybrid terpene synthases comprise stretches of contiguous amino acids from two or more different terpene synthases. Hybrid terpene synthases can be generated using any known method, including but not limited to exon shuffling, domain swapping, and the like (e.g., Nixon et al. (1997) Proc. Natl. Acad. Sci. USA 94:1069-1073; Fisch et al. (1996) Proc Natl Acad Sci USA 93(15):7761-7766).
[0164] In some embodiments, a nucleic acid comprising a nucleotide sequence encoding a terpene synthase variant hybridizes under stringent hybridization conditions to a nucleic acid encoding a naturally occurring terpene synthase. In another embodiment, a nucleic acid comprising a nucleotide sequence encoding a terpene synthase variant hybridizes under moderate hybridization conditions to a nucleic acid encoding a naturally occurring terpene synthase. In yet another embodiment, a nucleic acid comprising a nucleotide sequence encoding a terpene synthase variant hybridizes under low stringency hybridization conditions to a nucleic acid encoding a naturally occurring terpene synthase.
[0165] In some embodiments, the nucleotide sequence encoding the terpene synthase variant is altered from the nucleotide sequence encoding a naturally occurring terpene synthase to reflect the codon preferences for a particular host cell (i.e., is codon-optimized for expression in a particular host cell). The use of preferred codons for a particular host cell generally increases the likelihood of translation, and hence expression, of the nucleotide sequence. Codon usage tables that summarize the percentage of time a specific organism uses a specific codon to code a specific amino acid are available for many organisms, and can be used as a reference in designing suitable nucleotide sequences. In some embodiments, the nucleotide sequence encoding the terpene synthase is altered to reflect the codon preferences of Saccharomyces cerevisiae (see, e.g., Bennetzen and Hall (1982) J. Biol. Chem. 257(6): 3026-3031). In some embodiments, the nucleotide sequence encoding the terpene synthase is altered to reflect the codon preferences for Escherichia coli (see, e.g., Gouy and Gautier (1982) Nucleic Acids Res. 10(22):7055-7074; Eyre-Walker (1996) Mol. Biol. Evol. 13(6):864-872; Nakamura et al. (2000) Nucleic Acids Res. 28(1):292).
[0166] A nucleic acid comprising a nucleotide sequence encoding a terpene synthase can be obtained using any of a variety of known recombinant techniques and synthetic procedures. The nucleic acid can be prepared from genomic DNA, cDNA, or RNA, all of which can be extracted directly from a cell or can be recombinantly produced by various amplification processes including but not limited to PCR and rt-PCR. Direct chemical synthesis methods are also well known in the art.
[0167] A nucleic acid comprising a nucleotide sequence encoding a terpene synthase variant can be obtained using any of a variety of known methods. For example, nucleic acids can be isolated from cells that were treated with chemical mutagens or radiation, or from cells that have deficiencies in DNA repair. Suitable chemical mutagens include, but are not limited to, ethyl methanesulfonate (EMS), methyl methanesulfonate (MMS), N-nitroso urea (ENU), N-methyl-N-nitro-N'-nitrosoguanidine, 4-nitroquino line N-oxide, diethylsulfate, benzopyrene, cyclophosphamide, bleomycin, triethylmelamine, acrylamide monomer, nitrogen mustard, vincristine, diepoxyalkanes (for example, diepoxybutane), ICR-170, formaldehyde, procarbazine hydrochloride, ethylene oxide, dimethylnitrosamine, 7,12 dimethylbenz(a)anthracene, chlorambucil, hexamethylphosphoramide, bisulfan, and acridine dyes (see, for example Thomas D. Brock in Biotechnology: A Textbook of Industrial Microbiology, Second Edition (1989) Sinauer Associates, Inc., Sunderland, Mass., or Deshpande Mukund V., Appl. Biochem. Biotechnol. 36, 227 (1992)). Suitable radiation exposures include but are not limited to ultraviolet radiation (optionally in combination with exposure to chemical agents such as, for example, trimethylpsoralen), γ-irradiation, X-rays, and fast neutron bombardment. A suitable method for introducing deficiencies in DNA repair in a cell includes but is not limited to the expression of a mutant DNA repair enzyme that generates a high frequency of mutations in the genome of the cell (on the order of about 1 mutation/100 genes to about 1 mutation/10,000 genes). Examples of genes encoding DNA repair enzymes include but are not limited to Mut H, Mut S, Mut L, and Mut U, and the homologs thereof in other species (for example, MSH 1-6, PMS 1-2, MLH 1, GTBP, and ERCC-1). Other methods for obtaining a nucleic acid comprising a nucleotide sequence encoding a terpene synthase variant include manipulation of cell-free in vitro systems (e.g., using error-prone PCR for the amplification of a nucleic acid), random or targeted insertion in the genome of a cell of a mobile DNA element (e.g., a transposable element), or in vitro DNA shuffling (e.g., exon shuffling, domain swapping, and the like; see, for example, Ausubel et al., Current Protocols In Molecular Biology, John Wiley and Sons, New York (current edition); and Sambrook et al., Molecular Cloning, A Laboratory Manual, 3d. ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001)).
[0168] In some embodiments, the terpene synthase variants are variants of a sesquiterpene synthase selected from the group consisting of a β-farnesene synthase, an α-farnesene synthase, a trichodiene synthase, a patchoulol synthase, an amorphadiene synthase, a valencene synthase, a farnesol synthase, a nerolidol synthase, and a nootkatone synthase.
[0169] In some embodiments, the terpene synthase variant is a β-farnesene synthase variant. In some such embodiments, the β-farnesene synthase variant is derived from a β-farnesene synthase of Artemisia annua. The sequence of the β-farnesene synthase of Artemisia annua has been previously described (Picaud, et al, (2005) Phytochemistry 66 (9):961-967). The nucleotide sequence of the β-farnesene synthase of Artemisia annua is deposited under GenBank accession number AY835398, and SEQ ID NO: 112 as provided herein. The amino acid sequence of the β-farnesene synthase of Artemisia annua is deposited under GenBank accession number AAX39387, and SEQ ID NO: 111 as provided herein.
[0170] In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 2 from serine to aspartate (S2D mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 3 from threonine to asparagine (T3N mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 4 from leucine to serine (L4S mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 6 from isoleucine to threonine (16T mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 9 from valine to aspartic acid (V9D mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 11 from phenylalanine to serine (F11S mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 20 from valine to glutamic acid (V20E mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 24 from valine to aspartic acid (V24D mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 35 from methionine to threonine (M35T mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 38 from asparagine to serine (N38S mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 50 from aspartic acid to asparagine (D50N mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 61 from leucine to glutamine (L61Q mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 72 from glutamic acid to lysine (E72K mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 72 from glutamic acid to valine (E72V mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 80 from asparagine to aspartic acid (N80D mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 89 from isoleucine to valine (189V mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 105 from glutamic acid to aspartic acid (E105D mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 115 from isoleucine to methionine (I115M mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 115 from isoleucine to valine (I115V mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 144 from phenylalanine to tyrosine (F144Y mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 196 from threonine to serine (T196S mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 211 from serine to threonine (S211T mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 251 from leucine to methionine (L251M mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 280 from leucine to glutamine (L280Q mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 288 from tyrosine to phenylalanine (Y288F mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 319 from threonine to serine (T319S mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 357 from glutamic acid to valine (E357V mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 359 from glutamic acid to threonine (E359T mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 369 from valine to leucine (V369L mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 371 from leucine to methionine (L371M mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 385 from threonine to alanine (T385A mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 398 from isoleucine to valine (1398V mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 423 from valine to isoleucine (V423I mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 433 from methionine to isoleucine (M433I mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 434 from isoleucine to threonine (1434T mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 442 from glycine to alanine (G442A mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 442 from glycine to aspartic acid (G442D mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 444 from isoleucine to leucine (1444L mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 446 from threonine to asparagine (T446N mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 460 from isoleucine to valine (1460V mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 467 from valine to isoleucine (V467I mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 488 from serine to phenylalanine (S488F mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 495 from glutamic acid to glycine (E495G mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 505 from glutamic acid to valine (E505V mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 526 from threonine to serine (T526S mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 531 from proline to serine (P531S mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 556 from alanine to valine (A556V mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 572 from methionine to lysine (M572K mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 575 from a stop codon to lysine (stop575K mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 348 from arginine to lysine (R348K mutation). In some embodiments, the β-farnesene synthase variant has an amino acid sequence as given in SEQ ID NO: 111 but comprising an amino acid substitution at position 18 from leucine to isoleucine (L18I mutation).
6.6 Genetically Engineering Host Cells
[0171] The methods provided herein include obtaining a host cell that is genetically engineered to comprise an elevated intracellular FPP level or to express a terpene synthase or a terpene synthase variant. Such a genetically engineered host cell may comprise insertions, deletions, or modifications of nucleotides in such a manner as to provide the desired effect of elevating the intracellular level of FPP or of expressing the terpene synthase or the terpene synthase variant. Such genetic modifications may result in a decrease or increase or modification in copy number or activity of a specific enzyme.
[0172] For example, the copy number of an enzyme in a host cell may be altered by modifying the transcription of the gene that encodes the enzyme. This can be achieved for example by modifying the copy number of the nucleotide sequence encoding the enzyme (e.g., by using a higher or lower copy number expression vector comprising the nucleotide sequence, or by introducing additional copies of the nucleotide sequence into the genome of the host cell or by deleting or disrupting the nucleotide sequence in the genome of the host cell), by changing the order of coding sequences on a polycistronic mRNA of an operon or breaking up an operon into individual genes each with its own control elements, or by increasing the strength of the promoter or operator to which the nucleotide sequence is operably linked. Alternatively or in addition, the copy number of an enzyme in a host cell may be altered by modifying the level of translation of an mRNA that encodes the enzyme. This can be achieved for example by modifying the stability of the mRNA, modifying the sequence of the ribosome binding site, modifying the distance or sequence between the ribosome binding site and the start codon of the enzyme coding sequence, modifying the entire intercistronic region located "upstream of" or adjacent to the 5' side of the start codon of the enzyme coding region, stabilizing the 3'-end of the mRNA transcript using hairpins and specialized sequences, modifying the codon usage of enzyme, altering expression of rare codon tRNAs used in the biosynthesis of the enzyme, and/or increasing the stability of the enzyme, as, for example, via mutation of its coding sequence.
[0173] The activity of an enzyme in a host cell can be altered in a number of ways, including, but not limited to, expressing a modified form of the enzyme that exhibits increased or decreased solubility in the host cell, expressing an altered form of the enzyme that lacks a domain through which the activity of the enzyme is inhibited, expressing a modified form of the enzyme that has a higher or lower Kcat or a lower or higher Km for the substrate, or expressing an altered form of the enzyme that is more or less affected by feed-back or feed-forward regulation by another molecule in the pathway.
[0174] The methods provided herein further include steps of expressing a terpene synthase or a terpene synthase variant in a host cell that does not naturally express such terpene synthase or terpene synthase variant. Expression of a terpene synthase or a terpene synthase variant in a host cell can be accomplished by introducing into the host cells a nucleic acid comprising a nucleotide sequence encoding the terpene synthase or terpene synthase variant under the control of regulatory elements that permit expression in the host cell. In some embodiments, the nucleic acid is an extrachromosomal plasmid. In other embodiments, the nucleic acid is a chromosomal integration vector that can integrate the nucleotide sequence into the chromosome of the host cell.
[0175] In some embodiments, it is essential that expression levels of terpene synthases or terpene synthase variants in two or more host cells are similar. This can be accomplished using nucleic acids comprising nucleotide sequences encoding the terpene synthase or terpene synthase variant under the control of the same regulatory elements. Such nucleic acids can be used as extrachromosomal expression vectors or to integrate the nucleotide sequences encoding the terpene synthase or the terpene synthase variant and the regulatory elements into the chromosome of the host cell. Comparable expression levels can also be accomplished by targeting nucleic acids comprising nucleotide sequences encoding the terpene synthase or terpene synthase variant to identical locations in the two or more host cells, thus placing the nucleotide sequences under the control of the same endogenous regulatory elements. In addition to the use of similar regulatory elements, comparable expression levels may also depend on similar copy numbers of the nucleotide sequences in the two or more host cells. Copy numbers can be controlled by the use of similar or identical origins of replications in extrachromosomal expression vectors, or by the use of similar types and numbers of chromosomal integration constructs for the integration of the nucleotide sequences into the chromosome of the two or more host cells. A number of additional features of the nucleic acids can affect the expression level of the encoded terpene synthases or terpene synthase variants (e.g., protein or mRNA stability, sequence of the ribosome binding site, distance between the ribosome binding site and start codon, nature of the upstream and downstream sequences, hairpins and other specialized sequences, and codon usage), and all of these can be modified to ensure similar expression levels when required in the provided methods.
[0176] Nucleic acids can be introduced into microorganisms by any method known to one of skill in the art without limitation (see, for example, Hinnen et al. (1978) Proc. Natl. Acad. Sci. USA 75:1292-3; Cregg et al. (1985) Mol. Cell. Biol. 5:3376-3385; Goeddel et al., eds, 1990, Methods in Enzymology, vol. 185, Academic Press, Inc., CA; Krieger, 1990, Gene Transfer and Expression--A Laboratory Manual, Stockton Press, NY; Sambrook et al., 1989, Molecular Cloning--A Laboratory Manual, Cold Spring Harbor Laboratory, NY; and Ausubel et al., eds., Current Edition, Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley Interscience, NY). Exemplary techniques include but are not limited to spheroplasting, electroporation, PEG 1000 mediated transformation, and lithium acetate or lithium chloride mediated transformation.
[0177] In some embodiments, a nucleic acid used to genetically modify a host cell comprises one or more selectable markers useful for the selection of transformed host cells and for placing selective pressure on the host cell to maintain the foreign DNA.
[0178] In some embodiments, the selectable marker is an antibiotic resistance marker. Illustrative examples of antibiotic resistance markers include but are not limited to the BLA, NAT1, PAT, AUR1-C, PDR4, SMR1, CAT, mouse dhfr, HPH, DSDA, KANR, and SH BLE gene products. The BLA gene product from E. coli confers resistance to beta-lactam antibiotics (e.g., narrow-spectrum cephalosporins, cephamycins, and carbapenems (ertapenem), cefamandole, and cefoperazone) and to all the anti-gram-negative-bacterium penicillins except temocillin; the NAT1 gene product from S. noursei confers resistance to nourseothricin; the PAT gene product from S. viridochromogenes Tu94 confers resistance to bialophos; the AUR1-C gene product from Saccharomyces cerevisiae confers resistance to Auerobasidin A (AbA); the PDR4 gene product confers resistance to cerulenin; the SMR1 gene product confers resistance to sulfometuron methyl; the CAT gene product from Tn9 transposon confers resistance to chloramphenicol; the mouse dhfr gene product confers resistance to methotrexate; the HPH gene product of Klebsiella pneumonia confers resistance to Hygromycin B; the DSDA gene product of E. coli allows cells to grow on plates with D-serine as the sole nitrogen source; the KANR gene of the Tn903 transposon confers resistance to G418; and the SH BLE gene product from Streptoalloteichus hindustanus confers resistance to Zeocin (bleomycin). In some embodiments, the antibiotic resistance marker is deleted after the genetically modified host cell disclosed herein is isolated.
[0179] In some embodiments, the selectable marker rescues an auxotrophy (e.g., a nutritional auxotrophy) in the genetically modified microorganism. In such embodiments, a parent microorganism comprises a functional disruption in one or more gene products that function in an amino acid or nucleotide biosynthetic pathway and that when non-functional rende a parent cell incapable of growing in media without supplementation with one or more nutrients. Such gene products include but are not limited to the HIS3, LEU2, LYS1, LYS2, MET15, TRP1, ADE2, and URA3 gene products in yeast. The auxotrophic phenotype can then be rescued by transforming the parent cell with an expression vector or chromosomal integration construct encoding a functional copy of the disrupted gene product, and the genetically modified host cell generated can be selected for based on the loss of the auxotrophic phenotype of the parent cell. Utilization of the URA3, TRP1, and LYS2 genes as selectable markers has a marked advantage because both positive and negative selections are possible. Positive selection is carried out by auxotrophic complementation of the URA3, TRP1, and LYS2 mutations, whereas negative selection is based on specific inhibitors, i.e., 5-fluoro-orotic acid (FOA), 5-fluoroanthranilic acid, and α-aminoadipic acid (aAA), respectively, that prevent growth of the prototrophic strains but allows growth of the URA3, TRP1, and LYS2 mutants, respectively.
[0180] In other embodiments, the selectable marker rescues other non-lethal deficiencies or phenotypes that can be identified by a known selection method.
6.7 Growing Host Cells
[0181] The present invention provides methods for developing terpene synthase variants with improved in vivo performance, and for producing terpenes. The methods generally involve growing a host cell under suitable conditions in a suitable medium comprising a carbon source.
[0182] Suitable conditions and suitable media for growing microorganisms are well known in the art. In some embodiments, the suitable medium is supplemented with one or more additional agents, such as, for example, an inducing compound (e.g., when one or more nucleotide sequences encoding a gene product are under the control of an inducible promoter), a repressing compound (e.g., when one or more nucleotide sequences encoding a gene product are under the control of a repressible promoter), or a selection agent (e.g., an antibiotic to select for microorganisms comprising the genetic modifications).
[0183] In some embodiments, the carbon source is a monosaccharide (simple sugar), a disaccharide, a polysaccharide, a non-fermentable carbon source, or one or more combinations thereof. Non-limiting examples of suitable monosaccharides include glucose, galactose, mannose, fructose, ribose, and combinations thereof. Non-limiting examples of suitable disaccharides include sucrose, lactose, maltose, trehalose, cellobiose, and combinations thereof. Non-limiting examples of suitable polysaccharides include starch, glycogen, cellulose, chitin, and combinations thereof. Non-limiting examples of suitable non-fermentable carbon sources include acetate and glycerol.
[0184] In one aspect, the present invention provides a method for identifying a terpene synthase with improved in vivo performance based on the growth rate of a host cell comprising a test terpene synthase. The growth rate of a host cell can be determined, for example, by growing the host cell in liquid medium for a defined period of time, then plating all or an aliquot of the culture on an agar plate, and finally scoring the number of colonies that arise on the agar plate. Alternatively, the growth rate of a host cell is determined by measuring the biomass of a culture after a defined period of time. Biomass can be measured by determining the density of the liquid culture, e.g. by UV spectrometry, or by quantifying biomass index molecules such as hexoseamine and ergosterol (Frey et al. (1992) Biol. Fertil. Soils 13: 229-234; Newell (1992) p. 521-561. In G. C. Carroll and D. T. Wicklow (ed.), The fungal community: its organization and role in the ecosystem, 2nd ed. Marcel Dekker Inc., New York).
6.8 Producing Terpenes
[0185] The present invention provides methods for producing terpenes.
[0186] In some embodiments, the terpene is produced in an amount greater than about 10 grams per liter of fermentation medium. In some such embodiments, the terpene is produced in an amount from about 10 to about 50 grams, more than about 15 grams, more than about 20 grams, more than about 25 grams, or more than about 30 grams per liter of cell culture.
[0187] In some embodiments, the terpene is produced in an amount greater than about 50 milligrams per gram of dry cell weight. In some such embodiments, the terpene is produced in an amount from about 50 to about 1500 milligrams, more than about 100 milligrams, more than about 150 milligrams, more than about 200 milligrams, more than about 250 milligrams, more than about 500 milligrams, more than about 750 milligrams, or more than about 1000 milligrams per gram of dry cell weight.
[0188] In some embodiments, the terpene is produced in an amount that is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 2-fold, at least about 2.5-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, or at least about 1,000-fold, or more, higher than the amount of the terpene produced by a host cell that does not comprise the first heterologous nucleotide sequence, on a per unit volume of cell culture basis.
[0189] In some embodiments, the terpene is produced in an amount that is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 2-fold, at least about 2.5-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, or at least about 1,000-fold, or more, higher than the amount of the terpene produced by a host cell that does not comprise the first heterologous nucleotide sequence, on a per unit dry cell weight basis.
[0190] In some embodiments, the terpene is produced in an amount that is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 2-fold, at least about 2.5-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, or at least about 1,000-fold, or more, higher than the amount of the terpene produced by a host cell that does not comprise the first heterologous nucleotide sequence, on a per unit volume of cell culture per unit time basis.
[0191] In some embodiments, the terpene is produced in an amount that is at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 2-fold, at least about 2.5-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 75-fold, at least about 100-fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500-fold, or at least about 1,000-fold, or more, higher than the amount of the terpene produced by a host cell that does not comprise the first heterologous nucleotide sequence, on a per unit dry cell weight per unit time basis.
6.9 Extracting and Quantifying Terpenes
[0192] The terpene produced by the genetically modified host cell of the invention may be isolated from the fermentation using any suitable separation and purification methods known in the art.
[0193] In some embodiments, an organic phase comprising the terpene is separated from the fermentation by centrifugation. In other embodiments, an organic phase comprising the terpene separates from the fermentation spontaneously. In yet other embodiments, an organic phase comprising the terpene is separated from the fermentation by adding a deemulsifier and/or a nucleating agent into the fermentation reaction. Illustrative examples of deemulsifiers include flocculants and coagulants. Illustrative examples of nucleating agents include droplets of the terpene itself and organic solvents such as dodecane, isopropyl myristrate, and methyl oleate.
[0194] In some embodiments, the terpene is separated from other products that may be present in the organic phase. In some embodiments, separation is achieved using adsorption, distillation, gas-liquid extraction (stripping), liquid-liquid extraction (solvent extraction), ultrafiltration, and standard chromatographic techniques.
[0195] In some embodiments, the terpene is pure, e.g., at least about 40% pure, at least about 50% pure, at least about 60% pure, at least about 70% pure, at least about 80% pure, at least about 90% pure, at least about 95% pure, at least about 98% pure, or more than 98% pure, where "pure" in the context of an terpene refers to an terpene that is free from other terpenes or contaminants.
[0196] Terpene production can be readily quantified using well-known methods known in the art including but are not limited to gas chromatography (GC), gas chromatography-mass spectrometry (GC/MS), nuclear magnetic resonance (NMR), RAMAN spectroscopy, optical absorption (UV/VIS), infrared spectroscopy (IR), high performance liquid chromatography (HPLC), liquid chromatography-mass spectrometry (LC/MS), ion chromatography-mass spectrometry, thin layer chromatography, pulsed amperometric detection, and UV-vis spectrometry.
[0197] Terpenes produced by host cells can be recovered using any of a variety of methods including but not limited to chromatography, extraction, solvent extraction, membrane separation, electrodialysis, reverse osmosis, distillation, chemical derivatization, and crystallization.
[0198] Additional processing steps to improve terpene quantification or isolation include but are not limited to breaking open the host cells. Suitable methods include but are not limited to vortexing, sonication, and the use of glass beads. Other processing steps can include centrifugation to remove unwanted cell debris from the supernatant.
7. EXAMPLES
[0199] The following specific examples are intended to illustrate the disclosure and should not be construed as limiting the scope of the claims.
Example 1
[0200] This example describes methods for making DNA constructs useful in the generation and characterization of terpene synthase variants.
[0201] Expression plasmid pAM36-MevT66 was generated by inserting the MevT66 operon into vector pAM36. Vector pAM36 was generated by removing the tet resistance gene from and adding an oligonucleotide cassette containing AscI-SfiI-AsiSI-XhoI-PacI-FslI-PmeI restriction sites into the pACYC184 vector (GenBank accession number XO6403). The MevT66 operon encoded the set of MEV pathway enzymes that together transform the ubiquitous precursor acetyl-CoA to (R)-mevalonate, namely acetoacetyl-CoA thiolase, HMG-CoA synthase, and HMG-CoA reductase. The MevT66 operon was synthetically generated and comprised the atoB gene of Escherichia coli (GenBank accession number NC--000913 REGION: 2324131 . . . 2325315; encodes an acetoacetyl-CoA thiolase) codon-optimized for expression in Escherichia coli, the coding sequence of the ERG13 gene of Saccharomyces cerevisiae (GenBank accession number X96617, REGION: 220 . . . 1695; encodes a HMG-CoA synthase) codon-optimized for expression in Escherichia coli, and a truncated coding sequence of the HGM1 gene of Saccharomyces cerevisiae (GenBank accession number M22002, REGION: 1777 . . . 3285; encodes a truncated HMG-CoA reductase) codon-optimized for expression in Escherichia coli. The synthetically generated MevT66 operon was cloned into a cloning vector such as a standard pUC or pACYC origin vector, from which it was again PCR amplified with flanking SfiI and AsiSI restriction sites, the amplified DNA fragment was digested using SfiI and AsiSI restriction endonucleases, the approximately 4.2 kb DNA fragment comprising the MevT66 operon was gel purified, and the purified DNA fragment was inserted into the SfiI and AsiSI restriction sites of the pAM36 vector, yielding expression plasmid pAM36-MevT66.
[0202] Expression plasmid pMevB-Cm was generated by inserting the MevB operon into the pBBR1MCS-1 vector. The MevB operon encodes the set of enzymes that together convert (R)-mevalonate to IPP, namely mevalonate kinase, phosphomevalonate kinase, and mevalonate pyrophosphate carboxylase. The coding sequences of the ERG12 gene (GenBank accession number X55875, REGION: 580 . . . 1911; encodes a mevalonate kinase), the coding sequence of the ERG8 gene (GenBank accession number Z49939, REGION: 3363 . . . 4718; encodes a phosphomevalonate kinase), and the coding sequence of the MVD1 gene (GenBank accession number X97557, REGION: 544 . . . 1734; encodes a mevalonate pyrophosphate carboxylase) were PCR amplified from Saccharomyces cerevisiae genomic DNA. By choosing appropriate primer sequences, the stop codons of the ERG12 and ERG8 coding sequences were changed from TAA to TAG during PCR amplification to introduce ribosome binding sites. The PCR products were spliced together into the MevB operon by sequence overlap extension (SOE; Ho, et al, 1989). After the addition of 3' A overhangs, the MevB operon was ligated into the TA cloning vector pCR4 (Invitrogen, Carlsbad, Calif.). The MevB operon was excised again by digesting the cloning construct using PstI restriction endonuclease, the approximately 4.2 kb DNA fragment comprising the MevB operon was gel purified, and purified DNA fragment was ligated into the PstI restriction site of vector pBBR1MCS-1 (Kovach et al., Gene 166(1): 175-176 (1995)), yielding expression plasmid pMevB-Cm.
[0203] Expression plasmid pMBI was generated by inserting the MBI operon into the pBBR1MCS-3 vector. The MBI operon encodes the same enzymes as the MevB operon, as well as an isopentenyl pyrophosphatase isomerase that catalyzes the conversion of IPP to DMAPP. The MBI operon was generated by PCR amplifying from Escherichia coli genomic DNA the coding sequence of the idi gene (GenBank accession number AF119715) using primers that contained an XmaI restriction site at their 5' ends. The PCR product was digested using XmaI restriction endonuclease, the 0.5 kb DNA fragment comprising the idi coding sequence was gel purified, and the purified DNA fragment was inserted into the XmaI restriction site of expression plasmid pMevB-Cm, placing idi at the 3' end of the MevB operon. The MBI operon was then subcloned into the SalI and SacI restriction sites of vector pBBR1MCS-3 (Kovach et al., Gene 166(1): 175-176 (1995)), yielding expression plasmid pMBI.
[0204] Expression plasmid pMBIS was generated by inserting the ispA gene into expression plasmid pMBI. The ispA gene encodes a farnesyl pyrophosphate synthase that catalyzes the condensation of IPP and DMAPP to FPP. The coding sequence of the ispA gene (GenBank accession number D00694, REGION: 484.1383) was PCR amplified from Escherichia coli genomic DNA using a forward primer with a SacII restriction site and a reverse primer with a SacI restriction site. The amplified PCR product was digested using SacII and SacI restriction endonucleases, the 0.9 kb DNA fragment comprising the ispA coding sequence was gel purified, and the purified DNA fragment was ligated into the SacII and SacI restriction sites of pMBI, placing the ispA coding sequence 3' of idi and the MevB operon, and yielding expression plasmid pMBIS.
[0205] Expression plasmid pAM25 was generated by inserting the MevT66 operon into the pAM29 vector. The pAM29 vector was created by assembling the p15A origin of replication and kanamycin resistance conferring gene from the pZS24-MCS1 vector (Lutz and Bujard (1997) Nucl Acids Res. 25:1203-1210) with an oligonucleotide-generated lacUV5 promoter. The DNA synthesis construct comprising the MevT66 operon (see description for pAM36-MevT66 above) was digested using EcoRI and Hind III restriction endonucleases, the approximately 4.2 kb DNA fragment comprising the MevT66 operon was gel purified, and the purified DNA fragment was ligated into the EcoRI and HindIII restriction sites of pAM29, yielding expression plasmid pAM25.
[0206] Expression plasmid pAM41 was generated by replacing in expression plasmid pAM25 the truncated coding sequence of the HMG1 gene, which encodes a truncated version of the Saccharomyces cerevisiae HMG-CoA reductase, with the coding sequence of the mvaA gene, which encodes the Staphylococcus aureus HMG-CoA reductase (GenBank accession number BA000017, REGION: 2688925 . . . 2687648). The coding sequence of the mvaA gene was PCR amplified from Staphyloccoccus aureus subsp. aureus (ATCC 70069) genomic DNA using primers comprising SpeI restriction sites, the PCR product was digested using SpeI restriction endonuclease, and the approximately 1.3 kb DNA fragment comprising the mvaA coding sequence was gel purified. Expression plasmid pAM25 was digested using HindIII restriction endonuclease, terminal overhangs were blunted using T4 DNA polymerase, the linear vector backbone was partially digested using SpeI restriction endonuclease, and the approximately 4.8 kb DNA fragment lacking the truncated HMG1 coding sequence was gel purified. The purified DNA fragments were ligated, yielding expression plasmid pAM41.
[0207] Expression plasmid pAM43 was generated by inserting the MBIS operon into expression plasmid pAM36-MevT66. The MBIS operon was PCR amplified from pMBIS using primers comprising a 5' XhoI restriction site and a 3' Pad restriction site, the amplified PCR product was digested using XhoI and Pad restriction endonucleases, the approximately 5.4 kb DNA fragment comprising the MBIS operon was gel purified, and the purified DNA fragment was ligated into the XhoI Pad restriction site of expression plasmid pAM36-MevT66, yielding expression plasmid pAM43.
[0208] Expression plasmid pAM45 was generated by inserting lacUV5 promoters in front of the MBIS and MevT66 operons of expression plasmid pAM43. A DNA fragment comprising a nucleotide sequence encoding the lacUV5 promoter was synthesized from oligonucleotides, and inserted into the AscI SfiI and AsiSI XhoI restriction sites of pAM43, yielding expression plasmid pAM45.
[0209] Expression plasmid pAM52 was generated by replacing in expression plasmid pAM41 the coding sequence of the ERG13 gene, which encodes the Saccharomyces cerevisiae HMG-CoA synthase, with the coding sequence of the mvaS gene, which encodes the Staphylococcus aureus HMG-CoA synthase (GenBank accession number BA000017, REGION: 2689180 . . . 2690346). The coding sequence of the mvaS gene was PCR amplified from Staphyloccoccus aureus subsp. aureus (ATCC 70069) genomic DNA, and the amplified DNA fragment was used as a PCR primer to replace the coding sequence of the HMG1 gene in pAM41 according to the method of Geiser et al. (BioTechniques 31:88-92 (2001)), yielding expression plasmid pAM52.
[0210] Expression plasmid pAM97 was generated by replacing in expression plasmid pAM45 the MevT66 operon with the (atoB(opt):mvaS:mvaA) operon of expression plasmid pAM52. Expression plasmid pAM45 was digested using AsiSI and SfiI restriction endonucleases, and the approximately 8.3 kb DNA fragment lacking the MevT66 operon was gel purified. The (atoB(opt):mvaS:mvaA) operon of pAM52 was PCR amplified using primers comprising a SfiI and AsiSI restriction site, the PCR product was digested using SfiI and AsiSI restriction endonucleases, and the approximately 3.8 kb DNA fragment comprising the (atoB(opt):mvaS:mvaA) operon was gel purified. The purified DNA fragments were ligated, yielding expression plasmid pAM97.
[0211] Expression plasmid pAM765 was generated by replacing in expression plasmid pAM97 the coding sequence of the ERG12 gene, which encodes the Saccharomyces cerevisiae mevalonate kinase, with the coding sequence of the mvaK1 gene, which encodes the Staphylococcus aureus mevalonate kinase (GenBank accession number AAG02424). The Staphylococcus aureus mevalonate kinase is less sensitive to feedback inhibition by FPP (Voynova et al. (2004) J. Bacteriol. 186:61-67), and so expression plasmid pAM765 can cause greater production of FPP in a host cell than expression plasmid pAM97. The coding sequence of the mvaK1 gene was PCR amplified from an expression plasmid, and the approximately 0.9 kb PCR product was gel purified. The PMK-PMD-idi-ispA operon was PCR amplified from pAM97, and the approximately 4.1 kb PCR product was gel purified. The purified PCR products were stitched together, and the stitched product was gel purified. The purified stitched product and pAM97 were digested using XhoI and SacI restriction endonucleases, the digested DNA fragments were gel purified, and the purified DNA fragments were ligated, yielding expression plasmid pAM765 (SEQ ID NO: 1).
[0212] Plasmid pAM489 was generated by inserting the PGAL10-ERG20_PGAL1-tHMGR insert of vector pAM471 into vector pAM466. Vector pAM471 was generated by inserting DNA fragment PGAL10-ERG20_PGAL1-tHMGR, which comprises the coding sequence of the ERG20 gene of Saccharomyces cerevisiae (ERG20 nucleotide positions 1 to 1208; A of ATG start codon is nucleotide 1) (ERG20), the genomic locus containing the divergent GAL1 and GAL10 promoter of Saccharomyces cerevisiae (GAL1 nucleotide position -1 to -668) (PGAL), and a truncated coding sequence of the HMG1 gene of Saccharomyces cerevisiae (HMG1 nucleotide positions 1586 to 3323) (tHMGR), into the TOPO Zero Blunt II cloning vector (Invitrogen, Carlsbad, Calif.). Vector pAM466 was generated by inserting DNA fragment TRP1-856 to +548, which comprises a segment of the wild-type TRP1 locus of Saccharomyces cerevisiae that extends from nucleotide position -856 to position 548 and harbors a non-native internal XmaI restriction site between bases -226 and -225, into the TOPO TA pCR2.1 cloning vector (Invitrogen, q Carlsbad, Calif.). DNA fragments PGAL10-ERG20_PGAL1-tHMGR and TRP1-856 to +548 were generated by PCR amplification as outlined in Table 1. For the construction of pAM489, 400 ng of pAM471 and 100 ng of pAM466 were digested to completion using XmaI restriction enzyme (New England Biolabs, Ipswich, Mass.), DNA fragments corresponding to the PGAL10-ERG20_PGAL1-tHMGR insert and the linearized pAM466 vector were gel purified, and 4 molar equivalents of the purified insert was ligated with 1 molar equivalent of the purified linearized vector, yielding pAM489. FIG. 1R shows a map and SEQ ID NO: 2 the nucleotide sequence of the TRP1_PGAL10-ERG20_PGAL1-tHMGR_TRP insert of pAM489.
TABLE-US-00001 TABLE 1 PCR amplifications performed to generate pAM489 PCR Round Template Primer 1 Primer 2 PCR Product 1 100 ng of Y051 genomic 61-67-CPK001-G 61-67-CPK002-G TRP1-856 to -226 DNA (SEQ ID NO: 3) (SEQ ID NO: 4) 61-67-CPK003-G 61-67-CPK004-G TRP1-225-to +548 (SEQ ID NO: 5) (SEQ ID NO: 6) 100 ng of EG123 genomic 61-67-CPK025-G 61-67-CPK050-G ERG20 DNA (SEQ ID NO: 7) (SEQ ID NO: 8) 100 ng of Y002 genomic 61-67-CPK051-G 61-67-CPK052-G PGAL1/10 DNA (SEQ ID NO: 9) (SEQ ID NO: 10) 61-67-CPK053-G 61-67-CPK031-G tHMGR (SEQ ID NO: 11) (SEQ ID NO: 12) 2 100 ng each of TRP1-856 to -226 61-67-CPK001-G 61-67-CPK004-G TRP1-856 to +548 and TRP1-225-to +548 (SEQ ID NO: 3) (SEQ ID NO: 6) purified PCR products 100 ng each of ERG20 and 61-67-CPK025-G 61-67-CPK052-G ERG20-PGAL1/10 PGAL1/10 purified PCR (SEQ ID NO: 7) (SEQ ID NO: 10) products 3 100 ng each of ERG20- 61-67-CPK025-G 61-67-CPK031-G PGAL10-ERG20_PGAL1- PGAL1/10 and tHMGR (SEQ ID NO: 7) (SEQ ID NO: 12) tHMGR purified PCR products
[0213] Plasmid pAM491 was generated by inserting the PGAL10-ERG13_PGAL1-tHMGR insert of vector pAM472 into vector pAM467. Vector pAM472 was generated by inserting DNA fragment PGAL10-ERG13_PGAL1-tHMGR, which comprises the coding sequence of the ERG13 gene of Saccharomyces cerevisiae (ERG13 nucleotide positions 1 to 1626) (ERG13), the genomic locus containing the divergent GAL1 and GAL10 promoter of Saccharomyces cerevisiae (GAL1 nucleotide position -1 to -668) (PGAL), and a truncated ORF of the HMG1 gene of Saccharomyces cerevisiae (HMG1 nucleotide position 1586 to 3323) (tHMGR), into the TOPO Zero Blunt II cloning vector. Vector pAM467 was generated by inserting DNA fragment URA3-723 to 701, which comprises a segment of the wild-type URA3 locus of Saccharomyces cerevisiae that extends from nucleotide position -723 to position -224 and harbors a non-native internal XmaI restriction site between bases -224 and -223, into the TOPO TA pCR2.1 cloning vector. DNA fragments PGAL10-ERG13_PGAL1-tHMGR and URA3-723 to 701 were generated by PCR amplification as outlined in Table 2. For the construction of pAM491, 400 ng of pAM472 and 100 ng of pAM467 were digested to completion using XmaI restriction enzyme, DNA fragments corresponding to the ERG13-PGAL-tHMGR insert and the linearized pAM467 vector were gel purified, and 4 molar equivalents of the purified insert was ligated with 1 molar equivalent of the purified linearized vector, yielding pAM491. FIG. 1S shows a map and SEQ ID NO: 13 the nucleotide sequence of the URA3_PGAL10-ERG13_PGAL1-tHMGR_URA3 insert of pAM491.
TABLE-US-00002 TABLE 2 PCR amplifications performed to generate pAM491 PCR Round Template Primer 1 Primer 2 PCR Product 1 100 ng of Y007 genomic DNA 61-67-CPK005-G 61-67-CPK006-G URA3-723 to -224 (SEQ ID NO: 14) (SEQ ID NO: 15) 61-67-CPK007-G 61-67-CPK008-G URA3-223 to 701 (SEQ ID NO: 16) (SEQ ID NO: 17) 100 ng of Y002 genomic DNA 61-67-CPK032-G 61-67-CPK054-G ERG13 (SEQ ID NO: 18) (SEQ ID NO: 19) 61-67-CPK052-G 61-67-CPK055-G PGAL1/10 (SEQ ID NO: 20) (SEQ ID NO: 21) 61-67-CPK031-G 61-67-CPK053-G tHMGR (SEQ ID NO: 22) (SEQ ID NO: 23) 2 100 ng each of URA3-723 to -224 and 61-67-CPK005-G 61-67-CPK008-G URA3-723 to 701 URA3-223 to 701 purified PCR (SEQ ID NO: 14) (SEQ ID NO: 17) products 100 ng each of ERG13 and 61-67-CPK032-G 61-67-CPK052-G ERG13-PGAL1/10 PGAL1/10 purified PCR products (SEQ ID NO: 18) (SEQ ID NO: 20) 3 100 ng each of ERG13-PGAL1/10 61-67-CPK031-G 61-67-CPK032-G PGAL10- and tHMGR purified PCR (SEQ ID NO: 22) (SEQ ID NO: 18) ERG13_PGAL1- products tHMGR
[0214] Plasmid pAM493 was generated by inserting the PGAL10-IDI1_PGAL1-tHMGR insert of vector pAM473 into vector pAM468. Vector pAM473 was generated by inserting DNA fragment PGAL10-IDI1_PGAL1-tHMGR, which comprises the coding sequence of the IDI1 gene of Saccharomyces cerevisiae (IDI1 nucleotide position 1 to 1017) (IDI1), the genomic locus containing the divergent GAL1 and GAL10 promoter of Saccharomyces cerevisiae (GAL1 nucleotide position -1 to -668) (PGAL), and a truncated ORF of the HMG1 gene of Saccharomyces cerevisiae (HMG1 nucleotide positions 1586 to 3323) (tHMGR), into the TOPO Zero Blunt II cloning vector. Vector pAM468 was generated by inserting DNA fragment ADE1-825 to 653, which comprises a segment of the wild-type ADE1 locus of Saccharomyces cerevisiae that extends from nucleotide position -225 to position 653 and harbors a non-native internal XmaI restriction site between bases -226 and -225, into the TOPO TA pCR2.1 cloning vector. DNA fragments PGAL10-IDI1_PGAL1-tHMGR and ADE1-825 to 653 were generated by PCR amplification as outlined in Table 3. For the construction of pAM493, 400 ng of pAM473 and 100 ng of pAM468 were digested to completion using XmaI restriction enzyme, DNA fragments corresponding to the PGAL10-IDI1_PGAL1-tHMGR insert and the linearized pAM468 vector were gel purified, and 4 molar equivalents of the purified insert was ligated with 1 molar equivalent of the purified linearized vector, yielding vector pAM493. FIG. 1T shows a map and SEQ ID NO: 24 the nucleotide sequence of the ADE1_PGAL10-IDI1_PGAL1-tHMGR_ADE1 insert of pAM493.
TABLE-US-00003 TABLE 3 PCR amplifications performed to generate pAM493 PCR Round Template Primer 1 Primer 2 PCR Product 1 100 ng of Y007 genomic DNA 61-67-CPK009-G 61-67-CPK010-G ADE1-825 to -226 (SEQ ID NO: 25) (SEQ ID NO: 26) 61-67-CPK011-G 61-67-CPK012-G ADE1-225 to 653 (SEQ ID NO: 27) (SEQ ID NO: 28) 100 ng of Y002 genomic DNA 61-67-CPK047-G 61-67-CPK064-G IDI1 (SEQ ID NO: 29) (SEQ ID NO: 30) 61-67-CPK052-G 61-67-CPK065-G PGAL1/10 (SEQ ID NO: 31) (SEQ ID NO: 32) 61-67-CPK031-G 61-67-CPK053-G tHMGR (SEQ ID NO: 12) (SEQ ID NO: 33) 2 100 ng each of ADE1-825 to -226 and 61-67-CPK009-G 61-67-CPK012-G ADE1-825 to 653 ADE1-225 to 653 purified PCR products (SEQ ID NO: 25) (SEQ ID NO: 28) 100 ng each of IDI1 and PGAL1/10 61-67-CPK047-G 61-67-CPK052-G IDI1-PGAL1/10 purified PCR products (SEQ ID NO: 29) (SEQ ID NO: 31) 3 100 ng each of IDI1-PGAL1/10 and 61-67-CPK031-G 61-67-CPK047-G PGAL10- tHMGR purified PCR products (SEQ ID NO: 12) (SEQ ID NO: 29) IDI1_PGAL1- tHMGR
[0215] Plasmid pAM495 was generated by inserting the PGAL10-ERG10 PGAL1-ERG12 insert of pAM474 into vector pAM469. Vector pAM474 was generated by inserting DNA fragment PGAL10-ERG10_PGAL1-ERG12, which comprises the coding sequence of the ERG10 gene of Saccharomyces cerevisiae (ERG10 nucleotide position 1 to 1347) (ERG10), the genomic locus containing the divergent GAL1 and GAL10 promoter of Saccharomyces cerevisiae (GAL1 nucleotide position -1 to -668) (PGAL), and the coding sequence of the ERG12 gene of Saccharomyces cerevisiae (ERG12 nucleotide position 1 to 1482) (ERG12), into the TOPO Zero Blunt II cloning vector. Vector pAM469 was generated by inserting DNA fragment HIS3-32 to -1000_HISMX_HIS3504 to -1103, which comprises two segments of the HIS locus of Saccharomyces cerevisiae that extend from nucleotide position -32 to position -1000 and from nucleotide position 504 to position 1103, a HISMX marker, and a non-native XmaI restriction site between the HIS3504 to -1103 sequence and the HISMX marker, into the TOPO TA pCR2.1 cloning vector. DNA fragments PGAL10-ERG10_PGAL1-ERG12 and HIS3-32 to -1000_HISMX_HIS3504 to -1103 were generated by PCR amplification as outlined in Table 4. For construction of pAM495, 400 ng of pAM474 and 100 ng of pAM469 were digested to completion using XmaI restriction enzyme, DNA fragments corresponding to the PGAL10-ERG10_PGAL1-ERG12 insert and the linearized pAM469 vector were gel purified, and 4 molar equivalents of the purified insert was ligated with 1 molar equivalent of the purified linearized vector, yielding vector pAM495. FIG. 1D shows a map and SEQ ID NO: 34 the nucleotide sequence of the HIS3_PGAL10-ERG10 PGAL1-ERG12_HIS3 insert of pAM495.
TABLE-US-00004 TABLE 4 PCR reactions performed to generate pAM495 PCR Round Template Primer 1 Primer 2 PCR Product 1 100 ng of Y007 genomic 61-67-CPK013-G 61-67-CPK014alt-G HIS3-32 to -1000 DNA (SEQ ID NO: 35) (SEQ ID NO: 36) 61-67-CPK017-G 61-67-CPK018-G HIS3504 to -1103 (SEQ ID NO: 37) (SEQ ID NO: 38) 61-67-CPK035-G 61-67-CPK056-G ERG10 (SEQ ID NO: 39) (SEQ ID NO: 40) 61-67-CPK057-G 61-67-CPK058-G PGAL (SEQ ID NO: 41) (SEQ ID NO: 42) 61-67-CPK040-G 61-67-CPK059-G ERG12 (SEQ ID NO: 43) (SEQ ID NO: 44) 10 ng of plasmid pAM330 61-67-CPK015a1t-G 61-67-CPK016-G HISMX DNA** (SEQ ID NO: 45) (SEQ ID NO: 46) 2 100 ng each of HIS3504 to -1103 61-67-CPK015alt-G 61-67-CPK018-G HISMX_HIS3504 to -1103 and HISMX PCR purified (SEQ ID NO: 45) (SEQ ID NO: 38) products 100 ng each of ERG10 and 61-67-CPK035-G 61-67-CPK058-G ERG10-PGAL1/10 PGAL purified PCR products (SEQ ID NO: 39) (SEQ ID NO: 42) 3 100 ng each of HIS3-32 to -1000 61-67-CPK013-G 61-67-CPK018-G HIS3-32 to -1000_HISMX_HIS3504 to -1103 and HISMX_HIS3504 to -1103 (SEQ ID NO: 35) (SEQ ID NO: 38) purified PCR products 100 ng each of ERG10- 61-67-CPK035-G 61-67-CPK040-G PGAL10- PGAL1/10 and ERG12 purified (SEQ ID NO: 39) (SEQ ID NO: 43) ERG10_PGAL1- PCR products ERG12 **The HISMX marker in pAM330 originated from pFA6a-HISMX6-PGAL1 as described by van Dijken et al. ((2000) Enzyme Microb. Technol. 26(9-10): 706-714).
[0216] Plasmid pAM497 was generated by inserting the PGAL10-ERG8_PGAL1-ERG19 insert of pAM475 into vector pAM470. Vector pAM475 was generated by inserting DNA fragment PGAL10-ERG8_PGAL1-ERG19, which comprises the coding sequence of the ERG8 gene of Saccharomyces cerevisiae (ERG8 nucleotide position 1 to 1512) (ERG8), the genomic locus containing the divergent GAL1 and GAL10 promoter of Saccharomyces cerevisiae (GAL1 nucleotide position -1 to -668) (PGAL), and the coding sequence of the ERG19 gene of Saccharomyces cerevisiae (ERG19 nucleotide position 1 to 1341) (ERG19), into the TOPO Zero Blunt II cloning vector. Vector pAM470 was generated by inserting DNA fragment LEU2-100 to 450_HISMX_LEU21096 to 1770, which comprises two segments of the LEU2 locus of Saccharomyces cerevisiae that extend from nucleotide position -100 to position 450 and from nucleotide position 1096 to position 1770, a HISMX marker, and a non-native XmaI restriction site between the LEU21096 to 1770 sequence and the HISMX marker, into the TOPO TA pCR2.1 cloning vector. DNA fragments PGAL10-ERG8_PGAL1-ERG19 and LEU2-100 to 450_HISMX_LEU21096 to 1770 were generated by PCR amplification as outlined in Table 5. For the construction of pAM497, 400 ng of pAM475 and 100 ng of pAM470 were digested to completion using XmaI restriction enzyme, DNA fragments corresponding to the ERG8-PGAL-ERG19 insert and the linearized pAM470 vector were purified, and 4 molar equivalents of the purified insert was ligated with 1 molar equivalent of the purified linearized vector, yielding vector pAM497. FIG. 1V for a map and SEQ ID NO: 47 the nucleotide sequence of the LEU2 PGAL10-ERG8_PGAL1-ERG19_LEU2 insert of pAM497.
TABLE-US-00005 TABLE 5 PCR reactions performed to generate pAM497 PCR Round Template Primer 1 Primer 2 PCR Product 1 100 ng of Y007 genomic DNA 61-67-CPK019-G 61-67-CPK020-G LEU2-100 to 450 (SEQ ID NO: 48) (SEQ ID NO: 49) 61-67-CPK023-G 61-67-CPK024-G LEU21096 to 1770 (SEQ ID NO: 50) (SEQ ID NO: 51) 10 ng of plasmid pAM330 DNA** 61-67-CPK021-G 61-67-CPK022-G HISMX (SEQ ID NO: 52) (SEQ ID NO: 53) 100 ng of Y002 genomic DNA 61-67-CPK041-G 61-67-CPK060-G ERG8 (SEQ ID NO: 54) (SEQ ID NO: 55) 61-67-CPK061-G 61-67-CPK062-G PGAL (SEQ ID NO: 56) (SEQ ID NO: 57) 61-67-CPK046-G 61-67-CPK063-G ERG19 (SEQ ID NO: 58) (SEQ ID NO: 59) 2 100 ng each of LEU21096 to 1770 and 61-67-CPK021-G 61-67-CPK024-G HISMX_LEU21096 to 1770 HISMX purified PCR products (SEQ ID NO: 52) (SEQ ID NO: 51) 100 ng each of ERG8 and PGAL 61-67-CPK041-G 61-67-CPK062-G ERG8-PGAL purified PCR products (SEQ ID NO: 54) (SEQ ID NO: 57) 3 100 ng of LEU2-100 to 450 and 61-67-CPK019-G 61-67-CPK024-G LEU2-100 to 450_HISMX_LEU21096 to 1770 HISMX-LEU21096 to 1770 purified (SEQ ID NO: 48) (SEQ ID NO: 51) PCR products 100 ng each of ERG8-PGAL and 61-67-CPK041-G 61-67-CPK046-G PGAL10-ERG8_PGAL1- ERG19 purified PCR products (SEQ ID NO: 54) (SEQ ID NO: 58) ERG19 **The HISMX marker in pAM330 originated from pFA6a-HISMX6-PGAL1 as described by van Dijken et al. ((2000) Enzyme Microb. Technol. 26(9-10): 706-714).
[0217] Vector pAM1419 was generated by removing from vector pTrc99A (Amman et al., Gene 40:183-190 (1985)) two NcoI restriction sites. The NcoI restriction site in the multiple cloning site of vector pTrc99A was first changed to a NdeI restriction site using the Quikchange Multi Site-Directed Mutagenesis Kit (Stratagene Cloning Systems, La Jolla, Calif.) according to manufacturer recommended protocols. A second NdeI restriction site outside of the multiple cloning site at position 2699 of vector pTrc99A was then also removed using the Quikchange Multi Site-Directed Mutagenesis Kit, yielding vector pAM1419 (SEQ ID NO: 60).
[0218] Expression plasmid pAM1421 (FIG. 13A) were generated by inserting into vector pAM1419 the FS_S2D-Ec coding sequence. Vector pAM1419 was digested using BamHI and NdeI restriction endonucleases, the approximately 4.15 kb linearized vector backbone was gel purified, and the purified DNA fragment was digested with Calf Intestinal Alkaline Phosphatse (CIP) to remove 5' phosphate groups. The b-farnesene synthase gene of Artemisia annua (GenBank accession number AY835398; Picaud, et al, 2005) comprising an amino acid substitution at position 2 from serine to aspartate (S2D) and codon-optimized for expression in Escherichia coli (FS_S2D_Ec coding sequence; SEQ ID NO: 61) with flanking BamHI and NdeI restriction sites was PCR amplified from other expression plasmids, the PCR product was digested using BamHI and NdeI restriction endonucleases, and then gel purified. Purified linearized vector and digested PCR product were ligated using T4 DNA ligase, yielding expression plasmid pAM1421.
[0219] Expression plasmid pAM353 was generated by inserting into the pRS425-Gall vector (Mumberg et. al. (1994) Nucl. Acids. Res. 22(25): 5767-5768) the coding sequence of the β-farnesene synthase gene of Artemisia annua (GenBank accession number AY835398) codon-optimized for expression in Saccharomyces cerevisiae (FS_Aa_Sc coding sequence; SEQ ID NO: 68). The FS_Aa_Sc coding sequence was generated synthetically and was flanked by 5' BamHI and 3' XhoI restriction sites such that it could be cloned into compatible restriction sites of a cloning vector such as a standard pUC or pACYC origin vector. The FS_Aa_Sc coding sequence was excised again by digesting the construct using BamHI and XhoI restriction endonucleases, the approximately 1.7 kb DNA fragment comprising the FS_Aa_Sc coding sequence was gel purified, and the purified DNA fragment was ligated into the BamHI XhoI restriction site of the pRS425-Gall vector, yielding expression plasmid pAM353.
[0220] Expression plasmid pAM404 (FIG. 13B) was generated by inserting into vector pAM178 (SEQ ID NO: 69) the FS_Aa_Sc coding sequence. Vector pAM178 was digested using BamHI and NheI restriction endonucleases, and the approximately 7.3 kb vector backbone was gel purified. The FS_Aa_Sc coding sequence with flanking BamHI and NheI restriction sites was PCR amplified from pAM353, the PCR product was digested using BamHI and NheI restriction endonucleases, and the approximately 1.7 kb DNA fragment comprising the FS_Aa_Sc coding sequence was gel purified. The two gel purified DNA fragments were ligated, yielding expression plasmid pAM404.
[0221] The expression plasmids shown in Table 6 and FIG. 13B were generated by replacing in expression plasmid pAM404 the FS_Aa_Sc coding sequence with the indicated coding sequences. Vector pAM404 was digested using BamHI and NheI restriction endonucleases, and the approximately 7.3 kb linearized vector backbone lacking the FS_Aa_Sc coding sequence was gel purified. The FS_S2D_Ec coding sequence was PCR amplified from another expression plasmid using primers that overlap with terminal sequences of the linearized pAM404 vector backbone. The IS_Pn_Sc and TDS_Pn_Sc coding sequence were extracted by restriction endonuclease digestion from other expression vectors. The DNA fragments were gel purified. The FS_S2D_Ec coding sequence was inserted into the purified linearized vector via homologous recombination by transforming strainY539 and selecting host cell transformants on Complete Synthetic Medium (CSM) lacking leucine (CSM-L) with 2% glucose as a sole carbon source. The IS_Pn_Sc and TDS_Fs_Sc coding sequences were ligated into the purified linearized vector using T4 DNA ligase.
TABLE-US-00006 TABLE 6 Construction of pAM404-derived expression plasmids Size of Coding Expression Sequence Plasmid Coding Sequence (bp) pAM1765 FS_S2D_Ec (SEQ ID NO: 61) 1.7 pAM1795 TDS_Fs_Sc (SEQ ID NO: 70) 1.1 pAM1549 IS_Pn_Sc (SEQ ID NO: 71) 1.8 FS_S2D_Ec = β-farnesene synthase gene of Artemisia annua (GenBank accession number AY835398; Picaud, et al, 2005) comprising an amino acid substitution at position 2 from serine to aspartate (S2D) and codon-optimized for expression in Escherichia coli TDS_Fs_Sc = coding sequence of the trichodiene synthase gene of Fusarium sporotrichioides (GenBank accession number AF364179; Holn, et al, 1989) codon-optimized for expression in Saccharomyces cerevisiae IS_Pn_Sc = isoprene synthase gene of Populus nigra (GenBank accession number AM410988; Fortunati, et al, 2008) codon-optimized for expression in Saccharomyces cerevisiae
[0222] Expression plasmid pAM1812 (SEQ ID NO: 72; FIG. 13C) was generated by inserting into expression plasmid pAM404 the TDS_Fs_Sc coding sequence. Expression plasmid pAM404 was digested using NotI restriction endonuclease, and the approximately 9.0 kb linearized plasmid was gel purified. The TDS_Fs_Sc coding sequence was PCR amplified from expression plasmid pAM1795 using primers that overlap with terminal sequences of the linearized pAM404, and the 1.2 kb PCR product comprising the TDS_Fs_Sc coding sequence was gel purified. The two gel purified DNA fragments were ligated via homologous recombination by transforming strain Y539 with both purified DNA fragments and selecting host cell transformants on CSM-L with 2% glucose as a sole carbon source.
[0223] The expression plasmids shown in Table 7 and FIG. 13C were generated by replacing in expression plasmid pAM1812 the FS_Aa_Sc coding sequence with the indicated coding sequences. Expression plasmid pAM1812 was digested using BamHI and NheI restriction endonucleases, and the approximately 7.2 kb linear plasmid lacking the FS_Aa_Sc coding sequence was gel purified. The coding sequences were extracted by BamHI and NheI restriction endonuclease digestion from other expression vectors, and the DNA fragment comprising the coding sequence were gel purified. The purified DNA fragments were finally ligated using T4 DNA ligase, yielding the expression plasmids.
TABLE-US-00007 TABLE 7 Construction of pAM1812-derived expression plasmids Size of Coding Expression Sequence Plasmid Coding Sequence (kb) pAM1895 FS_S2D_Ec (SEQ ID NO: 61) 1.7 pAM1896 FS_Ad_Sc (SEQ ID NO: 73) 2.3 pAM1948 IS_Pn_Sc (SEQ ID NO: 71) 1.8 FS_S2D_Ec = β-farnesene synthase gene of Artemisia annua (GenBank accession number AY835398) comprising an amino acid substitution at position 2 from serine to aspartate (S2D) and codon-optimized for expression in Escherichia coli FS_Ad_Sc = α-farnesene synthase of Actinidia deliciosa (GenBank Accession No. FJ265785; Nieuwenhuizen, et al, 2009) codon-optimized for expression in Saccharomyces cerevisiae IS_Pn_Sc = isoprene synthase of Populus nigra (Accession No. AM410988; Fortunati, et al, 2008) codon-optimized for expression in Saccharomyces cerevisiae
[0224] Expression plasmid pAM1813 (FIG. 13D) was generated by inserting into expression plasmid pAM1795 the coding sequence of the FS_Aa_Sc coding sequence. Expression plasmid pAM1795 was digested using NotI restriction endonuclease, and the approximately 8.4 kb linearized plasmid was gel purified. The FS_Aa_Sc coding sequences was PCR amplified using primers that overlap with terminal sequences of the linearized pAM404, and the PCR product comprising the FS_Aa_Sc coding sequences was gel purified. The purified PCR product was ligated via homologous recombination by transforming it into strain Y539 and selecting host cell transformants on CSM-L with 2% glucose as a sole carbon source. Note that pAM1812 and pAM1813 are identical except that the promoters for TDS and FS are switched. Using promoters of different strengths allows variation of the farnesene/trichodiene ratios.
[0225] Expression plasmid pAM1653 was generated by inserting into vector pRS415 the IS_Pn_Sc coding sequence. Expression plasmid pAM1549 was digested using SapI restriction endonuclease, was treated with Klenow fragment to generated blunt ends, and digested again using NotI restriction endonuclease, and the 2.8 kb DNA fragment comprising the IS_Pn_Sc coding sequence and PGAL sequence was gel purified. Vector pRS415 was digested using NotI and AleI restriction endonucleases, and the 6.0 kb linearized vector backbone was gel purified. The two purified DNA fragments were ligated, yielding expression plasmid pAM1653.
[0226] Expression plasmid pAM1734 was generated by eliminating certain restriction sites from the multicloning region of expression plasmid pAM1653. Expression plasmid pAM1653 was digested using XbaI and HindIII restriction endonucleases, treated with Klenow fragment to generate blunt ends, and finally self-ligated, yielding expression plasmid pAM1734.
[0227] Expression plasmid pAM1764 (SEQ ID NO: 74) was generated by inserting into expression plasmid pAM1734 the FS_S2D_Ec coding sequence. Expression vector pAM1734 was digested using BamHI and NheI restriction endonucleases, and the approximately 6.9 kb linearized plasmid was gel purified. The FS_S2D_Ec coding sequence was PCR amplified from expression plasmid pAM1421 using primers that overlap with terminal sequences of the linearized pAM1734, and the 1.7 kb PCR product comprising the FS_S2D-Sc coding sequence was gel purified. The two purified DNA fragments were ligated via homologous recombination by transforming strain Y539 with both purified DNA fragments and selecting host cell transformants on CSM-L with 2% glucose as a sole carbon source.
[0228] Expression plasmid pAM1668 was generated by deleting from expression plasmid pAM1419 the lad gene. Expression plasmid pAM1419 was digested using EcoRV and SapI restriction endonucleases, the digested plasmid was repaired using the End-It DNA End-Repair Kit (Epicentre, Madison, Wis.) according to manufacturer recommended protocols, and the end-repaired vector was self-ligated, yielding vector pAM1668.
[0229] The expression plasmids shown in Table 8 and FIG. 13E were generated by inserting into vector pAM1668 the indicated coding sequences. Vector pAM1668 was digested using BamHI and NdeI restriction endonucleases, and the approximately 2.9 kb linearized vector backbone was gel purified. The coding sequences were PCR amplified using primers that overlap with terminal sequences of the linearized pAM1668, the PCR products were digested using BamHI and NdeI restriction endonucleases, and the digested PCR products comprising the coding sequences were gel purified. Purified linearized vector and digested PCR products were finally ligated, yielding the expression plasmids.
TABLE-US-00008 TABLE 8 Construction of pAM1688-derived expression plasmids Size of Coding Expression Sequence Plasmid Coding Sequence (bp) pAM1670 FS_S2D_Ec (SEQ ID NO: 61) 1725 pAM2158 FS_S2D_Sc (SEQ ID NO: 76) 1725 pAM2157 FS_Aa_Ec (SEQ ID NO: 62) 1725 pAM2117 FS_Aa_Sc (SEQ ID NO: 68) 1740 pAM2096 FS_Cj_Ec (SEQ ID NO: 63) 1686 pAM2097 FS_Cs_Ec (SEQ ID NO: 66) 1686 pAM2098 FS_Pt_Ec (SEQ ID NO: 67) 1725 pAM2101 PS_S_Ec (SEQ ID NO: 64) 1014 pAM2104 TDS_Fs_Ec (SEQ ID NO: 65) 1125 FS_S2D_Ec = β-farnesene synthase gene of Artemisia annua (GenBank accession number AY835398) comprising an amino acid substitution at position 2 from serine to aspartate (S2D) and codon-optimized for expression in Escherichia coli FS_S2D_Sc = β-farnesene synthase gene of Artemisia annua (GenBank accession number AY835398) comprising an amino acid substitution at position 2 from serine to aspartate (S2D) and codon-optimized for expression in Saccharomyces cerevisiae FS_Aa_Sc = β-farnesene synthase gene of Artemisia annua (GenBank accession number AY835398) codon-optimized for expression in Saccharomyces cerevisiae FS_Aa_Ec = β-farnesene synthase gene of Artemisia annua (GenBank accession number AY835398) codon-optimized for expression in Escherichia coli FS_Cj_Ec = β-farnesene synthase of Citrus junos (GenBank Accession No. AAK54279; Maruyama, et al, 2001) codon-optimized for expression in Escherichia coli FS_Cs_Ec = α-farnesene synthase of Cucumis sativus (GenBank Accession No. AAU05951; Mercke, et al, 2004) codon-optimized for expression in Escherichia coli FS_Pt_Ec = α-farnesene synthase of Pinus taeda (GenBank Accession No. AAO61226; Phillips, et al, 2003) codon-optimized for expression in Escherichia coli PS_S_Ec = pentalenene synthase of Streptomyces sp. (GenBank Accession No. AAA19131; Cane, et al, 1994) codon-optimized for expression in Escherichia coli TDS_Fs_Ec = trichodiene synthase of Fusarium sporotrichioides (GenBank accession number AF364179; Holn, et al, 1989) codon-optimized for expression in Escherichia coli
[0230] Construct A was generated by PCR amplification as described in Table 9. The construct comprises the upstream region of the NDT80 gene of Saccharomyces cerevisiae (NDT80 nucleotide positions -175 to -952), the LEU2 marker of Saccharomyces cerevisiae (LEU2 nucleotide positions -661 to +1541), the promoter of the GAL1 gene of Saccharomyces cerevisiae (GAL1 nucleotide positions -1 to -667), the FS_Aa_Sc coding sequence, the terminator of the CYC1 gene of Saccharomyces cerevisiae (CYC1 nucleotide positions +331 to +521), and the downstream region of the NDT80 gene of Saccharomyces cerevisiae (NDT80 nucleotide positions +1685 to +2471). FIG. 1W shows a map and SEQ ID NO: 86 the nucleotide sequence of Construct A.
TABLE-US-00009 TABLE 9 PCR reactions performed to generate Construct A PCR Round Template Primer 1 Primer 2 PCR Product 1 100 ng of Y002 PW-091-144-CPK640 AM-288-90-CPK1615 NDT80-175 to -952 genomic DNA (SEQ ID NO: 77) (SEQ ID NO: 78) AM-288-90-CPK1620 PW-091-144-CPK649 NDT80+1685 to +2471 (SEQ ID NO: 79) (SEQ ID NO: 80) AM-288-90-CPK1616 AM-288-90-CPK1638 GAL1-1 to -667 (SEQ ID NO: 81) (SEQ ID NO: 82) 10 ng of plasmid AM-288-90-CPK1618 AM-288-90-CPK1619 FS_Aa_Sc pAM404 (SEQ ID NO: 83) (SEQ ID NO: 84) AM-288-90-CPK1639 AM-288-90-CPK1621 CYC1+331 to +521 (SEQ ID NO: 85) (SEQ ID NO: 75) 10 ng of plasmid AM-288-90-CPK1614 AM-288-90-CPK1617 LEU2-661 to +1541 pRS415 (Sikorski, et al, (SEQ ID NO: 87) (SEQ ID NO: 88) 1989) 2 25 ng of CYC1+331 to +521 PW-091-144-CPK640 PW-091-144-CPK649 Construct A and equimolar amounts (SEQ ID NO: 77) (SEQ ID NO: 80) of each of NDT80-175 to -952, LEU2-661 to +1541, GAL1-1 to -667, FS_Aa_Sc, and NDT80+1685 to +2471 gel purified PCR products PCR amplifications were done using the Phusion High Fidelity DNA Polymerase System (Finnzyme, Inc., Espoo, Finland). PCR products were gel purified using the E.Z.N.A. ® Gel Extraction Kit (Omega Bio-Tek Inc., Norcross, GA) according to manufacturer's suggested protocols.
[0231] Construct B (FIG. 1X) was generated by PCR amplification. The construct comprises the upstream region of the NDT80 gene of Saccharomyces cerevisiae (NDT80 nucleotide positions -175 to -952), the LEU2 marker of Saccharomyces cerevisiae (LEU2 nucleotide positions -661 to +1541), the promoter of the GAL1 gene of Saccharomyces cerevisiae (GAL1 nucleotide positions -1 to -667), the HISG marker, the terminator of the CYC1 gene of Saccharomyces cerevisiae (CYC1 nucleotide positions +331 to +521), and the downstream region of the NDT80 gene of Saccharomyces cerevisiae (NDT80 nucleotide positions +1685 to +2471).
[0232] Construct D was generated by PCR amplification as described in Table 10. The construct comprises the FS_A--5.3 coding sequence flanked by the promoter of the GAL1 gene of Saccharomyces cerevisiae (PGAL1; GAL1 nucleotide positions -1 to -455) and the terminator of the PGK1 gene of Saccharomyces cerevisiae (TPGK1; PGK1 nucleotide positions +1159 to +1547), and the TDS_Fs_Sc coding sequence flanked by the promoter of the GAL10 gene of Saccharomyces cerevisiae (PGAL10; GAL10 nucleotide positions -1 to -202) and the terminator of the ADH1 gene of Saccharomyces cerevisiae (TADH1; ADH1 nucleotide positions -1 to -166). FIG. 1Z shows a map and SEQ ID NO: 116 the nucleotide sequence of Construct D.
TABLE-US-00010 TABLE 10 PCR reactions performed to generate Construct D PCR Round Template Primer 1 Primer 2 PCR Product 1 100 ng of Y002 AM-288-160- AM-288-160-CPK2041 TPGK1 genomic DNA CPK2039 (SEQ ID NO: 125) (SEQ ID NO: 123) 10 ng of a plasmid AM-288-160- AM-288-110-CPK1903 FS_A_5.3 comprising the CPK2040 (SEQ ID NO: 122) FS_A_5.3 coding (SEQ ID NO: 124) sequences 10 ng of plasmid AM-288-160- AM-288-160-CPK2046 PGAL10_TDS_TADH1 pAM1948 CPK2045 (SEQ ID NO: 130) (SEQ ID NO: 129) 10 ng of plasmid AM-288-160- AM-288-160-CPK2044 spacer comprising spacer CPK2042 (SEQ ID NO: 128) (SEQ ID NO: 126) 10 ng of plasmid AM-288-110- AM-288-160-CPK2043 PGAL1 pAM404 CPK1849 (SEQ ID NO: 127) (SEQ ID NO: 121) 2 25 ng of spacer and AM-288-160- AM-288-160-CPK2046 Construct D equimolar amounts of CPK2039 (SEQ ID NO: 130) each of PGAL1, (SEQ ID NO: 123) FSA_A_5.3, TPGK1, and PGAL10_TDS_TADH1 gel purified PCR products PCR amplifications were done using the Phusion High Fidelity DNA Polymerase System (Finnzyme, Inc., Espoo, Finland). PCR products were gel purified using the E.Z.N.A. ® Gel Extraction Kit (Omega Bio-Tek Inc., Norcross, GA) according to manufacturer's suggested protocols.
[0233] Expression plasmid pAM2191 was created by in transforming exponentially growing Y 3198 cells with 100 ng of vector pAM552 (SEQ ID NO: 156) digested using FastDigest® BstZ17I restriction enzyme (Fisher Scientific Worldwide, Hampton, N.H.) and 300 ng of Construct D. Host cell transformants were plated on CSM-L agar plates with 2% glucose as a sole carbon source, and the plates were incubated for 3 days at 30° C. until individual colonies were ˜1 mm in diameter. DNA was harvested from these colonies using the Zymoprep® Yeast Plasmid Miniprep Kit II (Zymo Research Corporation, Orange, Calif.), and the harvested DNA was transformed into the chemically competent XL1Blue Escherichia coli (Agilent Technologies Inc., Santa Clara, Calif.). Host cell transformants were plated to Lysogeny broth agar media supplemented with carbenicillin, and incubated for 24 hours at 37° C. until individual colonies were visible. Plasmid DNA was harvested from these colonies using the QIAprep Spin Miniprep Kit (QIAGEN Inc, Valencia, Calif.), and the plasmid DNA was sequenced to confirm correct creation of expression plasmid pAM2191.
Example 2
[0234] This example describes methods for making yeast strains useful in the generation and characterization of terpene synthases variants.
[0235] Strains Y93 (MAT A) and Y94 (MAT alpha) were generated by replacing the promoter of the ERG9 gene of yeast strains Y002 and Y003 (CEN.PK2 background MAT A or MAT alpha, respectively; ura3-52; trp1-289; leu2-3,112; his3Δ1; MAL2-8C; SUC2; van Dijken et al. (2000) Enzyme Microb. Technol. 26:706-714), respectively, with the promoter of the MET3 gene of Saccharomyces cerevisia. To this end, exponentially growing Y002 and Y003 cells were transformed with integration construct i8 (SEQ ID NO: 87), which comprised the kanamycin resistance marker (KanMX) flanked by the promoter and terminator of the Tef1 gene of Kluyveromyces lactis, the ERG9 coding sequence, a truncated segment of the ERG9 promoter (trune. PERG9), and the MET3 promoter (PMET3), flanked by ERG9 upstream and downstream sequences (FIG. 1A). Host cell transformants were selected on medium comprising 0.5 ug/mL Geneticin (Invitrogen Corp., Carlsbad, Calif.), and selected clones were confirmed by diagnostic PCR, yielding strains Y93 and Y94.
[0236] Strains Y176 (MAT A) and Y177 (MAT alpha) were generated by replacing the coding sequence of the ADE1 gene in strains Y93 and Y94, respectively, with the coding sequence of the LEU2 gene of Candida glabrata (CgLEU2). To this end, the 3.5 kb CgLEU2 genomic locus was PCR amplified from Candida glabrata genomic DNA (ATCC, Manassas, Va.) using primers 61-67-CPK066-G (SEQ ID NO: 88) and 61-67-CPK067-G (SEQ ID NO: 89), and transforming the PCR product into exponentially growing Y93 and Y94 cells. Host cell transformants were selected on CSM-L, and selected clones were confirmed by diagnostic PCR, yielding strains Y176 and Y177.
[0237] Strain Y188 was generated by introducing into strain Y176 an additional copy of the coding sequences of the ERG13, ERG10, and ERG12 genes of Saccharomyces cerevisia, and a truncated coding sequence of the HMG1 gene of Saccharomyces cerevisia, each under regulatory control of a galactose inducible promoter of the GAL1 or GAL10 gene of Saccharomyces cerevisia. To this end, exponentially growing Y176 cells were transformed with 2 μg of expression plasmids pAM491 and pAM495 digested with PmeI restriction endonuclease (New England Biolabs, Beverly, Mass.). Host cell transformants were selected on CSM lacking uracil and histidine (CSM-U-H), and selected clones were confirmed by diagnostic PCR, yielding strain Y188.
[0238] Strain Y189 was generated by introducing into strain Y177 an additional copy of the coding sequences of the ERG20, ERGS, and ERG19 genes of Saccharomyces cerevisia, and a truncated coding sequence of the HMG1 gene of Saccharomyces cerevisia, each under regulatory control of a galactose inducible promoter of the GAL1 or GAL10 gene of Saccharomyces cerevisia. To this end, exponentially growing Y188 cells were transformed with 2 ug of expression plasmids pAM489 and pAM497 digested with PmeI restriction endonuclease. Host cell transformants were selected on CSM lacking tryptophan and histidine (CSM-T-H), and selected clones were confirmed by diagnostic PCR, yielding strain Y189.
[0239] Strain Y238 was generated by mating strains Y188 and Y189, and by introducing an additional copy of the coding sequence of the IDI1 gene of Saccharomyces cerevisia and a truncated coding sequence of the HMG1 gene of Saccharomyces cerevisia, each under regulatory control of a galactose inducible promoter of the GAL1 or GAL10 gene of Saccharomyces cerevisia. To this end, approximately 1×107 cells of strains Y188 and Y189 were mixed on a YPD medium plate for 6 hours at room temperature, diploid cells were selected on CSM-H-U-T, and exponentially growing diploids were transformed with 2 ug of expression plasmid pAM493 digested with PmeI restriction endonuclease. Host cell transformants were selected on CSM lacking adenine (CSM-A), and selected clones were confirmed by diagnostic PCR, yielding strain Y238.
[0240] Strains Y210 (MAT A) and Y211 (MAT alpha) were generated by sporulating strain Y238. The diploid cells were sporulated in 2% potassium acetate and 0.02% raffinose liquid medium, and approximately 200 genetic tetrads were isolated using a Singer Instruments MSM300 series micromanipulator (Singer Instrument Co, LTD. Somerset, UK). Spores were selected on CSM-A-H-U-T, and selected clones were confirmed by diagnostic PCR, yielding strains Y210 (MAT A) and Y211 (MAT alpha).
[0241] Strain Y221 was generated by transforming exponentially growing Y211 cells with vector pAM178. Host cell transformants were selected on CSM-L.
[0242] Strain Y290 was generated by deleting the coding sequence of the GAL80 gene of strain Y221. To this end, exponentially growing Y221 cells were transformed with integration construct i32 (SEQ ID NO: 90), which comprised the hygromycin B resistance marker (hph) flanked by the promoter and terminator of the Tef1 gene of Kluyveromyces lactis flanked by GAL80 upstream and downstream sequences (FIG. 1B). Host cell transformants were selected on medium comprising hygromycin B, and selected clones were confirmed by diagnostic PCR, yielding strain Y290.
[0243] Strain Y318 was generated by removing the pAM178 vector from strain Y290 by serial propagation in leucine-rich media, and testing individual colonies for their inability to grow on CSM-L, yielding strain Y318.
[0244] Strain Y409 was generated by introducing a heterologous nucleotide sequence encoding a β-farnesene synthase into strain Y318. To this end, exponentially growing Y318 cells were transformed with expression plasmid pAM404. Host cell transformants were selected on CSM-L, yielding strain Y409.
[0245] Strain Y419 was generated by rendering the GAL promoters of strain Y409 constitutively active. To this end, exponentially growing Y409 cells were transformed with integration construct i33 (SEQ ID NO: 91), which comprised the nourseothricin resistance marker of Streptomyces noursei (NatR) flanked by the promoter and terminator of the Tef1 gene of Kluyveromyces lactis, and the coding sequence of the GAL4 gene of Saccharomyces cerevisiae under regulatory control of an "operative constitutive" version of its native promoter (PGAL4oc; Griggs & Johnston (1991) PNAS 88(19):8597-8601) and the GAL4 terminator (TGAL4) (FIG. 1C), flanked by upstream and downstream sequences of the modified ERG9 promoter and coding sequences. Host cell transformants were selected on medium comprising nourseothricin, and selected clones were confirmed by diagnostic PCR, yielding strain Y419.
[0246] Strain Y677 was generated by introducing at the modified GAL80 locus of strain Y419 an additional copy of the coding region of the ERG12 gene of Saccharomyces cerevisiae under regulatory control of the promoter of the GAL1 gene of Saccharomyces cerevisiae. To this end, exponentially growing Y677 cells were transformed with integration construct i37 (SEQ ID NO: 92), which comprised the kanamycin resistance marker of Streptomyces noursei (KanR) flanked by the promoter and terminator of the Tef1 gene of Kluyveromyces lactis, and the coding and terminator sequences of the ERG12 gene of Saccharomyces cerevisiae flanked by the GAL1 promoter (PGAL1) and the ERG12 terminator (TERG12) (FIG. 1D). Host cell transformants were selected on medium comprising kanamycin, and selected clones were confirmed by diagnostic PCR, yielding strain Y677.
[0247] Strain Y1551 was generated from strain Y677 by chemical mutagenesis. Mutated strains were screened for increased production of β-farnesene, yielding strain Y1551.
[0248] Strain Y1778 was generated from strain Y1551 by chemical mutagenesis. Mutated strains were screened for increased production of β-farnesene, yielding strain Y1778.
[0249] Strain Y1816 was generated by replacing the HXT3 coding sequence of strain Y1778 with two copies of an acetoacetyl-CoA thiolase coding sequence, one being derived from Saccharomyces cerevisiae and the other from C. butylicum, and one copy of the coding sequence of the HMGS gene of B. juncea. To this end, exponentially growing Y1778 cells were transformed with integration construct i301 (SEQ ID NO: 93), which comprised the hygromycin B resistance marker (hyg) flanked by the promoter and terminator of the Tef1 gene of Kluyveromyces lactis, the coding sequence of the ERG10 gene of Saccharomyces cerevisiae flanked by a truncated TDH3 promoter (tPTDH3) and the AHP1 terminator (TAHP1), the coding sequence of the acetoacetyl-CoA thiolase gene of C. butylicum (thiolase) flanked by the YPD1 promoter (PYPD1) and CCW12 terminator (TCCW12), and the coding sequence of the HMGS gene of B. juncea (HMGS) preceded by the TUB2 promoter (PTUB2), flanked by upstream and downstream sequences of the HXT3 gene of Saccharomyces cerevisiae (FIG. 1E). Host cell transformants were selected on medium comprising hygromycin B, and selected clones were confirmed by diagnostic PCR, yielding strain Y1816.
[0250] Strain Y2055 was generated from strain Y1778 by chemical mutagenesis. Mutant strains were screened for increased production of β-farnesene, yielding strain Y2055.
[0251] Strain Y2295 was generated from strain Y2055 by chemical mutagenesis. Mutant strains were screened for increased production of β-farnesene, yielding strain Y2295.
[0252] Strain Y3111 was generated by switching the mating type of strain Y2295 from MAT A to MAT alpha. To this end, exponentially growing Y2295 cells were transformed with integration construct i476 (SEQ ID NO: 94), which comprised the MAT alpha mating locus and the hygromycin B resistance marker (hygA) (FIG. 1F). Host cell transformants were selected on medium comprising hygromycin B, and selected clones were confirmed by diagnostic PCR, yielding strain Y3111.
[0253] Strain Y2168 was generated from strain Y1816 by chemical mutagenesis. Mutant strains were screened for increased production of β-farnesene, yielding strain Y2168.
[0254] Strain Y2446 was generated from strain Y2168 by chemical mutagenesis. Mutant strains were screened for increased production of β-farnesene, yielding strain Y2446.
[0255] Strain Y3118 was generated by inserting into the native URA3 locus of strain Y2446 the coding sequence, promoter, and terminator of the GAL80 gene of Saccharomyces cerevisiae. To this end, exponentially growing Y2446 cells were transformed with integration construct i477 (SEQ ID NO: 95), which comprised the promoter, terminator, and coding sequence of the GAL80 gene of Saccharomyces cerevisiae (GAL80) flanked by overlapping URA3 sequences (which enable loop-out excision of the GAL80 gene by homologous recombination and restoration of the original URA3 sequence) (FIG. 1G). Host cell transformants were selected on medium comprising 5-FOA, yielding strain Y3118.
[0256] Strain Y3125 was generated from strain Y3118 by removing expression plasmid pAM404. To this end, strain Y3118 was first incubated in 3 mL YPD+0.5% leucine medium with 40 mg/L uracil (YPD+L+U). Cells were diluted by 100-fold in fresh YPD+L+U every 24 hours for up to 5 days to lose expression plasmid pAM404, and were then plated on YPD and incubated at 30° C. for up to 5 days. Small colonies were replica-plated on both YPD and CSM-L, and colonies that could grow on YPD but failed to grow on CSM-L were identified, yielding strain Y3125.
[0257] The strains shown in Table 11 were generated by transforming exponentially growing Y3125 cells with the indicated expression plasmids comprising the indicated coding sequences, and selecting host cell transformants on CSM-L.
TABLE-US-00011 TABLE 11 FS and TDS expressing yeast strains Strain Plasmid Coding sequence (promoter) Y3353 pAM1812 FS_Aa_Sc (PGAL1) TDS_Fs_Sc (PGAL10) Y3354 pAM1813 FS_Aa_Sc (PGAL10) TDS_Fs_Sc (PGAL1) Y3394 pAM1895 FS_S2D_Ec (PGAL1) TDS_Fs_Sc (PGAL10) Y3395 pAM1896 FS_Ad_Sc (PGAL1) TDS_Fs_Sc (PGAL10)
[0258] Strain Y227 was generated by transforming strain Y211 with expression plasmid pAM426. Host cell transformants were selected on CSM-L.
[0259] Strain Y3198 was generated by removing expression plasmid pAM426 from strain Y227. To this end, Y227 cells were propagated in YPD+L for 4 days. Every 24 hours, the culture was inoculated to an OD600 of 0.05 in fresh YPD+L. After 4 days, cells were serial diluted and plated onto YPD solid agar, and the plates were incubated at 30° C. for 4 days. Smaller colonies were replica-plated on both YPD and CSM-L, and colonies that could grow on YPD but failed to grow on CSM-L were identified, yielding strain Y3198.
[0260] Strain Y3215 was generated by mating strains Y3111 and Y3118. Approximately 1×107 cells of strains Y3111 and Y3118 were mixed on a YPD medium plate for 6 hours at room temperature to allow for mating, followed by plating on YPD agar plate to isolate single colonies. Diploids were identified by screening by colony PCR for the presence of both the hphA-marked MAT alpha locus and the wild-type MAT A locus.
[0261] Strain Y3000 was generated by sporulating strain Y3215 and looping out the GAL80 coding sequence. The diploid cells were sporulated in 2% potassium acetate and 0.02% raffinose liquid medium. Random spores were isolated, plated on YPD agar, grown for 3 days, and then replica-plated to CSM-U to permit growth only of cells lacking GAL80 (i.e., having a functional URA3 gene). Spores were then tested for β-farnesene production, the best producer was identified, and the presence of integration construct i301 was confirmed by diagnostic PCR, yielding strain Y3000.
[0262] Strain Y3284 was generated by removing the URA3 marker from strain Y3000. To this end, exponentially growing Y3000 cells were transformed with integration construct i94 (SEQ ID NO: 96), which comprised the hisG coding sequence of Salmonella, and the coding sequence of the ERG13 gene and a truncated coding sequence of the HMG1 gene of Saccharomyces cerevisiae under control of a galactose inducible promoter of the GAL1 or GAL10 gene of Saccharomyces cerevisiae, flanked by upstream and downstream sequences of the URA3 gene of Saccharomyces cerevisiae (FIG. 1H). Host cell transformants were selected on medium comprising 5-FOA, and selected clones were confirmed by diagnostic PCR, yielding strain Y3284.
[0263] Strain Y3385 was generated by replacing the NDT80 coding sequence of strain Y3284 with an additional copy of the coding sequence of an acetyl-CoA synthetase gene of Saccharomyces cerevisiae and the coding sequence of the PDC gene of Z. mobilis. To this end, exponentially growing Y3385 cells were transformed with integration construct i467 (SEQ ID NO: 97), which comprised the URA3 marker, the coding sequence of the ACS2 gene of Saccharomyces cerevisiae (ACS2) flanked by the HXT3 promoter (PHXT3) and PGK1 terminator (TPGK1), and the coding sequence of the PDC gene of Z. mobilis (zmPDC) flanked by the GAL7 promoter (PGAL7) and the TDH3 terminator (TTDH3), flanked by upstream and downstream NDT80 sequences (FIG. 1I). Host cell transformants were selected on CSM-U, and selected clones were confirmed by diagnostic PCR, yielding strain Y3385.
[0264] Strain Y3547 was generated from strain Y3385 by chemical mutagenesis. Mutated strains were screened for increased production of β-farnesene, yielding strain Y3547.
[0265] Strain Y3639 was generated from strain Y3547 by chemical mutagenesis. Mutated strains were screened for increased production of β-farnesene, yielding strain Y3639.
[0266] Strain Y3902 was generated by disrupting the URA3 marker at the NDT80 locus of strain Y3639 with an integration of the coding sequence, promoter, and terminator of the GAL80 gene of Saccharomyces cerevisiae. In this instance, a mutant allele of GAL80 called GAL80s-2 was used (Nucleic Acids Research (1984) 12(24):9287-9298). Exponentially growing Y3639 cells were transformed with integration construct i601 (SEQ ID NO: 98), which comprised the promoter, terminator, and coding sequence of the GAL80 gene of Saccharomyces cerevisiae (PGAL80, TGAL80, and GAL80, respectively) flanked by overlapping URA3 sequences (which enable loop-out excision of the GAL80 gene by homologous recombination and restoration of the original URA3 sequence), the coding sequences of the ACS2 gene of Saccharomyces cerevisiae (ACS2) flanked by the HXT3 promoter (PHXT3) and the PGK1 terminator (TPGK1), and the PDC coding sequence of Z. mobilis (zmPDC) flanked by the GAL7 promoter (PGAL7) and the TDH3 terminator (TTDH3), flanked by upstream and downstream NDT80 sequences (FIG. 1J). Host cell transformants were selected on medium comprising 5-FOA, and selected clones were confirmed by diagnostic PCR, yielding strain Y3902.
[0267] Strain Y4027 was generated from strain Y3902 by removing expression plasmid pAM404 by serial propagation in leucine-rich media, and testing individual colonies for their inability to grow on medium lacking leucine.
[0268] Strain Y4909 was generated by replacing the ADH5 coding sequence of strain Y4027 with the FS_D--3.5 coding sequence and the FS_C--7 coding sequence (see Table 17). To this end, exponentially growing Y4909 cells were transformed with integration construct i2125 (SEQ ID NO: 99), which comprised the LEU2 coding sequence (LEU2) and the farnesene synthase variant coding sequences flanked by GAL1 or GAL10 promoter (PGAL1 or PGAL10) and the CYC1 or ADH1 terminator (TCYC1 or TADH1), respectively, flanked by upstream and downstream ADH5 sequences (FIG. 1K). Host cell transformants were selected on CSM-L, and selected clones were confirmed by diagnostic PCR, yielding strain Y4909.
[0269] Strain Y4959 was generated by removing from strain Y4909 the coding sequence, promoter, and terminator of the GAL80 gene of Saccharomyces cerevisiae. To this end, Y4909 cells were plated on CSM-U to select for spontaneous GAL80 "loop-out" recombination events, yielding strain Y4959.
[0270] Strain Y5444 was generated by inserting at the CANT locus of strain Y4959 the TDS_Fs_Sc coding sequence. To this end, exponentially growing Y4959 cells were transformed with integration construct i2608 (SEQ ID NO: 100), which comprised the TDS_Fs_Sc coding sequence flanked by the GAL1 promoter of Saccharomyces cerevisiae (PGAL1) and the CYC1 terminator of Saccharomyces cerevisiae (TCYC1) (FIG. 1L). Host cell transformants were selected on YNB medium comprising canavanine and lacking arginine, and selected clones were confirmed by diagnostic PCR, yielding strain Y5444.
[0271] Strain Y4910 was generated by inserting at the ADH5 locus of Y4027 the FS_A--5.3 coding sequence, the FS_B--5.3 coding sequence, the FS_C--7 coding sequence, and the FS_D--3.5 coding sequence (see Table 17). To this end, exponentially growing Y4909 cells were transformed with integration construct i2127 (SEQ ID NO: 101), which comprised the LEU2 coding sequence (LEU2) and the farnesene synthase variant coding sequences flanked by the GAL1 or GAL10 promoter (PGAL1 or PGAL10) and the ADH1 or CYC1 terminator (TADH1 or TCYC1), flanked by upstream and downstream ADH5 sequences (FIG. 1M), and which was generated by co-transformation with two overlapping segments of i2127, thereby stimulation homologous recombination between the two overlapping plasmid inserts. Host cell transformants were selected on CSM-L, and selected clones were confirmed by diagnostic PCR, yielding strain Y4910.
[0272] Strain Y4960 was generated by removing from strain Y4910 the coding sequence, promoter, and terminator of the GAL80 gene of Saccharomyces cerevisiae. To this end, Y4910 cells were plated on CSM-U to select for spontaneous GAL80 "loop-out" recombination events, yielding strain Y4960.
[0273] Strain Y5445 was generated by inserting at the CAN1 locus of strain Y4960 the TDS_Fs_Sc coding sequence. To this end, exponentially growing Y4959 cells were transformed with integration construct i2608 (SEQ ID NO: 100), which comprised the TDS_Fs_Sc coding sequence flanked by the GAL1 promoter of Saccharomyces cerevisiae (PGAL1) and the CYC1 terminator of Saccharomyces cerevisiae (TCYC1) (FIG. 1L). Host cell transformants were selected on YNB medium comprising canavanine and lacking arginine, and selected clones were confirmed by diagnostic PCR, yielding strain Y5445.
[0274] Strain Y5064 was generated by removing the URA3 marker from strain Y4960. To this end, exponentially growing Y4960 cells ware transformed with integration construct i569 (SEQ ID NO: 102), which comprised the coding sequence of the ACS2 gene of Saccharomyces cerevisiae (ACS2) flanked by the HXT3 promoter (PHXT3) and the PGK1 terminator (TPGK1), and the coding sequence of the PDC gene of Z. mobilis (zmPDC) flanked by the GAL7 promoter (PGAL7) and the TDH3 terminator (TTDH3), flanked by upstream and downstream NDT80 sequences (FIG. 1N). Host cell transformants were selected based on their ability to grow on medium containing 5-FO, and selected clones were confirmed by diagnostic PCR, yielding strain Y5064.
[0275] Strain Y5065 was generated by inserting at the BIO4 locus of strain Y5064 the FS_A--5.3 coding sequence and the FS_B--5.3 coding sequence (see Table 17). To this end, exponentially growing Y5064 cells were transformed with integration construct i2124 (SEQ ID NO: 103), which comprised the URA3 coding sequence (URA3), and the farnesene synthase variant coding sequences flanked by the GAL1 or GAL10 promoter (PGAL1 or PGAL10) and ADH1 or CYC1 terminator (TADH1 or TCYC1), flanked by upstream and downstream BIO4 sequences (FIG. 10). Host cell transformants were selected CSM-U, and selected clones were confirmed by diagnostic PCR, yielding strain Y5065.
[0276] Strain Y5066 was generated by inserting at the BIO4 locus of strain Y5064 the FS_A--5.3 coding sequence, the FS_B--5.3 coding sequence, the FS_C--7 coding sequence, and the FS_D--3.5 coding sequence (see Table 17). To this end, exponentially growing Y5064 cells were transformed with integration construct i2127 (SEQ ID NO: 101), which comprised the LEU2 coding sequence (LEU2) and the farnesene synthase variant coding sequences flanked by the GAL1 or GAL10 promoter (PGAL1 or PGAL10) and the ADH1 or CYC1 terminator (TADH1 or TCYC1), flanked by upstream and downstream ADH5 sequences (FIG. 1M), and which was generated by co-transformation with two overlapping segments of i2127, thereby stimulation homologous recombination between the two overlapping plasmid inserts. Host cell transformants were selected on CSM-L, and selected clones were confirmed by diagnostic PCR, yielding strain Y5066.
[0277] Strain Y5446 was generated by inserting at the CAN1 locus of strain Y5065 the TDS_Fs_Sc coding sequence. To this end, exponentially growing Y4959 cells were transformed with integration construct i2608 (SEQ ID NO: 100), which comprised the TDS_Fs_Sc coding sequence flanked by the promoter of the GAL1 gene of Saccharomyces cerevisiae (PGAL1) and the terminator of the CYC1 gene of Saccharomyces cerevisiae (TCYC1) (FIG. 1L). Host cell transformants were selected on YNB medium comprising canavanine and lacking arginine, and selected clones were confirmed by diagnostic PCR, yielding strain Y5446.
[0278] Strain Y5447 was generated by inserting at the CAN1 locus of strain Y5066 the TDS_Fs_Sc coding sequence. To this end, exponentially growing Y4959 cells were transformed with integration construct i2608 (SEQ ID NO: 100), which comprised the TDS_Fs_Sc coding sequence flanked by the GAL1 promoter of Saccharomyces cerevisiae (PGAL1) and the CYC1 terminator of Saccharomyces cerevisiae (TCYC1) (FIG. 1L). Host cell transformants were selected on YNB medium comprising canavanine and lacking arginine, and selected clones were confirmed by diagnostic PCR, yielding strain Y5447.
[0279] Strain Y224 was generated by introducing into strain Y211 an expression plasmid encoding an amorphadeine synthase (ADS), a cytochrome P450 monooxygenase (AMO, CYP71AV1), and a NADP-cytochrome P450 oxidoreductase (CPR). To this end, exponentially growing Y211 cells were transformed with expression plasmid pAM322, which comprised the coding sequence of the ADS gene of Artemisia annua (ADS), the coding sequence of the AMO gene of Artemisia annua, and the coding sequence of the CPR gene of Artemisia annua, all codon-optimized for expression in Saccharomyces cerevisiae and under regulatory control of the promoter of the GAL1 or GAL10 gene of Saccharomyces cerevisiae. Host cell transformants were selected CSM-L, yielding strain Y224.
[0280] Strain Y284 was generated by replacing the divergent promoter of the GAL1 and GAL10 genes and the GAL1 coding sequence of strain Y224 with the hygromycin B resistance marker (hphA). To this end, exponentially growing Y224 cells were transformed with integration construct i65 (SEQ ID NO: 104; FIG. 1P). Host cell transformants were selected based on their resistance to hygromycin B, and selected clones were confirmed by diagnostic PCR, yielding strain Y284.
[0281] Strain Y301 was generated by putting the ERG9 gene of strain Y284 under regulatory control of the promoter of the CTR3 gene of Saccharomyces cerevisiae. To this end, exponentially growing Y284 cells were transformed with integration construct i10 (SEQ ID NO: 105), which comprised the coding sequence of a D-serine deaminase (dsdA) and the CTR3 promoter (PCTR3), flanked by upstream and coding sequences of the ERG9 gene (FIG. 1Q). Host cell transformants were selected based on their ability to grow on D-serine deaminase, and selected clones were confirmed by diagnostic PCR, yielding strain Y301.
[0282] Strain Y539 was generated from strain Y301 by removing expression plasmid pAM322. To this end, strain Y301 was propagated in rich Yeast Peptone Dextrose (YPD) medium containing 0.5% leucine (w/v) for 4 days. Every 24 hours, the culture was inoculated to an OD600 of 0.05 in fresh YPD containing 0.5% leucine (w/v). After 4 days, cells were serial diluted and plated onto YPD solid agar, and the plates were incubated at 30° C. for 4 days. Two distinct colony sizes were observed. Smaller colonies (indicating a loss of pAM322) were replica plated onto minimal medium lacking leucine. A clone that was able to grow on YPD solid agar but was unable to grow on medium lacking leucine was selected as strain Y539.
Example 3
[0283] This example demonstrates the feasibility of using FPP starvation based selection in Escherichia coli to screen for terpene synthases with improved in vivo performance.
[0284] DH5αchemical- or electro-competent Escherichia coli cells (Invitrogen, Carlsbad, Calif.) were transformed with 5 ng of an expression plasmid selected from the group consisting of expression plasmids pAM1668 (negative control), pAM1670, pAM2096, pAM2097, pAM2098, pAM2101, and pAM2104. Host cell transformants were plated on agar plates comprising carbenicillin, and the plates were incubated at 30° C. for 2-3 days.
[0285] As shown in FIG. 2, cells transformed with expression plasmid pAM2097 or pAM2096 produced colonies of similar size as cells transformed with empty vector (pAM1668). However, cells transformed with expression plasmid pAM1670, pAM2098, as well as cells transformed with expression plasmids pAM2104 or pAM2101 (data not shown), produced colonies that were smaller than those produced by the control. The smaller colony sizes were likely due to FPP starvation triggered by the conversion in the host cells of FPP into farnesene mediated by the expression of an active sesquiterpene synthase. The in vivo activities of these sesquiterpene synthases were confirmed by GC analysis of host cells at 72 hours in shake flasks (FIG. 4), showing that FPP starvation based selection in Escherichia coli can be used to screen sesquiterpene synthases for in vivo enzyme activity.
Example 4
[0286] This example demonstrates the feasibility of using FPP toxicity based growth selection in Escherichia coli to screen for sesquiterpene synthases with improved in vivo performance.
[0287] DH5αchemical- or electro-competent Escherichia coli cells (Invitrogen, Carlsbad, Calif.) were co-transformed with 5 ng of expression plasmid pAM765 (encodes enzymes of the MEV pathway that collectively increase production of FPP in the host cells) and 5 ng of an expression plasmid selected from the group consisting of expression plasmids pAM1668 (negative control), pAM1670, pAM2117, pAM2157, pAM2158, pAM2098, pAM2104, pAM2097, pAM2101, and pAM2096. Host cell transformants were plated on agar plates comprising chloramphenicol and carbenicillin, and the plates were incubated at 30° C. for 2-5 days.
[0288] As shown in FIG. 3 and Table 12, cells transformed with empty vector (pAM1668) produced no colonies, likely due to cell death triggered by the accumulation of toxic FPP in the host cells (Withers at al. (2007) Appl. Environ. Microbiol. 73:6277-6283). Similarly, cells transformed with expression plasmid pAM2158 or pAM2117 did not form colonies, likely due to the fact that the farnesene synthase coding sequences of these plasmids were not codon-optimized for efficient expression in the Escherichia coli host cells. Cells transformed with expression plasmids pAM2096 also did not form colonies, suggesting that the Citrus junos farnesene synthase does not possess sufficient activity in Escherichia coli host cells. All other transformed cells produced colonies within 1-3 days of culture, presumably due to the conversion of FPP into less toxic sesquiterpenes by the active sesquiterpene synthases encoded by expression plasmids pAM1670, pAM2157, pAM2098, pAM2104, pAM2097, and pAM2101. The in vivo activities of several of these sesquiterpene synthases were confirmed by GC analysis of host cells at 72 hours in shake flasks (FIG. 4), showing that FPP toxicity based growth selection in Escherichia coli can be used to screen sesquiterpene synthases for in vivo enzyme activity.
TABLE-US-00012 TABLE 12 Growth of Escherichia coli Cells Transformed with Plasmids Comprising Various Sesquiterpene Synthase Coding Sequences FS coding Incubation Time Plasmid sequences Colonies Until Colonies pAM1668 None None n/a pAM2096 FS_Cj_Ec None n/a pAM2158 FS_S2D_Sc None n/a pAM2117 FS_Aa_Sc None n/a pAM2104 TDS_Fs_Ec Yes 1 day pAM2101 PS_S_Ec Yes 1 day pAM1670 FS_S2D_Ec Yes 1-2 days pAM2157 FS_Aa_Ec Yes >3 days pAM2098 FS_Pt_Ec Yes >3 days pAM2097 FS_Cs_Ec Yes >3 days
Example 5
[0289] This example demonstrates the feasibility of using FPP toxicity based growth selection in yeast to screen for sesquiterpene synthases with improved in vivo performance.
[0290] Strain Y3198 was transformed with 500 ng of Construct A or Construct B, respectively. Host cell transformants were incubated for 6 hours with shaking at 250 rpm in 5 mL YPD medium, and washed twice in 5 mL diH2O. Half of each washed culture was plated to CSM-L agar plates comprising 2% galactose as a sole carbon source (note that growth on galactose induces expression of the MEV pathway enzyme coding sequences engineered into strain Y3198 resulting in increased FPP production in the cells). The remaining half of each washed culture was plated to CSM-L agar plates comprising 2% glucose as a sole carbon source. Plates were incubated for 3 days at 30° C. until individual colonies were approximately 1 mm in diameter.
[0291] As shown in FIG. 5, only cells transformed with Construct A were able to grow on CSM-L medium comprising galactose as the sole carbon source, demonstrating the utility of FPP toxicity based growth selection in yeast to screen sesquiterpene synthases for in vivo enzyme activity.
Example 6
[0292] This example demonstrates the feasibility of using Nile Red fluorescence to screen for terpene synthases with improved in vivo performance.
[0293] To determine relative farnesene titers, 48 colonies of strain Y3198 transformed with Construct A and 48 colonies of strain Y3198 transformed with expression plasmid pAM404 were picked into separate wells of a 96-well plate containing 360 uL of Bird Seed Medium (BSM) with 2% galactose per well (preculture). After 2 days of incubation at 30° C. with 999 rpm agitation, 16 uL of each well was inoculated into a well of a new 96-well plate containing 360 uL of fresh BSM with 2% galactose (production culture). After another 2 days of incubation at 30° C. with 999 rpm agitation, samples were taken for farnesene titer determination by Nile Red fluorescence.
[0294] For Nile Red fluorescence analysis, 98 uL of each culture was transferred into a 96-well black polystyrene flat bottom assay plate, and 2 uL of Nile Red (Invitrogen, Carlsbad, Calif.) dissolved at 100 ug/mL in DMSO was added to each well. Fluorescence levels were immediately measured with excitation at 500 nm and emission at 550 nm.
[0295] As shown in FIG. 6, the single chromosomally integrated copy of the FS_Aa_Sc coding sequence in strain Y3198 transformed with Construct A produced a Nile Red fluorescence signal that was at 39% of that obtained with strain Y3198 transformed with high-copy expression plasmid pAM404. The approximately 3-fold difference in farnesene titers between the two strains was confirmed by GC analysis (data not shown), demonstrating that there is sufficient difference (delta) in Nile Red fluorescence levels (i.e., farnesene levels) for this system to be a suitable screen for terpene synthases with improved in vivo performance.
Example 7
[0296] This example demonstrates the feasibility of using sesquiterpene synthase competition in yeast to rank sesquiterpene synthases according to their in vivo enzyme activity levels.
[0297] For each of yeast strains Y3353 and Y3354, eight single colonies of the original transformation of strain Y3125 with expression plasmid pAM1812 or pAM1813, respectively, were incubated in separate wells of a 96-well plate containing 360 uL of Bird Seed Medium (BSM) with 2% sucrose per well (preculture). After 2 days of incubation at 30° C. with 999 rpm agitation, 16 uL of each well was inoculated into a well of a new 96-well plate containing 360 uL of fresh BSM with 4% sucrose (production culture). After another 2 days of incubation at 30° C. with 999 rpm agitation, samples were taken and analyzed for terpene production by gas chromatography (GC) analysis. For each strain, a single colony was also restreaked on CSM-L-M-U agar plates, and eight single colonies from each re-streak were grown as described, and analyzed for terpene production by GC analysis.
[0298] For GC analysis, samples were extracted with methanol-heptane (1:1 v/v), and the mixtures were centrifuged to remove cellular material. An aliquot of the methanol-heptane extract was diluted into heptane, and then injected onto a methyl silicone stationary phase using a pulsed split injection. Farnesene and trichodiene were separated by boiling point using GC with flame ionization detection (FID). Trans-β-caryophyllene was used as a retention time marker to monitor successful injection and elution during the specified GC oven profile. The titers of farnesene and trichodiene were used to calculate the farnesene/trichodiene ratios.
[0299] As shown in Table 13, terpene titers among independent original transformants varied considerably from well to well, resulting in coefficients of variation (CVs) of up to 29%. CVs were reduced for the eight replicates. The observed CVs show that well-to-well and clone-to-clone variations make it impossible to draw conclusions directly from sesquiterpene titers as to the activities of the sequiterpene synthases that produced the sesquiterpenes. However, as also shown in Table 13, farnesene/trichodiene ratios were rather consistent across samples, producing CVs of no more than 5.7%. Thus, by co-expressing a test sesquiterpene synthase from the same plasmid as a comparison sesquiterpene synthase, and by comparing the activities of the test and comparison sesequiterpene synthases, well-to-well and clone-to-clone variations were greatly reduced, making it possible to benchmark the in vivo catalytic efficiency of a test sesquiterpene synthase (e.g., a farnesene synthase) against that of a comparison sequiterpene synthase (e.g., a TDS).
TABLE-US-00013 TABLE 13 β-Farnesene and Trichodiene Titers and Titer Ratios for Yeast Strains Expressing a FS and a TDS from the Same Plasmid Coding Farnesene Trichodiene Farnesene/ Sequences (mg/L) (mg/L) Trichodiene Strain (promoters) (CV %) (CV %) (CV %) Y3353 FS_Aa_Sc 953 (5.6%) 695 (6.3%) 1.37 (3.0%) (PGAL1) Y3353 TDS_Fs_Sc 829 (7.1%) 613 (8.5%) 1.36 (5.7%) restreak (PGAL10) Y3354 FS_Aa_Sc 211 (28.9%) 1033 (29.3%) 0.21 (4.3%) (PGAL10) Y3354 TDS_Fs_Sc 200 (11.2%) 973 (7.9%) 0.21 (4.8%) restreak (PGAL1)
[0300] To further validate sesquiterpene synthase competition as a ranking tool for sesquiterpene synthase activities in yeast, yeast strains Y3353, Y3394, and Y3395 were evaluated as described. As shown in Table 14, absolute farnesene titers again showed significant variations whereas low CVs were observed for the farnesene/trichodiene ratios. As judged by the observed ratios, the tested farnesene synthases could be ranked as follows (from most active to least active): Actinidia deliciosa farnesene synthase expressed from the FS_Ad_Sc coding sequence (Y3395)>Artemisia annua farnesene synthase expressed from the FS_Aa_Sc coding sequence (Y3353)>S2D mutant Artemisia annua farnesene synthase expressed from the FS_S2D_Ec coding sequence (Y3394). This ranking was confirmed by GC analysis using strains that harbored a single copy of the FS_Aa_Sc, FS_S2D_Ec, or FS_Ad_Sc coding sequence (FIG. 7), thus validating the utility of sesquiterpene synthase competition as a means for ranking sesquiterpene synthases according to their in vivo enzyme activity levels in yeast.
TABLE-US-00014 TABLE 14 β-Farnesene and Trichodiene Titers and Titer Ratios for Yeast Strains Expressing a FS and a TDS from the Same Plasmid Farnesene Trichodiene Farnesene/ Coding Sequences (mg/L) (mg/L) Trichodiene Strain (promoters) (CV %) (CV %) (CV %) Y3395 FS_Ad_Sc (PGAL1) 752 453 1.66 TDS_Fs_Sc (PGAL10) (28.3%) (28.5%) (3.0%) Y3353 FS_Aa_Sc (PGAL1) 814 616 1.32 TDS_Fs_Sc (PGAL10) (6.0%) (5.0%) (2.6%) Y3394* FS_S2D_Ec (PGAL1) 590 710 0.82 TDS_Fs_Sc (PGAL10) (21.5%) (19.7%) (6.2%) *The S2D mutant Artemisia annua farnesene synthase expressed from the FS_S2D_Ec coding sequence was least active likely due to sub-optimal codon usage for the FS_S2D_Ec coding sequence in the yeast host cells.
[0301] To yet further validate sesquiterpene synthase competition as a ranking tool for sesquiterpene synthase activities in yeast, yeast strains Y5444, Y5445, Y5446, and Y5447 were evaluated as described with the following exceptions: for each strain four colonies instead of eight colonies were analyzed, cultures were incubated not at 30° C. but at 34° C., the preculture lasted not 2 days but 3 days, and the production culture was a 10-fold dilution of the preculture. As shown in Table 15 and FIG. 8, a linear relationship was observed between the number of integrated farnesene synthase coding sequences and farnesene to trichodiene ratios, confirming the utility of sesquiterpene synthase competition as a means for ranking sesquiterpene synthases according to their in vivo enzyme activity levels in yeast.
TABLE-US-00015 TABLE 15 β-Farnesene and Trichodiene Titers and Titer Ratios for Yeast Strains Expressing One Integrated Copy of TDS and Multiple Integrated Copies of FS Coding Sequences Copies of Integrated FS_Aa_Sc Farnesene Trichodiene Farnesene/ Strain Coding Sequence (mg/L) (mg/L) Trichodiene Y5444 2a) 2300 ± 62 811 ± 20 2.8 ± 0.038 Y5445 4b) 2721 ± 109 516 ± 19 5.3 ± 0.057 Y5446 6c) 2761 ± 129 387 ± 22 7.1 ± 0.089 Y5447 8d) 2822 ± 53 306 ± 9 9.2 ± 0.114 a)PGAL1_FS_C_7_TADH1 and pGAL10_FS_D_3.5_TCYC1 integrated at ADH5 locus b)= a) plus pGAL1_FS_B_5.3_TADH1 and pGAL10_FS_A_5.3_TCYC1 integrated at ADH5 locus c)= b) plus pGAL1_FS_B_5.3_TADH1 and pGAL10_FS_A_5.3_TCYC1 integrated at BIO4 locus d)= c) plus pGAL1_FS_C_7_TADH1 and pGAL10_FS_D_3.5_TCYC1 integrated at BIO4 locus
Example 8
[0302] This example describes methods for generating libraries of sesquiterpene synthases variants.
[0303] Several farnesene synthase variant libraries were generated using the FS_S2D_Ec coding sequence as a template. For each library, 250-500 ng of pAM1670 were subjected to error-prone PCR using the GeneMorph® II Random Mutagenesis Kit (Agilent Technologies, Inc., Santa Clara, Calif.) according to manufacturer suggested protocols, and using primers LX-268-139-S2D-F (SEQ ID NO: 106) and LX-268-139-S2D-R (SEQ ID NO: 107) in 25 amplication cycles. The PCR products were gel purified and digested sequentially with FastDigest® NdeI and BamHI restriction endonucleases (Fermentas Inc., Burlington, Ontario). Vector pAM1668 was digested to completion using the same two restriction endonucleases, and the linearized vector DNA fragment was treated with calf intestine alkaline phosphatase (CIP) to remove 5' phosphate groups that would permit recircularization. The purified PCR products and the linearized pAM1688 vector were ligated in an insert to vector ratio of 3:1 using T4 DNA ligase, and 2 uL of the ligation reaction mixture was transformed into XL1-Blue electro-competent Escherichia coli cells (Agilent Technologies Inc., Santa Clara, Calif.) according to manufacturer suggested protocols. Host cell transformants were selected on several LB agar plates (100 mm diameter) comprising carbenicillin. To assess the quality of the random mutagenesis library, 48 or 96 single colonies were picked and grown in LB media comprising carbenicillin, plasmid DNA was isolated from each culture using the QIAprep 96 Turbo Miniprep Kit (Qiagen, Valencia, Calif.), and the plasmid DNA was digested using FastDigest® NdeI and BamHI restriction endonucleases (Fermentas Inc., Burlington, Ontario) to determine that approximately 95% of plasmids contained an insert. The plasmids were also sequenced to determine the mutation frequency, which was found to be an estimated average of 2-6 nucleotide changes per FS coding sequence. The remaining colonies were washed off the agar plates and plasmid DNA was isolated using the QIAprep Spin Miniprep Kit (Qiagen, Valencia, Calif.).
[0304] Several farnesene synthase variant libraries were also generated using the FS_Aa_Sc coding sequence as a template. Construct C was essentially identical to Construct A except that prior to final assembly the FS_Aa_Sc PCR product was mutagenized by error-prone PCR using the Mutazyme II® Kit (Agilent Technologies, Inc., Santa Clara, Calif.) and primers AM-288-90-CPK1618 (SEQ ID NO: 83) and AM-288-90-CPK1619 (SEQ ID NO: 84) according to manufacturer suggested protocols. Strain Y3198 was transformed with 500 ng of Construct C, and host cell transformants were recovered for 6 hours with shaking at 250 rpm in 5 mL YPD medium before they were plated out on CSM-L with 2% galactose.
Example 9
[0305] This example describes methods for screening libraries of sesquiterpene synthase variants by FPP toxicity based growth selection in Escherichia coli.
[0306] ElectroMAX DH5α-E Escherichia coli cells (Invitrogen, Carlsbad, Calif.) were transformed with 5 ng of expression plasmid pAM765 (encoding enzymes of the MEV pathway) and 5 ng of the FS_S2D_Ec based farnesene synthase variant library plasmids of Example 8. More than 40 co-transformation experiments were performed to generate ˜2×105 host cell transformants. Host cell transformants were plated on LB agar plates (100 mm diameter) comprising carbenicillin and chlorophenicol, and incubated at 30° C. for 2 days, after which approximately 400 large colonies and a similar number of small colonies were visible on the agar plates. No colonies were observed when ElectroMAX DH5α-E Escherichia coli cells (Invitrogen, Carlsbad, Calif.) were transformed with 5 ng of expression plasmid pAM765 only were plated on LB agar plates comprising carbenicillin and chlorophenicol. Assuming that these colonies all contained farnesene synthase variants that possessed activity equal or greater than the parent farnesene synthase, the hit rate was estimated to be approximately 1%.
Example 10
[0307] This example describes methods for screening libraries of terpene synthase variants using Nile Red fluorescence.
[0308] The big colonies obtained in the FPP toxicity based growth selection screen of Example 9 were picked individually into 96-well plates containing 5 uL diH2O per well, and heated at 98° C. for 10 minutes. The generated lysates were transformed into XL1-Blue chemical-competent Escherichia coli cells (Agilent Technologies Inc., Santa Clara, Calif.), and host cell transformants were plated on LB agar plates comprising carbenicillin. Note that chloramphenicol was omitted from the selective medium so that expression plasmid pAM765 was lost from the cells. Individual colonies were picked and grown in LB media comprising carbenicillin, and plasmid DNA was isolated using the QIAprep 96 Turbo Miniprep Kit (Qiagen, Valencia, Calif.). After the big colonies had been isolated from the selection plates, the small colonies were washed off the plates and their plasmids were isolated as a mixture in a similar fashion.
[0309] XL1-Blue chemical-competent Escherichia coli cells (Agilent Technologies Inc., Santa Clara, Calif.) were co-transformed with 5 ng of expression plasmid pAM97 (encoding enzymes of the MEV pathway) and 5 ng of the isolated plasmids (obtained from big colonies) or plasmid mixture (obtained from small colonies). Host cell transformants were plated on LB agar plates containing carbenicillin and chlorophenicol, and incubated at 37° C. for 24 hours. Individual colonies were inoculated into 96-well plates containing M9-Hepes media comprising carbenicillin and chlorophenicol, and the cultures were incubated at 30° C. for 24 hours (pre-culture). Then, 50 uL of each culture was used to inoculate a second culture at an initial OD of 0.05. To induce the expression of the MEV pathway enzymes and farnesene synthase, isopropyl β-D-1-thiogalactopyranoside (IPTG) was added to each culture at 1 mM final concentration. The cultures were incubated for at least 20 hours (production culture) before farnesene titers were determined by Nile Red fluorescence. An Escherichia coli strain co-transformed with pAM97 and pAM1419 was used as the negative control, and an Escherichia coli strain co-transformed with pAM97 and pAM1421 was used as the positive control. To validate the Nile Red fluorescence analysis, farnesene titers were also determined by GC analysis.
[0310] As shown in FIG. 9, measured Nile Red fluorescence signals directly correlated with farnesene titers determined by GC analysis, further validating Nile Red fluorescence as a means of measuring farnesene titers.
[0311] The top 70 strains derived from cells transformed with plasmids obtained from large colonies that produced the largest farnesene titers as determined by Nile Red fluorescence and GC analysis were replica-plated into new 96-well plates, and their production levels were re-measured as described. As shown in FIG. 10, approximately 50 of these strains produced higher farnesene titers than the control strain comprising the parent FS_S2D_Ec coding sequence, with the best farnesene synthase variant producing 65% more farnesene than the parent farnesene synthase.
[0312] The plasmids extracted from the approximately 400 large colonies were combined in equal molar amounts, the FS coding sequences were PCR amplified using primers LX-268-130-3-S2D-F (SEQ ID NO: 110) and LX-268-130-4-S2D-R (SEQ ID NO: 109), and the PCR products were gel purified. Vector pAM1734 was linearized using FastDigest® Bst1101 restriction endonuclease (Fermentas Inc., Burlington, Ontario), and the linearized vector was cleaned using the Zymo DNA Clean & Concentrator® Kit (Zymo Research Corp., Orange, Calif.). The purified vector and PCR products were mixed in a ratio of 1:3 (vector:insert), and transformed into either strain Y539 or strain Y3198 for ligation via homologous recombination. Host cell transformants were plated on CSM-L agar plates with 2% glucose (Y539 host) or 2% galactose (Y3198 host) as the sole carbon source. Approximately 2,500 individual colonies were picked and farnesene titers were determined by Nile Red fluorescence as described (using BSM with 2% glucose for the Y539 host and BSM with 2% galactose for the Y3198 host). Clones that produced a fluorescence signal that was greater than the signal obtained for the parent control (pAM1764 (FS_S2D_Ec on CEN.ARS plasmid) in Y539) by three times the standard deviation were re-plated onto CSM-L agar plates to obtain single colonies, and four colonies of each restreak were re-tested by Nile Red fluorescence and GC analysis. As shown in FIGS. 11A and 11B, a number of cells transformed with farnesene synthase variant produced higher titers of farnesene than the parent control strain, and a few produced even higher titers than strain Y539 transformed with expression plasmid pAM1765 (FS_Aa_Ec on high-copy plasmid).
Example 11
[0313] This example describes methods for screening libraries of sesquiterpene synthase variants by FPP toxicity based growth selection in yeast.
[0314] The washed transformation of strain Y3198 transformed with Construct C of Example 8 was plated to CSM-L agar plates comprising 2% galactose as a sole carbon source. Plates were incubated for 5 days at 30° C. and the colonies were picked, propagated, and analyzed for farnesene titers by Nile Red fluorescence and GC analysis as described. As shown in FIG. 12, approximately 15% of clones grown on galactose as the sole carbon source had at least 15% higher farnesene titers than the average titer obtained with the parent control (strain Y3198 transformed with Construct A). Clones that had at least 15% higher farnesene titers than the parent control were streaked for individual colonies to CSM-L agar plates comprising 2% glucose. For each clone, eight individual colonies were picked and re-tested by GC analysis as described. Clones that maintained >15% higher average farnesene titer than the control through GC assay were promoted for the sesquiterpene competition assay.
Example 12
[0315] This example describes methods for screening sesquiterpene synthase variants by sesquiterpene synthase competition in yeast.
[0316] Plasmids were isolated from the top farnesene producing yeast strains of Example 10 using the Zymoprep® Yeast Plasmid Miniprep Kit (Zymo Research Corp., Orange, Calif.). The plasmids were digested using BamHI and NheI restriction endonucleases, and the farnesene synthase variant coding sequences were gel purified and ligated with expression vector pAM1812 digested with the same two restriction endonucleases, thus replacing the FS_Aa_Sc coding sequence of pAM1812 with the variant FS_S2D_Ec or FS_Aa_Sc coding sequences. The new plasmids were transformed into strain Y3125.
[0317] Alternatively, and in addition, farnesene synthase variant coding sequences were PCR amplified from isolated plasmids or from cell lysates of top farnesene producing yeast strains of Example 11 using primers AM-288-90-CPK1618 (SEQ ID NO: 83) and AM-288-90-CPK1619 (SEQ ID NO: 84), the PCR products were gel purified using the E.Z.N.A.® Gel Extraction Kit (Omega Bio-Tek Inc., Norcross, Ga.) according to manufacturer suggested protocols, and ligated with expression plasmid pAM1948 digested with FastDigest BamHI restriction endonuclease (Fermentas Inc., Burlington, Ontario) via homologous recombination by transforming strain Y3125 with both purified DNA fragments, thus replacing the IS_Pn_Sc coding sequence of pAM1948 with the variant FS_S2D_Ec coding sequences.
[0318] Host cell transformants were plated to CSM-L agar plates with 2% glucose as a sole carbon source, and then replica-plated to CSM-L-U agar plates at 30° C. for at least 72 hours to loop out the GAL80 coding sequence in the host cell transformants. For each clone, eight colonies were picked, propagated, and their terpene titers were determined by GC analysis as described. Farnesene synthase variants that produced a higher farnesene/trichodiene ratio than the ratio obtained for the parent farnesene synthase (strain Y3125 transformed with pAM1812) were re-streaked to CSM-L agar plates. For each re-streak, eight individual colonies were re-tested in a 96-well plate production experiment as described. A total of 11 yeast strains comprising farnesene synthase variant showed improved farnesene/trichodiene ratios, suggesting that these farnesene synthase variants possessed improved in vivo enzyme activity in yeast.
Example 13
[0319] This example describes the characterization of sesquiterpene synthase variants that have improved enzyme activity.
[0320] To identify possible causal mutations, the improved farnesene synthase variants identified in Example 12, and in other libraries of farnesene synthase variants generated and screened essentially as described, were sequenced by Elim Biopharmeceuticals, Inc. (Hayward, Calif.). The identified mutations are listed in Table 16. Overall, an estimated total of 300,000 clones were screened and evaluated by FPP toxicity based growth selection in Escherichia coli and/or yeast, Nile Red fluorescence and/or GC analysis, and sesquiterpene synthase competition in yeast, leading to the identification of 51 farnesene synthase variants with improved enzyme activity. A number of farnesene synthase variants were identified more than once (number of times are indicated in Table 16 in parenthesis next to the variant names), and certain nucleotide and amino acid changes were found in multiple farnesene synthase variants, suggesting causal relationships between the mutations and the increased enzyme activity. In some farnesene synthase variants only silent mutations were uncovered, suggesting that these mutations likely improved expression of the encoded FS.
TABLE-US-00016 TABLE 16 Mutations identified in farnesene synthase variants with improved enzyme activity Variant Amino acid Farnesene/trichodiene ratios FS Nucleotide change change over parent FS 1 1343 (A→G) I434T 163% 2 71 (T→A) V24D 150% 182 (T→A) L61Q 271 (C→T) silent 955 (A→T) T319S 3 71 (T→A) V24D 136% 587 (C→G) T196S 1092 (T→C) silent 1267 (G→A) V423I 1399 (G→A) V467I 4 441 (T→C) silent 129% 807 (A→G) silent 839 (T→A) L280Q 1301 (T→C) I434T 1599 (G→A) silent 1629 (T→C) silent 5 343 (A→G) I115V 129% 587 (C→G) T196S 955 (A→T) T319S 6 429 (T→C) silent 126% 751 (C→A) L251M 861 (G→T) silent 863 (A→T) Y288F 921(A→G) silent 957 (C→A) silent 1325 (G→A) G442D 7 168 (A→T) silent 122% 215 (A→T) E72V 431 (T→A) F144Y 1325 (G→C) G442A 1378 (A→G) I460V 8 32 (T→C) F11S 181% 225 (T→C) Silent 345 (A→G) I115M 1715 (T→A) M572K 9 32 (T→C) F11S 180% 1015 (T→C) Silent 1605 (A→G) Silent 10 598 (T→C) Silent 156 631 (T→A) S211T 1105 (G→C) V369L 11 (7) 11 (T→C) L4S 154% 12 (2) 8 (C→A) T3N 175% 13 (3) 8 (C→A) T3N 188% 870 (T→C) Silent 14 867 (A→G) Silent 124% 1587 (C→A) Silent 15 867 (A→G) Silent 127% 1591 (C→T) P531S 16 867 (A→G) Silent 116% 17 17 (T→C) I6T 149% 18 315 (A→T) E105D 124% 867 (A→G) Silent 19 1337 (C→A) T446N 125% 20 1667 (C→T) A556V 130% 21 238 (A→G) N80D 154% 22 1056 (A→G) Silent 163% 23 1098 (A→G) Silent 156% 24 1111 (T→A) L371M 156% 25 1542 (C→A) Silent 158% 26 627 (C→T) Silent 129% 27 1077 (A→T) E359T 128% 28 1153 (A→G) T385A 132% 1463 (C→T) S488F 29 104 (T→C) M35T 125% 1584 (T→C) Silent 30 1245 (T→C) Silent 137% 1299 (G→A) M433I 1509 (A→T) Silent 31 265 (A→G) I89V 127% 1192 (T→G) l398v 1330 (A→C) I444L 1371 (T→C) silent 1533 (A→G) Silent 1636 (T→C) Silent 1701 (T→C) Silent 32 519 (A→G) silent 120% 33 1491 (T→C) silent 119% 34 1514 (A→T) E505V 115% 35 1576 (A→T) T526S 125% 36 59 (T→A) V20E 128% 37 (3) 214 (G→A) E72K 128% 38 26 (T→A) V9D 129% 39 (A→G) silent 113 (A→G) N38S 148 (G→A) D50N 549 (T→A) silent 1723 (T→A) stop575K 39 792 (A→G) silent 133% 40 1100 (A→T) E357V 139% 1484 (A→G) E495G 1542 (C→T) silent
Example 14
[0321] This example describes methods for combining mutations and screening for improved farnesene synthase variants using sesquiterpene synthase competition in yeast.
[0322] Various amino acid changes identified in Example 13 were combined by sequence overlap extension (SOE; Ho, et al, 1989), and the combinations were screened by sequiterpene synthase competition as described to identify FS with increased enzyme activity. As shown in Table 17, several farnesene synthase variants showed substantial improvements in their farnesene/trichodiene ratios over that of the wild-type A. annua FS. The increased activity of several of these farnesene synthase variants was further confirmed by GC analysis of yeast strains comprising single chromosomally integrated copies of the farnesene synthase variants coding sequences (FIG. 14).
TABLE-US-00017 TABLE 17 Variant FS by combination of mutants Fold increase in enzyme activity over Parent FS coding Amino Acid mutations relative activity of WT FS as measured by Variant FS sequence to wild-type A. annua FS farnesene/trichodiene ratios G6 FS_A F11S, V24D, I115M, V423I, 3 (SEQ ID NO: 118) G442A, I460V, V467I FS_D_3.5 FS_D F11S, V24D, M35T, T196S, 3.5 (SEQ ID NO: 108) Y288F, T319S, I434T, T446N, I460V, V467I FS_A_4A FS_A F11S, V24D, I115M, S211T, 4 (SEQ ID NO: 118) V369L, V423I, I434T, G442A, I460V, V467I FS_A_4B FS_A F11S, V24D, I115M, T196S, 4 (SEQ ID NO: 118) T319S, V423I, I434T, G442A, I460V, V467I FS_A_4.5 FS_A F11S, V24D, I115M, T196S, 4.3 (SEQ ID NO: 118) Y288F, T319S, V423I, I434T, G442A, I460V, V467I FS_A_5.3 FS_A F11S, V24D, M35T, I115M, 5.3 (SEQ ID NO: 118) T196S, Y288F, T319S, I434T, T446N, I460V, V467I FS_B_5.3 FS_B F11S, V24D, M35T, T196S, 5.3 (SEQ ID NO: 119) Y288F, T319S, I434T, T446N, I460V, V467I FS_A_6 FS_A F11S, V20E, V24D, M35T, 6 (SEQ ID NO: 118) I115M, T196S, Y288F, T319S, T385A, I434T, T446N, I460V, V467I FS_C_6 FS_C F11S, V24D, S211T, V369L, 6 (SEQ ID NO: 120) V423I, I434T, G442A, I460V, V467I FS_C_7 FS_C F11S, V24D, M35T, T196S, 7 (SEQ ID NO: 120) Y288F, T319S, I434T, T446N, I460V, V467I FS_C_8 FS_C F11S, V24D, L18I, M35T, 8 (SEQ ID NO: 120) T196S, Y288F, T319S, R348K, T385A, I434T, T446N, I460V, V467I
Example 15
[0323] This example describes methods for expressing and purifying wild-type farnesene synthase and farnesene synthase variant proteins. Escherichia coli Rosetta (DE3) cells were transformed with expression plasmids comprising the FS_Aa_Ec, FS_B--5.3_Ec (FS_B--5.3 codon-optimized for expression in Escherichia coli), or FS_C--8 coding sequence cloned into the BamHI and NdeI sites of vector pAM1490 (SEQ ID NO: 117). Expression of FS in 1 L cultures of host cell transformants were induced by adding 0.4 mM IPTG, and each culture was incubated at 20° C. for 20 hours. Cell lysates were loaded onto His GraviTrap columns pre-packed with Ni Sepharose® 6 Fast Flow resin (GE Healthcare, Piscataway, N.J.). The columns were washed with 10 mL (10 column volumes) Binding Buffer (50 mM Tris-HCl, pH 8.0, 500 mM NaCl, 5 mM imidazole, 5% glycerol, 0.5 mM DTT), and fractions were step-wise eluted using 4 ml Elution Buffer (50 mM Tris-HCl, pH 8.0, 500 mM NaCl, 5% glycerol, 0.5 mM DTT) comprising 50 (Fraction 1), 100 (Fraction 2), or 250 mM (Fraction 3) imidazole. All fractions were dialyzed against Binding Buffer, and Fraction 2 was further dialyzed against Protease Digestion Buffer (20 mM Tris-HCl, pH 7.5, 200 mM NaCl, 5% glycerol, 1 mM DTT) in a dialysis cassette. To remove the His6-tags, 120 U of PreScission Protease (GE Healthcare, Piscataway, N.J.) was added directly to each dialysis cassette, and dialysis was allowed to continue overnight before the protease-digested samples were dialyzed against Storage Buffer (20 mM Tris-HCl, pH 7.5, 200 mM NaCl, 20% glycerol, 1 mM DTT) and were removed from the dialysis cassette. To remove the GST-tagged protease, Glutathione Sepharose 4B beads (GE Healthcare, Piscataway, N.J.) pre-washed with the Storage Buffer were added to the protease-digested samples, and the bead mixtures were incubated for one hour with gentle mixing. The FS proteins were finally recovered by passing the mixtures through a Poly-Prep Chromatography Column (Bio-Rad, Hercules, Calif.), and the purified FS proteins were stored at -80° C.
[0324] The isolated farnesene synthase variants were assayed for kinetic properties. As shown in Table 18, the increased in vivo activity of the farnesene synthase variants was reflected in an increased kcat of the isolated farnesene synthase variants.
TABLE-US-00018 TABLE 18 Steady-state kinetic parameters of wild-type and farnesene synthase variants FS coding sequence kcat (s-1) Relative kcat Km (uM) FS_Aa_Ec 0.071 ± 0.004 1 0.58 ± 0.19 FS_B_5.3_Ec 0.093 ± 0.009 1.31 1.18 ± 0.44 FS_C_8 0.139 ± 0.012 1.96 1.55 ± 0.76
Example 16
[0325] This example describes the use of sesquiterpene synthase competition to select suitable promoters to tune farnesene synthase expression to a level that enables FPP toxicity-based growth selection in yeast.
[0326] Various promoters were PCR amplified as described in Table 19.
TABLE-US-00019 TABLE 19 Templates and primers used to PCR amplify S. cerevisiae promoters Pro- moter of Gene Template PCR primer 1 PCR primer 2 FBA1 100 ng AM-288-160-CPK2063 AM-288-160-CPK2064 of Y002 (SEQ ID NO: 141) (SEQ ID NO: 142) TPI1 genomic AM-288-160-CPK2061 AM-288-160-CPK2062 DNA (SEQ ID NO: 139) (SEQ ID NO: 140) HSP12 AM-288-160-CPK2065 AM-288-160-CPK2066 (SEQ ID NO: 143) (SEQ ID NO: 144) PET9 AM-288-160-CPK2085 AM-288-160-CPK2086 (SEQ ID NO: 151) (SEQ ID NO: 152) QCR9 AM-288-160-CPK2091 AM-288-160-CPK2092 (SEQ ID NO: 114) (SEQ ID NO: 115) QCR7 AM-288-160-CPK2087 AM-288-160-CPK2088 (SEQ ID NO: 153) (SEQ ID NO: 154) CDC19 AM-288-160-CPK2055 AM-288-160-CPK2056 (SEQ ID NO: 135) (SEQ ID NO: 136) TEF2 AM-288-160-CPK2073 AM-288-160-CPK2074 (SEQ ID NO: 147) (SEQ ID NO: 148) PGK1 AM-288-160-CPK2079 AM-288-160-CPK2080 (SEQ ID NO: 149) (SEQ ID NO: 150) SIP18 AM-288-160-CPK2067 AM-288-160-CPK2068 (SEQ ID NO: 145) (SEQ ID NO: 146) ERG8 AM-288-160-CPK2051 AM-288-160-CPK2052 (SEQ ID NO: 131) (SEQ ID NO: 132) GRE1 AM-288-160-CPK2053 AM-288-160-CPK2054 (SEQ ID NO: 133) (SEQ ID NO: 134) PDC1 AM-288-160-CPK2059 AM-288-160-CPK2060 (SEQ ID NO: 137) (SEQ ID NO: 138) ANB1 AM-288-160-CPK2089 AM-288-160-CPK2090 (SEQ ID NO: 155) (SEQ ID NO: 113) PCR amplifications were done using the Phusion High Fidelity DNA Polymerase System (Finnzyme Inc, Espoo, Finland). PCR products were gel purified using the E.Z.N.A. ® Gel Extraction Kit (Omega Bio-Tek Inc., Norcross, GA) according to manufacturer's suggested protocols.
[0327] To replace the GAL1 promoter in pAM2191, the expression plasmid was digested using FastDigest® BamHI restriction endonuclease, and 100 ng of this linearized plasmid was co-transformed with 300 ng of each of the promoters PCR products into exponentially growing Y3198 cells. Host cell transformants were plated to CSM-L with 2% glucose as a sole carbon source, and incubated for 3 days at 30° C. until individual colonies were ˜1 mm in diameter. Eight colonies from each transformation were picked and grown as described, before their farnesene and trichodiene titers were determined by GC analysis as described (Table 20). Promoters that gave farnesene/trichodiene ratios similar to that of the GAL1 promoter linked to the FS_Aa_Sc coding sequence were selected and further screened by FPP-toxicity based growth selection in Y227 as described. Of the tested promoters, the promoter of the PET9 gene was shown to be suitable for use in FPP toxicity-based selection for improved FS when using the FS_A--5.3 coding sequence as the parent template.
TABLE-US-00020 TABLE 20 Farnesene to trichodiene titers obtained using various promoters to drive expression of the FS_A_5.3 coding sequence Promoter FS coding % Strength of GAL1 of Gene sequence Farnesene/Trichodiene promoter GAL1 FS_Aa_Sc 1.06 1 FBA1 FS_A_5.3 1.18 0.222 TPI1 0.875 0.165 HSP12 0.87 0.164 PET9 0.71 0.133 QCR9 0.6 0.113 QCR7 0.525 0.099 CDC19 0.19 0.035 TEF2 0.19 0.035 PGK1 0.19 0.035 SIP18 0.16 0.030 ERG8 0.137 0.025 GRE1 0.093 0.017 PDC1 0.085 0.016 ANB1 0.072 0.013
Example 17
[0328] This example describes methods for porting beneficial mutations of farnesene synthase, identified through sesquiterpene synthase competition, into a related sesquiterpene synthase.
[0329] Various amino acid changes of FS identified in Example 13 were confirmed as causal for improvement in FS activity using saturation mutagenesis, and several of these mutations were ported into a related sesquiterpene synthase, amorphadiene synthase of Artemisia annua (ADS), to determine whether a similar improvement in activity could be achieved. The amino acid positions of FS selected for porting were Met 35, Tyr288, Thr 319, Val 369, Ile 434, Thr 446, 1460 and V467. Based on multiple sequence alignments, the aligned corresponding amino acids in ADS are Ala13, Cys260, Ala291, Met341, Thr406, Thr418, Phe432 and Gly439. Each of these positions were mutated by substitution with 19 other residues, and each mutant was tested in a amorphadiene:trichodiene competition assay.
[0330] The ADS mutants were constructed by using separate PCR reactions to amplify two DNA fragments that overlap at a specific codon in the ADS gene. Each oligonucleotide pair was synthesized with a mismatched degenerate nucleotide sequence in the middle of the oligonucleotide (for example, NNK, wherein K represents mixed G and T bases, and N represents A, T, G and C mixed bases), flanked on both sides by nucleotides that specifically anneal to the target region.
TABLE-US-00021 TABLE 21 Primers used in Constructing ADS-TDS 2μ plasmid Primer Sequence (5' to 3') ADS-A13-F GGAGAAAAAACCCCGGATCCATGGCCTTGACTGAAGAGAAA CCTATAAGGCCAATTNNKAATTTCCCACCTTCTATTTG (SEQ ID NO: 157) ADS-C260-F CATTTGATATTAAGAAAAATGCCCCANNKCTGAGAGATCGTA TCGTTGAATGC (SEQ ID NO: 158) ADS-C260-R CATTTTTCTTAATATCAAATGCCTTCCACC (SEQ ID NO: 159) ADS-A291-F CAAGAGCTAGAGTTTTTTTCACTAAGNNKGTTGCTGTGATAA CACTTATTG (SEQ ID NO: 160) ADS-A291-R GAAAAAAACTCTAGCTCTTGAATAC (SEQ ID NO: 161) ADS-M341-F CATGAAGCCTATTTACAAATTATTCNNKGATACCTACACAGA AATG (SEQ ID NO: 162) ADS-M341-R AATTTGTAAATAGGCTTCATGTATTC (SEQ ID NO: 163) ADS-M406-F GTTATTATCACTGGTGGTGCAAACTTGCTANNKACTACCTGT TATCTAG (SEQ ID NO: 164) ADS-M406-R GTTTGCACCACCAGTGATAATAACTACGGG (SEQ ID NO: 165) ADS-M418-F GTTATCTAGGAATGAGCGATATTTTCNNKAAGGAATCAGTTG AGTGGGC (SEQ ID NO: 166) ADS-M418-R CGCTCATTCCTAGATAACAGGTAG (SEQ ID NO: 167) ADS-F432-F GGGCTGTATCTGCTCCGCCTTTANNKCGTTACAGTGGTATTCT G (SEQ ID NO: 168) ADS-F432-R GGCGGAGCAGATACAGCCCACTCAAC (SEQ ID NO: 169) ADS-G439-F CTTTATTCCGTTACAGTGGTATTCTGNNKAGGAGATTAAATG ACCTGATG (SEQ ID NO: 170) ADS-G439-R GAATACCACTGTAACGGAATAAAG (SEQ ID NO: 171) ADS-SM-5' GAAAAAACCCCGGATCCATGGCCTTGACTGAAGAGAAAC (SEQ ID NO: 172) ADS-SM-3' GGTTAGAGCGGATCTTAGCTAGCTTAGATAGACATAGGGTAA AC (SEQ ID NO: 173)
TABLE-US-00022 TABLE 22 List of PCR reactions for generating ADS saturation mutants AA Fwd Rev Fwd Rev oligo- position oligonucleotide oligonucleotide oligonucleotide nucleotide Ala13 ADS-A13-F ADS-SM-3' Cys260 ADS-SM-5' ADS-C260-R ADS-C260-F ADS-SM-3' Ala291 ADS-SM-5' ADS-A291-R ADS-A291-F ADS-SM-3' Met341 ADS-SM-5' ADS-M341-R ADS-M341-F ADS-SM-3' Thr406 ADS-SM-5' ADS-M406-R ADS-M406-F ADS-SM-3' Thr418 ADS-SM-5' ADS-M418-R ADS-M418-F ADS-SM-3' Phe432 ADS-SM-5' ADS-M432-R ADS-M432-F ADS-SM-3' Gly439 ADS-SM-5' ADS-M439-R ADS-M439-F ADS-SM-3'
[0331] To prepare ADS-TDS competition vectors, pAM1948 plasmid was digested with BamHI and NheI to excise the IS_Pn_Sc coding sequence, and gel purified using the Zymoclean Gel purification kit (Zymo Research, Irvine Calif.). Amplification of the ADS open reading frame (orf) containing each saturation mutant was performed by mixing equimolar amounts of a PCR fragment listed in Table 22 and the appropriate ADS-SM-5' and ADS-SM-3' oligos listed in Table 21, with the exception that for mutagenesis of residue Ala13, ADS-A13-F and ADS-SM-3' were used to amplify the orf directly. The amplified PCR products were gap-repaired in linearized pAM1948 and transformed in Y3125. For each site saturation mutant, the fold-improvement was obtained by comparing the ADS/TDS ratio of the mutant to that of the ADS WT.
[0332] As shown in FIG. 17, substitution of Ala291 with either a valine (A291V; SEQ ID NO: 174), cysteine (A291C; SEQ ID NO: 175) or a isoleucine (A291I; SEQ ID NO: 176) resulted in improvement of the ADS/TDS ratio by more than 30% compared to the ADS parent (WT).
[0333] To confirm the improved activities of ADS A291V, A291C and A291I, amorphadiene titers were determined in cells transformed with expression plasmids for each mutant. The ADS-TDS plasmid containing A291V, A291C and A291I, respectively, was digested using BamHI and NheI and gel extracted. The CEN.ARS plasmid and 2A Leu2 plasmid were linearized using the same restriction enzyme and gel purified. The digested fragments containing ADS mutants were ligated into linearized CEN.ARS or 2μ A Leu2 plasmid using T4 ligase at 16° C. 2 μl of the reaction was transformed into X11-Blue cells and plated on LB plates. Colonies containing each ADS mutant either in CEN.ARS plasmid or 2μ A Leu2 plasmid were sequence verified.
TABLE-US-00023 TABLE 23 List of plasmids encoding ADS variants Plasmid No. Description pAM2507 Artemesia Annua (Aa) ADS mutant A291C on CEN.ARS plasmid using pAM1734 as the backbone pAM2506 Aa.ADS mutant A291I on CEN.ARS plasmid using pAM1734 as the backbone pAM2505 Aa.ADS mutant A291V on CEN.ARS plasmid using pAM1734 as the backbone pAM2504 Aa.ADS WT on CEN.ARS plasmid using pAM1734 as the backbone pAM2503 PGAL1-Aa.ADS mutant A291C in leu2 2u pAM2502 PGAL1-Aa.ADS mutant A291I in leu2 2u pAM2501 PGAL1-Aa.ADS mutant A291V in leu2 2u pAM2419 Aa.ADS mutant A291I (under pGAL1) and TDS (under PGAL10) in leu2d pAM2418 Aa.ADS mutant A291C (under pGAL1) and TDS (under PGAL10) in leu2d pAM2417 Artemesia Annua ADS mutant A291V (under pGAL1) and TDS (under PGAL10) in leu2d pAM2414 Aa. ADS (under pGAL1) and TDS (under PGAL10) in leu2d
[0334] For production, each plasmid was transformed into cured Y227 and plated on CSM-L plates. Eight colonies were picked for each mutant and grown in a 96-well plate containing 360 μl of Bird Seed Media with 4% galactose. After 2 days of incubation at 34° C., 16 μl of each well was inoculated into a new 96-well plate containing fresh Bird Seed Media with 4% galactose for production. After 2 days of incubation at 30° C., production samples were taken for Nile Red and GC analysis.
[0335] As shown in FIG. 18, each of ADS A291V, A291C and A291I showed an increase in amorphadiene production compared to parent ADS when expressed on either a 2μ plasmid or CEN.ARS plasmid. The best mutant, Ala291Val, showed up to 58% improvement in amorphadiene titer than that of the parent.
[0336] These results demonstrate that beneficial mutations identified in one terpene synthase using the terpene synthase competition assay can be successfully ported into a related terpene synthase to effect improved synthase activity.
Example 18
[0337] This example demonstrates the feasibility of using sesquiterpene synthase competition in yeast to rank patchoulol synthases (PS) according to their in vivo enzyme activity levels.
[0338] Yeast strains Y9259, Y11136, Y9260 were made by transforming expression plasmids pAM2596, pAM2702, and pAM2597 into yeast strain Y9120 (comprising the MEV pathway), respectively, and confirmed by colony PCR to contain the correct plasmid. Each plasmid contains a different PS isoform on a GAL1 promoter and identical versions of trichodiene synthase (TDS) on the divergent GAL10 promoter. The confirmed colony was re-streaked for single colonies, from which eight colonies were incubated in separate wells of a 96-well plate containing 360 uL Bird Seed Medium (BSM) with 2% sucrose per well (preculture). After 2 days of incubation at 30° C. with 999 rpm agitation, 6.4 uL of each well was inoculated into a well of a new 96-well plate containing 150 uL of fresh BSM with 4% galactose and 3.33% mineral oil and Brij-56 emulsion (production culture). After another 4 days of incubation at 30° C. with 999 rpm agitation, samples were taken and analyzed for terpene production by gas chromatography (GC) analysis.
[0339] For GC analysis, samples were extracted with methanol-butoxy ethanol-heptane (100 uL:50 uL:400 uL v/v), and the cell material was allowed to settle by gravity. An aliquot of the heptane extract was further diluted into heptane, and then injected onto a methyl silicone stationary phase using a pulsed split injection. Patchouli alcohol and trichodiene were separated by boiling point using GC with flame ionization detection (FID). Hexadecane was used as a retention time marker to monitor successful injection and elution during the specified GC oven profile. The titers of patchouli alcohol and trichodiene were used to calculate the patchouli oil/trichodiene ratios (patchouli oil is approximately three times the titer of patchouli alcohol).
[0340] As shown in Table 24, patchouli oil/trichodiene ratios were fairly consistent across samples, producing CVs of no more than 5.47%. Thus, by co-expressing PS from the same plasmid as a TDS, the tested patchoulol synthases could be ranked as follows (from most active to least active): PS_isoform--3 coding sequence (Y9260)>PS_isoform--2 coding sequence (Y11136)>PS_isoform--1 coding sequence (Y9259).
TABLE-US-00024 TABLE 24 Patchouli Oil and Trichodiene Titers and Titer Ratios for Yeast Strains Expressing a PS and a TDS from the Same Plasmid Patchouli Oil/Trichodiene Strain Coding Sequences (promoters) (CV %) Y9259 PS_isoform_1 (PGAL1) 0.17 (2.16%) TDS_Fs_Sc (PGAL10) Y11136 PS_isoform_2 (PGAL1) 0.68 (5.47%) TDS_Fs_Sc (PGAL10) Y9260 PS_isoform_3 (PGAL1) 1.24 (1.82%) TDS_Fs_Sc (PGAL10)
Example 19
[0341] This example demonstrates the feasibility of using monoterpene synthase competition to rank monoterpene synthases according to their in vivo enzymatic activity.
[0342] To determine the productivity of synthases for the monoterpene limonene, a competition vector was prepared comprising the coding sequence for myrcene synthase of Ocimum basilicum, used here as the comparison terpene synthase, being driven by a pGal10 promoter, and the coding sequence for a query limonene synthase (LS) being driven by pGAL1 on the same plasmid (pAM2645). Eight competition plasmids each encoding a different LS truncation variant or isoform were transformed into yeast strain Y8270 (comprising the MEV pathway), respectively, and transformed strains were confirmed by colony PCR to contain the correct plasmid. Eight single colonies of each strain were incubated in 96-well microtiter plates with 360 μL of Bird Seed Medium containing 2% glucose as a carbon source. After 3 days of growth at 30° C. with shaking at 998 RPM, 6 μL of each culture was inoculated into a well of a 96-well plate containing 75 μL of Bird Seed Medium containing 4% galactose and 75 μL of isopropyl myristate per well. The production plates were sealed with a Velocity 11 heat sealer (Agilent Technologies) and grown at 30° C. with shaking at 998 RPM prior to flash freezing for 2 hours at -20° C. The products were then assayed after quickly adding 300 ml of ethyl acetate containing 0.001% hexadecane internal standard, heat sealing, and shaking for 2 hours at room temperature. Gas chromatogram flame ionization detection (GC-FID) was performed using standard curves of absolute concentrations of myrcene and limonene. In detail, 2 μL of the ethyl acetate extract was injected onto a methyl silicone stationary phase column with a split ratio of 1:50. This injection was analyzed using hexadecane as an internal standard for injection accuracy and retention time adjustment. Oven temperatures were ramped from 25° C.-250° C. over the course of 2.5 minutes, at which point the oven was rapidly cooled for the next sample. The titers of myrcene and the limonene were used to calculate the competition ratio.
[0343] As shown in FIG. 18, the terpene synthase competition assay can be used to rank the relative performance of different limonene synthase truncation variants and isoforms.
[0344] Various modifications and variations of the present disclosure will be apparent to those skilled in the art without departing from the scope and spirit of the disclosure. Although the disclosure has been described in connection with specific preferred embodiments, it should be understood that the claims should not be unduly limited to such specific embodiments. Indeed, various modifications of the described modes for carrying out the disclosure, which are understood by those skilled in the art are intended to be within the scope of the claims.
Sequence CWU
1
176111741DNAArtificial SequenceSynthetic, Expression plasmid pAM765
1gaattccgga tgagcattca tcaggcgggc aagaatgtga ataaaggccg gataaaactt
60gtgcttattt ttctttacgg tctttaaaaa ggccgtaata tccagctgaa cggtctggtt
120ataggtacat tgagcaactg actgaaatgc ctcaaaatgt tctttacgat gccattggga
180tatatcaacg gtggtatatc cagtgatttt tttctccatt ttagcttcct tagctcctga
240aaatctcgat aactcaaaaa atacgcccgg tagtgatctt atttcattat ggtgaaagtt
300ggaacctctt acgtgccgat caacgtctca ttttcgccaa aagttggccc agggcttccc
360ggtatcaaca gggacaccag gatttattta ttctgcgaag tgatcttccg tcacaggtat
420ttattcggcg caaagtgcgt cgggtgatgc tgccaactta ctgatttagt gtatgatggt
480gtttttgagg tgctccagtg gcttctgttt ctatcagctg tccctcctgt tcagctactg
540acggggtggt gcgtaacggc aaaagcaccg ccggacatca gcgctagcgg agtgtatact
600ggcttactat gttggcactg atgagggtgt cagtgaagtg cttcatgtgg caggagaaaa
660aaggctgcac cggtgcgtca gcagaatatg tgatacagga tatattccgc ttcctcgctc
720actgactcgc tacgctcggt cgttcgactg cggcgagcgg aaatggctta cgaacggggc
780ggagatttcc tggaagatgc caggaagata cttaacaggg aagtgagagg gccgcggcaa
840agccgttttt ccataggctc cgcccccctg acaagcatca cgaaatctga cgctcaaatc
900agtggtggcg aaacccgaca ggactataaa gataccaggc gtttccccct ggcggctccc
960tcgtgcgctc tcctgttcct gcctttcggt ttaccggtgt cattccgctg ttatggccgc
1020gtttgtctca ttccacgcct gacactcagt tccgggtagg cagttcgctc caagctggac
1080tgtatgcacg aaccccccgt tcagtccgac cgctgcgcct tatccggtaa ctatcgtctt
1140gagtccaacc cggaaagaca tgcaaaagca ccactggcag cagccactgg taattgattt
1200agaggagtta gtcttgaagt catgcgccgg ttaaggctaa actgaaagga caagttttgg
1260tgactgcgct cctccaagcc agttacctcg gttcaaagag ttggtagctc agagaacctt
1320cgaaaaaccg ccctgcaagg cggttttttc gttttcagag caagagatta cgcgcagacc
1380aaaacgatct caagaagatc atcttattaa tcagataaaa tatttctaga tttcagtgca
1440atttatctct tcaaatgtag cacctgaagt cagccccata cgatataagt tgtaattctc
1500atgtttgaca gcttatcatc gataagcttc cgatggcgcg ccgagaggct ttacacttta
1560tgcttccggc tcgtataatg tgtggaattg tgagcggata acaattgaat tcaaaggagg
1620ccatcctggc catgaagaac tgtgtgattg tttctgcggt ccgcacggcg atcggcagct
1680ttaacggctc tttagcgagc acctctgcaa tcgatctggg tgcgacggtc attaaggccg
1740ccattgaacg cgccaaaatc gacagccagc acgttgatga ggtgatcatg ggcaatgtgt
1800tacaagccgg cctgggtcaa aacccagcgc gtcaagcact gttaaaatct ggtctggccg
1860agaccgtgtg tggcttcacc gtcaataagg tttgcggctc tggcctgaag agcgtggccc
1920tggcagcaca agcgattcaa gccggtcagg cacaaagcat cgttgcgggt ggcatggaga
1980acatgtctct ggcgccgtac ttattagatg ccaaagcccg cagcggttat cgcctgggcg
2040atggtcaggt gtacgacgtc atcttacgcg atggcttaat gtgcgcgacc cacggttacc
2100acatgggtat tacggccgaa aacgtggcga aagaatacgg cattacgcgc gagatgcagg
2160atgaattagc actgcactct cagcgcaaag cagcagccgc gatcgagtct ggtgcgttta
2220cggcggaaat cgtgccagtt aacgtggtca cgcgcaagaa gacgttcgtt ttcagccagg
2280acgagttccc gaaggcaaac agcaccgcgg aggccttagg tgccttacgc ccagcctttg
2340acaaagcggg cacggtcacc gccggtaatg cgagcggcat caatgatggt gcagcggcac
2400tggtcatcat ggaagagagc gccgcattag cagcgggtct gaccccatta gcgcgcatta
2460aatcttatgc cagcggcggc gtcccaccag ccctgatggg catgggtccg gtcccagcca
2520cgcaaaaagc cctgcaatta gcgggcctgc aactggccga cattgatctg atcgaggcga
2580acgaggcgtt tgcagcgcag ttcctggcgg tgggtaagaa tctgggcttc gacagcgaga
2640aagtcaatgt gaacggtggc gcgattgcgt taggccatcc gattggtgca agcggcgcac
2700gcatcttagt gacgttactg cacgccatgc aggcacgcga caagacctta ggcctggcga
2760ccttatgtat tggtggcggt caaggtatcg ccatggtgat cgaacgcctg aactgaagat
2820ctaggaggaa agcaaaatga caataggtat cgacaaaata aacttttacg ttccaaagta
2880ctatgtagac atggctaaat tagcagaagc acgccaagta gacccaaaca aatttttaat
2940tggaattggt caaactgaaa tggctgttag tcctgtaaac caagacatcg tttcaatggg
3000cgctaacgct gctaaggaca ttataacaga cgaagataaa aagaaaattg gtatggtaat
3060tgtggcaact gaatcagcag ttgatgctgc taaagcagcc gctgttcaaa ttcacaactt
3120attaggtatt caaccttttg cacgttgctt tgaaatgaaa gaagcttgtt atgctgcaac
3180accagcaatt caattagcta aagattattt agcaactaga ccgaatgaaa aagtattagt
3240tattgctaca gatacagcac gttatggatt gaattcaggc ggcgagccaa cacaaggtgc
3300tggcgcagtt gcgatggtta ttgcacataa tccaagcatt ttggcattaa atgaagatgc
3360tgttgcttac actgaagacg tttatgattt ctggcgtcca actggacata aatatccatt
3420agttgatggt gcattatcta aagatgctta tatccgctca ttccaacaaa gctggaatga
3480atacgcaaaa cgtcaaggta agtcgctagc tgacttcgca tctctatgct tccatgttcc
3540atttacaaaa atgggtaaaa aggcattaga gtcaatcatt gataacgctg atgaaacaac
3600tcaagagcgt ttacgttcag gatatgaaga tgctgtagat tataaccgtt atgtcggtaa
3660tatttatact ggatcattat atttaagcct aatatcatta cttgaaaatc gtgatttaca
3720agctggtgaa acaatcggtt tattcagtta tggctcaggt tcagttggtg aattttatag
3780tgcgacatta gttgaaggct acaaagatca tttagatcaa gctgcacata aagcattatt
3840aaataaccgt actgaagtat ctgttgatgc atatgaaaca ttcttcaaac gttttgatga
3900cgttgaattt gacgaagaac aagatgctgt tcatgaagat cgtcatattt tctacttatc
3960aaatattgaa aataacgttc gcgaatatca cagaccagag taactagtag gaggaaaaca
4020tcatgcaaag tttagataag aatttccgac atttatctcg tcaacaaaag ttacaacaat
4080tggtagataa gcaatggtta tcagaagatc aattcgacat tttattgaat catccattaa
4140ttgatgagga agtagcaaat agtttaattg aaaatgtcat cgcgcaaggt gcattacccg
4200ttggattatt accgaatatc attgtggacg ataaggcata tgttgtacct atgatggtgg
4260aagagccttc agttgtcgct gcagctagtt atggtgcaaa gctagtgaat cagactggcg
4320gatttaaaac ggtatcttct gaacgtatta tgataggtca aatcgtcttt gatggcgttg
4380acgatactga aaaattatca gcagacatta aagctttaga aaagcaaatt cataaaattg
4440cggatgaggc atatccttct attaaagcgc gtggtggtgg ttaccaacgt atagctattg
4500atacatttcc tgagcaacag ttactatctt taaaagtatt tgttgatacg aaagatgcta
4560tgggcgctaa tatgcttaat acgattttag aggccataac tgcattttta aaaaatgaat
4620ctccacaaag cgacatttta atgagtattt tatccaatca tgcaacagcg tccgttgtta
4680aagttcaagg cgaaattgac gttaaagatt tagcaagggg cgagagaact ggagaagagg
4740ttgccaaacg aatggaacgt gcttctgtat tggcacaagt tgatattcat cgtgctgcaa
4800cacataataa aggtgttatg aatggcatac atgccgttgt tttagcaaca ggaaatgata
4860cgcgtggtgc agaagcaagt gcgcatgcat acgcgagtcg tgacggacag tatcgtggta
4920ttgcaacatg gagatacgat caaaaacgtc aacgtttaat tggtacaata gaagtgccta
4980tgacattggc aatcgttggc ggtggtacaa aagtattacc aattgctaaa gcttctttag
5040aattgctaaa tgtagattca gcacaagaat taggtcatgt agttgctgcc gttggtttag
5100cacagaactt tgcagcatgt cgcgcgctcg tttccgaagg tatccagcaa ggccatatga
5160gcttgcaata taaatcttta gctattgttg taggtgcaaa aggtgatgaa attgcgcaag
5220tagctgaagc attgaagcaa gaaccccgtg cgaatacaca agtagctgaa cgcattttac
5280aagaaattag acaacaatag tctagaagca gcttcgatcc catggtacgc gtgctagagg
5340catcaaataa aacgaaaggc tcagtcgaaa gactgggcct ttcgttttat ctgttgtttg
5400tcggtgaacg ctctcctgag taggacaaat ccgccggcga tcgccgagag gctttacact
5460ttatgcttcc ggctcgtata atgtgtggaa ttgtgagcgg ataacaattg aattcaaagg
5520aggctcgaga tgacgcgcaa aggctacggt gaatctactg gtaagattat cctgattggc
5580gagcatgctg taacctttgg cgaacctgcc atcgcagtac cgttcaacgc gggcaaaatc
5640aaggttctga tcgaagccct ggagtccggc aactattcta gcatcaaatc tgacgtatac
5700gacggtatgc tgtacgacgc gccggaccac ctgaagagcc tggtgaaccg ttttgttgaa
5760ctgaacaaca tcactgaacc gctggcggta accattcaga ccaacctgcc gccatctcgc
5820ggcctgggta gctctgctgc ggttgctgta gcgttcgtac gcgcgtctta tgatttcctg
5880ggtaagtctc tgaccaaaga agaactgatt gagaaagcga actgggcaga acagattgca
5940cacggcaaac caagcggcat cgacacccaa actattgtgt ctggcaaacc agtttggttc
6000caaaaaggcc aggcggagac cctgaaaacc ctgagcctgg acggttacat ggttgtaatt
6060gacactggtg taaaaggcag cacccgccag gcagtagagg atgtgcacaa actgtgcgaa
6120gaccctcagt atatgagcca cgtgaagcac atcggtaaac tggtactgcg cgcttctgac
6180gtgattgaac accacaactt cgaagcactg gcggatatct tcaacgaatg ccatgcggat
6240ctgaaagcac tgactgtgag ccatgacaaa attgagcagc tgatgaaaat cggcaaagaa
6300aacggtgcga tcgctggcaa actgactggt gcaggtcgcg gtggctctat gctgctgctg
6360gctaaagacc tgccgactgc taaaaacatt gttaaggcag tagaaaaggc aggtgctgca
6420cacacttgga ttgaaaacct gggtggttag gaggcagatc aaatgtcaga gttgagagcc
6480ttcagtgccc cagggaaagc gttactagct ggtggatatt tagttttaga tacaaaatat
6540gaagcatttg tagtcggatt atcggcaaga atgcatgctg tagcccatcc ttacggttca
6600ttgcaagggt ctgataagtt tgaagtgcgt gtgaaaagta aacaatttaa agatggggag
6660tggctgtacc atataagtcc taaaagtggc ttcattcctg tttcgatagg cggatctaag
6720aaccctttca ttgaaaaagt tatcgctaac gtatttagct actttaaacc taacatggac
6780gactactgca atagaaactt gttcgttatt gatattttct ctgatgatgc ctaccattct
6840caggaggata gcgttaccga acatcgtggc aacagaagat tgagttttca ttcgcacaga
6900attgaagaag ttcccaaaac agggctgggc tcctcggcag gtttagtcac agttttaact
6960acagctttgg cctccttttt tgtatcggac ctggaaaata atgtagacaa atatagagaa
7020gttattcata atttagcaca agttgctcat tgtcaagctc agggtaaaat tggaagcggg
7080tttgatgtag cggcggcagc atatggatct atcagatata gaagattccc acccgcatta
7140atctctaatt tgccagatat tggaagtgct acttacggca gtaaactggc gcatttggtt
7200gatgaagaag actggaatat tacgattaaa agtaaccatt taccttcggg attaacttta
7260tggatgggcg atattaagaa tggttcagaa acagtaaaac tggtccagaa ggtaaaaaat
7320tggtatgatt cgcatatgcc agaaagcttg aaaatatata cagaactcga tcatgcaaat
7380tctagattta tggatggact atctaaacta gatcgcttac acgagactca tgacgattac
7440agcgatcaga tatttgagtc tcttgagagg aatgactgta cctgtcaaaa gtatcctgaa
7500atcacagaag ttagagatgc agttgccaca attagacgtt cctttagaaa aataactaaa
7560gaatctggtg ccgatatcga acctcccgta caaactagct tattggatga ttgccagacc
7620ttaaaaggag ttcttacttg cttaatacct ggtgctggtg gttatgacgc cattgcagtg
7680attactaagc aagatgttga tcttagggct caaaccgcta atgacaaaag attttctaag
7740gttcaatggc tggatgtaac tcaggctgac tggggtgtta ggaaagaaaa agatccggaa
7800acttatcttg ataaatagga ggtaatactc atgaccgttt acacagcatc cgttaccgca
7860cccgtcaaca tcgcaaccct taagtattgg gggaaaaggg acacgaagtt gaatctgccc
7920accaattcgt ccatatcagt gactttatcg caagatgacc tcagaacgtt gacctctgcg
7980gctactgcac ctgagtttga acgcgacact ttgtggttaa atggagaacc acacagcatc
8040gacaatgaaa gaactcaaaa ttgtctgcgc gacctacgcc aattaagaaa ggaaatggaa
8100tcgaaggacg cctcattgcc cacattatct caatggaaac tccacattgt ctccgaaaat
8160aactttccta cagcagctgg tttagcttcc tccgctgctg gctttgctgc attggtctct
8220gcaattgcta agttatacca attaccacag tcaacttcag aaatatctag aatagcaaga
8280aaggggtctg gttcagcttg tagatcgttg tttggcggat acgtggcctg ggaaatggga
8340aaagctgaag atggtcatga ttccatggca gtacaaatcg cagacagctc tgactggcct
8400cagatgaaag cttgtgtcct agttgtcagc gatattaaaa aggatgtgag ttccactcag
8460ggtatgcaat tgaccgtggc aacctccgaa ctatttaaag aaagaattga acatgtcgta
8520ccaaagagat ttgaagtcat gcgtaaagcc attgttgaaa aagatttcgc cacctttgca
8580aaggaaacaa tgatggattc caactctttc catgccacat gtttggactc tttccctcca
8640atattctaca tgaatgacac ttccaagcgt atcatcagtt ggtgccacac cattaatcag
8700ttttacggag aaacaatcgt tgcatacacg tttgatgcag gtccaaatgc tgtgttgtac
8760tacttagctg aaaatgagtc gaaactcttt gcatttatct ataaattgtt tggctctgtt
8820cctggatggg acaagaaatt tactactgag cagcttgagg ctttcaacca tcaatttgaa
8880tcatctaact ttactgcacg tgaattggat cttgagttgc aaaaggatgt tgccagagtg
8940attttaactc aagtcggttc aggcccacaa gaaacaaacg aatctttgat tgacgcaaag
9000actggtctac caaaggaata actgcagccc gggaggagga ttactatatg caaacggaac
9060acgtcatttt attgaatgca cagggagttc ccacgggtac gctggaaaag tatgccgcac
9120acacggcaga cacccgctta catctcgcgt tctccagttg gctgtttaat gccaaaggac
9180aattattagt tacccgccgc gcactgagca aaaaagcatg gcctggcgtg tggactaact
9240cggtttgtgg gcacccacaa ctgggagaaa gcaacgaaga cgcagtgatc cgccgttgcc
9300gttatgagct tggcgtggaa attacgcctc ctgaatctat ctatcctgac tttcgctacc
9360gcgccaccga tccgagtggc attgtggaaa atgaagtgtg tccggtattt gccgcacgca
9420ccactagtgc gttacagatc aatgatgatg aagtgatgga ttatcaatgg tgtgatttag
9480cagatgtatt acacggtatt gatgccacgc cgtgggcgtt cagtccgtgg atggtgatgc
9540aggcgacaaa tcgcgaagcc agaaaacgat tatctgcatt tacccagctt aaataacccg
9600ggggatccac tagttctaga gcggccgcca ccgcggagga ggaatgagta atggactttc
9660cgcagcaact cgaagcctgc gttaagcagg ccaaccaggc gctgagccgt tttatcgccc
9720cactgccctt tcagaacact cccgtggtcg aaaccatgca gtatggcgca ttattaggtg
9780gtaagcgcct gcgacctttc ctggtttatg ccaccggtca tatgttcggc gttagcacaa
9840acacgctgga cgcacccgct gccgccgttg agtgtatcca cgcttactca ttaattcatg
9900atgatttacc ggcaatggat gatgacgatc tgcgtcgcgg tttgccaacc tgccatgtga
9960agtttggcga agcaaacgcg attctcgctg gcgacgcttt acaaacgctg gcgttctcga
10020ttttaagcga tgccgatatg ccggaagtgt cggaccgcga cagaatttcg atgatttctg
10080aactggcgag cgccagtggt attgccggaa tgtgcggtgg tcaggcatta gatttagacg
10140cggaaggcaa acacgtacct ctggacgcgc ttgagcgtat tcatcgtcat aaaaccggcg
10200cattgattcg cgccgccgtt cgccttggtg cattaagcgc cggagataaa ggacgtcgtg
10260ctctgccggt actcgacaag tatgcagaga gcatcggcct tgccttccag gttcaggatg
10320acatcctgga tgtggtggga gatactgcaa cgttgggaaa acgccagggt gccgaccagc
10380aacttggtaa aagtacctac cctgcacttc tgggtcttga gcaagcccgg aagaaagccc
10440gggatctgat cgacgatgcc cgtcagtcgc tgaaacaact ggctgaacag tcactcgata
10500cctcggcact ggaagcgcta gcggactaca tcatccagcg taataaataa gagctccaat
10560tcgccctata gtgagacgcg tgctagaggc atcaaataaa acgaaaggct cagtcgaaag
10620actgggcctt tcgttttatc tgttgtttgt cggtgaacgc tctcctgagt taattaactc
10680caggccggcc tacgcgttta aacttccggt taacgccatg agcggcctca tttcttattc
10740tgagttacaa cagtccgcac cgctgccggt agctccttcc ggtgggcgcg gggcatgact
10800atcgtcgccg cacttatgac tgtcttcttt atcatgcaac tcgtaggaca ggtgccggca
10860gcgcccaaca gtcccccggc cacggggcct gccaccatac ccacgccgaa acaagcgccc
10920tgcaccatta tgttccggat ctgcatcgca ggatgctgct ggctaccctg tggaacacct
10980acatctgtat taacgaagcg ctaaccgttt ttatcaggct ctgggaggca gaataaatga
11040tcatatcgtc aattattacc tccacgggga gagcctgagc aaactggcct caggcatttg
11100agaagcacac ggtcacactg cttccggtag tcaataaacc ggtaaaccag caatagacat
11160aagcggctat ttaacgaccc tgccctgaac cgacgaccgg gtcgaatttg ctttcgaatt
11220tctgccattc atccgcttat tatcacttat tcaggcgtag caccaggcgt ttaagggcac
11280caataactgc cttaaaaaaa ttacgccccg ccctgccact catcgcagta ctgttgtaat
11340tcattaagca ttctgccgac atggaagcca tcacagacgg catgatgaac ctgaatcgcc
11400agcggcatca gcaccttgtc gccttgcgta taatatttgc ccatggtgaa aacgggggcg
11460aagaagttgt ccatattggc cacgtttaaa tcaaaactgg tgaaactcac ccagggattg
11520gctgagacga aaaacatatt ctcaataaac cctttaggga aataggccag gttttcaccg
11580taacacgcca catcttgcga atatatgtgt agaaactgcc ggaaatcgtc gtggtattca
11640ctccagagcg atgaaaacgt ttcagtttgc tcatggaaaa cggtgtaaca agggtgaaca
11700ctatcccata tcaccagctc accgtctttc attgccatac g
1174125050DNAArtificial SequenceSynthetic,
TRP1_PGAL10-ERG20_PGAL1-tHMGR_TRP insert of expression plasmid
pAM489 2gtttaaacta ctattagctg aattgccact gctatcgttg ttagtggcgt tagtgcttgc
60attcaaagac atggagggcg ttattacgcc ggagctcctc gacagcagat ctgatgactg
120gtcaatatat ttttgcattg aggctctgtt tggaattata ttttgagatg acccatctaa
180tgtactggta tcaccagatt tcatgtcgtt ttttaaagcg gctgcttgag tcttagcaat
240agcgtcacca tctggtgaat cctttgaagg aaccactgac gaaggtttgg acagtgacga
300agaggatctt tcctgctttg aattagtcgc gctgggagca gatgacgagt tggtggagct
360gggggcagga ttgctggccg tcgtgggtcc tgaatgggtc cttggctggt ccatctctat
420tctgaaaacg gaagaggagt agggaatatt actggctgaa aataagtctt gaatgaacgt
480atacgcgtat atttctacca atctctcaac actgagtaat ggtagttata agaaagagac
540cgagttaggg acagttagag gcggtggaga tattccttat ggcatgtctg gcgatgataa
600aacttttcaa acggcagccc cgatctaaaa gagctgacac ccgggagtta tgacaattac
660aacaacagaa ttctttctat atatgcacga acttgtaata tggaagaaat tatgacgtac
720aaactataaa gtaaatattt tacgtaacac atggtgctgt tgtgcttctt tttcaagaga
780ataccaatga cgtatgacta agtttaggat ttaatgcagg tgacggaccc atctttcaaa
840cgatttatat cagtggcgtc caaattgtta ggttttgttg gttcagcagg tttcctgttg
900tgggtcatat gactttgaac caaatggccg gctgctaggg cagcacataa ggataattca
960cctgccaaga cggcacaggc aactattctt gctaattgac gtgcgttggt accaggagcg
1020gtagcatgtg ggcctcttac acctaataag tccaacatgg caccttgtgg ttctagaaca
1080gtaccaccac cgatggtacc tacttcgatg gatggcatgg atacggaaat tctcaaatca
1140ccgtccactt ctttcatcaa tgttatacag ttggaacttt cgacattttg tgcaggatct
1200tgtcctaatg ccaagaaaac agctgtcact aaattagctg catgtgcgtt aaatccacca
1260acagacccag ccattgcaga tccaaccaaa ttcttagcaa tgttcaactc aaccaatgcg
1320gaaacatcac tttttaacac ttttctgaca acatcaccag gaatagtagc ttctgcgacg
1380acactcttac cacgaccttc gatccagttg atggcagctg gttttttgtc ggtacagtag
1440ttaccagaaa cggagacaac ctccatatct tcccagccat actcttctac catttgcttt
1500aatgagtatt cgacaccctt agaaatcata ttcataccca ttgcgtcacc agtagttgtt
1560ctaaatctca tgaagagtaa atctcctgct agacaagttt gaatatgttg cagacgtgca
1620aatcttgatg tagagttaaa agctttttta attgcgtttt gtccctcttc tgagtctaac
1680catatcttac aggcaccaga tcttttcaaa gttgggaaac ggactactgg gcctcttgtc
1740ataccatcct tagttaaaac agttgttgca ccaccgccag cattgattgc cttacagcca
1800cgcatggcag aagctaccaa acaaccctct gtagttgcca ttggtatatg ataagatgta
1860ccatcgataa ccaaggggcc tataacacca acgggcaaag gcatgtaacc tataacattt
1920tcacaacaag cgccaaatac gcggtcgtag tcataatttt tatatggtaa acgatcagat
1980gctaatacag gagcttctgc caaaattgaa agagccttcc tacgtaccgc aaccgctctc
2040gtagtatcac ctaatttttt ctccaaagcg tacaaaggta acttaccgtg aataaccaag
2100gcagcgacct ctttgttctt caattgtttt gtatttccac tacttaataa tgcttctaat
2160tcttctaaag gacgtatttt cttatccaag ctttcaatat cgcgggaatc atcttcctca
2220ctagatgatg aaggtcctga tgagctcgat tgcgcagatg ataaactttt gactttcgat
2280ccagaaatga ctgttttatt ggttaaaact ggtgtagaag ccttttgtac aggagcagta
2340aaagacttct tggtgacttc agtcttcacc aattggtctg cagccattat agttttttct
2400ccttgacgtt aaagtataga ggtatattaa caattttttg ttgatacttt tatgacattt
2460gaataagaag taatacaaac cgaaaatgtt gaaagtatta gttaaagtgg ttatgcagct
2520tttgcattta tatatctgtt aatagatcaa aaatcatcgc ttcgctgatt aattacccca
2580gaaataaggc taaaaaacta atcgcattat tatcctatgg ttgttaattt gattcgttga
2640tttgaaggtt tgtggggcca ggttactgcc aatttttcct cttcataacc ataaaagcta
2700gtattgtaga atctttattg ttcggagcag tgcggcgcga ggcacatctg cgtttcagga
2760acgcgaccgg tgaagaccag gacgcacgga ggagagtctt ccgtcggagg gctgtcgccc
2820gctcggcggc ttctaatccg tacttcaata tagcaatgag cagttaagcg tattactgaa
2880agttccaaag agaaggtttt tttaggctaa gataatgggg ctctttacat ttccacaaca
2940tataagtaag attagatatg gatatgtata tggtggtatt gccatgtaat atgattatta
3000aacttctttg cgtccatcca aaaaaaaagt aagaattttt gaaaattcaa tataaatggc
3060ttcagaaaaa gaaattagga gagagagatt cttgaacgtt ttccctaaat tagtagagga
3120attgaacgca tcgcttttgg cttacggtat gcctaaggaa gcatgtgact ggtatgccca
3180ctcattgaac tacaacactc caggcggtaa gctaaataga ggtttgtccg ttgtggacac
3240gtatgctatt ctctccaaca agaccgttga acaattgggg caagaagaat acgaaaaggt
3300tgccattcta ggttggtgca ttgagttgtt gcaggcttac ttcttggtcg ccgatgatat
3360gatggacaag tccattacca gaagaggcca accatgttgg tacaaggttc ctgaagttgg
3420ggaaattgcc atcaatgacg cattcatgtt agaggctgct atctacaagc ttttgaaatc
3480tcacttcaga aacgaaaaat actacataga tatcaccgaa ttgttccatg aggtcacctt
3540ccaaaccgaa ttgggccaat tgatggactt aatcactgca cctgaagaca aagtcgactt
3600gagtaagttc tccctaaaga agcactcctt catagttact ttcaagactg cttactattc
3660tttctacttg cctgtcgcat tggccatgta cgttgccggt atcacggatg aaaaggattt
3720gaaacaagcc agagatgtct tgattccatt gggtgaatac ttccaaattc aagatgacta
3780cttagactgc ttcggtaccc cagaacagat cggtaagatc ggtacagata tccaagataa
3840caaatgttct tgggtaatca acaaggcatt ggaacttgct tccgcagaac aaagaaagac
3900tttagacgaa aattacggta agaaggactc agtcgcagaa gccaaatgca aaaagatttt
3960caatgacttg aaaattgaac agctatacca cgaatatgaa gagtctattg ccaaggattt
4020gaaggccaaa atttctcagg tcgatgagtc tcgtggcttc aaagctgatg tcttaactgc
4080gttcttgaac aaagtttaca agagaagcaa atagaactaa cgctaatcga taaaacatta
4140gatttcaaac tagataagga ccatgtataa gaactatata cttccaatat aatatagtat
4200aagctttaag atagtatctc tcgatctacc gttccacgtg actagtccaa ggattttttt
4260taacccggga tatatgtgta ctttgcagtt atgacgccag atggcagtag tggaagatat
4320tctttattga aaaatagctt gtcaccttac gtacaatctt gatccggagc ttttcttttt
4380ttgccgatta agaattcggt cgaaaaaaga aaaggagagg gccaagaggg agggcattgg
4440tgactattga gcacgtgagt atacgtgatt aagcacacaa aggcagcttg gagtatgtct
4500gttattaatt tcacaggtag ttctggtcca ttggtgaaag tttgcggctt gcagagcaca
4560gaggccgcag aatgtgctct agattccgat gctgacttgc tgggtattat atgtgtgccc
4620aatagaaaga gaacaattga cccggttatt gcaaggaaaa tttcaagtct tgtaaaagca
4680tataaaaata gttcaggcac tccgaaatac ttggttggcg tgtttcgtaa tcaacctaag
4740gaggatgttt tggctctggt caatgattac ggcattgata tcgtccaact gcatggagat
4800gagtcgtggc aagaatacca agagttcctc ggtttgccag ttattaaaag actcgtattt
4860ccaaaagact gcaacatact actcagtgca gcttcacaga aacctcattc gtttattccc
4920ttgtttgatt cagaagcagg tgggacaggt gaacttttgg attggaactc gatttctgac
4980tgggttggaa ggcaagagag ccccgaaagc ttacatttta tgttagctgg tggactgacg
5040ccgtttaaac
5050330DNAArtificial SequenceSynthetic, Primer 61-67-CPK001-G 3gtttaaacta
ctattagctg aattgccact
30446DNAArtificial SequenceSynthetic, Primer 61-67-CPK002-G 4actgcaaagt
acacatatat cccgggtgtc agctctttta gatcgg
46546DNAArtificial SequenceSynthetic, Primer 61-67-CPK003-G 5ccgatctaaa
agagctgaca cccgggatat atgtgtactt tgcagt
46630DNAArtificial SequenceSynthetic, Primer 61-67-CPK004-G 6gtttaaacgg
cgtcagtcca ccagctaaca
30735DNAArtificial SequenceSynthetic, Primer 61-67-CPK025-G 7tccccccggg
ttaaaaaaaa tccttggact agtca
35847DNAArtificial SequenceSynthetic, Primer 61-67-CPK050-G 8aatttttgaa
aattcaatat aaatggcttc agaaaaagaa attagga
47947DNAArtificial SequenceSynthetic, Primer 61-67-CPK051-G 9tcctaatttc
tttttctgaa gccatttata ttgaattttc aaaaatt
471051DNAArtificial SequenceSynthetic, Primer 61-67-CPK052-G 10agttttcacc
aattggtctg cagccattat agttttttct ccttgacgtt a
511151DNAArtificial SequenceSynthetic, Primer 61-67-CPK053-G 11taacgtcaag
gagaaaaaac tataatggct gcagaccaat tggtgaaaac t
511235DNAArtificial SequenceSynthetic, Primer 61-67-CPK031-G 12tccccccggg
agttatgaca attacaacaa cagaa
35135488DNAArtificial SequenceSynthetic,
URA3_PGAL10-ERG13_PGAL1-tHMGR_URA3 insert of expression plasmid
pAM491 13gtttaaactt gctaaattcg agtgaaacac aggaagacca gaaaatcctc
atttcatcca 60tattaacaat aatttcaaat gtttatttgc attatttgaa actagggaag
acaagcaacg 120aaacgttttt gaaaattttg agtattttca ataaatttgt agaggactca
gatattgaaa 180aaaagctaca gcaattaata cttgataaga agagtattga gaagggcaac
ggttcatcat 240ctcatggatc tgcacatgaa caaacaccag agtcaaacga cgttgaaatt
gaggctactg 300cgccaattga tgacaataca gacgatgata acaaaccgaa gttatctgat
gtagaaaagg 360attaaagatg ctaagagata gtgatgatat ttcataaata atgtaattct
atatatgtta 420attacctttt ttgcgaggca tatttatggt gaaggataag ttttgaccat
caaagaaggt 480taatgtggct gtggtttcag ggtccatacc cgggagttat gacaattaca
acaacagaat 540tctttctata tatgcacgaa cttgtaatat ggaagaaatt atgacgtaca
aactataaag 600taaatatttt acgtaacaca tggtgctgtt gtgcttcttt ttcaagagaa
taccaatgac 660gtatgactaa gtttaggatt taatgcaggt gacggaccca tctttcaaac
gatttatatc 720agtggcgtcc aaattgttag gttttgttgg ttcagcaggt ttcctgttgt
gggtcatatg 780actttgaacc aaatggccgg ctgctagggc agcacataag gataattcac
ctgccaagac 840ggcacaggca actattcttg ctaattgacg tgcgttggta ccaggagcgg
tagcatgtgg 900gcctcttaca cctaataagt ccaacatggc accttgtggt tctagaacag
taccaccacc 960gatggtacct acttcgatgg atggcatgga tacggaaatt ctcaaatcac
cgtccacttc 1020tttcatcaat gttatacagt tggaactttc gacattttgt gcaggatctt
gtcctaatgc 1080caagaaaaca gctgtcacta aattagctgc atgtgcgtta aatccaccaa
cagacccagc 1140cattgcagat ccaaccaaat tcttagcaat gttcaactca accaatgcgg
aaacatcact 1200ttttaacact tttctgacaa catcaccagg aatagtagct tctgcgacga
cactcttacc 1260acgaccttcg atccagttga tggcagctgg ttttttgtcg gtacagtagt
taccagaaac 1320ggagacaacc tccatatctt cccagccata ctcttctacc atttgcttta
atgagtattc 1380gacaccctta gaaatcatat tcatacccat tgcgtcacca gtagttgttc
taaatctcat 1440gaagagtaaa tctcctgcta gacaagtttg aatatgttgc agacgtgcaa
atcttgatgt 1500agagttaaaa gcttttttaa ttgcgttttg tccctcttct gagtctaacc
atatcttaca 1560ggcaccagat cttttcaaag ttgggaaacg gactactggg cctcttgtca
taccatcctt 1620agttaaaaca gttgttgcac caccgccagc attgattgcc ttacagccac
gcatggcaga 1680agctaccaaa caaccctctg tagttgccat tggtatatga taagatgtac
catcgataac 1740caaggggcct ataacaccaa cgggcaaagg catgtaacct ataacatttt
cacaacaagc 1800gccaaatacg cggtcgtagt cataattttt atatggtaaa cgatcagatg
ctaatacagg 1860agcttctgcc aaaattgaaa gagccttcct acgtaccgca accgctctcg
tagtatcacc 1920taattttttc tccaaagcgt acaaaggtaa cttaccgtga ataaccaagg
cagcgacctc 1980tttgttcttc aattgttttg tatttccact acttaataat gcttctaatt
cttctaaagg 2040acgtattttc ttatccaagc tttcaatatc gcgggaatca tcttcctcac
tagatgatga 2100aggtcctgat gagctcgatt gcgcagatga taaacttttg actttcgatc
cagaaatgac 2160tgttttattg gttaaaactg gtgtagaagc cttttgtaca ggagcagtaa
aagacttctt 2220ggtgacttca gtcttcacca attggtctgc agccattata gttttttctc
cttgacgtta 2280aagtatagag gtatattaac aattttttgt tgatactttt atgacatttg
aataagaagt 2340aatacaaacc gaaaatgttg aaagtattag ttaaagtggt tatgcagctt
ttgcatttat 2400atatctgtta atagatcaaa aatcatcgct tcgctgatta attaccccag
aaataaggct 2460aaaaaactaa tcgcattatt atcctatggt tgttaatttg attcgttgat
ttgaaggttt 2520gtggggccag gttactgcca atttttcctc ttcataacca taaaagctag
tattgtagaa 2580tctttattgt tcggagcagt gcggcgcgag gcacatctgc gtttcaggaa
cgcgaccggt 2640gaagaccagg acgcacggag gagagtcttc cgtcggaggg ctgtcgcccg
ctcggcggct 2700tctaatccgt acttcaatat agcaatgagc agttaagcgt attactgaaa
gttccaaaga 2760gaaggttttt ttaggctaag ataatggggc tctttacatt tccacaacat
ataagtaaga 2820ttagatatgg atatgtatat ggtggtattg ccatgtaata tgattattaa
acttctttgc 2880gtccatccaa aaaaaaagta agaatttttg aaaattcaat ataaatgaaa
ctctcaacta 2940aactttgttg gtgtggtatt aaaggaagac ttaggccgca aaagcaacaa
caattacaca 3000atacaaactt gcaaatgact gaactaaaaa aacaaaagac cgctgaacaa
aaaaccagac 3060ctcaaaatgt cggtattaaa ggtatccaaa tttacatccc aactcaatgt
gtcaaccaat 3120ctgagctaga gaaatttgat ggcgtttctc aaggtaaata cacaattggt
ctgggccaaa 3180ccaacatgtc ttttgtcaat gacagagaag atatctactc gatgtcccta
actgttttgt 3240ctaagttgat caagagttac aacatcgaca ccaacaaaat tggtagatta
gaagtcggta 3300ctgaaactct gattgacaag tccaagtctg tcaagtctgt cttgatgcaa
ttgtttggtg 3360aaaacactga cgtcgaaggt attgacacgc ttaatgcctg ttacggtggt
accaacgcgt 3420tgttcaactc tttgaactgg attgaatcta acgcatggga tggtagagac
gccattgtag 3480tttgcggtga tattgccatc tacgataagg gtgccgcaag accaaccggt
ggtgccggta 3540ctgttgctat gtggatcggt cctgatgctc caattgtatt tgactctgta
agagcttctt 3600acatggaaca cgcctacgat ttttacaagc cagatttcac cagcgaatat
ccttacgtcg 3660atggtcattt ttcattaact tgttacgtca aggctcttga tcaagtttac
aagagttatt 3720ccaagaaggc tatttctaaa gggttggtta gcgatcccgc tggttcggat
gctttgaacg 3780ttttgaaata tttcgactac aacgttttcc atgttccaac ctgtaaattg
gtcacaaaat 3840catacggtag attactatat aacgatttca gagccaatcc tcaattgttc
ccagaagttg 3900acgccgaatt agctactcgc gattatgacg aatctttaac cgataagaac
attgaaaaaa 3960cttttgttaa tgttgctaag ccattccaca aagagagagt tgcccaatct
ttgattgttc 4020caacaaacac aggtaacatg tacaccgcat ctgtttatgc cgcctttgca
tctctattaa 4080actatgttgg atctgacgac ttacaaggca agcgtgttgg tttattttct
tacggttccg 4140gtttagctgc atctctatat tcttgcaaaa ttgttggtga cgtccaacat
attatcaagg 4200aattagatat tactaacaaa ttagccaaga gaatcaccga aactccaaag
gattacgaag 4260ctgccatcga attgagagaa aatgcccatt tgaagaagaa cttcaaacct
caaggttcca 4320ttgagcattt gcaaagtggt gtttactact tgaccaacat cgatgacaaa
tttagaagat 4380cttacgatgt taaaaaataa tcttccccca tcgattgcat cttgctgaac
ccccttcata 4440aatgctttat ttttttggca gcctgctttt tttagctctc atttaataga
gtagtttttt 4500aatctatata ctaggaaaac tctttattta ataacaatga tatatatata
cccgggaagc 4560ttttcaattc atcttttttt tttttgttct tttttttgat tccggtttct
ttgaaatttt 4620tttgattcgg taatctccga gcagaaggaa gaacgaagga aggagcacag
acttagattg 4680gtatatatac gcatatgtgg tgttgaagaa acatgaaatt gcccagtatt
cttaacccaa 4740ctgcacagaa caaaaacctg caggaaacga agataaatca tgtcgaaagc
tacatataag 4800gaacgtgctg ctactcatcc tagtcctgtt gctgccaagc tatttaatat
catgcacgaa 4860aagcaaacaa acttgtgtgc ttcattggat gttcgtacca ccaaggaatt
actggagtta 4920gttgaagcat taggtcccaa aatttgttta ctaaaaacac atgtggatat
cttgactgat 4980ttttccatgg agggcacagt taagccgcta aaggcattat ccgccaagta
caatttttta 5040ctcttcgaag acagaaaatt tgctgacatt ggtaatacag tcaaattgca
gtactctgcg 5100ggtgtataca gaatagcaga atgggcagac attacgaatg cacacggtgt
ggtgggccca 5160ggtattgtta gcggtttgaa gcaggcggcg gaagaagtaa caaaggaacc
tagaggcctt 5220ttgatgttag cagaattgtc atgcaagggc tccctagcta ctggagaata
tactaagggt 5280actgttgaca ttgcgaagag cgacaaagat tttgttatcg gctttattgc
tcaaagagac 5340atgggtggaa gagatgaagg ttacgattgg ttgattatga cacccggtgt
gggtttagat 5400gacaagggag acgcattggg tcaacagtat agaaccgtgg atgatgtggt
ctctacagga 5460tctgacatta ttattgttgg gtttaaac
54881430DNAArtificial SequenceSynthetic, Primer 61-67-CPK005-G
14gtttaaactt gctaaattcg agtgaaacac
301546DNAArtificial SequenceSynthetic, Primer 61-67-CPK006-G 15aaagatgaat
tgaaaagctt cccgggtatg gaccctgaaa ccacag
461646DNAArtificial SequenceSynthetic, Primer 61-67-CPK007-G 16ctgtggtttc
agggtccata cccgggaagc ttttcaattc atcttt
461730DNAArtificial SequenceSynthetic, Primer 61-67-CPK008-G 17gtttaaaccc
aacaataata atgtcagatc
301830DNAArtificial SequenceSynthetic, Primer 61-67-CPK032-G 18tccccccggg
tatatatata tcattgttat
301947DNAArtificial SequenceSynthetic, Primer 61-67-CPK054-G 19aatttttgaa
aattcaatat aaatgaaact ctcaactaaa ctttgtt
472051DNAArtificial SequenceSynthetic, Primer 61-67-CPK052-G 20agttttcacc
aattggtctg cagccattat agttttttct ccttgacgtt a
512147DNAArtificial SequenceSynthetic, Primer 61-67-CPK055-G 21aacaaagttt
agttgagagt ttcatttata ttgaattttc aaaaatt
472235DNAArtificial SequenceSynthetic, Primer 61-67-CPK031-G 22tccccccggg
agttatgaca attacaacaa cagaa
352351DNAArtificial SequenceSynthetic, Primer 61-67-CPK053-G 23taacgtcaag
gagaaaaaac tataatggct gcagaccaat tggtgaaaac t
51244933DNAArtificial SequenceSynthetic,
ADE1_PGAL10-IDI1_PGAL1-tHMGR_ADE1 insert of expression plasmid
pAM493 24gtttaaacta ctcagtatat taagtttcga attgaagggc gaactcttat
tcgaagtcgg 60agtcaccaca acacttccgc ccatactctc cgaatcctcg tttcctaaag
taagtttact 120tccacttgta ggcctattat taatgatatc tgaataatcc tctattaggg
ttggatcatt 180cagtagcgcg tgcgattgaa aggagtccat gcccgacgtc gacgtgatta
gcgaaggcgc 240gtaaccattg tcatgtctag cagctataga actaacctcc ttgacaccac
ttgcggaagt 300ctcatcaaca tgctcttcct tattactcat tctcttacca agcagagaat
gttatctaaa 360aactacgtgt atttcacctc tttctcgact tgaacacgtc caactcctta
agtactacca 420cagccaggaa agaatggatc cagttctaca cgatagcaaa gcagaaaaca
caaccagcgt 480acccctgtag aagcttcttt gtttacagca cttgatccat gtagccatac
tcgaaatttc 540aactcatctg aaacttttcc tgaaggttga aaaagaatgc cataagggtc
acccgaagct 600tattcacgcc cgggagttat gacaattaca acaacagaat tctttctata
tatgcacgaa 660cttgtaatat ggaagaaatt atgacgtaca aactataaag taaatatttt
acgtaacaca 720tggtgctgtt gtgcttcttt ttcaagagaa taccaatgac gtatgactaa
gtttaggatt 780taatgcaggt gacggaccca tctttcaaac gatttatatc agtggcgtcc
aaattgttag 840gttttgttgg ttcagcaggt ttcctgttgt gggtcatatg actttgaacc
aaatggccgg 900ctgctagggc agcacataag gataattcac ctgccaagac ggcacaggca
actattcttg 960ctaattgacg tgcgttggta ccaggagcgg tagcatgtgg gcctcttaca
cctaataagt 1020ccaacatggc accttgtggt tctagaacag taccaccacc gatggtacct
acttcgatgg 1080atggcatgga tacggaaatt ctcaaatcac cgtccacttc tttcatcaat
gttatacagt 1140tggaactttc gacattttgt gcaggatctt gtcctaatgc caagaaaaca
gctgtcacta 1200aattagctgc atgtgcgtta aatccaccaa cagacccagc cattgcagat
ccaaccaaat 1260tcttagcaat gttcaactca accaatgcgg aaacatcact ttttaacact
tttctgacaa 1320catcaccagg aatagtagct tctgcgacga cactcttacc acgaccttcg
atccagttga 1380tggcagctgg ttttttgtcg gtacagtagt taccagaaac ggagacaacc
tccatatctt 1440cccagccata ctcttctacc atttgcttta atgagtattc gacaccctta
gaaatcatat 1500tcatacccat tgcgtcacca gtagttgttc taaatctcat gaagagtaaa
tctcctgcta 1560gacaagtttg aatatgttgc agacgtgcaa atcttgatgt agagttaaaa
gcttttttaa 1620ttgcgttttg tccctcttct gagtctaacc atatcttaca ggcaccagat
cttttcaaag 1680ttgggaaacg gactactggg cctcttgtca taccatcctt agttaaaaca
gttgttgcac 1740caccgccagc attgattgcc ttacagccac gcatggcaga agctaccaaa
caaccctctg 1800tagttgccat tggtatatga taagatgtac catcgataac caaggggcct
ataacaccaa 1860cgggcaaagg catgtaacct ataacatttt cacaacaagc gccaaatacg
cggtcgtagt 1920cataattttt atatggtaaa cgatcagatg ctaatacagg agcttctgcc
aaaattgaaa 1980gagccttcct acgtaccgca accgctctcg tagtatcacc taattttttc
tccaaagcgt 2040acaaaggtaa cttaccgtga ataaccaagg cagcgacctc tttgttcttc
aattgttttg 2100tatttccact acttaataat gcttctaatt cttctaaagg acgtattttc
ttatccaagc 2160tttcaatatc gcgggaatca tcttcctcac tagatgatga aggtcctgat
gagctcgatt 2220gcgcagatga taaacttttg actttcgatc cagaaatgac tgttttattg
gttaaaactg 2280gtgtagaagc cttttgtaca ggagcagtaa aagacttctt ggtgacttca
gttttcacca 2340attggtctgc agccattata gttttttctc cttgacgtta aagtatagag
gtatattaac 2400aattttttgt tgatactttt atgacatttg aataagaagt aatacaaacc
gaaaatgttg 2460aaagtattag ttaaagtggt tatgcagctt ttgcatttat atatctgtta
atagatcaaa 2520aatcatcgct tcgctgatta attaccccag aaataaggct aaaaaactaa
tcgcattatt 2580atcctatggt tgttaatttg attcgttgat ttgaaggttt gtggggccag
gttactgcca 2640atttttcctc ttcataacca taaaagctag tattgtagaa tctttattgt
tcggagcagt 2700gcggcgcgag gcacatctgc gtttcaggaa cgcgaccggt gaagaccagg
acgcacggag 2760gagagtcttc cgtcggaggg ctgtcgcccg ctcggcggct tctaatccgt
acttcaatat 2820agcaatgagc agttaagcgt attactgaaa gttccaaaga gaaggttttt
ttaggctaag 2880ataatggggc tctttacatt tccacaacat ataagtaaga ttagatatgg
atatgtatat 2940ggtggtattg ccatgtaata tgattattaa acttctttgc gtccatccaa
aaaaaaagta 3000agaatttttg aaaattcaat ataaatgact gccgacaaca atagtatgcc
ccatggtgca 3060gtatctagtt acgccaaatt agtgcaaaac caaacacctg aagacatttt
ggaagagttt 3120cctgaaatta ttccattaca acaaagacct aatacccgat ctagtgagac
gtcaaatgac 3180gaaagcggag aaacatgttt ttctggtcat gatgaggagc aaattaagtt
aatgaatgaa 3240aattgtattg ttttggattg ggacgataat gctattggtg ccggtaccaa
gaaagtttgt 3300catttaatgg aaaatattga aaagggttta ctacatcgtg cattctccgt
ctttattttc 3360aatgaacaag gtgaattact tttacaacaa agagccactg aaaaaataac
tttccctgat 3420ctttggacta acacatgctg ctctcatcca ctatgtattg atgacgaatt
aggtttgaag 3480ggtaagctag acgataagat taagggcgct attactgcgg cggtgagaaa
actagatcat 3540gaattaggta ttccagaaga tgaaactaag acaaggggta agtttcactt
tttaaacaga 3600atccattaca tggcaccaag caatgaacca tggggtgaac atgaaattga
ttacatccta 3660ttttataaga tcaacgctaa agaaaacttg actgtcaacc caaacgtcaa
tgaagttaga 3720gacttcaaat gggtttcacc aaatgatttg aaaactatgt ttgctgaccc
aagttacaag 3780tttacgcctt ggtttaagat tatttgcgag aattacttat tcaactggtg
ggagcaatta 3840gatgaccttt ctgaagtgga aaatgacagg caaattcata gaatgctata
acaacgcgtc 3900aataatatag gctacataaa aatcataata actttgttat catagcaaaa
tgtgatataa 3960aacgtttcat ttcacctgaa aaatagtaaa aataggcgac aaaaatcctt
agtaatatgt 4020aaactttatt ttctttattt acccgggagt cagtctgact cttgcgagag
atgaggatgt 4080aataatacta atctcgaaga tgccatctaa tacatataga catacatata
tatatatata 4140cattctatat attcttaccc agattctttg aggtaagacg gttgggtttt
atcttttgca 4200gttggtacta ttaagaacaa tcgaatcata agcattgctt acaaagaata
cacatacgaa 4260atattaacga taatgtcaat tacgaagact gaactggacg gtatattgcc
attggtggcc 4320agaggtaaag ttagagacat atatgaggta gacgctggta cgttgctgtt
tgttgctacg 4380gatcgtatct ctgcatatga cgttattatg gaaaacagca ttcctgaaaa
ggggatccta 4440ttgaccaaac tgtcagagtt ctggttcaag ttcctgtcca acgatgttcg
taatcatttg 4500gtcgacatcg ccccaggtaa gactattttc gattatctac ctgcaaaatt
gagcgaacca 4560aagtacaaaa cgcaactaga agaccgctct ctattggttc acaaacataa
actaattcca 4620ttggaagtaa ttgtcagagg ctacatcacc ggatctgctt ggaaagagta
cgtaaaaaca 4680ggtactgtgc atggtttgaa acaacctcaa ggacttaaag aatctcaaga
gttcccagaa 4740ccaatcttca ccccatcgac caaggctgaa caaggtgaac atgacgaaaa
catctctcct 4800gcccaggccg ctgagctggt gggtgaagat ttgtcacgta gagtggcaga
actggctgta 4860aaactgtact ccaagtgcaa agattatgct aaggagaagg gcatcatcat
cgcagacact 4920aaattgttta aac
49332530DNAArtificial SequenceSynthetic, Primer 61-67-CPK009-G
25gtttaaacta ctcagtatat taagtttcga
302670DNAArtificial SequenceSynthetic, Primer 61-67-CPK010-G 26atctctcgca
agagtcagac tgactcccgg gcgtgaataa gcttcgggtg acccttatgg 60cattcttttt
702770DNAArtificial SequenceSynthetic, Primer 61-67-CPK011-G 27aaaaagaatg
ccataagggt cacccgaagc ttattcacgc ccgggagtca gtctgactct 60tgcgagagat
702830DNAArtificial SequenceSynthetic, Primer 61-67-CPK012-G 28gtttaaacaa
tttagtgtct gcgatgatga
302930DNAArtificial SequenceSynthetic, Primer 61-67-CPK047-G 29tccccccggg
taaataaaga aaataaagtt
303047DNAArtificial SequenceSynthetic, Primer 61-67-CPK064-G 30aatttttgaa
aattcaatat aaatgactgc cgacaacaat agtatgc
473151DNAArtificial SequenceSynthetic, Primer 61-67-CPK052-G 31agttttcacc
aattggtctg cagccattat agttttttct ccttgacgtt a
513247DNAArtificial SequenceSynthetic, Primer 61-67-CPK065-G 32gcatactatt
gttgtcggca gtcatttata ttgaattttc aaaaatt
473351DNAArtificial SequenceSynthetic, Primer 61-67-CPK053-G 33taacgtcaag
gagaaaaaac tataatggct gcagaccaat tggtgaaaac t
51346408DNAArtificial SequenceSynthetic,
HIS3_PGAL10-ERG10_PGAL1-ERG12_HIS3 insert of expression plasmid
pAM495 34gtttaaacta ttgtgagggt cagttatttc atccagatat aacccgagag
gaaacttctt 60agcgtctgtt ttcgtaccat aaggcagttc atgaggtata ttttcgttat
tgaagcccag 120ctcgtgaatg cttaatgctg ctgaactggt gtccatgtcg cctaggtacg
caatctccac 180aggctgcaaa ggttttgtct caagagcaat gttattgtgc accccgtaat
tggtcaacaa 240gtttaatctg tgcttgtcca ccagctctgt cgtaaccttc agttcatcga
ctatctgaag 300aaatttacta ggaatagtgc catggtacag caaccgagaa tggcaatttc
tactcgggtt 360cagcaacgct gcataaacgc tgttggtgcc gtagacatat tcgaagatag
gattatcatt 420cataagtttc agagcaatgt ccttattctg gaacttggat ttatggctct
tttggtttaa 480tttcgcctga ttcttgatct cctttagctt ctcgacgtgg gcctttttct
tgccatatgg 540atccgctgca cggtcctgtt ccctagcatg tacgtgagcg tatttccttt
taaaccacga 600cgctttgtct tcattcaacg tttcccattg tttttttcta ctattgcttt
gctgtgggaa 660aaacttatcg aaagatgacg actttttctt aattctcgtt ttaagagctt
ggtgagcgct 720aggagtcact gccaggtatc gtttgaacac ggcattagtc agggaagtca
taacacagtc 780ctttcccgca attttctttt tctattactc ttggcctcct ctagtacact
ctatattttt 840ttatgcctcg gtaatgattt tcattttttt tttttccacc tagcggatga
ctcttttttt 900ttcttagcga ttggcattat cacataatga attatacatt atataaagta
atgtgatttc 960ttcgaagaat atactaaagt ttagcttgcc tcgtccccgc cgggtcaccc
ggccagcgac 1020atggaggccc agaataccct ccttgacagt cttgacgtgc gcagctcagg
ggcatgatgt 1080gactgtcgcc cgtacattta gcccatacat ccccatgtat aatcatttgc
atccatacat 1140tttgatggcc gcacggcgcg aagcaaaaat tacggctcct cgctgcagac
ctgcgagcag 1200ggaaacgctc ccctcacaga cgcgttgaat tgtccccacg ccgcgcccct
gtagagaaat 1260ataaaaggtt aggatttgcc actgaggttc ttctttcata tacttccttt
taaaatcttg 1320ctaggataca gttctcacat cacatccgaa cataaacaac catggcagaa
ccagcccaaa 1380aaaagcaaaa acaaactgtt caggagcgca aggcgtttat ctcccgtatc
actaatgaaa 1440ctaaaattca aatcgctatt tcgctgaatg gtggttatat tcaaataaaa
gattcgattc 1500ttcctgcaaa gaaggatgac gatgtagctt cccaagctac tcagtcacag
gtcatcgata 1560ttcacacagg tgttggcttt ttggatcata tgatccatgc gttggcaaaa
cactctggtt 1620ggtctcttat tgttgaatgt attggtgacc tgcacattga cgatcaccat
actaccgaag 1680attgcggtat cgcattaggg caagcgttca aagaagcaat gggtgctgtc
cgtggtgtaa 1740aaagattcgg tactgggttc gcaccattgg atgaggcgct atcacgtgcc
gtagtcgatt 1800tatctagtag accatttgct gtaatcgacc ttggattgaa gagagagatg
attggtgatt 1860tatccactga aatgattcca cactttttgg aaagtttcgc ggaggcggcc
agaattactt 1920tgcatgttga ttgtctgaga ggtttcaacg atcaccacag aagtgagagt
gcgttcaagg 1980ctttggctgt tgccataaga gaagctattt ctagcaatgg caccaatgac
gttccctcaa 2040ccaaaggtgt tttgatgtga agtactgaca ataaaaagat tcttgttttc
aagaacttgt 2100catttgtata gtttttttat attgtagttg ttctatttta atcaaatgtt
agcgtgattt 2160atattttttt tcgcctcgac atcatctgcc cagatgcgaa gttaagtgcg
cagaaagtaa 2220tatcatgcgt caatcgtatg tgaatgctgg tcgctatact gctgtcgatt
cgatactaac 2280gccgccatcc acccgggatg gtctgcttaa atttcattct gtcttcgaaa
gctgaattga 2340tactacgaaa aatttttttt tgtttctctt tctatcttta ttacataaaa
cttcatacac 2400agttaagatt aaaaacaact aataaataat gcctatcgca aattagctta
tgaagtccat 2460ggtaaattcg tgtttcctgg caataataga tcgtcaattt gttgctttgt
ggtagtttta 2520ttttcaaata attggaatac tagggatttg attttaagat ctttattcaa
attttttgcg 2580cttaacaaac agcagccagt cccacccaag tctgtttcaa atgtctcgta
actaaaatca 2640tcttgcaatt tctttttgaa actgtcaatt tgctcttgag taatgtctct
tcgtaacaaa 2700gtcaaagagc aaccgccgcc accagcaccg gtaagttttg tggagccaat
tctcaaatca 2760tcgctcagat ttttaataag ttctaatcca ggatgagaaa caccgattga
gacaagcagt 2820ccatgattta ttcttatcaa ttccaatagt tgttcataca gttcattatt
agtttctaca 2880gcctcgtcat cggtgccttt acatttactt aacttagtca tgatctctaa
gccttgtagg 2940gcacattcac ccatggcatc tagaattggc ttcataactt caggaaattt
ctcggtgacc 3000aacacacgaa cgcgagcaac aagatctttt gtagaccttg gaattctagt
ataggttagg 3060atcattggaa tggctgggaa atcatctaag aacttaaaat tgtttgtgtt
tattgttcca 3120ttatgtgagt ctttttcaaa tagcagggca ttaccataag tggccacagc
gttatctatt 3180cctgaagggg taccgtgaat acacttttca cctatgaagg cccattgatt
cactatatgc 3240ttatcgtttt ctgacagctt ttccaagtca ttagatccta ttaacccccc
caagtaggcc 3300atagctaagg ccagtgatac agaaatagag gcgcttgagc ccaacccagc
accgatgggt 3360aaagtagact ttaaagaaaa cttaatattc ttggcatggg ggcataggca
aacaaacata 3420tacaggaaac aaaacgctgc atggtagtgg aaggattcgg atagttgagc
taacaacgga 3480tccaaaagac taacgagttc ctgagacaag ccatcggtgg cttgttgagc
cttggccaat 3540ttttgggagt ttacttgatc ctcggtgatg gcattgaaat cattgatgga
ccacttatga 3600ttaaagctaa tgtccgggaa gtccaattca atagtatctg gtgcagatga
ctcgcttatt 3660agcaggtagg ttctcaacgc agacacacta gcagcgacgg caggcttgtt
gtacacagca 3720gagtgttcac caaaaataat aacctttccc ggtgcagaag ttaagaacgg
taatgacatt 3780atagtttttt ctccttgacg ttaaagtata gaggtatatt aacaattttt
tgttgatact 3840tttatgacat ttgaataaga agtaatacaa accgaaaatg ttgaaagtat
tagttaaagt 3900ggttatgcag cttttgcatt tatatatctg ttaatagatc aaaaatcatc
gcttcgctga 3960ttaattaccc cagaaataag gctaaaaaac taatcgcatt attatcctat
ggttgttaat 4020ttgattcgtt gatttgaagg tttgtggggc caggttactg ccaatttttc
ctcttcataa 4080ccataaaagc tagtattgta gaatctttat tgttcggagc agtgcggcgc
gaggcacatc 4140tgcgtttcag gaacgcgacc ggtgaagacc aggacgcacg gaggagagtc
ttccgtcgga 4200gggctgtcgc ccgctcggcg gcttctaatc cgtacttcaa tatagcaatg
agcagttaag 4260cgtattactg aaagttccaa agagaaggtt tttttaggct aagataatgg
ggctctttac 4320atttccacaa catataagta agattagata tggatatgta tatggtggta
ttgccatgta 4380atatgattat taaacttctt tgcgtccatc caaaaaaaaa gtaagaattt
ttgaaaattc 4440aatataaatg tctcagaacg tttacattgt atcgactgcc agaaccccaa
ttggttcatt 4500ccagggttct ctatcctcca agacagcagt ggaattgggt gctgttgctt
taaaaggcgc 4560cttggctaag gttccagaat tggatgcatc caaggatttt gacgaaatta
tttttggtaa 4620cgttctttct gccaatttgg gccaagctcc ggccagacaa gttgctttgg
ctgccggttt 4680gagtaatcat atcgttgcaa gcacagttaa caaggtctgt gcatccgcta
tgaaggcaat 4740cattttgggt gctcaatcca tcaaatgtgg taatgctgat gttgtcgtag
ctggtggttg 4800tgaatctatg actaacgcac catactacat gccagcagcc cgtgcgggtg
ccaaatttgg 4860ccaaactgtt cttgttgatg gtgtcgaaag agatgggttg aacgatgcgt
acgatggtct 4920agccatgggt gtacacgcag aaaagtgtgc ccgtgattgg gatattacta
gagaacaaca 4980agacaatttt gccatcgaat cctaccaaaa atctcaaaaa tctcaaaagg
aaggtaaatt 5040cgacaatgaa attgtacctg ttaccattaa gggatttaga ggtaagcctg
atactcaagt 5100cacgaaggac gaggaacctg ctagattaca cgttgaaaaa ttgagatctg
caaggactgt 5160tttccaaaaa gaaaacggta ctgttactgc cgctaacgct tctccaatca
acgatggtgc 5220tgcagccgtc atcttggttt ccgaaaaagt tttgaaggaa aagaatttga
agcctttggc 5280tattatcaaa ggttggggtg aggccgctca tcaaccagct gattttacat
gggctccatc 5340tcttgcagtt ccaaaggctt tgaaacatgc tggcatcgaa gacatcaatt
ctgttgatta 5400ctttgaattc aatgaagcct tttcggttgt cggtttggtg aacactaaga
ttttgaagct 5460agacccatct aaggttaatg tatatggtgg tgctgttgct ctaggtcacc
cattgggttg 5520ttctggtgct agagtggttg ttacactgct atccatctta cagcaagaag
gaggtaagat 5580cggtgttgcc gccatttgta atggtggtgg tggtgcttcc tctattgtca
ttgaaaagat 5640atgattacgt tctgcgattt tctcatgatc tttttcataa aatacataaa
tatataaatg 5700gctttatgta taacaggcat aatttaaagt tttatttgcg attcatcgtt
tttcaggtac 5760tcaaacgctg aggtgtgcct tttgacttac ttttcccggg agaggctagc
agaattaccc 5820tccacgttga ttgtctgcga ggcaagaatg atcatcaccg tagtgagagt
gcgttcaagg 5880ctcttgcggt tgccataaga gaagccacct cgcccaatgg taccaacgat
gttccctcca 5940ccaaaggtgt tcttatgtag tgacaccgat tatttaaagc tgcagcatac
gatatatata 6000catgtgtata tatgtatacc tatgaatgtc agtaagtatg tatacgaaca
gtatgatact 6060gaagatgaca aggtaatgca tcattctata cgtgtcattc tgaacgaggc
gcgctttcct 6120tttttctttt tgctttttct ttttttttct cttgaactcg agaaaaaaaa
tataaaagag 6180atggaggaac gggaaaaagt tagttgtggt gataggtggc aagtggtatt
ccgtaagaac 6240aacaagaaaa gcatttcata ttatggctga actgagcgaa caagtgcaaa
atttaagcat 6300caacgacaac aacgagaatg gttatgttcc tcctcactta agaggaaaac
caagaagtgc 6360cagaaataac agtagcaact acaataacaa caacggcggc gtttaaac
64083530DNAArtificial SequenceSynthetic, Primer 61-67-CPK013-G
35gtttaaacta ttgtgagggt cagttatttc
303644DNAArtificial SequenceSynthetic, Primer 61-67-CPK014alt-G
36gcggggacga ggcaagctaa actttagtat attcttcgaa gaaa
443760DNAArtificial SequenceSynthetic, Primer 61-67-CPK017-G 37cgatactaac
gccgccatcc acccgggaga ggctagcaga attaccctcc acgttgattg
603830DNAArtificial SequenceSynthetic, Primer 61-67-CPK018-G 38gtttaaacgc
cgccgttgtt gttattgtag
303930DNAArtificial SequenceSynthetic, Primer 61-67-CPK035-G 39tccccccggg
aaaagtaagt caaaaggcac
304047DNAArtificial SequenceSynthetic, Primer 61-67-CPK056-G 40aatttttgaa
aattcaatat aaatgtctca gaacgtttac attgtat
474147DNAArtificial SequenceSynthetic, Primer 61-67-CPK057-G 41atacaatgta
aacgttctga gacatttata ttgaattttc aaaaatt
474251DNAArtificial SequenceSynthetic, Primer 61-67-CPK058-G 42tgcagaagtt
aagaacggta atgacattat agttttttct ccttgacgtt a
514330DNAArtificial SequenceSynthetic, Primer 61-67-CPK040-G 43tccccccggg
atggtctgct taaatttcat
304451DNAArtificial SequenceSynthetic, Primer 61-67-CPK059-G 44taacgtcaag
gagaaaaaac tataatgtca ttaccgttct taacttctgc a
514544DNAArtificial SequenceSynthetic, Primer 61-67-CPK015alt-G
45tttcttcgaa gaatatacta aagtttagct tgcctcgtcc ccgc
444660DNAArtificial SequenceSynthetic, Primer 61-67-CPK016-G 46caatcaacgt
ggagggtaat tctgctagcc tctcccgggt ggatggcggc gttagtatcg
60476087DNAArtificial SequenceSynthetic,
LEU2_PGAL10-ERG8_PGAL1-ERG19_LEU2 insert of expression plasmid
pAM497 47gtttaaactt ttccaatagg tggttagcaa tcgtcttact ttctaacttt
tcttaccttt 60tacatttcag caatatatat atatatattt caaggatata ccattctaat
gtctgcccct 120aagaagatcg tcgttttgcc aggtgaccac gttggtcaag aaatcacagc
cgaagccatt 180aaggttctta aagctatttc tgatgttcgt tccaatgtca agttcgattt
cgaaaatcat 240ttaattggtg gtgctgctat cgatgctaca ggtgttccac ttccagatga
ggcgctggaa 300gcctccaaga aggctgatgc cgttttgtta ggtgctgtgg gtggtcctaa
atggggtacc 360ggtagtgtta gacctgaaca aggtttacta aaaatccgta aagaacttca
attgtacgcc 420aacttaagac catgtaactt tgcatccgac tctcttttag acttatctcc
aatcaagcca 480caatttgcta aaggtactga cttcgttgtt gtcagagaat tagtgggagg
tatttacttt 540ggtaagagaa aggaagacgt ttagcttgcc tcgtccccgc cgggtcaccc
ggccagcgac 600atggaggccc agaataccct ccttgacagt cttgacgtgc gcagctcagg
ggcatgatgt 660gactgtcgcc cgtacattta gcccatacat ccccatgtat aatcatttgc
atccatacat 720tttgatggcc gcacggcgcg aagcaaaaat tacggctcct cgctgcagac
ctgcgagcag 780ggaaacgctc ccctcacaga cgcgttgaat tgtccccacg ccgcgcccct
gtagagaaat 840ataaaaggtt aggatttgcc actgaggttc ttctttcata tacttccttt
taaaatcttg 900ctaggataca gttctcacat cacatccgaa cataaacaac catggcagaa
ccagcccaaa 960aaaagcaaaa acaaactgtt caggagcgca aggcgtttat ctcccgtatc
actaatgaaa 1020ctaaaattca aatcgctatt tcgctgaatg gtggttatat tcaaataaaa
gattcgattc 1080ttcctgcaaa gaaggatgac gatgtagctt cccaagctac tcagtcacag
gtcatcgata 1140ttcacacagg tgttggcttt ttggatcata tgatccatgc gttggcaaaa
cactctggtt 1200ggtctcttat tgttgaatgt attggtgacc tgcacattga cgatcaccat
actaccgaag 1260attgcggtat cgcattaggg caagcgttca aagaagcaat gggtgctgtc
cgtggtgtaa 1320aaagattcgg tactgggttc gcaccattgg atgaggcgct atcacgtgcc
gtagtcgatt 1380tatctagtag accatttgct gtaatcgacc ttggattgaa gagagagatg
attggtgatt 1440tatccactga aatgattcca cactttttgg aaagtttcgc ggaggcggcc
agaattactt 1500tgcatgttga ttgtctgaga ggtttcaacg atcaccacag aagtgagagt
gcgttcaagg 1560ctttggctgt tgccataaga gaagctattt ctagcaatgg caccaatgac
gttccctcaa 1620ccaaaggtgt tttgatgtga agtactgaca ataaaaagat tcttgttttc
aagaacttgt 1680catttgtata gtttttttat attgtagttg ttctatttta atcaaatgtt
agcgtgattt 1740atattttttt tcgcctcgac atcatctgcc cagatgcgaa gttaagtgcg
cagaaagtaa 1800tatcatgcgt caatcgtatg tgaatgctgg tcgctatact gctgtcgatt
cgatactaac 1860gccgccatcc acccgggttt ctcattcaag tggtaactgc tgttaaaatt
aagatattta 1920taaattgaag cttggtcgtt ccgaccaata ccgtagggaa acgtaaatta
gctattgtaa 1980aaaaaggaaa agaaaagaaa agaaaaatgt tacatatcga attgatctta
ttcctttggt 2040agaccagtct ttgcgtcaat caaagattcg tttgtttctt gtgggcctga
accgacttga 2100gttaaaatca ctctggcaac atccttttgc aactcaagat ccaattcacg
tgcagtaaag 2160ttagatgatt caaattgatg gttgaaagcc tcaagctgct cagtagtaaa
tttcttgtcc 2220catccaggaa cagagccaaa caatttatag ataaatgcaa agagtttcga
ctcattttca 2280gctaagtagt acaacacagc atttggacct gcatcaaacg tgtatgcaac
gattgtttct 2340ccgtaaaact gattaatggt gtggcaccaa ctgatgatac gcttggaagt
gtcattcatg 2400tagaatattg gagggaaaga gtccaaacat gtggcatgga aagagttgga
atccatcatt 2460gtttcctttg caaaggtggc gaaatctttt tcaacaatgg ctttacgcat
gacttcaaat 2520ctctttggta cgacatgttc aattctttct ttaaatagtt cggaggttgc
cacggtcaat 2580tgcataccct gagtggaact cacatccttt ttaatatcgc tgacaactag
gacacaagct 2640ttcatctgag gccagtcaga gctgtctgcg atttgtactg ccatggaatc
atgaccatct 2700tcagcttttc ccatttccca ggccacgtat ccgccaaaca acgatctaca
agctgaacca 2760gacccctttc ttgctattct agatatttct gaagttgact gtggtaattg
gtataactta 2820gcaattgcag agaccaatgc agcaaagcca gcagcggagg aagctaaacc
agctgctgta 2880ggaaagttat tttcggagac aatgtggagt ttccattgag ataatgtggg
caatgaggcg 2940tccttcgatt ccatttcctt tcttaattgg cgtaggtcgc gcagacaatt
ttgagttctt 3000tcattgtcga tgctgtgtgg ttctccattt aaccacaaag tgtcgcgttc
aaactcaggt 3060gcagtagccg cagaggtcaa cgttctgagg tcatcttgcg ataaagtcac
tgatatggac 3120gaattggtgg gcagattcaa cttcgtgtcc cttttccccc aatacttaag
ggttgcgatg 3180ttgacgggtg cggtaacgga tgctgtgtaa acggtcatta tagttttttc
tccttgacgt 3240taaagtatag aggtatatta acaatttttt gttgatactt ttatgacatt
tgaataagaa 3300gtaatacaaa ccgaaaatgt tgaaagtatt agttaaagtg gttatgcagc
ttttgcattt 3360atatatctgt taatagatca aaaatcatcg cttcgctgat taattacccc
agaaataagg 3420ctaaaaaact aatcgcatta ttatcctatg gttgttaatt tgattcgttg
atttgaaggt 3480ttgtggggcc aggttactgc caatttttcc tcttcataac cataaaagct
agtattgtag 3540aatctttatt gttcggagca gtgcggcgcg aggcacatct gcgtttcagg
aacgcgaccg 3600gtgaagacca ggacgcacgg aggagagtct tccgtcggag ggctgtcgcc
cgctcggcgg 3660cttctaatcc gtacttcaat atagcaatga gcagttaagc gtattactga
aagttccaaa 3720gagaaggttt ttttaggcta agataatggg gctctttaca tttccacaac
atataagtaa 3780gattagatat ggatatgtat atggtggtat tgccatgtaa tatgattatt
aaacttcttt 3840gcgtccatcc aaaaaaaaag taagaatttt tgaaaattca atataaatgt
cagagttgag 3900agccttcagt gccccaggga aagcgttact agctggtgga tatttagttt
tagatccgaa 3960atatgaagca tttgtagtcg gattatcggc aagaatgcat gctgtagccc
atccttacgg 4020ttcattgcaa gagtctgata agtttgaagt gcgtgtgaaa agtaaacaat
ttaaagatgg 4080ggagtggctg taccatataa gtcctaaaac tggcttcatt cctgtttcga
taggcggatc 4140taagaaccct ttcattgaaa aagttatcgc taacgtattt agctacttta
agcctaacat 4200ggacgactac tgcaatagaa acttgttcgt tattgatatt ttctctgatg
atgcctacca 4260ttctcaggag gacagcgtta ccgaacatcg tggcaacaga agattgagtt
ttcattcgca 4320cagaattgaa gaagttccca aaacagggct gggctcctcg gcaggtttag
tcacagtttt 4380aactacagct ttggcctcct tttttgtatc ggacctggaa aataatgtag
acaaatatag 4440agaagttatt cataatttat cacaagttgc tcattgtcaa gctcagggta
aaattggaag 4500cgggtttgat gtagcggcgg cagcatatgg atctatcaga tatagaagat
tcccacccgc 4560attaatctct aatttgccag atattggaag tgctacttac ggcagtaaac
tggcgcattt 4620ggttaatgaa gaagactgga atataacgat taaaagtaac catttacctt
cgggattaac 4680tttatggatg ggcgatatta agaatggttc agaaacagta aaactggtcc
agaaggtaaa 4740aaattggtat gattcgcata tgccggaaag cttgaaaata tatacagaac
tcgatcatgc 4800aaattctaga tttatggatg gactatctaa actagatcgc ttacacgaga
ctcatgacga 4860ttacagcgat cagatatttg agtctcttga gaggaatgac tgtacctgtc
aaaagtatcc 4920tgagatcaca gaagttagag atgcagttgc cacaattaga cgttccttta
gaaaaataac 4980taaagaatct ggtgccgata tcgaacctcc cgtacaaact agcttattgg
atgattgcca 5040gaccttaaaa ggagttctta cttgcttaat acctggtgct ggtggttatg
acgccattgc 5100agtgattgct aagcaagatg ttgatcttag ggctcaaacc gctgatgaca
aaagattttc 5160taaggttcaa tggctggatg taactcaggc tgactggggt gttaggaaag
aaaaagatcc 5220ggaaacttat cttgataaat aacttaaggt agataatagt ggtccatgtg
acatctttat 5280aaatgtgaag tttgaagtga ccgcgcttaa catctaacca ttcatcttcc
gatagtactt 5340gaaattgttc ctttcggcgg catgataaaa ttcttttaat gggtacaagc
tacccgggcc 5400cgggaaagat tctctttttt tatgatattt gtacataaac tttataaatg
aaattcataa 5460tagaaacgac acgaaattac aaaatggaat atgttcatag ggtagacgaa
actatatacg 5520caatctacat acatttatca agaaggagaa aaaggaggat gtaaaggaat
acaggtaagc 5580aaattgatac taatggctca acgtgataag gaaaaagaat tgcactttaa
cattaatatt 5640gacaaggagg agggcaccac acaaaaagtt aggtgtaaca gaaaatcatg
aaactatgat 5700tcctaattta tatattggag gattttctct aaaaaaaaaa aaatacaaca
aataaaaaac 5760actcaatgac ctgaccattt gatggagttt aagtcaatac cttcttgaac
catttcccat 5820aatggtgaaa gttccctcaa gaattttact ctgtcagaaa cggccttaac
gacgtagtcg 5880acctcctctt cagtactaaa tctaccaata ccaaatctga tggaagaatg
ggctaatgca 5940tcatccttac ccagcgcatg taaaacataa gaaggttcta gggaagcaga
tgtacaggct 6000gaacccgagg ataatgcgat atcccttagt gccatcaata aagattctcc
ttccacgtag 6060gcgaaagaaa cgttaacacg tttaaac
60874830DNAArtificial SequenceSynthetic, Primer 61-67-CPK019-G
48gtttaaactt ttccaatagg tggttagcaa
304955DNAArtificial SequenceSynthetic, Primer 61-67-CPK020-G 49gggtgacccg
gcggggacga ggcaagctaa acgtcttcct ttctcttacc aaagt
555062DNAArtificial SequenceSynthetic, Primer 61-67-CPK023-G 50gctgtcgatt
cgatactaac gccgccatcc acccgggaaa gattctcttt ttttatgata 60tt
625145DNAArtificial SequenceSynthetic, Primer 61-67-CPK024-G 51gtttaaacgt
gttaacgttt ctttcgccta cgtggaagga gaatc
455255DNAArtificial SequenceSynthetic, Primer 61-67-CPK021-G 52actttggtaa
gagaaaggaa gacgtttagc ttgcctcgtc cccgccgggt caccc
555362DNAArtificial SequenceSynthetic, Primer 61-67-CPK022-G 53aatatcataa
aaaaagagaa tctttcccgg gtggatggcg gcgttagtat cgaatcgaca 60gc
625445DNAArtificial SequenceSynthetic, Primer 61-67-CPK041-G 54tccccccggg
tagcttgtac ccattaaaag aattttatca tgccg
455547DNAArtificial SequenceSynthetic, Primer 61-67-CPK060-G 55aatttttgaa
aattcaatat aaatgtcaga gttgagagcc ttcagtg
475647DNAArtificial SequenceSynthetic, Primer 61-67-CPK061-G 56cactgaaggc
tctcaactct gacatttata ttgaattttc aaaaatt
475751DNAArtificial SequenceSynthetic, Primer 61-67-CPK062-G 57ggtaacggat
gctgtgtaaa cggtcattat agttttttct ccttgacgtt a
515830DNAArtificial SequenceSynthetic, Primer 61-67-CPK046-G 58tccccccggg
tttctcattc aagtggtaac
305951DNAArtificial SequenceSynthetic, Primer 61-67-CPK063-G 59taacgtcaag
gagaaaaaac tataatgacc gtttacacag catccgttac c
51604178DNAArtificial SequenceSynthetic, Expression plasmid pAM1419
60gtttgacagc ttatcatcga ctgcacggtg caccaatgct tctggcgtca ggcagccatc
60ggaagctgtg gtatggctgt gcaggtcgta aatcactgca taattcgtgt cgctcaaggc
120gcactcccgt tctggataat gttttttgcg ccgacatcat aacggttctg gcaaatattc
180tgaaatgagc tgttgacaat taatcatccg gctcgtataa tgtgtggaat tgtgagcgga
240taacaatttc acacaggaaa cagacatatg ggaattcgag ctcggtaccc ggggatcctc
300tagagtcgac ctgcaggcat gcaagcttgg ctgttttggc ggatgagaga agattttcag
360cctgatacag attaaatcag aacgcagaag cggtctgata aaacagaatt tgcctggcgg
420cagtagcgcg gtggtcccac ctgaccccat gccgaactca gaagtgaaac gccgtagcgc
480cgatggtagt gtggggtctc cccatgcgag agtagggaac tgccaggcat caaataaaac
540gaaaggctca gtcgaaagac tgggcctttc gttttatctg ttgtttgtcg gtgaacgctc
600tcctgagtag gacaaatccg ccgggagcgg atttgaacgt tgcgaagcaa cggcccggag
660ggtggcgggc aggacgcccg ccataaactg ccaggcatca aattaagcag aaggccatcc
720tgacggatgg cctttttgcg tttctacaaa ctctttttgt ttatttttct aaatacattc
780aaatatgtat ccgctcatga gacaataacc ctgataaatg cttcaataat attgaaaaag
840gaagagtatg agtattcaac atttccgtgt cgcccttatt cccttttttg cggcattttg
900ccttcctgtt tttgctcacc cagaaacgct ggtgaaagta aaagatgctg aagatcagtt
960gggtgcacga gtgggttaca tcgaactgga tctcaacagc ggtaagatcc ttgagagttt
1020tcgccccgaa gaacgttttc caatgatgag cacttttaaa gttctgctat gtggcgcggt
1080attatcccgt gttgacgccg ggcaagagca actcggtcgc cgcatacact attctcagaa
1140tgacttggtt gagtactcac cagtcacaga aaagcatctt acggatggca tgacagtaag
1200agaattatgc agtgctgcca taaccatgag tgataacact gcggccaact tacttctgac
1260aacgatcgga ggaccgaagg agctaaccgc ttttttgcac aacatggggg atcatgtaac
1320tcgccttgat cgttgggaac cggagctgaa tgaagccata ccaaacgacg agcgtgacac
1380cacgatgcct acagcaatgg caacaacgtt gcgcaaacta ttaactggcg aactacttac
1440tctagcttcc cggcaacaat taatagactg gatggaggcg gataaagttg caggaccact
1500tctgcgctcg gcccttccgg ctggctggtt tattgctgat aaatctggag ccggtgagcg
1560tgggtctcgc ggtatcattg cagcactggg gccagatggt aagccctccc gtatcgtagt
1620tatctacacg acggggagtc aggcaactat ggatgaacga aatagacaga tcgctgagat
1680aggtgcctca ctgattaagc attggtaact gtcagaccaa gtttactcat atatacttta
1740gattgattta aaacttcatt tttaatttaa aaggatctag gtgaagatcc tttttgataa
1800tctcatgacc aaaatccctt aacgtgagtt ttcgttccac tgagcgtcag accccgtaga
1860aaagatcaaa ggatcttctt gagatccttt ttttctgcgc gtaatctgct gcttgcaaac
1920aaaaaaacca ccgctaccag cggtggtttg tttgccggat caagagctac caactctttt
1980tccgaaggta actggcttca gcagagcgca gataccaaat actgtccttc tagtgtagcc
2040gtagttaggc caccacttca agaactctgt agcaccgcct acatacctcg ctctgctaat
2100cctgttacca gtggctgctg ccagtggcga taagtcgtgt cttaccgggt tggactcaag
2160acgatagtta ccggataagg cgcagcggtc gggctgaacg gggggttcgt gcacacagcc
2220cagcttggag cgaacgacct acaccgaact gagataccta cagcgtgagc tatgagaaag
2280cgccacgctt cccgaaggga gaaaggcgga caggtatccg gtaagcggca gggtcggaac
2340aggagagcgc acgagggagc ttccaggggg aaacgcctgg tatctttata gtcctgtcgg
2400gtttcgccac ctctgacttg agcgtcgatt tttgtgatgc tcgtcagggg ggcggagcct
2460atggaaaaac gccagcaacg cggccttttt acggttcctg gccttttgct ggccttttgc
2520tcacatgttc tttcctgcgt tatcccctga ttctgtggat aaccgtatta ccgcctttga
2580gtgagctgat accgctcgcc gcagccgaac gaccgagcgc agcgagtcag tgagcgagga
2640agcggaagag cgcctgatgc ggtattttct ccttacgcat ctgtgcggta tttcacaccg
2700cacatggtgc actctcagta caatctgctc tgatgccgca tagttaagcc agtatacact
2760ccgctatcgc tacgtgactg ggtcatggct gcgccccgac acccgccaac acccgctgac
2820gcgccctgac gggcttgtct gctcccggca tccgcttaca gacaagctgt gaccgtctcc
2880gggagctgca tgtgtcagag gttttcaccg tcatcaccga aacgcgcgag gcagcagatc
2940aattcgcgcg cgaaggcgaa gcggcatgca tttacgttga caccatcgaa tggtgcaaaa
3000cctttcgcgg tatggcatga tagcgcccgg aagagagtca attcagggtg gtgaatgtga
3060aaccagtaac gttatacgat gtcgcagagt atgccggtgt ctcttatcag accgtttccc
3120gcgtggtgaa ccaggccagc cacgtttctg cgaaaacgcg ggaaaaagtg gaagcggcga
3180tggcggagct gaattacatt cccaaccgcg tggcacaaca actggcgggc aaacagtcgt
3240tgctgattgg cgttgccacc tccagtctgg ccctgcacgc gccgtcgcaa attgtcgcgg
3300cgattaaatc tcgcgccgat caactgggtg ccagcgtggt ggtgtcgatg gtagaacgaa
3360gcggcgtcga agcctgtaaa gcggcggtgc acaatcttct cgcgcaacgc gtcagtgggc
3420tgatcattaa ctatccgctg gatgaccagg atgccattgc tgtggaagct gcctgcacta
3480atgttccggc gttatttctt gatgtctctg accagacacc catcaacagt attattttct
3540cccatgaaga cggtacgcga ctgggcgtgg agcatctggt cgcattgggt caccagcaaa
3600tcgcgctgtt agcgggccca ttaagttctg tctcggcgcg tctgcgtctg gctggctggc
3660ataaatatct cactcgcaat caaattcagc cgatagcgga acgggaaggc gactggagtg
3720ccatgtccgg ttttcaacaa accatgcaaa tgctgaatga gggcatcgtt cccactgcga
3780tgctggttgc caacgatcag atggcgctgg gcgcaatgcg cgccattacc gagtccgggc
3840tgcgcgttgg tgcggatatc tcggtagtgg gatacgacga taccgaagac agctcatgtt
3900atatcccgcc gtcaaccacc atcaaacagg attttcgcct gctggggcaa accagcgtgg
3960accgcttgct gcaactctct cagggccagg cggtgaaggg caatcagctg ttgcccgtct
4020cactggtgaa aagaaaaacc accctggcgc ccaatacgca aaccgcctct ccccgcgcgt
4080tggccgattc attaatgcag ctggcacgac aggtttcccg actggaaagc gggcagtgag
4140cgcaacgcaa ttaatgtgag ttagcgcgaa ttgatctg
4178611725DNAArtificial SequenceSynthetic, FS_S2D_Ec coding sequence
61atggacactc tgccgatctc ttccgtaagc ttttcttcct ctacttcccc gctggtagtc
60gatgacaagg tttctaccaa acctgatgta attcgtcaca ctatgaactt caacgcatct
120atctggggcg atcagttcct gacttatgat gaaccggaag atctggtaat gaaaaagcaa
180ctggtagaag aactgaaaga agaagttaaa aaggaactga tcaccattaa gggtagcaac
240gaaccgatgc agcacgtgaa actgattgaa ctgatcgatg cggttcagcg tctgggtatt
300gcttatcatt ttgaagagga aatcgaggaa gctctgcaac acatccacgt aacctacggc
360gaacaatggg tggataaaga gaatctgcag tctatcagcc tgtggttccg cctgctgcgt
420cagcaaggtt tcaatgtctc ttctggcgtt ttcaaagact tcatggatga aaagggcaaa
480ttcaaggaat ccctgtgtaa cgatgcgcaa ggtatcctgg cactgtacga agcggccttc
540atgcgtgtgg aagacgaaac cattctggac aacgcgctgg aattcactaa agtgcatctg
600gacatcatcg cgaaagatcc gtcctgcgac tcctctctgc gtactcagat ccatcaagcg
660ctgaaacagc cgctgcgtcg tcgcctggca cgtattgagg ctctgcacta tatgccgatt
720taccagcagg aaacctctca cgacgaagtc ctgctgaaac tggctaaact ggacttcagc
780gttctgcaat ctatgcacaa gaaagaactg tcccacatct gcaaatggtg gaaagatctg
840gatctgcaaa acaaactgcc gtacgttcgt gaccgtgttg ttgagggcta tttttggatt
900ctgtccatct actatgaacc acagcacgcg cgtactcgca tgtttctgat gaaaacctgc
960atgtggctgg ttgtcctgga cgacaccttt gacaactatg gtacgtacga agaactggaa
1020atcttcaccc aggccgtgga acgttggtct atttcctgcc tggatatgct gccggaatac
1080atgaaactga tctatcaaga actggttaac ctgcacgtgg aaatggaaga gtctctggag
1140aaagaaggta aaacttacca gatccactac gtcaaggaga tggcgaaaga actggtccgt
1200aactatctgg tcgaggcgcg ttggctgaaa gagggctata tgccgactct ggaagaatac
1260atgagcgtat ccatggttac cggcacctac ggcctgatga ttgcgcgttc ctacgtcggc
1320cgtggtgata ttgttaccga agataccttt aagtgggttt cttcctaccc gccgatcatc
1380aaagcgtctt gtgtcatcgt tcgcctgatg gacgacatcg tttctcacaa agaggagcaa
1440gaacgtggtc acgtagcatc tagcatcgaa tgctactcca aagaatccgg cgcgtccgaa
1500gaagaagctt gcgaatacat cagccgtaaa gttgaagatg cctggaaagt tatcaaccgc
1560gaaagcctgc gtccgacggc ggtcccgttt ccgctgctga tgccggcaat caacctggca
1620cgcatgtgtg aggttctgta cagcgtgaac gatggtttta ctcacgcgga aggtgacatg
1680aagagctata tgaagagctt cttcgtacac cctatggtcg tatga
1725621725DNAArtificial SequenceSynthetic, FS_Aa_Ec coding sequence
62atgtctactc tgccgatctc ttccgtaagc ttttcttcct ctacttcccc gctggtagtc
60gatgacaagg tttctaccaa acctgatgta attcgtcaca ctatgaactt caacgcatct
120atctggggcg atcagttcct gacttatgat gaaccggaag atctggtaat gaaaaagcaa
180ctggtagaag aactgaaaga agaagttaaa aaggaactga tcaccattaa gggtagcaac
240gaaccgatgc agcacgtgaa actgattgaa ctgatcgatg cggttcagcg tctgggtatt
300gcttatcatt ttgaagagga aatcgaggaa gctctgcaac acatccacgt aacctacggc
360gaacaatggg tggataaaga gaatctgcag tctatcagcc tgtggttccg cctgctgcgt
420cagcaaggtt tcaatgtctc ttctggcgtt ttcaaagact tcatggatga aaagggcaaa
480ttcaaggaat ccctgtgtaa cgatgcgcaa ggtatcctgg cactgtacga agcggccttc
540atgcgtgtgg aagacgaaac cattctggac aacgcgctgg aattcactaa agtgcatctg
600gacatcatcg cgaaagatcc gtcctgcgac tcctctctgc gtactcagat ccatcaagcg
660ctgaaacagc cgctgcgtcg tcgcctggca cgtattgagg ctctgcacta tatgccgatt
720taccagcagg aaacctctca cgacgaagtc ctgctgaaac tggctaaact ggacttcagc
780gttctgcaat ctatgcacaa gaaagaactg tcccacatct gcaaatggtg gaaagatctg
840gatctgcaaa acaaactgcc gtacgttcgt gaccgtgttg ttgagggcta tttttggatt
900ctgtccatct actatgaacc acagcacgcg cgtactcgca tgtttctgat gaaaacctgc
960atgtggctgg ttgtcctgga cgacaccttt gacaactatg gtacgtacga agaactggaa
1020atcttcaccc aggccgtgga acgttggtct atttcctgcc tggatatgct gccggaatac
1080atgaaactga tctatcaaga actggttaac ctgcacgtgg aaatggaaga gtctctggag
1140aaagaaggta aaacttacca gatccactac gtcaaggaga tggcgaaaga actggtccgt
1200aactatctgg tcgaggcgcg ttggctgaaa gagggctata tgccgactct ggaagaatac
1260atgagcgtat ccatggttac cggcacctac ggcctgatga ttgcgcgttc ctacgtcggc
1320cgtggtgata ttgttaccga agataccttt aagtgggttt cttcctaccc gccgatcatc
1380aaagcgtctt gtgtcatcgt tcgcctgatg gacgacatcg tttctcacaa agaggagcaa
1440gaacgtggtc acgtagcatc tagcatcgaa tgctactcca aagaatccgg cgcgtccgaa
1500gaagaagctt gcgaatacat cagccgtaaa gttgaagatg cctggaaagt tatcaaccgc
1560gaaagcctgc gtccgacggc ggtcccgttt ccgctgctga tgccggcaat caacctggca
1620cgcatgtgtg aggttctgta cagcgtgaac gatggtttta ctcacgcgga aggtgacatg
1680aagagctata tgaagagctt cttcgtacac cctatggtcg tatga
1725631683DNAArtificial SequenceSynthetic, FS_Cj_Ec coding sequence
63atgaaagata tgagcatccc gctgttagcc gcggtttcta gctctaccga ggagacggtc
60cgtccgatcg cggatttcca tccgacgctg tggggcaacc atttcctgaa gtctgcggca
120gatgttgaga cgattgatgc ggcaacgcaa gagcagcacg cggcactgaa acaagaggtt
180cgccgcatga ttaccaccac ggcgaataag ctggcgcaga aactgcacat gattgacgcc
240gtccagcgct taggtgtggc gtaccacttc gagaaggaga ttgaagacga actgggcaaa
300gttagccatg acctggactc tgacgatctg tatgtggtca gcctgcgttt tcgtctgttt
360cgtcaacagg gcgtcaagat tagctgcgat gtgttcgaca agttcaagga cgacgagggc
420aaattcaaag agagcctgat taacgacatc cgtggcatgt tatctttata cgaggcggcc
480tatctggcaa ttcgcggtga ggatatctta gacgaggcaa ttgtcttcac cacgacccat
540ctaaagagcg tcatcagcat tagcgaccat tctcatgcga atagcaatct ggcggagcag
600atccgtcata gcctgcaaat tccactgcgc aaagccgccg cccgtctgga ggcccgctac
660ttcctggaca tctattctcg tgacgacctg catgacgaga ccttactgaa attcgccaaa
720ctggacttca acatcttaca agccgcgcac caaaaggagg caagcatcat gacccgctgg
780tggaatgacc tgggcttccc aaaaaaggtg ccgtacgcgc gcgaccgcat tattgagacc
840tacatttgga tgctgctggg cgtgagctac gagccaaacc tggcctttgg ccgtatcttc
900gcgagcaaag tggtctgcat gatcacgacg atcgacgata ccttcgacgc gtacggtacg
960ttcgaggaac tgaccctgtt tacggaggcg gtgacgcgct gggacatcgg cctgatcgac
1020acgctgccgg agtacatgaa gttcatcgtc aaggccctgc tggacattta ccgtgaagcg
1080gaggaggaat tagcgaagga aggccgcagc tatggtatcc cgtacgcgaa gcagatgatg
1140caggagctga tcatcctgta ctttaccgaa gcgaaatggc tgtacaaggg ctacgtgccg
1200acgttcgacg agtacaaaag cgttgccctg cgcagcattg gtctgcgcac gctggccgtt
1260gcaagcattg tggacctggg cgacttcatt gcgaccaagg acaacttcga gtgcatcctg
1320aagaacgcca agagcctgaa agccacggag accatcggcc gtctgatgga tgatatcgcg
1380ggctacaagt tcgagcagaa acgcggccat aacccatctg cggtggagtg ttacaagaat
1440cagcacggcg tcagcgaaga ggaggcggtt aaagagctgc tgctggaggt ggcgaacagc
1500tggaaggaca tcaatgagga gctgttaaac ccgaccaccg tcccactgcc gatgctgcag
1560cgtctgctgt acttcgcacg cagcggtcat ttcatttacg acgacggcca tgatcgctac
1620acccacagcc tgatgatgaa gcgccaggtc gcgttactgt taacggaacc actggcgatc
1680taa
1683641014DNAArtificial SequenceSynthetic, PS_S_Ec coding sequence
64atgccgcagg acgtcgactt ccatattccg ctgccaggcc gtcagtcacc ggaccatgcc
60cgcgctgaag cggagcaatt agcgtggccg cgcagcttgg gcctgattcg ttccgatgct
120gcggcagagc gtcatctccg tggtggttac gcagatctgg caagccgctt ttatccgcat
180gcgaccggcg cagaccttga tttaggggtg gacctgatga gctggttttt cctctttgat
240gacctgttcg atggcccgcg cggtgaaaac ccggaggata ccaaacagct gaccgaccaa
300gtggctgcag cactggatgg cccgctcccc gataccgccc cccccatcgc tcacggtttt
360gcagatattt ggcgccgtac gtgtgaaggt atgacgccgg cgtggtgcgc ccgtagcgcg
420cgccattggc gtaattattt tgatggctac gtagatgaag ccgagagccg cttttggaac
480gctccatgcg attcggccgc ccaatacctg gcgatgcgcc gtcacacgat cggtgtacaa
540cctaccgtcg atttggcgga gcgtgcgggc cgtttcgaag tgccacaccg tgtgttcgat
600tctgcagtga tgtctgcaat gctgcagatt gcggtagacg tgaacctgct gctgaacgac
660atcgccagcc tggaaaaaga ggaagcccgt ggtgagcaaa acaatatggt catgatcctg
720cgtcgcgaac acggctggtc aaagagccgc agcgtcagcc acatgcaaaa tgaagttcgc
780gcccgccttg aacagtattt gttactggaa agctgtctcc cgaaagtcgg cgaaatttat
840cagctggata ccgcagaacg cgaggcactg gaacgttatc gtacggatgc tgtccgtacc
900gttatccgtg gttcctatga ctggcatcgc agcagtgggc gctatgacgc cgagttcgct
960ctggcggcag gtgcacaggg atacctggaa gaactgggct ccagcgccca ttaa
1014651125DNAArtificial SequenceSynthetic, TDS_Fs_Ec coding sequence
65atggaaaatt ttcctacgga atacttcctg aataccacgg tccgcttgct ggaatacatt
60cgctaccgtg attctaatta tacgcgcgag gagcgtatcg aaaacctcca ttatgcgtac
120aacaaagcgg ctcatcattt tgcacagccg cgtcagcaac aactcctgaa agtggaccct
180aaacgtctcc aggcaagcct gcaaactatt gttggcatgg tggtttatag ctgggccaaa
240gtttcaaaag agtgcatggc ggatctgagt atccattata cgtatacgct ggtgttagat
300gactcaaaag atgacccgta cccaactatg gtgaattact ttgacgactt gcaagcgggc
360cgtgaacagg cacatccgtg gtgggctctg gtgaacgaac attttccgaa tgttcttcgc
420catttcggcc cgttttgctc gttaaattta atccgtagca ccctggattt ctttgaagga
480tgctggatcg aacagtataa ttttggcggt tttccaggga gccacgacta cccgcagttt
540ctgcgccgca tgaatggtct tggacattgt gttggtgcct cgttatggcc gaaggaacag
600tttaatgaac gcagcctgtt cctggaaatc acctctgcca ttgcacagat ggaaaattgg
660atggtatggg tcaacgatct gatgtccttc tataaagagt tcgatgatga acgcgaccag
720atttcgttag tcaaaaatta tgtcgtgtca gatgaaatct ccttgcacga agccctggag
780aagttgacgc aggacaccct gcactccagt aaacaaatgg tagccgtttt ttctgacaaa
840gatccgcaag taatggacac catcgagtgt ttcatgcatg ggtatgtgac ctggcatttg
900tgcgaccgtc gttatcgtct gtccgaaatt tacgaaaaag ttaaggagga gaaaaccgaa
960gacgcacaaa aattctgcaa attttacgaa caggccgcga atgtaggcgc tgtcagccct
1020tccgaatggg catatccgcc tgtggcccag ctggcgaacg ttcgttcaaa agatgtgaaa
1080gaagtccaga aaccgtttct gagctctatt gaattagtcg agtaa
1125661686DNAArtificial SequenceSynthetic, FS_Cs_Ec coding sequence
66atgagctcta acgtgagcgc catcccaaac tcttttgaac tgattcgccg ctctgcgcaa
60ttccaggcaa gcgtctgggg cgattatttc ctgagctacc acagcctgcc accggagaag
120ggcaacaagg tgatggaaaa acaaacggag gagctgaagg aggagatcaa aatggagctg
180gtgtctacca ccaaggacga gccggagaaa ttacgcctga ttgatctgat ccaacgttta
240ggcgtgtgct accacttcga gaacgaaatc aacaatatcc tgcagcagct gcatcacatc
300acgattacca gcgagaaaaa tggcgacgac aatccataca acatgacgct gtgctttcgt
360ttactgcgtc agcagggcta caacgtgtct tctgagccgt ttgaccgctt ccgcggcaag
420tgggagagca gctacgacaa caatgtggaa gaactgctga gcctgtatga agcaagccaa
480ctgcgcatgc aaggcgagga ggccctggat gaggcgtttt gcttcgccac cgcgcaactg
540gaagcgatcg tgcaagaccc gaccaccgat ccgatggtcg ccgcggagat tcgtcaggcc
600ttaaaatggc caatgtacaa gaatttaccg cgtctgaaag cccgtcacca cattggtctg
660tattctgaga aaccgtggcg taacgagagc ttactgaact ttgcgaagat ggacttcaac
720aagctgcaaa acctgcatca gaccgagatc gcatacatct ctaagtggtg ggacgattat
780ggctttgcgg agaaactgtc ttttgcccgt aatcgcattg tggaaggtta tttctttgcc
840ctgggtatct tcttcgaacc gcaattatta accgcacgcc tgatcatgac gaaagttatt
900gcgattggta gcatgctgga tgacatctac gacgtctacg gtacgtttga ggaactgaag
960ctgttaacgt tagcgttaga acgctgggac aagagcgaaa cgaagcaatt accgaactac
1020atgaaaatgt actacgaggc cctgctggac gtgtttgaag agattgagca ggaaatgtct
1080caaaaagaga cggaaacgac cccgtattgc attcatcaca tgaaagaagc cacgaaggaa
1140ttaggtcgtg ttttcttagt cgaggcgacc tggtgtaagg agggttatac cccgaaggtc
1200gaagaatatc tggacattgc gctgatcagc ttcggccaca agctgctgat ggttacggca
1260ctgctgggta tgggttctca catggccacg cagcagattg tccagtggat cacgagcatg
1320ccgaatatcc tgaaggcaag cgccgttatt tgtcgcctga tgaacgatat cgtctctcac
1380aagtttgagc aggaacgcgg ccacgttgcg agcgcgatcg agtgctacat ggagcaaaat
1440cacttatctg agtacgaggc actgatcgcc ttacgtaagc agatcgatga tctgtggaaa
1500gacatggtcg aaaactactg tgcggtgatc acggaggacg aggttccgcg cggcgtcctg
1560atgcgcgtgt taaatttaac ccgtttattt aacgtgattt acaaagatgg cgatggctat
1620acgcagtctc atggtagcac gaaggcacat attaagagcc tgttagttga ctctgttcca
1680ttataa
1686671725DNAArtificial SequenceSynthetic, FS_Pt_Ec coding sequence
67atgagctctt tagcggttga tgacgccgaa cgccgtgtgg gcgactacca cccgaactta
60tgggacgacg cactgatcca gagcttaagc acgccatacg gcgcaagccc gtatcgcgat
120gttgccgaga agctgatcgg cgagatcaag gagatgtttg cgagcatctc tatcgaggat
180ggcgatgacg agatctgcta cttcctgcag cgcctgtgga tgattgacaa cgtcgagcgc
240ctgggcatta gccgtcattt cgaaaatgag attaaggcgg cgatggagga cgtgtattct
300cgtcattgga gcgacaaagg catcgcgtgt ggccgccaca gcgtggttgc agacctgaac
360tctaccgcac tggcgttccg caccctgcgc ctgcacggct acagcgtttg cagcgacgtg
420ttcaagattt tccaagatca gaaaggtgag ttcgcatgtt ctgcggatca gaccgagggt
480gagattaaag gcattctgaa cctgttacgc gccagcctga tcgcctttcc gggcgagcgt
540atcctgcagg aggccgagat ctttgcgacg acctatctga aagaggcctt accgaagatc
600cagggcagcc gcttatctca ggaaattgaa tacgtgctgg agtacggctg gctgaccgat
660ctgccgcgcc tggagacgcg taactacatc gaggtcctgg ccgaggagat cacgccgtac
720ttcaagaagc cgtgcatggc cgtcgagaaa ctgctgaaac tggcgaaaat cgagttcaac
780ctgtttcaca gcctgcagca aaccgagctg aagcacctgt ctcgctggtg gaaggacagc
840ggttttgcgc agctgacgtt cacgcgtcac cgccatgttg aattttatac cctggccagc
900tgcatcgcca tggagccgaa gcactctgcg ttccgcctgg gcttcgccaa actgtgctat
960ctgggcatcg tgctggacga tatctatgac acctacggca agatggagga gctggagctg
1020ttcaccgcgg caatcaaacg ttgggatacg agcacgacgg agtgcctgcc ggagtacatg
1080aagggcgttt acatggcgtt ttatgactgt gtcaacgaga tggcccgcca agcagagaag
1140acccaaggct gggacaccct ggactacgcg cgcaagacct gggaggccct gatcgacgca
1200ttcatggagg aggcgaagtg gatcagctct ggctacgtcc caaccttcca gaagtacctg
1260gacaacggca aggtcagctt cggttaccgt gcagcgacgc tgcagccaat cttaacgctg
1320gacatcccgc tgccgctgca catcctgcaa gagattgact tcccgagcag cttcaacgac
1380ctggcgagct ctattctgcg cttacgtggc gacatttgcg gttatcaggc cgaacgttct
1440cgtggtgagc aggcgtctag catcagctgc tacatgaagg ataacccggg tagcacggaa
1500gaggatgccc tgagccacgt caacgccatg atcggcgaca agatcccgga gttcaattgg
1560gagttcatga aaccaagcaa ggccccgatt agcagcaaaa agtacgcctt cgacatcctg
1620cgcgcattct accacctgta caagtaccgc gatggcttca gcatcgccaa gatcgagacc
1680aaaaaactgg tgatgcgcac ggtcctggac ccggtcccaa tgtaa
1725681725DNAArtificial SequenceSynthetic, FS_Aa_Sc coding sequence
68atgtcaactt tgcctatttc ttctgtgtca ttttcctctt ctacatcacc attagtcgtg
60gacgacaaag tctcaaccaa gcccgacgtt atcagacata caatgaattt caatgcttct
120atttggggag atcaattctt gacctatgat gagcctgaag atttagttat gaagaaacaa
180ttagtggagg aattaaaaga ggaagttaag aaggaattga taactatcaa aggttcaaat
240gagcccatgc agcatgtgaa attgattgaa ttaattgatg ctgttcaacg tttaggtata
300gcttaccatt ttgaagaaga gatcgaggaa gctttgcaac atatacatgt tacctatggt
360gaacagtggg tggataagga aaatttacag agtatttcat tgtggttcag gttgttgcgt
420caacagggct ttaacgtctc ctctggcgtt ttcaaagact ttatggacga aaaaggtaaa
480ttcaaagagt ctttatgcaa tgatgcacaa ggaatattag ccttatatga agctgcattt
540atgagggttg aagatgaaac catcttagac aatgctttgg aattcacaaa agttcattta
600gatatcatag caaaagaccc atcttgcgat tcttcattgc gtacacaaat ccatcaagcc
660ttaaaacaac ctttaagaag gagattagca aggattgaag cattacatta catgccaatc
720taccaacagg aaacatctca tgatgaagta ttgttgaaat tagccaagtt ggatttcagt
780gttttgcagt ctatgcataa aaaggaattg tcacatatct gtaagtggtg gaaagattta
840gatttacaaa ataagttacc ttatgtacgt gatcgtgttg tcgaaggcta cttctggata
900ttgtccatat actatgagcc acaacacgct agaacaagaa tgtttttgat gaaaacatgc
960atgtggttag tagttttgga cgatactttt gataattatg gaacatacga agaattggag
1020atttttactc aagccgtcga gagatggtct atctcatgct tagatatgtt gcccgaatat
1080atgaaattaa tctaccaaga attagtcaat ttgcatgtgg aaatggaaga atctttggaa
1140aaggagggaa agacctatca gattcattac gttaaggaga tggctaaaga attagttcgt
1200aattacttag tagaagcaag atggttgaag gaaggttata tgcctacttt agaagaatac
1260atgtctgttt ctatggttac tggtacttat ggtttgatga ttgcaaggtc ctatgttggc
1320agaggagaca ttgttactga agacacattc aaatgggttt ctagttaccc acctattatt
1380aaagcttcct gtgtaatagt aagattaatg gacgatattg tatctcacaa ggaagaacaa
1440gaaagaggac atgtggcttc atctatagaa tgttactcta aagaatcagg tgcttctgaa
1500gaggaagcat gtgaatatat tagtaggaaa gttgaggatg cctggaaagt aatcaataga
1560gaatctttgc gtccaacagc cgttcccttc cctttgttaa tgccagcaat aaacttagct
1620agaatgtgtg aggtcttgta ctctgttaat gatggtttta ctcatgctga gggtgacatg
1680aaatcttata tgaagtcctt cttcgttcat cctatggtcg tttga
1725697348DNAArtificial SequenceSynthetic, Expression plasmid pAM178
69tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
60cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
120ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
180accatatcga ctacgtcgta aggccgtttc tgacagagta aaattcttga gggaactttc
240accattatgg gaaatgcttc aagaaggtat tgacttaaac tccatcaaat ggtcaggtca
300ttgagtgttt tttatttgtt gtattttttt ttttttagag aaaatcctcc aatatcaaat
360taggaatcgt agtttcatga ttttctgtta cacctaactt tttgtgtggt gccctcctcc
420ttgtcaatat taatgttaaa gtgcaattct ttttccttat cacgttgagc cattagtatc
480aatttgctta cctgtattcc tttactatcc tcctttttct ccttcttgat aaatgtatgt
540agattgcgta tatagtttcg tctaccctat gaacatattc cattttgtaa tttcgtgtcg
600tttctattat gaatttcatt tataaagttt atgtacaaat atcataaaaa aagagaatct
660ttttaagcaa ggattttctt aacttcttcg gcgacagcat caccgacttc ggtggtactg
720ttggaaccac ctaaatcacc agttctgata cctgcatcca aaaccttttt aactgcatct
780tcaatggcct taccttcttc aggcaagttc aatgacaatt tcaacatcat tgcagcagac
840aagatagtgg cgatagggtc aaccttattc tttggcaaat ctggagcaga accgtggcat
900ggttcgtaca aaccaaatgc ggtgttcttg tctggcaaag aggccaagga cgcagatggc
960aacaaaccca aggaacctgg gataacggag gcttcatcgg agatgatatc accaaacatg
1020ttgctggtga ttataatacc atttaggtgg gttgggttct taactaggat catggcggca
1080gaatcaatca attgatgttg aaccttcaat gtagggaatt cgttcttgat ggtttcctcc
1140acagtttttc tccataatct tgaagaggcc aaaagattag ctttatccaa ggaccaaata
1200ggcaatggtg gctcatgttg tagggccatg aaagcggcca ttcttgtgat tctttgcact
1260tctggaacgg tgtattgttc actatcccaa gcgacaccat caccatcgtc ttcctttctc
1320ttaccaaagt aaatacctcc cactaattct ctgacaacaa cgaagtcagt acctttagca
1380aattgtggct tgattggaga taagtctaaa agagagtcgg atgcaaagtt acatggtctt
1440aagttggcgt acaattgaag ttctttacgg atttttagta aaccttgttc aggtctaaca
1500ctaccggtac cccatttagg accagccaca gcacctaaca aaacggcatc aaccttcttg
1560gaggcttcca gcgcctcatc tggaagtgga acacctgtag catcgatagc agcaccacca
1620attaaatgat tttcgaaatc gaacttgaca ttggaacgaa catcagaaat agctttaaga
1680accttaatgg cttcggctgt gatttcttga ccaacgtggt cacctggcaa aacgacgatc
1740ttcttagggg cagacattac aatggtatat ccttgaaata tatataaaaa aaggcgcctt
1800agaccgctcg gccaaacaac caattacttg ttgagaaata gagtataatt atcctataaa
1860tataacgttt ttgaacacac atgaacaagg aagtacagga caattgattt tgaagagaat
1920gtggattttg atgtaattgt tgggattcca tttttaataa ggcaataata ttaggtatgt
1980ggatatacta gaagttctcc tcgaccgtcg atatgcggtg tgaaataccg cacagatgcg
2040taaggagaaa ataccgcatc aggaaattgt aaacgttaat attttgttaa aattcgcgtt
2100aaatttttgt taaatcagct cattttttaa ccaataggcc gaaatcggca aaatccctta
2160taaatcaaaa gaatagaccg agatagggtt gagtgttgtt ccagtttgga acaagagtcc
2220actattaaag aacgtggact ccaacgtcaa agggcgaaaa accgtctatc agggcgatgg
2280cccactacgt gaaccatcac cctaatcaag ttttttgggg tcgaggtgcc gtaaagcact
2340aaatcggaac cctaaaggga gcccccgatt tagagcttga cggggaaagc cggcgaacgt
2400ggcgagaaag gaagggaaga aagcgaaagg agcgggcgct agggcgctgg caagtgtagc
2460ggtcacgctg cgcgtaacca ccacacccgc cgcgcttaat gcgccgctac agggcgcgtc
2520gcgccattcg ccattcaggc tgcgcaactg ttgggaaggg cgatcggtgc gggcctcttc
2580gctattacgc cagctgaatt ggagcgacct catgctatac ctgagaaagc aacctgacct
2640acaggaaaga gttactcaag aataagaatt ttcgttttaa aacctaagag tcactttaaa
2700atttgtatac acttattttt tttataactt atttaataat aaaaatcata aatcataaga
2760aattcgctta tttagaagtg tcaacaacgt atctaccaac gatttgaccc ttttccatct
2820tttcgtaaat ttctggcaag gtagacaagc cgacaacctt gattggagac ttgaccaaac
2880ctctggcgaa gaattgttaa ttaagagctc agatcttatc gtcgtcatcc ttgtaatcca
2940tcgatactag tgcggccgcc ctttagtgag ggttgaattc gaattttcaa aaattcttac
3000tttttttttg gatggacgca aagaagttta ataatcatat tacatggcat taccaccata
3060tacatatcca tatacatatc catatctaat cttacttata tgttgtggaa atgtaaagag
3120ccccattatc ttagcctaaa aaaaccttct ctttggaact ttcagtaata cgcttaactg
3180ctcattgcta tattgaagta cggattagaa gccgccgagc gggtgacagc cctccgaagg
3240aagactctcc tccgtgcgtc ctcgtcttca ccggtcgcgt tcctgaaacg cagatgtgcc
3300tcgcgccgca ctgctccgaa caataaagat tctacaatac tagcttttat ggttatgaag
3360aggaaaaatt ggcagtaacc tggccccaca aaccttcaaa tgaacgaatc aaattaacaa
3420ccataggatg ataatgcgat tagtttttta gccttatttc tggggtaatt aatcagcgaa
3480gcgatgattt ttgatctatt aacagatata taaatgcaaa aactgcataa ccactttaac
3540taatactttc aacattttcg gtttgtatta cttcttattc aaatgtaata aaagtatcaa
3600caaaaaattg ttaatatacc tctatacttt aacgtcaagg agaaaaaacc ccggatccgt
3660aatacgactc actatagggc ccgggcgtcg acatggaaca gaagttgatt tccgaagaag
3720acctcgagta agcttggtac cgcggctagc taagatccgc tctaaccgaa aaggaaggag
3780ttagacaacc tgaagtctag gtccctattt atttttttat agttatgtta gtattaagaa
3840cgttatttat atttcaaatt tttctttttt ttctgtacag acgcgtgtac gcatgtaaca
3900ttatactgaa aaccttgctt gagaaggttt tgggacgctc gaagatccag ctgcattaat
3960gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc gcttcctcgc
4020tcactgactc gctgcgctcg gtcgttcggc tgcggcgagc ggtatcagct cactcaaagg
4080cggtaatacg gttatccaca gaatcagggg ataacgcagg aaagaacatg tgagcaaaag
4140gccagcaaaa ggccaggaac cgtaaaaagg ccgcgttgct ggcgtttttc cataggctcc
4200gcccccctga cgagcatcac aaaaatcgac gctcaagtca gaggtggcga aacccgacag
4260gactataaag ataccaggcg tttccccctg gaagctccct cgtgcgctct cctgttccga
4320ccctgccgct taccggatac ctgtccgcct ttctcccttc gggaagcgtg gcgctttctc
4380atagctcacg ctgtaggtat ctcagttcgg tgtaggtcgt tcgctccaag ctgggctgtg
4440tgcacgaacc ccccgttcag cccgaccgct gcgccttatc cggtaactat cgtcttgagt
4500ccaacccggt aagacacgac ttatcgccac tggcagcagc cactggtaac aggattagca
4560gagcgaggta tgtaggcggt gctacagagt tcttgaagtg gtggcctaac tacggctaca
4620ctagaaggac agtatttggt atctgcgctc tgctgaagcc agttaccttc ggaaaaagag
4680ttggtagctc ttgatccggc aaacaaacca ccgctggtag cggtggtttt tttgtttgca
4740agcagcagat tacgcgcaga aaaaaaggat ctcaagaaga tcctttgatc ttttctacgg
4800ggtctgacgc tcagtggaac gaaaactcac gttaagggat tttggtcatg agattatcaa
4860aaaggatctt cacctagatc cttttaaatt aaaaatgaag ttttaaatca atctaaagta
4920tatatgagta aacttggtct gacagttacc aatgcttaat cagtgaggca cctatctcag
4980cgatctgtct atttcgttca tccatagttg cctgactccc cgtcgtgtag ataactacga
5040tacgggaggg cttaccatct ggccccagtg ctgcaatgat accgcgagac ccacgctcac
5100cggctccaga tttatcagca ataaaccagc cagccggaag ggccgagcgc agaagtggtc
5160ctgcaacttt atccgcctcc atccagtcta ttaattgttg ccgggaagct agagtaagta
5220gttcgccagt taatagtttg cgcaacgttg ttgccattgc tacaggcatc gtggtgtcac
5280gctcgtcgtt tggtatggct tcattcagct ccggttccca acgatcaagg cgagttacat
5340gatcccccat gttgtgcaaa aaagcggtta gctccttcgg tcctccgatc gttgtcagaa
5400gtaagttggc cgcagtgtta tcactcatgg ttatggcagc actgcataat tctcttactg
5460tcatgccatc cgtaagatgc ttttctgtga ctggtgagta ctcaaccaag tcattctgag
5520aatagtgtat gcggcgaccg agttgctctt gcccggcgtc aatacgggat aataccgcgc
5580cacatagcag aactttaaaa gtgctcatca ttggaaaacg ttcttcgggg cgaaaactct
5640caaggatctt accgctgttg agatccagtt cgatgtaacc cactcgtgca cccaactgat
5700cttcagcatc ttttactttc accagcgttt ctgggtgagc aaaaacagga aggcaaaatg
5760ccgcaaaaaa gggaataagg gcgacacgga aatgttgaat actcatactc ttcctttttc
5820aatattattg aagcatttat cagggttatt gtctcatgag cggatacata tttgaatgta
5880tttagaaaaa taaacaaata ggggttccgc gcacatttcc ccgaaaagtg ccacctgaac
5940gaagcatctg tgcttcattt tgtagaacaa aaatgcaacg cgagagcgct aatttttcaa
6000acaaagaatc tgagctgcat ttttacagaa cagaaatgca acgcgaaagc gctattttac
6060caacgaagaa tctgtgcttc atttttgtaa aacaaaaatg caacgcgaga gcgctaattt
6120ttcaaacaaa gaatctgagc tgcattttta cagaacagaa atgcaacgcg agagcgctat
6180tttaccaaca aagaatctat acttcttttt tgttctacaa aaatgcatcc cgagagcgct
6240atttttctaa caaagcatct tagattactt tttttctcct ttgtgcgctc tataatgcag
6300tctcttgata actttttgca ctgtaggtcc gttaaggtta gaagaaggct actttggtgt
6360ctattttctc ttccataaaa aaagcctgac tccacttccc gcgtttactg attactagcg
6420aagctgcggg tgcatttttt caagataaag gcatccccga ttatattcta taccgatgtg
6480gattgcgcat actttgtgaa cagaaagtga tagcgttgat gattcttcat tggtcagaaa
6540attatgaacg gtttcttcta ttttgtctct atatactacg tataggaaat gtttacattt
6600tcgtattgtt ttcgattcac tctatgaata gttcttacta caattttttt gtctaaagag
6660taatactaga gataaacata aaaaatgtag aggtcgagtt tagatgcaag ttcaaggagc
6720gaaaggtgga tgggtaggtt atatagggat atagcacaga gatatatagc aaagagatac
6780ttttgagcaa tgtttgtgga agcggtattc gcaatatttt agtagctcgt tacagtccgg
6840tgcgtttttg gttttttgaa agtgcgtctt cagagcgctt ttggttttca aaagcgctct
6900gaagttccta tactttctag agaataggaa cttcggaata ggaacttcaa agcgtttccg
6960aaaacgagcg cttccgaaaa tgcaacgcga gctgcgcaca tacagctcac tgttcacgtc
7020gcacctatat ctgcgtgttg cctgtatata tatatacatg agaagaacgg catagtgcgt
7080gtttatgctt aaatgcgtac ttatatgcgt ctatttatgt aggatgaaag gtagtctagt
7140acctcctgtg atattatccc attccatgcg gggtatcgta tgcttccttc agcactaccc
7200tttagctgtt ctatatgctg ccactcctca attggattag tctcatcctt caatgctatc
7260atttcctttg atattggatc atactaagaa accattatta tcatgacatt aacctataaa
7320aataggcgta tcacgaggcc ctttcgtc
7348701125DNAArtificial SequenceSynthetic, TDS_Fs_Sc coding sequence
70atggaaaact ttccaaccga gtacttcttg aacaccaccg tcaggttgtt ggagtacatt
60aggtacaggg actcaaacta taccagggag gagaggattg agaacttaca ctacgcctac
120aacaaagccg cccaccactt cgcccagcca agacagcagc agttgttgaa ggtcgaccct
180aagagattgc aagcttcatt gcagaccatt gtcggtatgg ttgtatattc atgggccaag
240gtatctaaag agtgtatggc agacttgtca atccactata cctacacctt ggtattggac
300gattcaaaag acgacccata ccctactatg gtaaactact tcgatgactt acaagcaggt
360agagaacagg ctcatccttg gtgggcttta gtaaacgagc actttccaaa cgtattgagg
420cattttggtc ctttttgctc attgaacttg atcaggtcta ccttagactt cttcgagggt
480tgctggatag aacaatacaa ttttggagga ttcccaggtt ctcacgacta cccacagttc
540ttgagaagaa tgaacggttt aggacactgc gtcggtgcct ctttgtggcc aaaggagcag
600ttcaatgaaa gatcattgtt tttggagatc acttcagcca tagctcaaat ggaaaattgg
660atggtctggg ttaatgattt gatgtcattt tacaaggagt tcgacgacga gagggatcag
720atctctttgg taaagaacta cgttgtttct gacgagatat cattacacga ggccttagaa
780aaattgaccc aggatacctt gcactcttca aagcaaatgg ttgcagtttt ctcagacaag
840gaccctcaag taatggacac catagagtgc ttcatgcatg gttatgtcac atggcattta
900tgcgacagga ggtacaggtt gtctgaaatc tacgagaaag tcaaggagga aaagactgag
960gatgcccaaa aattttgcaa gttctacgag caagctgcca atgtaggagc cgtttcacct
1020tctgagtggg cctatccacc agtcgcccag ttagctaacg taagatcaaa ggacgtcaaa
1080gaggtccaga aaccattttt atcatctata gaattagttg aataa
1125711788DNAArtificial SequenceSynthetic, IS_Pn_Sc coding sequence
71atggctaccg agttgttgtg cttgcacagg ccaatatctt tgacccacaa attgttcagg
60aatccattgc caaaagtcat acaagcaaca ccattgacct tgaagttaag gtgctctgta
120tcaaccgaga acgtttcatt cacagagaca gaaacagaaa caaggaggtc agctaattac
180gagccaaact catgggatta tgactacttg ttgtcttctg acaccgacga gtctattgag
240gtatataaag acaaggcaaa gaagttggag gctgaagtca ggagggagat caacaacgaa
300aaggcagagt tcttgacttt gccagagttg attgacaacg tacagaggtt gggattgggt
360tataggtttg agtcagacat aagaagggct ttggacaggt ttgtatcttc aggtggattc
420gacgcagtta ctaagacctc attgcatgct accgctttat cttttaggtt attgagacag
480catggtttcg aagtatcaca ggaggcattc tcaggattca aagaccagaa cggaaacttt
540ttgaagaact tgaaggagga cataaaagcc atcttgtctt tatacgaagc ctcatttttg
600gccttagagg gtgagaatat tttagacgag gctaaggtct tcgccatatc tcacttgaag
660gagttgtctg aggagaaaat aggaaaggac ttagccgaac aagtaaacca cgcattggaa
720ttaccattgc ataggagaac tcaaaggtta gaagcagtct ggtctatcga ggcctacagg
780aagaaagagg atgctgatca ggttttattg gagttggcca tcttagacta caacatgatc
840cagtcagtct atcagagaga cttgagagaa acttctaggt ggtggagaag agtcggatta
900gccactaaat tgcacttcgc tagggatagg ttaatagagt cattctattg ggctgttgga
960gtagcttttg aaccacaata ctcagattgt aggaactcag tagccaagat gttctcattc
1020gtcaccataa tcgatgacat ctacgacgta tacggaactt tggatgaatt ggaattattc
1080actgatgcag tcgagagatg ggacgtaaat gccattgatg acttgcctga ttacatgaag
1140ttgtgcttct tagctttgta caacaccata aacgagatcg catacgacaa cttgaaggac
1200aagggtgaaa atatattgcc ttacttaacc aaggcctggg ctgatttgtg taacgcattc
1260ttacaggaag caaaatggtt gtataacaaa tcaacaccta ctttcgacga gtattttggt
1320aacgcttgga agtcttcatc tggaccttta caattggtat ttgcttactt cgccgtcgta
1380caaaacatta agaaagagga gattgataac ttgcaaaagt accacgatat catctcaaga
1440ccatcacaca ttttcaggtt atgtaacgac ttggcctctg cttcagctga aatagctaga
1500ggagagactg caaattcagt ttcatgttac atgaggacca agggtatatc agaagaatta
1560gcaaccgaat ctgtcatgaa tttaatcgac gagacctgga agaagatgaa caaggaaaag
1620ttgggaggtt ctttattcgc aaaacctttt gtcgaaacag ccatcaattt agccaggcag
1680tcacactgta catatcacaa tggtgatgcc cacacctcac ctgacgagtt gaccaggaaa
1740agagttttgt cagttattac tgaacctata ttaccttttg agaggtga
1788729905DNAArtificial SequenceSynthetic, Expression plasmid pAM1812
72gacgaaaggg cctcgtgata cgcctatttt tataggttaa tgtcatgata ataatggttt
60cttagtatga tccaatatca aaggaaatga tagcattgaa ggatgagact aatccaattg
120aggagtggca gcatatagaa cagctaaagg gtagtgctga aggaagcata cgataccccg
180catggaatgg gataatatca caggaggtac tagactacct ttcatcctac ataaatagac
240gcatataagt acgcatttaa gcataaacac gcactatgcc gttcttctca tgtatatata
300tatacaggca acacgcagat ataggtgcga cgtgaacagt gagctgtatg tgcgcagctc
360gcgttgcatt ttcggaagcg ctcgttttcg gaaacgcttt gaagttccta ttccgaagtt
420cctattctct agaaagtata ggaacttcag agcgcttttg aaaaccaaaa gcgctctgaa
480gacgcacttt caaaaaacca aaaacgcacc ggactgtaac gagctactaa aatattgcga
540ataccgcttc cacaaacatt gctcaaaagt atctctttgc tatatatctc tgtgctatat
600ccctatataa cctacccatc cacctttcgc tccttgaact tgcatctaaa ctcgacctct
660acatttttta tgtttatctc tagtattact ctttagacaa aaaaattgta gtaagaacta
720ttcatagagt gaatcgaaaa caatacgaaa atgtaaacat ttcctatacg tagtatatag
780agacaaaata gaagaaaccg ttcataattt tctgaccaat gaagaatcat caacgctatc
840actttctgtt cacaaagtat gcgcaatcca catcggtata gaatataatc ggggatgcct
900ttatcttgaa aaaatgcacc cgcagcttcg ctagtaatca gtaaacgcgg gaagtggagt
960caggcttttt ttatggaaga gaaaatagac accaaagtag ccttcttcta accttaacgg
1020acctacagtg caaaaagtta tcaagagact gcattataga gcgcacaaag gagaaaaaaa
1080gtaatctaag atgctttgtt agaaaaatag cgctctcggg atgcattttt gtagaacaaa
1140aaagaagtat agattctttg ttggtaaaat agcgctctcg cgttgcattt ctgttctgta
1200aaaatgcagc tcagattctt tgtttgaaaa attagcgctc tcgcgttgca tttttgtttt
1260acaaaaatga agcacagatt cttcgttggt aaaatagcgc tttcgcgttg catttctgtt
1320ctgtaaaaat gcagctcaga ttctttgttt gaaaaattag cgctctcgcg ttgcattttt
1380gttctacaaa atgaagcaca gatgcttcgt tcaggtggca cttttcgggg aaatgtgcgc
1440ggaaccccta tttgtttatt tttctaaata cattcaaata tgtatccgct catgagacaa
1500taaccctgat aaatgcttca ataatattga aaaaggaaga gtatgagtat tcaacatttc
1560cgtgtcgccc ttattccctt ttttgcggca ttttgccttc ctgtttttgc tcacccagaa
1620acgctggtga aagtaaaaga tgctgaagat cagttgggtg cacgagtggg ttacatcgaa
1680ctggatctca acagcggtaa gatccttgag agttttcgcc ccgaagaacg ttttccaatg
1740atgagcactt ttaaagttct gctatgtggc gcggtattat cccgtattga cgccgggcaa
1800gagcaactcg gtcgccgcat acactattct cagaatgact tggttgagta ctcaccagtc
1860acagaaaagc atcttacgga tggcatgaca gtaagagaat tatgcagtgc tgccataacc
1920atgagtgata acactgcggc caacttactt ctgacaacga tcggaggacc gaaggagcta
1980accgcttttt tgcacaacat gggggatcat gtaactcgcc ttgatcgttg ggaaccggag
2040ctgaatgaag ccataccaaa cgacgagcgt gacaccacga tgcctgtagc aatggcaaca
2100acgttgcgca aactattaac tggcgaacta cttactctag cttcccggca acaattaata
2160gactggatgg aggcggataa agttgcagga ccacttctgc gctcggccct tccggctggc
2220tggtttattg ctgataaatc tggagccggt gagcgtgggt ctcgcggtat cattgcagca
2280ctggggccag atggtaagcc ctcccgtatc gtagttatct acacgacggg gagtcaggca
2340actatggatg aacgaaatag acagatcgct gagataggtg cctcactgat taagcattgg
2400taactgtcag accaagttta ctcatatata ctttagattg atttaaaact tcatttttaa
2460tttaaaagga tctaggtgaa gatccttttt gataatctca tgaccaaaat cccttaacgt
2520gagttttcgt tccactgagc gtcagacccc gtagaaaaga tcaaaggatc ttcttgagat
2580cctttttttc tgcgcgtaat ctgctgcttg caaacaaaaa aaccaccgct accagcggtg
2640gtttgtttgc cggatcaaga gctaccaact ctttttccga aggtaactgg cttcagcaga
2700gcgcagatac caaatactgt ccttctagtg tagccgtagt taggccacca cttcaagaac
2760tctgtagcac cgcctacata cctcgctctg ctaatcctgt taccagtggc tgctgccagt
2820ggcgataagt cgtgtcttac cgggttggac tcaagacgat agttaccgga taaggcgcag
2880cggtcgggct gaacgggggg ttcgtgcaca cagcccagct tggagcgaac gacctacacc
2940gaactgagat acctacagcg tgagctatga gaaagcgcca cgcttcccga agggagaaag
3000gcggacaggt atccggtaag cggcagggtc ggaacaggag agcgcacgag ggagcttcca
3060gggggaaacg cctggtatct ttatagtcct gtcgggtttc gccacctctg acttgagcgt
3120cgatttttgt gatgctcgtc aggggggcgg agcctatgga aaaacgccag caacgcggcc
3180tttttacggt tcctggcctt ttgctggcct tttgctcaca tgttctttcc tgcgttatcc
3240cctgattctg tggataaccg tattaccgcc tttgagtgag ctgataccgc tcgccgcagc
3300cgaacgaccg agcgcagcga gtcagtgagc gaggaagcgg aagagcgccc aatacgcaaa
3360ccgcctctcc ccgcgcgttg gccgattcat taatgcagct ggatcttcga gcgtcccaaa
3420accttctcaa gcaaggtttt cagtataatg ttacatgcgt acacgcgtct gtacagaaaa
3480aaaagaaaaa tttgaaatat aaataacgtt cttaatacta acataactat aaaaaaataa
3540atagggacct agacttcagg ttgtctaact ccttcctttt cggttagagc ggatcttagc
3600tagctcaaac gaccatagga tgaacgaaga aggacttcat ataagatttc atgtcaccct
3660cagcatgagt aaaaccatca ttaacagagt acaagacctc acacattcta gctaagttta
3720ttgctggcat taacaaaggg aagggaacgg ctgttggacg caaagattct ctattgatta
3780ctttccaggc atcctcaact ttcctactaa tatattcaca tgcttcctct tcagaagcac
3840ctgattcttt agagtaacat tctatagatg aagccacatg tcctctttct tgttcttcct
3900tgtgagatac aatatcgtcc attaatctta ctattacaca ggaagcttta ataataggtg
3960ggtaactaga aacccatttg aatgtgtctt cagtaacaat gtctcctctg ccaacatagg
4020accttgcaat catcaaacca taagtaccag taaccataga aacagacatg tattcttcta
4080aagtaggcat ataaccttcc ttcaaccatc ttgcttctac taagtaatta cgaactaatt
4140ctttagccat ctccttaacg taatgaatct gataggtctt tccctccttt tccaaagatt
4200cttccatttc cacatgcaaa ttgactaatt cttggtagat taatttcata tattcgggca
4260acatatctaa gcatgagata gaccatctct cgacggcttg agtaaaaatc tccaattctt
4320cgtatgttcc ataattatca aaagtatcgt ccaaaactac taaccacatg catgttttca
4380tcaaaaacat tcttgttcta gcgtgttgtg gctcatagta tatggacaat atccagaagt
4440agccttcgac aacacgatca cgtacataag gtaacttatt ttgtaaatct aaatctttcc
4500accacttaca gatatgtgac aattcctttt tatgcataga ctgcaaaaca ctgaaatcca
4560acttggctaa tttcaacaat acttcatcat gagatgtttc ctgttggtag attggcatgt
4620aatgtaatgc ttcaatcctt gctaatctcc ttcttaaagg ttgttttaag gcttgatgga
4680tttgtgtacg caatgaagaa tcgcaagatg ggtcttttgc tatgatatct aaatgaactt
4740ttgtgaattc caaagcattg tctaagatgg tttcatcttc aaccctcata aatgcagctt
4800catataaggc taatattcct tgtgcatcat tgcataaaga ctctttgaat ttaccttttt
4860cgtccataaa gtctttgaaa acgccagagg agacgttaaa gccctgttga cgcaacaacc
4920tgaaccacaa tgaaatactc tgtaaatttt ccttatccac ccactgttca ccataggtaa
4980catgtatatg ttgcaaagct tcctcgatct cttcttcaaa atggtaagct atacctaaac
5040gttgaacagc atcaattaat tcaatcaatt tcacatgctg catgggctca tttgaacctt
5100tgatagttat caattccttc ttaacttcct cttttaattc ctccactaat tgtttcttca
5160taactaaatc ttcaggctca tcataggtca agaattgatc tccccaaata gaagcattga
5220aattcattgt atgtctgata acgtcgggct tggttgagac tttgtcgtcc acgactaatg
5280gtgatgtaga agaggaaaat gacacagaag aaataggcaa agttgacatg gatccggggt
5340tttttctcct tgacgttaaa gtatagaggt atattaacaa ttttttgttg atacttttat
5400tacatttgaa taagaagtaa tacaaaccga aaatgttgaa agtattagtt aaagtggtta
5460tgcagttttt gcatttatat atctgttaat agatcaaaaa tcatcgcttc gctgattaat
5520taccccagaa ataaggctaa aaaactaatc gcattatcat cctatggttg ttaatttgat
5580tcgttcattt gaaggtttgt ggggccaggt tactgccaat ttttcctctt cataaccata
5640aaagctagta ttgtagaatc tttattgttc ggagcagtgc ggcgcgaggc acatctgcgt
5700ttcaggaacg cgaccggtga agacgaggac gcacggagga gagtcttcct tcggagggct
5760gtcacccgct cggcggcttc taatccgtac ttcaatatag caatgagcag ttaagcgtat
5820tactgaaagt tccaaagaga aggttttttt aggctaagat aatggggctc tttacatttc
5880cacaacatat aagtaagatt agatatggat atgtatatgg atatgtatat ggtggtaatg
5940ccatgtaata tgattattaa acttctttgc gtccatccaa aaaaaaagta agaatttttg
6000aaaattcgaa ttcatggaaa actttccaac cgagtacttc ttgaacacca ccgtcaggtt
6060gttggagtac attaggtaca gggactcaaa ctataccagg gaggagagga ttgagaactt
6120acactacgcc tacaacaaag ccgcccacca cttcgcccag ccaagacagc agcagttgtt
6180gaaggtcgac cctaagagat tgcaagcttc attgcagacc attgtcggta tggttgtata
6240ttcatgggcc aaggtatcta aagagtgtat ggcagacttg tcaatccact atacctacac
6300cttggtattg gacgattcaa aagacgaccc ataccctact atggtaaact acttcgatga
6360cttacaagca ggtagagaac aggctcatcc ttggtgggct ttagtaaacg agcactttcc
6420aaacgtattg aggcattttg gtcctttttg ctcattgaac ttgatcaggt ctaccttaga
6480cttcttcgag ggttgctgga tagaacaata caattttgga ggattcccag gttctcacga
6540ctacccacag ttcttgagaa gaatgaacgg tttaggacac tgcgtcggtg cctctttgtg
6600gccaaaggag cagttcaatg aaagatcatt gtttttggag atcacttcag ccatagctca
6660aatggaaaat tggatggtct gggttaatga tttgatgtca ttttacaagg agttcgacga
6720cgagagggat cagatctctt tggtaaagaa ctacgttgtt tctgacgaga tatcattaca
6780cgaggcctta gaaaaattga cccaggatac cttgcactct tcaaagcaaa tggttgcagt
6840tttctcagac aaggaccctc aagtaatgga caccatagag tgcttcatgc atggttatgt
6900cacatggcat ttatgcgaca ggaggtacag gttgtctgaa atctacgaga aagtcaagga
6960ggaaaagact gaggatgccc aaaaattttg caagttctac gagcaagctg ccaatgtagg
7020agccgtttca ccttctgagt gggcctatcc accagtcgcc cagttagcta acgtaagatc
7080aaaggacgtc aaagaggtcc agaaaccatt tttatcatct atagaattag ttgaataagc
7140gaatttctta tgatttatga tttttattat taaataagtt ataaaaaaaa taagtgtata
7200caaattttaa agtgactctt aggttttaaa acgaaaattc ttattcttga gtaactcttt
7260cctgtaggtc aggttgcttt ctcaggtata gcatgaggtc gctccaattc agctggcgta
7320atagcgaaga ggcccgcacc gatcgccctt cccaacagtt gcgcagcctg aatggcgaat
7380ggcgcgacgc gccctgtagc ggcgcattaa gcgcggcggg tgtggtggtt acgcgcagcg
7440tgaccgctac acttgccagc gccctagcgc ccgctccttt cgctttcttc ccttcctttc
7500tcgccacgtt cgccggcttt ccccgtcaag ctctaaatcg ggggctccct ttagggttcc
7560gatttagtgc tttacggcac ctcgacccca aaaaacttga ttagggtgat ggttcacgta
7620gtgggccatc gccctgatag acggtttttc gccctttgac gttggagtcc acgttcttta
7680atagtggact cttgttccaa actggaacaa cactcaaccc tatctcggtc tattcttttg
7740atttataagg gattttgccg atttcggcct attggttaaa aaatgagctg atttaacaaa
7800aatttaacgc gaattttaac aaaatattaa cgtttacaat ttcctgatgc ggtattttct
7860ccttacgcat ctgtgcggta tttcacaccg catatcgacg gtcgaggaga acttctagta
7920tatccacata cctaatatta ttgccttatt aaaaatggaa tcccaacaat tacatcaaaa
7980tccacattct cttcaaaatc aattgtcctg tacttccttg ttcatgtgtg ttcaaaaacg
8040ttatatttat aggataatta tactctattt ctcaacaagt aattggttgt ttggccgagc
8100ggtctaaggc gccttttttt atatatattt caaggatata ccattgtaat gtctgcccct
8160aagaagatcg tcgttttgcc aggtgaccac gttggtcaag aaatcacagc cgaagccatt
8220aaggttctta aagctatttc tgatgttcgt tccaatgtca agttcgattt cgaaaatcat
8280ttaattggtg gtgctgctat cgatgctaca ggtgttccac ttccagatga ggcgctggaa
8340gcctccaaga aggttgatgc cgttttgtta ggtgctgtgg ctggtcctaa atggggtacc
8400ggtagtgtta gacctgaaca aggtttacta aaaatccgta aagaacttca attgtacgcc
8460aacttaagac catgtaactt tgcatccgac tctcttttag acttatctcc aatcaagcca
8520caatttgcta aaggtactga cttcgttgtt gtcagagaat tagtgggagg tatttacttt
8580ggtaagagaa aggaagacga tggtgatggt gtcgcttggg atagtgaaca atacaccgtt
8640ccagaagtgc aaagaatcac aagaatggcc gctttcatgg ccctacaaca tgagccacca
8700ttgcctattt ggtccttgga taaagctaat cttttggcct cttcaagatt atggagaaaa
8760actgtggagg aaaccatcaa gaacgaattc cctacattga aggttcaaca tcaattgatt
8820gattctgccg ccatgatcct agttaagaac ccaacccacc taaatggtat tataatcacc
8880agcaacatgt ttggtgatat catctccgat gaagcctccg ttatcccagg ttccttgggt
8940ttgttgccat ctgcgtcctt ggcctctttg ccagacaaga acaccgcatt tggtttgtac
9000gaaccatgcc acggttctgc tccagatttg ccaaagaata aggttgaccc tatcgccact
9060atcttgtctg ctgcaatgat gttgaaattg tcattgaact tgcctgaaga aggtaaggcc
9120attgaagatg cagttaaaaa ggttttggat gcaggtatca gaactggtga tttaggtggt
9180tccaacagta ccaccgaagt cggtgatgct gtcgccgaag aagttaagaa aatccttgct
9240taaaaagatt ctcttttttt atgatatttg tacataaact ttataaatga aattcataat
9300agaaacgaca cgaaattaca aaatggaata tgttcatagg gtagacgaaa ctatatacgc
9360aatctacata catttatcaa gaaggagaaa aaggaggata gtaaaggaat acaggtaagc
9420aaattgatac taatggctca acgtgataag gaaaaagaat tgcactttaa cattaatatt
9480gacaaggagg agggcaccac acaaaaagtt aggtgtaaca gaaaatcatg aaactacgat
9540tcctaatttg atattggagg attttctcta aaaaaaaaaa aatacaacaa ataaaaaaca
9600ctcaatgacc tgaccatttg atggagttta agtcaatacc ttcttgaagc atttcccata
9660atggtgaaag ttccctcaag aattttactc tgtcagaaac ggccttacga cgtagtcgat
9720atggtgcact ctcagtacaa tctgctctga tgccgcatag ttaagccagc cccgacaccc
9780gccaacaccc gctgacgcgc cctgacgggc ttgtctgctc ccggcatccg cttacagaca
9840agctgtgacc gtctccggga gctgcatgtg tcagaggttt tcaccgtcat caccgaaacg
9900cgcga
9905732307DNAArtificial SequenceSynthetic, FS_Ad_Sc coding sequence
73atggaacctc tgctattctc aatccaaaca ctagtgcatc aagtgaaaca ggaaattttc
60tcatctactt ttgatttgta tagctttgta agcccatctg cctatgatac agcatggtta
120gccatgattc cccatccaaa acaaaactct tgccctaaat ttaaaggctg tttggattgg
180atcttagata accaaaagga agcaggatac tggggtgaat gtgatcacga tggattacca
240actatagata gcctgcccgc aactctagcc tgtatggtag ctttgaagac gtggggtgtg
300tcagagaagc atataaataa aggacttgct tttattcacg caaactcaac cacattgttg
360aaagaaaaat acgaccattt gccaaggtgg tttgtcatag tttttcccgc gatggtcgaa
420gtcgctcaag ccgccggcct aaaagttttg tttagtaacg gattagaaga ggtggttctt
480aatatttctc tggaaagaga aaaaatacta gaaagagaag agttcgtcga taaatatcat
540tacccacctc ttgcatctta tttagaagcc ctgcctccaa gttataccat agacagaaag
600gatataacta tgaacctatc aggcgatggc tcctgctttc agtccccgtc agctactgct
660tgcgcctttt tggcaaccgg aaatcaaaaa tgcatggctt acctggaatc tttggtacag
720aagagacccg gtggtgtgcc gaccatgtat ccgatggatg gagaattggt gagcctttgc
780ttagtaaatc aaattcaaag attgggttta gcggagcatt tcacagaaga aattgaggag
840aatttaaaat tgatatatga aaattataag aaccaagaat cacgtgaaat gaaagattca
900tatttggtgc caactaagat ttataaggat agtttagcct tcagattgct acgtatgcac
960ggttataatg ttacgcccag acgtttctgt tggtttttat accaagaaga tatacgtgtc
1020cacatagaga aaaattacga gtgttttaca tcagcgctgt acaatgtcta ccgtgccaca
1080gacttaatgt tttctggtga atatgaattg gaagaagcca gggtcttctc taggaaattg
1140ctggagaaat caatgaaatt gaagtcttta aacgataatt tggttaattt tccatctttc
1200aggtcagtta ttgatcatga gttgtctgtg ccttggatcg cccgtttgga gcatcttgat
1260catagaatgt ggattgaaga aaataaggtg gatacacttt ggatcggtaa agcctctttt
1320tatcgtctgc gtgcgcttaa cgataagtta atgacattag ctgtggagtc atataagttt
1380agacaatctt tttatagaaa cgaacttgaa gaattgaaaa gatggagtaa ggactggggt
1440ttgacagatt taggattcgg tagaaaaaaa acgacatatt gttattatgc aattgctgct
1500tcctctagtt taccacacaa ttctatggtc agattgattg tggcaaaatc cgcattactt
1560gtgaccattg cagatgattt ctttgatatg gaagggtccc tagaggattt acaaagtttg
1620acacaggctg tacaaagatg ggatggcaac agtttgtccg gtcacggtaa aataatattc
1680tgcgcattag acaacttggt tagtgatatc gccaaacccc atttacacct agaagggtca
1740catgtagccg agaatgtcaa aaacatgtgg tctgaaacta tcgccagctg gttgactgag
1800actacctgga gtcacacagg ttacgtccct agtctggatg aatacctaca gacaggtaag
1860atttctgttg cttctcagtt gatgaccgtc ccagctttat gttttttatc tccaaacgtt
1920caccctatct gtaagcttga agctaatcac tatcaaatta taactaagtt gttgatggtc
1980tctacaagat tgcttaacga tactcaaaca tacgaaaagg agttaaaaga cggtaaaaga
2040aattttgtta tccttcattc taaggggtca ccacagacag gaatcgagaa atcagttgct
2100tttgttaagg aaattttgga tcaaatagaa aaagagttct tagaacatac tttgatggac
2160ggtcataacg atctacctaa gccttgtaag catttacatt tgtctatatt aagagcattt
2220cacatgttct ataactcagg agacttattc gatagcgata caggattgct tcatgatatc
2280aataaggcgt tttatgtccc cttgtaa
2307748671DNAArtificial SequenceSynthetic, Expression plasmid pAM1764
74tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
60cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
120ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
180accatatcga ctacgtcgta aggccgtttc tgacagagta aaattcttga gggaactttc
240accattatgg gaaatggttc aagaaggtat tgacttaaac tccatcaaat ggtcaggtca
300ttgagtgttt tttatttgtt gtattttttt ttttttagag aaaatcctcc aatatcaaat
360taggaatcgt agtttcatga ttttctgtta cacctaactt tttgtgtggt gccctcctcc
420ttgtcaatat taatgttaaa gtgcaattct ttttccttat cacgttgagc cattagtatc
480aatttgctta cctgtattcc tttactatcc tcctttttct ccttcttgat aaatgtatgt
540agattgcgta tatagtttcg tctaccctat gaacatattc cattttgtaa tttcgtgtcg
600tttctattat gaatttcatt tataaagttt atgtacaaat atcataaaaa aagagaatct
660ttttaagcaa ggattttctt aacttcttcg gcgacagcat caccgacttc ggtggtactg
720ttggaaccac ctaaatcacc agttctgata cctgcatcca aaaccttttt aactgcatct
780tcaatggcct taccttcttc aggcaagttc aatgacaatt tcaacatcat tgcagcagac
840aagatagtgg cgatagggtc aaccttattc tttggcaaat ctggagcaga accgtggcat
900ggttcgtaca aaccaaatgc ggtgttcttg tctggcaaag aggccaagga cgcagatggc
960aacaaaccca aggaacctgg gataacggag gcttcatcgg agatgatatc accaaacatg
1020ttgctggtga ttataatacc atttaggtgg gttgggttct taactaggat catggcggca
1080gaatcaatca attgatgttg aaccttcaat gtagggaatt cgttcttgat ggtttcctcc
1140acagtttttc tccataatct tgaagaggcc aaaacattag ctttatccaa ggaccaaata
1200ggcaatggtg gctcatgttg tagggccatg aaagcggcca ttcttgtgat tctttgcact
1260tctggaacgg tgtattgttc actatcccaa gcgacaccat caccatcgtc ttcctttctc
1320ttaccaaagt aaatacctcc cactaattct ctgacaacaa cgaagtcagt acctttagca
1380aattgtggct tgattggaga taagtctaaa agagagtcgg atgcaaagtt acatggtctt
1440aagttggcgt acaattgaag ttctttacgg atttttagta aaccttgttc aggtctaaca
1500ctaccggtac cccatttagg accacccaca gcacctaaca aaacggcatc aaccttcttg
1560gaggcttcca gcgcctcatc tggaagtggg acacctgtag catcgatagc agcaccacca
1620attaaatgat tttcgaaatc gaacttgaca ttggaacgaa catcagaaat agctttaaga
1680accttaatgg cttcggctgt gatttcttga ccaacgtggt cacctggcaa aacgacgatc
1740ttcttagggg cagacatagg ggcagacatt agaatggtat atccttgaaa tatatatata
1800tattgctgaa atgtaaaagg taagaaaagt tagaaagtaa gacgattgct aaccacctat
1860tggaaaaaac aataggtcct taaataatat tgtcaacttc aagtattgtg atgcaagcat
1920ttagtcatga acgcttctct attctatatg aaaagccggt tccggcctct cacctttcct
1980ttttctccca atttttcagt tgaaaaaggt atatgcgtca ggcgacctct gaaattaaca
2040aaaaatttcc agtcatcgaa tttgattctg tgcgatagcg cccctgtgtg ttctcgttat
2100gttgaggaaa aaaataatgg ttgctaagag attcgaactc ttgcatctta cgatacctga
2160gtattcccac agttaactgc ggtcaagata tttcttgaat caggcgcctt agaccgctcg
2220gccaaacaac caattacttg ttgagaaata gagtataatt atcctataaa tataacgttt
2280ttgaacacac atgaacaagg aagtacagga caattgattt tgaagagaat gtggattttg
2340atgtaattgt tgggattcca tttttaataa ggcaataata ttaggtatgt ggatatacta
2400gaagttctcc tcgaccgtcg atatgcggtg tgaaataccg cacagatgcg taaggagaaa
2460ataccgcatc aggaaattgt aaacgttaat attttgttaa aattcgcgtt aaatttttgt
2520taaatcagct cattttttaa ccaataggcc gaaatcggca aaatccctta taaatcaaaa
2580gaatagaccg agatagggtt gagtgttgtt ccagtttgga acaagagtcc actattaaag
2640aacgtggact ccaacgtcaa agggcgaaaa accgtctatc agggcgatgg cccactacgt
2700gaaccatcac cctaatcaag ttttttgggg tcgaggtgcc gtaaagcact aaatcggaac
2760cctaaaggga gcccccgatt tagagcttga cggggaaagc cggcgaacgt ggcgagaaag
2820gaagggaaga aagcgaaagg agcgggcgct agggcgctgg caagtgtagc ggtcacgctg
2880cgcgtaacca ccacacccgc cgcgcttaat gcgccgctac agggcgcgtc gcgccattcg
2940ccattcaggc tgcgcaactg ttgggaaggg cgatcggtgc gggcctcttc gctattacgc
3000cagctggcga aagggggatg tgctgcaagg cgattaagtt gggtaacgcc agggttttcc
3060cagtcacgac gttgtaaaac gacggccagt gagcgcgcgt aatacgactc actatagggc
3120gaattgggta ccgggccccc cctcgaggtc gacggtatcg ataagctcta gagcggccgc
3180cctttagtga gggttgaatt cgaattttca aaaattctta cttttttttt ggatggacgc
3240aaagaagttt aataatcata ttacatggca ttaccaccat atacatatcc atatacatat
3300ccatatctaa tcttacttat atgttgtgga aatgtaaaga gccccattat cttagcctaa
3360aaaaaccttc tctttggaac tttcagtaat acgcttaact gctcattgct atattgaagt
3420acggattaga agccgccgag cgggtgacag ccctccgaag gaagactctc ctccgtgcgt
3480cctcgtcttc accggtcgcg ttcctgaaac gcagatgtgc ctcgcgccgc actgctccga
3540acaataaaga ttctacaata ctagctttta tggttatgaa gaggaaaaat tggcagtaac
3600ctggccccac aaaccttcaa atgaacgaat caaattaaca accataggat gataatgcga
3660ttagtttttt agccttattt ctggggtaat taatcagcga agcgatgatt tttgatctat
3720taacagatat ataaatgcaa aaactgcata accactttaa ctaatacttt caacattttc
3780ggtttgtatt acttcttatt caaatgtaat aaaagtatca acaaaaaatt gttaatatac
3840ctctatactt taacgtcaag gagaaaaaac cccggatcca tggatacttt gcctatttct
3900tctgtgtcat tttcctcttc tacatcacca ttagtcgtgg acgacaaagt ctcaaccaag
3960cccgacgtta tcagacatac aatgaatttc aatgcttcta tttggggaga tcaattcttg
4020acctatgatg agcctgaaga tttagttatg aagaaacaat tagtggagga attaaaagag
4080gaagttaaga aggaattgat aactatcaaa ggttcaaatg agcccatgca gcatgtgaaa
4140ttgattgaat taattgatgc tgttcaacgt ttaggtatag cttaccattt tgaagaagag
4200atcgaggaag ctttgcaaca tatacatgtt acctatggtg aacagtgggt ggataaggaa
4260aatttacaga gtatttcatt gtggttcagg ttgttgcgtc aacagggctt taacgtctcc
4320tctggcgttt tcaaagactt tatggacgaa aaaggtaaat tcaaagagtc tttatgcaat
4380gatgcacaag gaatattagc cttatatgaa gctgcattta tgagggttga agatgaaacc
4440atcttagaca atgctttgga attcacaaaa gttcatttag atatcatagc aaaagaccca
4500tcttgcgatt cttcattgcg tacacaaatc catcaagcct taaaacaacc tttaagaagg
4560agattagcaa ggattgaagc attacattac atgccaatct accaacagga aacatctcat
4620gatgaagtat tgttgaaatt agccaagttg gatttcagtg ttttgcagtc tatgcataaa
4680aaggaattgt cacatatctg taagtggtgg aaagatttag atttacaaaa taagttacct
4740tatgtacgtg atcgtgttgt cgaaggctac ttctggatat tgtccatata ctatgagcca
4800caacacgcta gaacaagaat gtttttgatg aaaacatgca tgtggttagt agttttggac
4860gatacttttg ataattatgg aacatacgaa gaattggaga tttttactca agccgtcgag
4920agatggtcta tctcatgctt agatatgttg cccgaatata tgaaattaat ctaccaagaa
4980ttagtcaatt tgcatgtgga aatggaagaa tctttggaaa aggagggaaa gacctatcag
5040attcattacg ttaaggagat ggctaaagaa ttagttcgta attacttagt agaagcaaga
5100tggttgaagg aaggttatat gcctacttta gaagaataca tgtctgtttc tatggttact
5160ggtacttatg gtttgatgat tgcaaggtcc tatgttggca gaggagacat tgttactgaa
5220gacacattca aatgggtttc tagttaccca cctattatta aagcttcctg tgtaatagta
5280agattaatgg acgatattgt atctcacaag gaagaacaag aaagaggaca tgtggcttca
5340tctatagaat gttactctaa agaatcaggt gcttctgaag aggaagcatg tgaatatatt
5400agtaggaaag ttgaggatgc ctggaaagta atcaatagag aatctttgcg tccaacagcc
5460gttcccttcc ctttgttaat gccagcaata aacttagcta gaatgtgtga ggtcttgtac
5520tctgttaatg atggttttac tcatgctgag ggtgacatga aatcttatat gaagtccttc
5580ttcgttcatc ctatggtcgt ttgagctagc taagatccgc tctaaccgaa aaggaaggag
5640ttagacaacc tgaagtctag gtccctattt atttttttat agttatgtta gtattaagaa
5700cgttatttat atttcaaatt tttctttttt ttctgtacag acgcgtgtac gcatgtaaca
5760ttatactgaa aaccttgctt gagaaggttt tgggacgctc gaagatccag ctgcattaat
5820gaatcggcca acgcgcgggg agaggcggtt tgcgtattgg gcgctcttcc gctcggtgga
5880gctccagctt ttgttccctt tagtgagggt taattgcgcg cttggcgtaa tcatggtcat
5940agctgtttcc tgtgtgaaat tgttatccgc tcacaattcc acacaacata ggagccggaa
6000gcataaagtg taaagcctgg ggtgcctaat gagtgaggta actcacatta attgcgttgc
6060gctcactgcc cgctttccag tcgggaaacc tgtcgtgcca gctgcattaa tgaatcggcc
6120aacgcgcggg gagaggcggt ttgcgtattg ggcgctcttc cgcttcctcg ctcactgact
6180cgctgcgctc ggtcgttcgg ctgcggcgag cggtatcagc tcactcaaag gcggtaatac
6240ggttatccac agaatcaggg gataacgcag gaaagaacat gtgagcaaaa ggccagcaaa
6300aggccaggaa ccgtaaaaag gccgcgttgc tggcgttttt ccataggctc cgcccccctg
6360acgagcatca caaaaatcga cgctcaagtc agaggtggcg aaacccgaca ggactataaa
6420gataccaggc gtttccccct ggaagctccc tcgtgcgctc tcctgttccg accctgccgc
6480ttaccggata cctgtccgcc tttctccctt cgggaagcgt ggcgctttct catagctcac
6540gctgtaggta tctcagttcg gtgtaggtcg ttcgctccaa gctgggctgt gtgcacgaac
6600cccccgttca gcccgaccgc tgcgccttat ccggtaacta tcgtcttgag tccaacccgg
6660taagacacga cttatcgcca ctggcagcag ccactggtaa caggattagc agagcgaggt
6720atgtaggcgg tgctacagag ttcttgaagt ggtggcctaa ctacggctac actagaagga
6780cagtatttgg tatctgcgct ctgctgaagc cagttacctt cggaaaaaga gttggtagct
6840cttgatccgg caaacaaacc accgctggta gcggtggttt ttttgtttgc aagcagcaga
6900ttacgcgcag aaaaaaagga tctcaagaag atcctttgat cttttctacg gggtctgacg
6960ctcagtggaa cgaaaactca cgttaaggga ttttggtcat gagattatca aaaaggatct
7020tcacctagat ccttttaaat taaaaatgaa gttttaaatc aatctaaagt atatatgagt
7080aaacttggtc tgacagttac caatgcttaa tcagtgaggc acctatctca gcgatctgtc
7140tatttcgttc atccatagtt gcctgactcc ccgtcgtgta gataactacg atacgggagg
7200gcttaccatc tggccccagt gctgcaatga taccgcgaga cccacgctca ccggctccag
7260atttatcagc aataaaccag ccagccggaa gggccgagcg cagaagtggt cctgcaactt
7320tatccgcctc catccagtct attaattgtt gccgggaagc tagagtaagt agttcgccag
7380ttaatagttt gcgcaacgtt gttgccattg ctacaggcat cgtggtgtca cgctcgtcgt
7440ttggtatggc ttcattcagc tccggttccc aacgatcaag gcgagttaca tgatccccca
7500tgttgtgcaa aaaagcggtt agctccttcg gtcctccgat cgttgtcaga agtaagttgg
7560ccgcagtgtt atcactcatg gttatggcag cactgcataa ttctcttact gtcatgccat
7620ccgtaagatg cttttctgtg actggtgagt actcaaccaa gtcattctga gaatagtgta
7680tgcggcgacc gagttgctct tgcccggcgt caatacggga taataccgcg ccacatagca
7740gaactttaaa agtgctcatc attggaaaac gttcttcggg gcgaaaactc tcaaggatct
7800taccgctgtt gagatccagt tcgatgtaac ccactcgtgc acccaactga tcttcagcat
7860cttttacttt caccagcgtt tctgggtgag caaaaacagg aaggcaaaat gccgcaaaaa
7920agggaataag ggcgacacgg aaatgttgaa tactcatact cttccttttt caatattatt
7980gaagcattta tcagggttat tgtctcatga gcggatacat atttgaatgt atttagaaaa
8040ataaacaaat aggggttccg cgcacatttc cccgaaaagt gccacctggg tccttttcat
8100cacgtgctat aaaaataatt ataatttaaa ttttttaata taaatatata aattaaaaat
8160agaaagtaaa aaaagaaatt aaagaaaaaa tagtttttgt tttccgaaga tgtaaaagac
8220tctaggggga tcgccaacaa atactacctt ttatcttgct cttcctgctc tcaggtatta
8280atgccgaatt gtttcatctt gtctgtgtag aagaccacac acgaaaatcc tgtgatttta
8340cattttactt atcgttaatc gaatgtatat ctatttaatc tgcttttctt gtctaataaa
8400tatatatgta aagtacgctt tttgttgaaa ttttttaaac ctttgtttat ttttttttct
8460tcattccgta actcttctac cttctttatt tactttctaa aatccaaata caaaacataa
8520aaataaataa acacagagta aattcccaaa ttattccatc attaaaagat acgaggcgcg
8580tgtaagttac aggcaagcga tccgtcctaa gaaaccatta ttatcatgac attaacctat
8640aaaaataggc gtatcacgag gccctttcgt c
86717544DNAArtificial SequenceSynthetic, Primer AM-288-90-CPK1621
75cttggcacat cctcttccgt agcttcgagc gtcccaaaac cttc
44761725DNAArtificial SequenceSynthetic, FS_S2D_Sc coding sequence
76atggatactt tgcctatttc ttctgtgtca ttttcctctt ctacatcacc attagtcgtg
60gacgacaaag tctcaaccaa gcccgacgtt atcagacata caatgaattt caatgcttct
120atttggggag atcaattctt gacctatgat gagcctgaag atttagttat gaagaaacaa
180ttagtggagg aattaaaaga ggaagttaag aaggaattga taactatcaa aggttcaaat
240gagcccatgc agcatgtgaa attgattgaa ttaattgatg ctgttcaacg tttaggtata
300gcttaccatt ttgaagaaga gatcgaggaa gctttgcaac atatacatgt tacctatggt
360gaacagtggg tggataagga aaatttacag agtatttcat tgtggttcag gttgttgcgt
420caacagggct ttaacgtctc ctctggcgtt ttcaaagact ttatggacga aaaaggtaaa
480ttcaaagagt ctttatgcaa tgatgcacaa ggaatattag ccttatatga agctgcattt
540atgagggttg aagatgaaac catcttagac aatgctttgg aattcacaaa agttcattta
600gatatcatag caaaagaccc atcttgcgat tcttcattgc gtacacaaat ccatcaagcc
660ttaaaacaac ctttaagaag gagattagca aggattgaag cattacatta catgccaatc
720taccaacagg aaacatctca tgatgaagta ttgttgaaat tagccaagtt ggatttcagt
780gttttgcagt ctatgcataa aaaggaattg tcacatatct gtaagtggtg gaaagattta
840gatttacaaa ataagttacc ttatgtacgt gatcgtgttg tcgaaggcta cttctggata
900ttgtccatat actatgagcc acaacacgct agaacaagaa tgtttttgat gaaaacatgc
960atgtggttag tagttttgga cgatactttt gataattatg gaacatacga agaattggag
1020atttttactc aagccgtcga gagatggtct atctcatgct tagatatgtt gcccgaatat
1080atgaaattaa tctaccaaga attagtcaat ttgcatgtgg aaatggaaga atctttggaa
1140aaggagggaa agacctatca gattcattac gttaaggaga tggctaaaga attagttcgt
1200aattacttag tagaagcaag atggttgaag gaaggttata tgcctacttt agaagaatac
1260atgtctgttt ctatggttac tggtacttat ggtttgatga ttgcaaggtc ctatgttggc
1320agaggagaca ttgttactga agacacattc aaatgggttt ctagttaccc acctattatt
1380aaagcttcct gtgtaatagt aagattaatg gacgatattg tatctcacaa ggaagaacaa
1440gaaagaggac atgtggcttc atctatagaa tgttactcta aagaatcagg tgcttctgaa
1500gaggaagcat gtgaatatat tagtaggaaa gttgaggatg cctggaaagt aatcaataga
1560gaatctttgc gtccaacagc cgttcccttc cctttgttaa tgccagcaat aaacttagct
1620agaatgtgtg aggtcttgta ctctgttaat gatggtttta ctcatgctga gggtgacatg
1680aaatcttata tgaagtcctt cttcgttcat cctatggtcg tttga
17257729DNAArtificial SequenceSynthetic, Primer PW-091-144-CPK640
77gtttaaactg cgaaaagaaa cgtggataa
297844DNAArtificial SequenceSynthetic, Primer AM-288-90-CPK1615
78aagttccctc aagaatttta ctgacaggcc tcgagatatt tgag
447944DNAArtificial SequenceSynthetic, Primer AM-288-90-CPK1620
79gaaggttttg ggacgctcga agctacggaa gaggatgtgc caag
448028DNAArtificial SequenceSynthetic, Primer PW-091-144-CPK649
80gtttaaaccg tttaagtgtc actgtgct
288141DNAArtificial SequenceSynthetic, Primer AM-288-90-CPK1616
81actagaagtt ctcctcgacc gttttcaaaa attcttactt t
418220DNAArtificial SequenceSynthetic, Primer AM-288-90-CPK1638
82gtatagaggt atattaacaa
208351DNAArtificial SequenceSynthetic, Primer AM-288-90-CPK1618
83ttgttaatat acctctatac tttaacgtca aggagaaaaa accccggatc c
518447DNAArtificial SequenceSynthetic, Primer AM-288-90-CPK1619
84aggttgtctg actccttcct tttcggttag agcggatctt agctagc
478520DNAArtificial SequenceSynthetic, Primer AM-288-90-CPK1639
85gaaaaggaag gagtcagaca
20866365DNAArtificial SequenceSynthetic, Construct A 86ctgcgaaaag
aaacgtggat aagtattata gaaacagcac ttcttcggcc aacaatatca 60cgcaaattga
gcaagatagt gctataaaag gtcttttgcc cttttttgcc tattatgcaa 120gcattgcttt
actagtgtgg atgcaaccaa gctttattac actctctttc atcctttccg 180ttggtttcac
gggagcattt accgtcggaa gaataatcgt ttgccattta actaagcaga 240gctttcccat
gttcaatgca cccatgttaa ttcctttgtg ccagatagta ttgtacaaaa 300tatgtctatc
cctttgggga attgagtcta ataaaatcgt ctttgcccta tcttggcttg 360ggttcggtct
ctcactaggt gttcacatta tgtttatgaa tgacattatc catgaattta 420ctgagtacct
ggacgtttat gctttatcca tcaagcgctc caagctgaca taaatcgcac 480tttgtatcta
ctttttttta ttcgaaaaca aggcacaaca atgaatctat cgccctgtga 540gattttcaat
ctcaagtttg tgtaatagat agcgttatat tatagaacta taaaggtcct 600tgaatataca
tagtgtttca ttcctattac tgtatatgtg actttacatt gttacttccg 660cggctatttg
acgttttctg cttcaggtgc ggcttggagg gcaaagtgtc agaaaatcgg 720ccaggccgta
tgacacaaaa gagtagaaaa cgagatctca aatatctcga ggcctgtcag 780taaaattctt
gagggaactt tcaccattat gggaaatggt tcaagaaggt attgacttaa 840actccatcaa
atggtcaggt cattgagtgt tttttatttg ttgtattttt ttttttttag 900agaaaatcct
ccaatatcaa attaggaatc gtagtttcat gattttctgt tacacctaac 960tttttgtgtg
gtgccctcct ccttgtcaat attaatgtta aagtgcaatt ctttttcctt 1020atcacgttga
gccattagta tcaatttgct tacctgtatt cctttactat cctccttttt 1080ctccttcttg
ataaatgtat gtagattgcg tatatagttt cgtctaccct atgaacatat 1140tccattttgt
aatttcgtgt cgtttctatt atgaatttca tttataaagt ttatgtacaa 1200atatcataaa
aaaagagaat ctttttaagc aaggattttc ttaacttctt cggcgacagc 1260atcaccgact
tcggtggtac tgttggaacc acctaaatca ccagttctga tacctgcatc 1320caaaaccttt
ttaactgcat cttcaatggc cttaccttct tcaggcaagt tcaatgacaa 1380tttcaacatc
attgcagcag acaagatagt ggcgataggg tcaaccttat tctttggcaa 1440atctggagca
gaaccgtggc atggttcgta caaaccaaat gcggtgttct tgtctggcaa 1500agaggccaag
gacgcagatg gcaacaaacc caaggaacct gggataacgg aggcttcatc 1560ggagatgata
tcaccaaaca tgttgctggt gattataata ccatttaggt gggttgggtt 1620cttaactagg
atcatggcgg cagaatcaat caattgatgt tgaaccttca atgtagggaa 1680ttcgttcttg
atggtttcct ccacagtttt tctccataat cttgaagagg ccaaaacatt 1740agctttatcc
aaggaccaaa taggcaatgg tggctcatgt tgtagggcca tgaaagcggc 1800cattcttgtg
attctttgca cttctggaac ggtgtattgt tcactatccc aagcgacacc 1860atcaccatcg
tcttcctttc tcttaccaaa gtaaatacct cccactaatt ctctgacaac 1920aacgaagtca
gtacctttag caaattgtgg cttgattgga gataagtcta aaagagagtc 1980ggatgcaaag
ttacatggtc ttaagttggc gtacaattga agttctttac ggatttttag 2040taaaccttgt
tcaggtctaa cactaccggt accccattta ggaccaccca cagcacctaa 2100caaaacggca
tcaaccttct tggaggcttc cagcgcctca tctggaagtg ggacacctgt 2160agcatcgata
gcagcaccac caattaaatg attttcgaaa tcgaacttga cattggaacg 2220aacatcagaa
atagctttaa gaaccttaat ggcttcggct gtgatttctt gaccaacgtg 2280gtcacctggc
aaaacgacga tcttcttagg ggcagacata ggggcagaca ttagaatggt 2340atatccttga
aatatatata tatattgctg aaatgtaaaa ggtaagaaaa gttagaaagt 2400aagacgattg
ctaaccacct attggaaaaa acaataggtc cttaaataat attgtcaact 2460tcaagtattg
tgatgcaagc atttagtcat gaacgcttct ctattctata tgaaaagccg 2520gttccggcct
ctcacctttc ctttttctcc caatttttca gttgaaaaag gtatatgcgt 2580caggcgacct
ctgaaattaa caaaaaattt ccagtcatcg aatttgattc tgtgcgatag 2640cgcccctgtg
tgttctcgtt atgttgagga aaaaaataat ggttgctaag agattcgaac 2700tcttgcatct
tacgatacct gagtattccc acagttaact gcggtcaaga tatttcttga 2760atcaggcgcc
ttagaccgct cggccaaaca accaattact tgttgagaaa tagagtataa 2820ttatcctata
aatataacgt ttttgaacac acatgaacaa ggaagtacag gacaattgat 2880tttgaagaga
atgtggattt tgatgtaatt gttgggattc catttttaat aaggcaataa 2940tattaggtat
gtggatatac tagaagttct cctcgaccgt tttcaaaaat tcttactttt 3000tttttggatg
gacgcaaaga agtttaataa tcatattaca tggcattacc accatataca 3060tatccatata
catatccata tctaatctta cttatatgtt gtggaaatgt aaagagcccc 3120attatcttag
cctaaaaaaa ccttctcttt ggaactttca gtaatacgct taactgctca 3180ttgctatatt
gaagtacgga ttagaagccg ccgagcgggt gacagccctc cgaaggaaga 3240ctctcctccg
tgcgtcctcg tcttcaccgg tcgcgttcct gaaacgcaga tgtgcctcgc 3300gccgcactgc
tccgaacaat aaagattcta caatactagc ttttatggtt atgaagagga 3360aaaattggca
gtaacctggc cccacaaacc ttcaaatgaa cgaatcaaat taacaaccat 3420aggatgataa
tgcgattagt tttttagcct tatttctggg gtaattaatc agcgaagcga 3480tgatttttga
tctattaaca gatatataaa tgcaaaaact gcataaccac tttaactaat 3540actttcaaca
ttttcggttt gtattacttc ttattcaaat gtaataaaag tatcaacaaa 3600aaattgttaa
tatacctcta tactttaacg tcaaggagaa aaaaccccgg atccatgtca 3660actttgccta
tttcttctgt gtcattttcc tcttctacat caccattagt cgtggacgac 3720aaagtctcaa
ccaagcccga cgttatcaga catacaatga atttcaatgc ttctatttgg 3780ggagatcaat
tcttgaccta tgatgagcct gaagatttag ttatgaagaa acaattagtg 3840gaggaattaa
aagaggaagt taagaaggaa ttgataacta tcaaaggttc aaatgagccc 3900atgcagcatg
tgaaattgat tgaattaatt gatgctgttc aacgtttagg tatagcttac 3960cattttgaag
aagagatcga ggaagctttg caacatatac atgttaccta tggtgaacag 4020tgggtggata
aggaaaattt acagagtatt tcattgtggt tcaggttgtt gcgtcaacag 4080ggctttaacg
tctcctctgg cgttttcaaa gactttatgg acgaaaaagg taaattcaaa 4140gagtctttat
gcaatgatgc acaaggaata ttagccttat atgaagctgc atttatgagg 4200gttgaagatg
aaaccatctt agacaatgct ttggaattca caaaagttca tttagatatc 4260atagcaaaag
acccatcttg cgattcttca ttgcgtacac aaatccatca agccttaaaa 4320caacctttaa
gaaggagatt agcaaggatt gaagcattac attacatgcc aatctaccaa 4380caggaaacat
ctcatgatga agtattgttg aaattagcca agttggattt cagtgttttg 4440cagtctatgc
ataaaaagga attgtcacat atctgtaagt ggtggaaaga tttagattta 4500caaaataagt
taccttatgt acgtgatcgt gttgtcgaag gctacttctg gatattgtcc 4560atatactatg
agccacaaca cgctagaaca agaatgtttt tgatgaaaac atgcatgtgg 4620ttagtagttt
tggacgatac ttttgataat tatggaacat acgaagaatt ggagattttt 4680actcaagccg
tcgagagatg gtctatctca tgcttagata tgttgcccga atatatgaaa 4740ttaatctacc
aagaattagt caatttgcat gtggaaatgg aagaatcttt ggaaaaggag 4800ggaaagacct
atcagattca ttacgttaag gagatggcta aagaattagt tcgtaattac 4860ttagtagaag
caagatggtt gaaggaaggt tatatgccta ctttagaaga atacatgtct 4920gtttctatgg
ttactggtac ttatggtttg atgattgcaa ggtcctatgt tggcagagga 4980gacattgtta
ctgaagacac attcaaatgg gtttctagtt acccacctat tattaaagct 5040tcctgtgtaa
tagtaagatt aatggacgat attgtatctc acaaggaaga acaagaaaga 5100ggacatgtgg
cttcatctat agaatgttac tctaaagaat caggtgcttc tgaagaggaa 5160gcatgtgaat
atattagtag gaaagttgag gatgcctgga aagtaatcaa tagagaatct 5220ttgcgtccaa
cagccgttcc cttccctttg ttaatgccag caataaactt agctagaatg 5280tgtgaggtct
tgtactctgt taatgatggt tttactcatg ctgagggtga catgaaatct 5340tatatgaagt
ccttcttcgt tcatcctatg gtcgtttgag ctagctaaga tccgctctaa 5400ccgaaaagga
aggagtcaga caacctgaag tctaggtccc tatttatttt tttatagtta 5460tgttagtatt
aagaacgtta tttatatttc aaatttttct tttttttctg tacagacgcg 5520tgtacgcatg
taacattata ctgaaaacct tgcttgagaa ggttttggga cgctcgaagc 5580tacggaagag
gatgtgccaa ggacattttc aagaatatta gaaacaggtt cgtttcaaaa 5640ttattatcaa
aaaatggatg cagaaaatgc agatagggta tattcgaaag gggtcaagtt 5700gattgcaagc
ggtactctac catctggtat atttaatagg gaagaattgt ttgaggaaga 5760tagtttctat
aagtattaaa taaactaatg attttaaatc gttaaaaaaa tatgcgaatt 5820ctgtggatcg
aacacaggac ctccagataa cttgaccgaa gttttttctt cagtctggcg 5880ctctcccaac
tgagctaaat ccgcttacta tttgttatca gttcccttca tatctacata 5940gaataggtta
agtattttat tagttgccag aagaactact gatagttggg aatatttggt 6000gaataatgaa
gattgggtga ataatttgat aattttgaga ttcaattgtt aatcaatgtt 6060acaatattat
gtatacagag tatactagaa gttctcttcg gagatcttga agttcacaaa 6120agggaatcga
tatttctaca taatattatc attacttctt ccccatctta tatttgtcat 6180tcattattga
ttatgatcaa tgcaataatg attggtagtt gccaaacatt taatacgatc 6240ctctgtaata
tttctatgaa taattatcac agcaacgttc aattatcttc aattcggctt 6300cagtactgta
tgaaatactc gctaacattt tctttattct ataatagcac agtgacactt 6360aaacg
6365875251DNAArtificial SequenceSynthetic, Integration construct i8
87ttgcctatgc tttgtttgct ttgaacactt gtttccgctc tccttttact tattggctac
60taaaactacg tgtaaaagat cgcccagcgc aaaaaggtcc ggcggtttca aataatctcg
120aactattcct ataatatgca aaatagtagg taggaacaag tcgactctag gcagataagg
180aagatgtccg gtaaatggag actagtgctg accgggatag gcaatccaga gcctcagtac
240gctggtaccc gtcacaatgt agggctatat atgctggagc tgctacgaaa gcggcttggt
300ctgcagggga gaacttattc ccctgtgcct aatacgggcg gcaaagtgca ttatatagaa
360gacgaacatt gtacgatact aagatcggat ggccagtaca tgaatctaag tggagaacag
420gtgtgcaagg tctgggcccg gtacgccaag taccaagccc gacacgtagt tattcatgac
480gagttaagtg tggcgtgtgg aaaagtgcag ctcagagccc ccagcaccag tattagaggt
540cataatgggc tgcgaagcct gctaaaatgc agtggaggcc gtgtaccctt tgccaaattg
600gctattggaa tcggcagaga acctgggtcc cgttctagag accctgcgag cgtgtcccgg
660tgggttctgg gagctctaac tccgcaggaa ctacaaacct tgcttacaca gagtgaacct
720gctgcctggc gtgctctgac tcagtacatt tcatagtgga tggcggcgtt agtatcgaat
780cgacagcagt atagcgacca gcattcacat acgattgacg catgatatta ctttctgcgc
840acttaacttc gcatctgggc agatgatgtc gaggcgaaaa aaaatataaa tcacgctaac
900atttgattaa aatagaacaa ctacaatata aaaaaactat acaaatgaca agttcttgaa
960aacaagaatc tttttattgt cagtactgat tagaaaaact catcgagcat caaatgaaac
1020tgcaatttat tcatatcagg attatcaata ccatattttt gaaaaagccg tttctgtaat
1080gaaggagaaa actcaccgag gcagttccat aggatggcaa gatcctggta tcggtctgcg
1140attccgactc gtccaacatc aatacaacct attaatttcc cctcgtcaaa aataaggtta
1200tcaagtgaga aatcaccatg agtgacgact gaatccggtg agaatggcaa aagcttatgc
1260atttctttcc agacttgttc aacaggccag ccattacgct cgtcatcaaa atcactcgca
1320tcaaccaaac cgttattcat tcgtgattgc gcctgagcga gacgaaatac gcgatcgctg
1380ttaaaaggac aattacaaac aggaatcgaa tgcaaccggc gcaggaacac tgccagcgca
1440tcaacaatat tttcacctga atcaggatat tcttctaata cctggaatgc tgttttgccg
1500gggatcgcag tggtgagtaa ccatgcatca tcaggagtac ggataaaatg cttgatggtc
1560ggaagaggca taaattccgt cagccagttt agtctgacca tctcatctgt aacatcattg
1620gcaacgctac ctttgccatg tttcagaaac aactctggcg catcgggctt cccatacaat
1680cgatagattg tcgcacctga ttgcccgaca ttatcgcgag cccatttata cccatataaa
1740tcagcatcca tgttggaatt taatcgcggc ctcgaaacgt gagtcttttc cttacccatg
1800gttgtttatg ttcggatgtg atgtgagaac tgtatcctag caagatttta aaaggaagta
1860tatgaaagaa gaacctcagt ggcaaatcct aaccttttat atttctctac aggggcgcgg
1920cgtggggaca attcaacgcg tctgtgaggg gagcgtttcc ctgctcgcag gtctgcagcg
1980aggagccgta atttttgctt cgcgccgtgc ggccatcaaa atgtatggat gcaaatgatt
2040atacatgggg atgtatgggc taaatgtacg ggcgacagtc acatcatgcc cctgagctgc
2100gcacgtcaag actgtcaagg agggtattct gggcctccat gtcgctggcc gggtgacccg
2160gcggggacga ggcaagctaa acagatctga tcttgaaact gagtaagatg ctcagaatac
2220ccgtcaagat aagagtataa tgtagagtaa tataccaagt attcagcata ttctcctctt
2280cttttgtata aatcacggaa gggatgattt ataagaaaaa tgaatactat tacacttcat
2340ttaccaccct ctgatctaga ttttccaacg atatgtacgt agtggtataa ggtgaggggg
2400tccacagata taacatcgtt taatttagta ctaacagaga cttttgtcac aactacatat
2460aagtgtacaa atatagtaca gatatgacac acttgtagcg ccaacgcgca tcctacggat
2520tgctgacaga aaaaaaggtc acgtgaccag aaaagtcacg tgtaattttg taactcaccg
2580cattctagcg gtccctgtcg tgcacactgc actcaacacc ataaacctta gcaacctcca
2640aaggaaatca ccgtataaca aagccacagt tttacaactt agtctcttat gaagttactt
2700accaatgaga aatagaggct ctttctcgag aaatatgaat atggatatat atatatatat
2760atatatatat atatatatat gtaaacttgg ttctttttta gcttgtgatc tctagcttgg
2820gtctctctct gtcgtaacag ttgtgatatc ggaagaagag aaaagacgaa gagcagaagc
2880ggaaaacgta tacacgtcac atatcacaca cacacaatgg gaaagctatt acaattggca
2940ttgcatccgg tcgagatgaa ggcagctttg aagctgaagt tttgcagaac accgctattc
3000tccatctatg atcagtccac gtctccatat ctcttgcact gtttcgaact gttgaacttg
3060acctccagat cgtttgctgc tgtgatcaga gagctgcatc cagaattgag aaactgtgtt
3120actctctttt atttgatttt aagggctttg gataccatcg aagacgatat gtccatcgaa
3180cacgatttga aaattgactt gttgcgtcac ttccacgaga aattgttgtt aactaaatgg
3240agtttcgacg gaaatgcccc cgatgtgaag gacagagccg ttttgacaga tttcgaatcg
3300attcttattg aattccacaa attgaaacca gaatatcaag aagtcatcaa ggagatcacc
3360gagaaaatgg gtaatggtat ggccgactac atcttagatg aaaattacaa cttgaatggg
3420ttgcaaaccg tccacgacta cgacgtgtac tgtcactacg tagctggttt ggtcggtgat
3480ggtttgaccc gtttgattgt cattgccaag tttgccaacg aatctttgta ttctaatgag
3540caattgtatg aaagcatggg tcttttccta caaaaaacca acatcatcag agattacaat
3600gaagatttgg tcgatggtag atccttctgg cccaaggaaa tctggtcaca atacgctcct
3660cagttgaagg acttcatgaa acctgaaaac gaacaactgg ggttggactg tataaaccac
3720ctcgtcttaa acgcattgag tcatgttatc gatgtgttga cttatttggc cggtatccac
3780gagcaatcca ctttccaatt ttgtgccatt ccccaagtta tggccattgc aaccttggct
3840ttggtattca acaaccgtga agtgctacat ggcaatgtaa agattcgtaa gggtactacc
3900tgctatttaa ttttgaaatc aaggactttg cgtggctgtg tcgagatttt tgactattac
3960ttacgtgata tcaaatctaa attggctgtg caagatccaa atttcttaaa attgaacatt
4020caaatctcca agatcgaaca gtttatggaa gaaatgtacc aggataaatt acctcctaac
4080gtgaagccaa atgaaactcc aattttcttg aaagttaaag aaagatccag atacgatgat
4140gaattggttc caacccaaca agaagaagag tacaagttca atatggtttt atctatcatc
4200ttgtccgttc ttcttgggtt ttattatata tacactttac acagagcgtg aagtctgcgc
4260caaataacat aaacaaacaa ctccgaacaa taactaagta cttacataat aggtagaggc
4320ctatccttaa agataacctt atatttcatt acatcaacta attcgacctt attatctttc
4380gaattgaaat gcattatacc catcggtacg tctagctttg tcaccttccc cagtaaacgc
4440tgtttcttgc cgacaaacaa tgtggccctc tctccgtcaa tctgtaacga cccaaatcgt
4500attaaagttt cgccgtcctg ttcactgaac cttccctcat ttggagaatc tctcctcgcc
4560agcgacgcaa agtccttagg caactctagt tcaccttgaa tctccagcat catcatccca
4620agcggtgtta tcaccgtggt ctgcttttct cttgactgtg tcaacttctg ccattgacta
4680gcatctatat ctacactagg cattcttttc agctgtttat tgggctgaat gatagtgata
4740attctttttt ctatcactcc tttggctata ttagtggtta gcttactaaa aaagattaaa
4800ggaaaaatga aattcaagat gctaacgttg acatgtatat tttaagaaaa caaaaatcat
4860acaaagagga gatcggatat aaaagaataa cataaatatg tttagtgcat taggtaaatg
4920ggtccgaggc tctcgcaatg ataaggactt tgtgacgaag tataccgcag atttatcaca
4980aataacttca cagatccatc aattagatgt cgcgttaaag aaaagccaat ccatcttgag
5040tcaatggcaa tcaaatctga ccttttatgg tattgcgtta acggtattgg ccctgagcta
5100cacatattgg gagtaccatg gttatcgacc ataccttgtg gtgactgcgc tactatgcat
5160aggctcgcta atcttgttca aatgggcatt aaccaaactc tatgcatttt ataacaacaa
5220taggttacgc aagttggcaa aactccgtgc a
52518870DNAArtificial SequenceSynthetic, Primer 61-67-CPK066-G
88ggtaagacgg ttgggtttta tcttttgcag ttggtactat taagaacaat cacaggaaac
60agctatgacc
708970DNAArtificial SequenceSynthetic, Primer 61-67-CPK067-G 89ttgcgttttg
tactttggtt cgctcaattt tgcaggtaga taatcgaaaa gttgtaaaac 60gacggccagt
70904162DNAArtificial SequenceSynthetic, Integration construct i32
90gcctgtctac aggataaaga cgggtcggat acctgcacaa gcaatttggc acctgcatac
60cccatttccc cagtagataa cttcaacaca cacatcaatg tccctcacca gtttatttcc
120aaaagagacg ctttttacta cctgactaga ttttcatttt gtttcttttg gattgcgctt
180gcctttgtag gtgtgtcgtt tatcctttac gttttgactt ggtgctcgaa gatgctttca
240gagatggtgc ttatcctcat gtcttttggg tttgtcttca atacggcagc cgttgtcttg
300caaacggccg cctctgccat ggcaaagaat gctttccatg acgatcatcg tagtgcccaa
360ttgggtgcct ctatgatggg tatggcttgg gcaagtgtct ttttatgtat cgtggaattt
420atcctgctgg tcttctggtc tgttagggca aggttggcct ctacttactc catcgacaat
480tcaagataca gaacctcctc cagatggaat cccttccata gagagaagga gcaagcaact
540gacccaatat tgactgccac tggacctgaa gacatgcaac aaagtgcaag catagtgggg
600ccttcttcca atgctaatcc ggtcactgcc actgctgcta cggaaaacca acctaaaggt
660attaacttct tcactataag aaaatcacac gagcgcccgg acgatgtctc tgtttaaatg
720gcgcaagttt tccgctttgt aatatatatt tatacccctt tcttctctcc cctgcaatat
780aatagtttaa ttctaatatt aataatatcc tatattttct tcatttaccg gcgcactctc
840gcccgaacga cctcaaaatg tctgctacat tcataataac caaaagctca taactttttt
900ttttgaacct gaatatatat acatcacata tcactgctgg tccttgccga ccagcgtata
960caatctcgat agttggtttc ccgttctttc cactcccgtc cacaggaaac agctatgacc
1020atgattacgc caagctattt aggtgacact atagaatact caagctatgc atcaagcttg
1080gtaccgagct cggatccact agtaacggcc gccagtgtgc tggaattcgc cctgtcgaca
1140ctagtaatac acatcatcgt cctacaagtt catcaaagtg ttggacagac aactatacca
1200gcatggatct cttgtatcgg ttcttttctc ccgctctctc gcaataacaa tgaacactgg
1260gtcaatcata gcctacacag gtgaacagag tagcgtttat acagggttta tacggtgatt
1320cctacggcaa aaatttttca tttctaaaaa aaaaaagaaa aatttttctt tccaacgcta
1380gaaggaaaag aaaaatctaa ttaaattgat ttggtgattt tctgagagtt ccctttttca
1440tatatcgaat tttgaatata aaaggagatc gaaaaaattt ttctattcaa tctgttttct
1500ggttttattt gatagttttt ttgtgtatta ttattatgga ttagtactgg tttatatggg
1560tttttctgta taacttcttt ttattttagt ttgtttaatc ttattttgag ttacattata
1620gttccctaac tgcaagagaa gtaacattaa aaatgaaaaa gcctgaactc accgcgacgt
1680ctgtcgagaa gtttctgatc gaaaagttcg acagcgtctc cgacctgatg cagctctcgg
1740agggcgaaga atctcgtgct ttcagcttcg atgtaggagg gcgtggatat gtcctgcggg
1800taaatagctg cgccgatggt ttctacaaag atcgttatgt ttatcggcac tttgcatcgg
1860ccgcgctccc gattccggaa gtgcttgaca ttggggaatt cagcgagagc ctgacctatt
1920gcatctcccg ccgtgcacag ggtgtcacgt tgcaagacct gcctgaaacc gaactgcccg
1980ctgttctgca gccggtcgcg gaggccatgg atgcgatcgc tgcggccgat cttagccaga
2040cgagcgggtt cggcccattc ggaccgcaag gaatcggtca atacactaca tggcgtgatt
2100tcatatgcgc gattgctgat ccccatgtgt atcactggca aactgtgatg gacgacaccg
2160tcagtgcgtc cgtcgcgcag gctctcgatg agctgatgct ttgggccgag gactgccccg
2220aagtccggca cctcgtgcac gcggatttcg gctccaacaa tgtcctgacg gacaatggcc
2280gcataacagc ggtcattgac tggagcgagg cgatgttcgg ggattcccaa tacgaggtcg
2340ccaacatctt cttctggagg ccgtggttgg cttgtatgga gcagcagacg cgctacttcg
2400agcggaggca tccggagctt gcaggatcgc cgcggctccg ggcgtatatg ctccgcattg
2460gtcttgacca actctatcag agcttggttg acggcaattt cgatgatgca gcttgggcgc
2520agggtcgatg cgacgcaatc gtccgatccg gagccgggac tgtcgggcgt acacaaatcg
2580cccgcagaag cgcggccgtc tggaccgatg gctgtgtaga agtactcgcc gatagtggaa
2640accgacgccc cagcactcgt ccgagggcaa aggaataggt ttaacttgat actactagat
2700tttttctctt catttataaa atttttggtt ataattgaag ctttagaagt atgaaaaaat
2760cctttttttt cattctttgc aaccaaaata agaagcttct tttattcatt gaaatgatga
2820atataaacct aacaaaagaa aaagactcga atatcaaaca ttaaaaaaaa ataaaagagg
2880ttatctgttt tcccatttag ttggagtttg cattttctaa tagatagaac tctcaattaa
2940tgtggattta gtttctctgt tcgttttttt ttgttttgtt ctcactgtat ttacatttct
3000atttagtatt tagttattca tataatctta acttctcgag gagctctaag ggcgaattct
3060gcagatatcc atcacactgg cggccgctcg agcatgcatc tagagggccc aattcgccct
3120atagtgagtc gtattacaat tcactggccg tcgttttaca acaagcatct tgccctgtgc
3180ttggccccca gtgcagcgaa cgttataaaa acgaatactg agtatatatc tatgtaaaac
3240aaccatatca tttcttgttc tgaactttgt ttacctaact agttttaaat ttcccttttt
3300cgtgcatgcg ggtgttctta tttattagca tactacattt gaaatatcaa atttccttag
3360tagaaaagtg agagaaggtg cactgacaca aaaaataaaa tgctacgtat aactgtcaaa
3420actttgcagc agcgggcatc cttccatcat agcttcaaac atattagcgt tcctgatctt
3480catacccgtg ctcaaaatga tcaaacaaac tgttattgcc aagaaataaa cgcaaggctg
3540ccttcaaaaa ctgatccatt agatcctcat atcaagcttc ctcatagaac gcccaattac
3600aataagcatg ttttgctgtt atcaccgggt gataggtttg ctcaaccatg gaaggtagca
3660tggaatcata atttggatac taatacaaat cggccatata atgccattag taaattgcgc
3720tcccatttag gtggttctcc aggaatacta ataaatgcgg tgcatttgca aaatgaattt
3780attccaaggc caaaacaaca cgatgaatgg ctttattttt ttgttattcc tgacatgaag
3840ctttatgtaa ttaaggaaac ggacatcgag gaatttgcat cttttttaga tgaaggagct
3900attcaagcac caaagctatc cttccaggat tatttaagcg gtaaggccaa ggcttcccaa
3960caggttcatg aagtgcatca tagaaagctt acaaggtttc agggtgaaac ttttctaaga
4020gattggaact tagtctgtgg gcattataag agagatgcta agtgtggaga aatgggaccc
4080gacataattg cagcatttca agatgaaaag ctttttcctg agaataatct agccttaatt
4140tctcatattg ggggtcatat tt
4162917879DNAArtificial SequenceSynthetic, Integration construct i33
91atgaattggc cagttttttc caattatgga acgcctgttc ctgatccacg gcctgcactt
60gcgaccacaa ttccacacct gaggcgcctg cctcttttcc agcatgtggc aactgtcccc
120acgacagggc atcccagaat cctctggtaa atcttaaatg aaactgacgc gtggcagtag
180attccaacaa tggtgggatg gcccgtggga aagtcgtgta gtgctcatac gcatcatatg
240acatggatga tacggccggg tcaaacggtn cgattgcagt tggaatgcaa atgagagtag
300cagatcattg ttgggcagcg gcttcaacac cagtgcttcg tcgtacggat accataaact
360gtcatttata ccaatctgcg acaccgtgtc ttctgcgaac acacccagca gtagagtgcc
420cagcatgaaa taggccagtg tgaggatcat cgtcgtcttg cctatgcttt gtttgctttg
480aacacttgtt tccgctctcc ttttacttat tggctactaa aactacgtgt aaaagatcgc
540ccagcgcaaa aaggtccggc ggtttcaaat aatctcgaac tattcctata atatgcaaaa
600tagtaggtag gaacaagtca actctaggca gataacgaag atgtccggta aatggagact
660agtgctgact gggataggca atccagagcc tcagtacgct ggcacccgtc acaatgtagg
720gctatatatg ctggagctgc tacgaaagcg gcttggtctg caggggagaa cttattcccc
780tgtgcctaat acgggcggca aagtgcatta tatagaagac gaacattgta cgatactaag
840atcggatggc cagtacatga atctaagtgg agaacaggtg tgcaaggtct gggcccggta
900cgccaagtac caagcccgac acgttgttat tcatgacgag ttaagtgtgg cgtgtggaaa
960agtgcagctc agagccccca gcaccagtat tagaggtcat aatgggctgc gaagcctgct
1020aaaatgcagt ggaggccgtg taccctttgc caaattggct attggaatcg gcagagaacc
1080tgggtcccgt tctagagacc ctgcgagcgt gtcccggtgg gttctgggag ctctaactcc
1140gcaggaacta caaaccttgc ttacacagag tgaacctgct gcctggcgtg ctctgactca
1200gtacatttca taggacagca ttcgcccagt atttttttta ttctacaaac cttctataat
1260ttcaaagtat ttacataatt ctgtatcagt ttaatcacca taatatcgtt ttctttgttt
1320agtgcaatta atttttccta ttgttacttc gggccttttt ctgttttatg agctattttt
1380tccgtcatcc ttccggatcc agattttcag cttcatctcc agattgtgtc tacgtaatgc
1440acgccatcat tttaagagag gacagagaag caagcctcct gaaagatgaa gctactgtct
1500tctatcgaac aagcatgcga tatttgccga cttaaaaagc tcaagtgctc caaagaaaaa
1560ccgaagtgcg ccaagtgtct gaagaacaac tgggagtgtc gctactctcc caaaaccaaa
1620aggtctccgc tgactagggc acatctgaca gaagtggaat caaggctaga aagactggaa
1680cagctatttc tactgatttt tcctcgagaa gaccttgaca tgattttgaa aatggattct
1740ttacaggata taaaagcatt gttaacagga ttatttgtac aagataatgt gaataaagat
1800gccgtcacag atagattggc ttcagtggag actgatatgc ctctaacatt gagacagcat
1860agaataagtg cgacatcatc atcggaagag agtagtaaca aaggtcaaag acagttgact
1920gtatcgattg actcggcagc tcatcatgat aactccacaa ttccgttgga ttttatgccc
1980agggatgctc ttcatggatt tgattggtct gaagaggatg acatgtcgga tggcttgccc
2040ttcctgaaaa cggaccccaa caataatggg ttctttggcg acggttctct cttatgtatt
2100cttcgatcta ttggctttaa accggaaaat tacacgaact ctaacgttaa caggctcccg
2160accatgatta cggatagata cacgttggct tctagatcca caacatcccg tttacttcaa
2220agttatctca ataattttca cccctactgc cctatcgtgc actcaccgac gctaatgatg
2280ttgtataata accagattga aatcgcgtcg aaggatcaat ggcaaatcct ttttaactgc
2340atattagcca ttggagcctg gtgtatagag ggggaatcta ctgatataga tgttttttac
2400tatcaaaatg ctaaatctca tttgacgagc aaggtcttcg agtcaggttc cataattttg
2460gtgacagccc tacatcttct gtcgcgatat acacagtgga ggcagaaaac aaatactagc
2520tataattttc acagcttttc cataagaatg gccatatcat tgggcttgaa tagggacctc
2580ccctcgtcct tcagtgatag cagcattctg gaacaaagac gccgaatttg gtggtctgtc
2640tactcttggg agatccaatt gtccctgctt tatggtcgat ccatccagct ttctcagaat
2700acaatctcct tcccttcttc tgtcgacgat gtgcagcgta ccacaacagg tcccaccata
2760tatcatggca tcattgaaac agcaaggctc ttacaagttt tcacaaaaat ctatgaacta
2820gacaaaacag taactgcaga aaaaagtcct atatgtgcaa aaaaatgctt gatgatttgt
2880aatgagattg aggaggtttc gagacaggca ccaaagtttt tacaaatgga tatttccacc
2940accgctctaa ccaatttgtt gaaggaacac ccttggctat cctttacaag attcgaactg
3000aagtggaaac agttgtctct tatcatttat gtattaagag attttttcac taattttacc
3060cagaaaaagt cacaactaga acaggatcaa aatgatcatc aaagttatga agttaaacga
3120tgctccatca tgttaagcga tgcagcacaa agaactgtta tgtctgtaag tagctatatg
3180gacaatcata atgtcacccc atattttgcc tggaattgtt cttattactt gttcaatgca
3240gtcctagtac ccataaagac tctactctca aactcaaaat cgaatgctga gaataacgag
3300accgcacaat tattacaaca aattaacact gttctgatgc tattaaaaaa actggccact
3360tttaaaatcc agacttgtga aaaatacatt caagtactgg aagaggtatg tgcgccgttt
3420ctgttatcac agtgtgcaat cccattaccg catatcagtt ataacaatag taatggtagc
3480gccattaaaa atattgtcgg ttctgcaact atcgcccaat accctactct tccggaggaa
3540aatgtcaaca atatcagtgt taaatatgtt tctcctggct cagtagggcc ttcacctgtg
3600ccattgaaat caggagcaag tttcagtgat ctagtcaagc tgttatctaa ccgtccaccc
3660tctcgtaact ctccagtgac aataccaaga agcacacctt cgcatcgctc agtcacgcct
3720tttctagggc aacagcaaca gctgcaatca ttagtgccac tgaccccgtc tgctttgttt
3780ggtggcgcca attttaatca aagtgggaat attgctgata gctcattgtc cttcactttc
3840actaacagta gcaacggtcc gaacctcata acaactcaaa caaattctca agcgctttca
3900caaccaattg cctcctctaa cgttcatgat aacttcatga ataatgaaat cacggctagt
3960aaaattgatg atggtaataa ttcaaaacca ctgtcacctg gttggacgga ccaaactgcg
4020tataacgcgt ttggaatcac tacagggatg tttaatacca ctacaatgga tgatgtatat
4080aactatctat tcgatgatga agatacccca ccaaacccaa aaaaagagta aaatgaatcg
4140tagatactga aaaaccccgc aagttcactt caactgtgca tcgtgcacca tctcaatttc
4200tttcatttat acatcgtttt gccttctttt atgtaactat actcctctaa gtttcaatct
4260tggccatgta acctctgatc tatagaattt tttaaatgac tagaattaat gcccatcttt
4320tttttggacc taaattcttc atgaaaatat attacgaggg cttattcaga agcttcgctc
4380agtcgacact agtaatacac atcatcgtcc tacaagttca tcaaagtgtt ggacagacaa
4440ctataccagc atggatctct tgtatcggtt cttttctccc gctctctcgc aataacaatg
4500aacactgggt caatcatagc ctacacaggt gaacagagta gcgtttatac agggtttata
4560cggtgattcc tacggcaaaa atttttcatt tctaaaaaaa aaaagaaaaa tttttctttc
4620caacgctaga aggaaaagaa aaatctaatt aaattgattt ggtgattttc tgagagttcc
4680ctttttcata tatcgaattt tgaatataaa aggagatcga aaaaattttt ctattcaatc
4740tgttttctgg ttttatttga tagttttttt gtgtattatt attatggatt agtactggtt
4800tatatgggtt tttctgtata acttcttttt attttagttt gtttaatctt attttgagtt
4860acattatagt tccctaactg caagagaagt aacattaaaa atgaccactc ttgacgacac
4920ggcttaccgg taccgcacca gtgtcccggg ggacgccgag gccatcgagg cactggatgg
4980gtccttcacc accgacaccg tcttccgcgt caccgccacc ggggacggct tcaccctgcg
5040ggaggtgccg gtggacccgc ccctgaccaa ggtgttcccc gacgacgaat cggacgacga
5100atcggacgcc ggggaggacg gcgacccgga ctcccggacg ttcgtcgcgt acggggacga
5160cggcgacctg gcgggcttcg tggtcgtctc gtactccggc tggaaccgcc ggctgaccgt
5220cgaggacatc gaggtcgccc cggagcaccg ggggcacggg gtcgggcgcg cgttgatggg
5280gctcgcgacg gagttcgccc gcgagcgggg cgccgggcac ctctggctgg aggtcaccaa
5340cgtcaacgca ccggcgatcc acgcgtaccg gcggatgggg ttcaccctct gcggcctgga
5400caccgccctg tacgacggca ccgcctcgga cggcgagcag gcgctctaca tgagcatgcc
5460ctgcccctga gtttaacttg atactactag attttttctc ttcatttata aaatttttgg
5520ttataattga agctttagaa gtatgaaaaa atcctttttt ttcattcttt gcaaccaaaa
5580taagaagctt cttttattca ttgaaatgat gaatataaac ctaacaaaag aaaaagactc
5640gaatatcaaa cattaaaaaa aaataaaaga ggttatctgt tttcccattt agttggagtt
5700tgcattttct aatagataga actctcaatt aatgtggatt tagtttctct gttcgttttt
5760ttttgttttg ttctcactgt atttacattt ctatttagta tttagttatt catataatct
5820taacttctcg aggagctcga tcttgaaact gagtaagatg ctcagaatac ccgtcaagat
5880aagagtataa tgtagagtaa tataccaagt attcagcata ttctcctctt cttttgtata
5940aatcacggaa gggatgattt ataagaaaaa tgaatactat tacacttcat ttaccaccct
6000ctgatctaga ttttccaacg atatgtacgt agtggtataa ggtgaggggg tccacagata
6060taacatcgtt taatttagta ctaacagaga cttttgtcac aactacatat aagtgtacaa
6120atatagtaca gatatgacac acttgtagcg ccaacgcgca tcctacggat tgctgacaga
6180aaaaaaggtc acgtgaccag aaaagtcacg tgtaattttg taactcaccg cattctagcg
6240gtccctgtcg tgcacactgc actcaacacc ataaacctta gcaacctcca aaggaaatca
6300ccgtataaca aagccacagt tttacaactt agtctcttat gaagtgtctc tctctgtcgt
6360aacagttgtg atatcggaag aagagaaaag acgaagagca gaagcggaaa acgtatacac
6420gtcacatatc acacacacac aatgggaaag ctattacaat tggcattgca tccggtcgag
6480atgaaggcag ctttgaagct gaagttttgc agaacaccgc tattctccat ctatgatcag
6540tccacgtctc catatctctt gcactgtttc gaactgttga acttgacctc cagatcgttt
6600gctgctgtga tcagagagct gcatccagaa ttgagaaact gtgttactct cttttatttg
6660attttaaggg ctttggatac catcgaagac gatatgtcca tcgaacacga tttgaaaatt
6720gacttgttgc gtcacttcca cgagaaattg ttgttaacta aatggagttt cgacggaaat
6780gcccccgatg tgaaggacag agccgttttg acagatttcg aatcgattct tattgaattc
6840cacaaattga aaccagaata tcaagaagtc atcaaggaga tcaccgagaa aatgggtaat
6900ggtatggccg actacatctt ggatgaaaat tacaacttga atgggttgca aaccgtccac
6960gactacgacg tgtactgtca ctacgtagct ggtttggtcg gtgatggttt gacccgtttg
7020attgtcattg ccaagtttgc caacgaatct ttgtattcta atgagcaatt gtatgaaagc
7080atgggtcttt tcctacaaaa aaccaacatc atcagagact acaatgaaga tttggtcgat
7140ggtagatcct tctggcccaa ggaaatctgg tcacaatacg ctcctcagtt gaaggacttc
7200atgaaacctg aaaacgaaca actggggttg gactgtataa accacctcgt cttaaacgca
7260ttgagtcatg ttatcgatgt gttgacttat ttggccagta tccacgagca atccactttc
7320caattttgtg ccattcccca agttatggcc attgcaacct tggctttggt attcaacaac
7380cgtgaagtgc tacatggcaa tgtaaagatt cgtaagggta ctacctgcta tttaattttg
7440aaatcaagga ctttgcgtgg ctgtgtcgag atttttgact attacttacg tgatatcaaa
7500tctaaattgg ctgtgcaaga tccaaatttc ttaaaattga acattcaaat ctccaagatc
7560gaacaattca tggaagaaat gtaccaggat aaattacctc ctaacgtgaa gccaaatgaa
7620actccaattt tcttgaaagt taaagaaaga tccagatacg atgatgaatt ggtcccaacc
7680caacaagaag aagagtacaa gttcaatatg gttttatcta tcatcttgtc cgttcttctt
7740gggttttatt atatatacac tttacacaga gcgtgaagtc tgcgccaaat aacataaaca
7800aacaactccg aacaataact aagtacttac ataataggta gaggcctatc cttaaagata
7860accttatatt tcattacat
7879925714DNAArtificial SequenceSynthetic, Integration construct i37
92gcctgtctac aggataaaga cgggtcggat acctgcacaa gcaatttggc acctgcatac
60cccatttccc cagtagataa cttcaacaca cacatcaatg tccctcacca gtttatttcc
120aaaagagacg ctttttacta cctgactaga ttttcatttt gtttcttttg gattgcgctt
180gcctttgtag gtgtgtcgtt tatcctttac gttttgactt ggtgctcgaa gatgctttca
240gagatggtgc ttatcctcat gtcttttggg tttgtcttca atacggcagc cgttgtcttg
300caaacggccg cctctgccat ggcaaagaat gctttccatg acgatcatcg tagtgcccaa
360ttgggtgcct ctatgatggg tttaaacgta tggcttgggc aagtgtcttt ttatgtatcg
420tggaatttat cctgctggtc ttctggtctg ttagggcaag gttggcctct acttactcca
480tcgacaattc aagatacaga acctcctcca gatggaatcc cttccataga gagaaggagc
540aagcaactga cccaatattg actgccactg gacctgaaga catgcaacaa agtgcaagca
600tagtggggcc ttcttccaat gctaatccgg tcactgccac tgctgctacg gaaaaccaac
660ctaaaggtat taacttcttc actataagaa aatcacacga gcgcccggac gatgtctctg
720tttaaatggc gcaagttttc cgctttgtaa tatatattta tacccctttc ttctctcccc
780tgcaatataa tagtttaatt ctaatattaa taatatccta tattttcttc atttaccggc
840gcactctcgc ccgaacgacc tcaaaatgtc tgctacattc ataataacca aaagctcata
900actttttttt ttgaacctga atatatatac atcacatatc actgctggtc ctgagaagtt
960aagattatat gaataactaa atactaaata gaaatgtaaa tacagtgaga acaaaacaaa
1020aaaaaacgaa cagagaaact aaatccacat taattgagag ttctatctat tagaaaatgc
1080aaactccaac taaatgggaa aacagataac ctcttttatt tttttttaat gtttgatatt
1140cgagtctttt tcttttgtta ggtttatatt catcatttca atgaataaaa gaagcttctt
1200attttggttg caaagaatga aaaaaaagga ttttttcata cttctaaagc ttcaattata
1260accaaaaatt ttataaatga agagaaaaaa tctagtagta tcaagttaaa cttagaaaaa
1320ctcatcgagc atcaaatgaa actgcaattt attcatatca ggattatcaa taccatattt
1380ttgaaaaagc cgtttctgta atgaaggaga aaactcaccg aggcagttcc ataggatggc
1440aagatcctgg tatcggtctg cgattccgac tcgtccaaca tcaatacaac ctattaattt
1500cccctcgtca aaaataaggt tatcaagtga gaaatcacca tgagtgacga ctgaatccgg
1560tgagaatggc aaaagcttat gcatttcttt ccagacttgt tcaacaggcc agccattacg
1620ctcgtcatca aaatcactcg catcaaccaa accgttattc attcgtgatt gcgcctgagc
1680gagacgaaat acgcgatcgc tgttaaaagg acaattacaa acaggaatcg aatgcaaccg
1740gcgcaggaac actgccagcg catcaacaat attttcacct gaatcaggat attcttctaa
1800tacctggaat gctgttttgc cggggatcgc agtggtgagt aaccatgcat catcaggagt
1860acggataaaa tgcttgatgg tcggaagagg cataaattcc gtcagccagt ttagtctgac
1920catctcatct gtaacatcat tggcaacgct acctttgcca tgtttcagaa acaactctgg
1980cgcatcgggc ttcccataca atcgatagat tgtcgcacct gattgcccga cattatcgcg
2040agcccattta tacccatata aatcagcatc catgttggaa tttaatcgcg gcctcgaaac
2100gtgagtcttt tccttaccca tttttaatgt tacttctctt gcagttaggg aactataatg
2160taactcaaaa taagattaaa caaactaaaa taaaaagaag ttatacagaa aaacccatat
2220aaaccagtac taatccataa taataataca caaaaaaact atcaaataaa accagaaaac
2280agattgaata gaaaaatttt ttcgatctcc ttttatattc aaaattcgat atatgaaaaa
2340gggaactctc agaaaatcac caaatcaatt taattagatt tttcttttcc ttctagcgtt
2400ggaaagaaaa atttttcttt ttttttttag aaatgaaaaa tttttgccgt aggaatcacc
2460gtataaaccc tgtataaacg ctactctgtt cacctgtgta ggctatgatt gacccagtgt
2520tcattgttat tgcgagagag cgggagaaaa gaaccgatac aagagatcca tgctggtata
2580gttgtctgtc caacactttg atgaacttgt aggacgatga tgtgtattac tagtgtcgac
2640accatataca tatccatatc taatcttact tatatgttgt ggaaatgtaa agagccccat
2700tatcttagcc taaaaaaacc ttctctttgg aactttcagt aatacgctta actgctcatt
2760gctatattga agtacggatt agaagccgcc gagcgggcga cagccctccg acggaagact
2820ctcctccgtg cgtcctggtc ttcaccggtc gcgttcctga aacgcagatg tgcctcgcgc
2880cgcactgctc cgaacaataa agattctaca atactagctt ttatggttat gaagaggaaa
2940aattggcagt aacctggccc cacaaacctt caaatcaacg aatcaaatta acaaccatag
3000gataataatg cgattagttt tttagcctta tttctggggt aattaatcag cgaagcgatg
3060atttttgatc tattaacaga tatataaatg caaaagctgc ataaccactt taactaatac
3120tttcaacatt ttcggtttgt attacttctt attcaaatgt cataaaagta tcaacaaaaa
3180attgttaata tacctctata ctttaacgtc aaggagaaaa aactataatg tcattaccgt
3240tcttaacttc tgcaccggga aaggttatta tttttggtga acactctgct gtgtacaaca
3300agcctgccgt cgctgctagt gtgtctgcgt tgagaaccta cctgctaata agcgagtcat
3360ctgcaccaga tactattgaa ttggacttcc cggacattag ctttaatcat aagtggtcca
3420tcaatgattt caatgccatc accgaggatc aagtaaactc ccaaaaattg gccaaggctc
3480aacaagccac cgatggcttg tctcaggaac tcgttagtct tttggatccg ttgttagctc
3540aactatccga atccttccac taccatgcag cgttttgttt cctgtatatg tttgtttgcc
3600tatgccccca tgccaagaat attaagtttt ctttaaagtc tactttaccc atcggtgctg
3660ggttgggctc aagcgcctct atttctgtat cactggcctt agctatggcc tacttggggg
3720ggttaatagg atctaatgac ttggaaaagc tgtcagaaaa cgataagcat atagtgaatc
3780aatgggcctt cataggtgaa aagtgtattc acggtacccc ttcaggaata gataacgctg
3840tggccactta tggtaatgcc ctgctatttg aaaaagactc acataatgga acaataaaca
3900caaacaattt taagttctta gatgatttcc cagccattcc aatgatccta acctatacta
3960gaattccaag gtctacaaaa gatcttgttg ctcgcgttcg tgtgttggtc accgagaaat
4020ttcctgaagt tatgaagcca attctagatg ccatgggtga atgtgcccta caaggcttag
4080agatcatgac taagttaagt aaatgtaaag gcaccgatga cgaggctgta gaaactaata
4140atgaactgta tgaacaacta ttggaattga taagaataaa tcatggactg cttgtctcaa
4200tcggtgtttc tcatcctgga ttagaactta ttaaaaatct gagcgatgat ttgagaattg
4260gctccacaaa acttaccggt gctggtggcg gcggttgctc tttgactttg ttacgaagag
4320acattactca agagcaaatt gacagtttca aaaagaaatt gcaagatgat tttagttacg
4380agacatttga aacagacttg ggtgggactg gctgctgttt gttaagcgca aaaaatttga
4440ataaagatct taaaatcaaa tccctagtat tccaattatt tgaaaataaa actaccacaa
4500agcaacaaat tgacgatcta ttattgccag gaaacacgaa tttaccatgg acttcataag
4560ctaatttgcg ataggcatta tttattagtt gtttttaatc ttaactgtgt atgaagtttt
4620atgtaataaa gatagaaaga gaaacaaaaa aaaatttttc gtagtatcaa ttcagctttc
4680gaagacagaa tgaaatttaa gcagaccatc atcttgccct gtgcttggcc cccagtgcag
4740cgaacgttat aaaaacgaat actgagtata tatctatgta aaacaaccat atcatttctt
4800gttctgaact ttgtttacct aactagtttt aaatttccct ttttcgtgca tgcgggtgtt
4860cttatttatt agcatactac atttgaaata tcaaatttcc ttagtagaaa agtgagagaa
4920ggtgcactga cacaaaaaat aaaatgctac gtataactgt caaaactttg cagcagcggg
4980catccttcca tcatagcttc aaacatatta gcgttcctga tcttcatacc cgtgctcaaa
5040atgatcaaac aaactgttat tgccaagaaa taaacgcaag gctgccttca aaaactgatc
5100cattagatcc tcatatcaag cttcctcata gaacgcccaa ttacaataag catgttttgc
5160tgttatcacc gggtgatagg tttgctcaac catggaaggt agcatggaat cataatttgg
5220atactaatac aaatcggcca tataatgcca ttagtaaatt gcgctcccat ttaggtggtt
5280ctccaggcaa atttgaatac taataaatgc ggtgcatttg caaaatgaat ttattccaag
5340gccaaaacaa cacgatgaat ggctttattt ttttgttatt cctgacatga agctttatgt
5400aattaaggaa acggacatcg aggaatttgc atctttttta gatgaaggag ctattcaagc
5460accaaagcta tccttccagg attatttaag cggtaaggcc aaggcttccc aacaggttca
5520tgaagtgcat catagaaagc ttacaaggtt tcagggtgaa acttttctaa gagattggaa
5580cttagtctgt gggcattata agagagatgc taagtgtgga gaaatgggac ccgacataat
5640tgcagcattt caagatgaaa agctttttcc tgagaataat ctagccttaa tttctcatat
5700tgggggtcat attt
5714937688DNAArtificial SequenceSynthetic, Integration construct i301
93gacggcacgg ccacgcgttt aaaccgccga gctattcgcg gaacattcta gctcgtttgc
60atcttcttgc atttggtagg ttttcaatag ttcggtaata ttaacggata cctactatta
120tcccctagta ggctcttttc acggagaaat tcgggagtgt tttttttccg tgcgcatttt
180cttagctata ttcttccagc ttcgcctgct gcccggtcat cgttcctgtc acgtagtttt
240tccggattcg tccggctcat ataataccgc aataaacacg gaatatctcg ttccgcggat
300tcggttaaac tctcggtcgc ggattatcac agagaaagct tcgtggagaa tttttccaga
360ttttccgctt tccccgatgt tggtatttcc ggaggtcatt atactgaccg ccattataat
420gactgtacaa cgaccttctg gagaaagaaa caactcaata acgatgtggg acattggggg
480cccactcaaa aaatctgggg actatatccc cagagaattt ctccagaaga gaagaaaagt
540caaagttttt tttcgcttgg gggttgcata taaagctcac acgcggccag ggggagccat
600gaaaaagcct gaactcaccg cgacgtctgt cgagaagttt ctgatcgaaa agttcgacag
660cgtctccgac ctgatgcagc tctcggaggg cgaagaatct cgtgctttca gcttcgatgt
720aggagggcgt ggatatgtcc tgcgggtaaa tagctgcgcc gatggtttct acaaagatcg
780ttatgtttat cggcactttg catcggccgc gctcccgatt ccggaagtgc ttgacattgg
840ggaattcagc gagagcctga cctattgcat ctcccgccgt gcacagggtg tcacgttgca
900agacctgcct gaaaccgaac tgcccgctgt tctgcagccg gtcgcggagg ccatggatgc
960gatcgctgcg gccgatctta gccagacgag cgggttcggc ccattcggac cgcaaggaat
1020cggtcaatac actacatggc gtgatttcat atgcgcgatt gctgatcccc atgtgtatca
1080ctggcaaact gtgatggacg acaccgtcag tgcgtccgtc gcgcaggctc tcgatgagct
1140gatgctttgg gccgaggact gccccgaagt ccggcacctc gtgcacgcgg atttcggctc
1200caacaatgtc ctgacggaca atggccgcat aacagcggtc attgactgga gcgaggcgat
1260gttcggggat tcccaatacg aggtcgccaa catcttcttc tggaggccgt ggttggcttg
1320tatggagcag cagacgcgct acttcgagcg gaggcatccg gagcttgcag gatcgccgcg
1380gctccgggcg tatatgctcc gcattggtct tgaccaactc tatcagagct tggttgacgg
1440caatttcgat gatgcagctt gggcgcaggg tcgatgcgac gcaatcgtcc gatccggagc
1500cgggactgtc gggcgtacac aaatcgcccg cagaagcgcg gccgtctgga ccgatggctg
1560tgtagaagta ctcgccgata gtggaaaccg acgccccagc actcgtccga gggcaaagga
1620atagcgctcg tccaacgccg gcggacctcg ctcgtccaac gccggcggac ctcttttaat
1680tctgctgtaa cccgtacatg cccaaaatag ggggcgggtt acacagaata tataacatcg
1740taggtgtctg ggtgaacagt ttattcctgg catccactaa atataatgga gcccgctttt
1800taagctggca tccagaaaaa aaaagaatcc cagcaccaaa atattgtttt cttcaccaac
1860catcagttca taggtccatt ctcttagcgc aactacagag aacaggggca caaacaggca
1920aaaaacgggc acaacctcaa tggagtgatg caacctgcct ggagtaaatg atgacacaag
1980gcaattgacc cacgcatgta tctatctcat tttcttacac cttctattac cttctgctct
2040ctctgatttg gaaaaagctg aaaaaaaagg ttgaaaccag ttccctgaaa ttattcccct
2100acttgactaa taagtatata aagacggtag gtattgattg taattctgta aatctatttc
2160ttaaacttct taaattctac ttttatagtt agtctttttt ttagttttaa aacaccaaga
2220acttagtttc gatccccgcg tgcttggccg gccgtatccc cgcgtgcttg gccggccgta
2280tgtctcagaa cgtttacatt gtatcgactg ccagaacccc aattggttca ttccagggtt
2340ctctatcctc caagacagca gtggaattgg gtgctgttgc tttaaaaggc gccttggcta
2400aggttccaga attggatgca tccaaggatt ttgacgaaat tatttttggt aacgttcttt
2460ctgccaattt gggccaagct ccggccagac aagttgcttt ggctgccggt ttgagtaatc
2520atatcgttgc aagcacagtt aacaaggtct gtgcatccgc tatgaaggca atcattttgg
2580gtgctcaatc catcaaatgt ggtaatgctg atgttgtcgt agctggtggt tgtgaatcta
2640tgactaacgc accatactac atgccagcag cccgtgcggg tgccaaattt ggccaaactg
2700ttcttgttga tggtgtcgaa agagatgggt tgaacgatgc gtacgatggt ctagccatgg
2760gtgtacacgc agaaaagtgt gcccgtgatt gggatattac tagagaacaa caagacaatt
2820ttgccatcga atcctaccaa aaatctcaaa aatctcaaaa ggaaggtaaa ttcgacaatg
2880aaattgtacc tgttaccatt aagggattta gaggtaagcc tgatactcaa gtcacgaagg
2940acgaggaacc tgctagatta cacgttgaaa aattgagatc tgcaaggact gttttccaaa
3000aagaaaacgg tactgttact gccgctaacg cttctccaat caacgatggt gctgcagccg
3060tcatcttggt ttccgaaaaa gttttgaagg aaaagaattt gaagcctttg gctattatca
3120aaggttgggg tgaggccgct catcaaccag ctgattttac atgggctcca tctcttgcag
3180ttccaaaggc tttgaaacat gctggcatcg aagacatcaa ttctgttgat tactttgaat
3240tcaatgaagc cttttcggtt gtcggtttgg tgaacactaa gattttgaag ctagacccat
3300ctaaggttaa tgtatatggt ggtgctgttg ctctaggtca cccattgggt tgttctggtg
3360ctagagtggt tgttacactg ctatccatct tacagcaaga aggaggtaag atcggtgttg
3420ccgccatttg taatggtggt ggtggtgctt cctctattgt cattgaaaag atatgattac
3480gttctgcgat tttctcatga tctttttcat aaaatacata aatatataaa tggctttatg
3540tataacaggc ataatttaaa gttttatttg cgattcatcg tttttcaggt actcaaacgc
3600tgaggtgtgc cttttgactt acttttccgc cttggcaagc tggccgggtg atacttgcac
3660aagttccact aattactgac atttgtggta ttaactcgtt tgactgctct acaattgtag
3720gatgttaatc aatgtcttgg ctgcctaacc tgcaggccgc gagcgccgat atgctatgta
3780atagacaata aaaccatgtt tatataaaaa aaattcaaaa tagaaaacga ttctgtacaa
3840ggagtatttt ttttttgttc tagtgtgttt atattatcct tggctaagag gcactgcgta
3900tacttcaagg tacccctgtg ttttgaaaaa aaacaacagt aaaataggaa ctccgcgagg
3960ttcaggaacc tgaaacaaaa tcaataaaaa cattatatgc gtttcgaaca aaattaaaga
4020aaaagaataa atatagatta aaaaaaaaaa gaagaaatta aaagaatttc tactaaatcc
4080caattgttat atatttgtta aatgccaaaa aagtttataa aaaatttaga atgtataaat
4140aataataaac taagtaacgc gatcgccgac gccgccgata tctccctcgc cagcggccgc
4200cttatggcta agaatgttgg aattttggcc atggacatct acttcccacc aacttgtgtt
4260cagcaggagg ctttagaagc acatgacgga gcctcaaagg gtaagtacac aatcggatta
4320ggacaggatt gcttagcatt ctgcactgaa ttggaggacg tcatctcaat gtctttcaac
4380gccgtcacct cattgttaga gaagtacaaa atcgacccaa accagatcgg aaggttggaa
4440gtcggttctg aaaccgtcat cgacaagtct aaatcaatca agactttcgt tatgcagttg
4500ttcgaaaagt gcggtaatac tgacgtcgag ggtgtagact ctactaacgc ttgttatggt
4560ggtaccgcag ctttattgaa ctgcgtaaac tgggttgagt caaactcatg ggatggtagg
4620tacggattag tcatttgcac cgattctgcc gtctacgccg agggtccagc aaggccaacc
4680ggtggagctg cagctattgc tatgttaatc ggaccagatg cccctatagt cttcgagtct
4740aagttgaggg gttcacacat ccctaacgtc tacgacttct acaagccaaa cttggcctca
4800gagtatccag ttgtcgacgg aaagttatct cagacatgct acttgatggc cttagattca
4860tgttacaagc acttatgcaa caagttcgaa aagttggagg gaaaggagtt ctcaattaac
4920gacgccgact acttcgtttt tcactctcca tacaacaaat tggtccagaa gtcattcgcc
4980aggttattgt acaacgattt tttgagaaac gcatcatcta tcgatgaggc cgccaaggag
5040aaattcaccc catattcttc tttgtcattg gacgagtctt accagtctag ggacttggag
5100aaggtatcac agcaattggc taaaaccttc tatgacgcca aagttcagcc aaccaccttg
5160gtccctaaac aggtcggaaa tatgtatact gcatctttgt atgccgcctt tgcctctttg
5220atccacaaca agcacaacga tttagtcgga aaaagggttg tcatgttttc ttacggtgcc
5280ggatctactg ccactatgtt ctcattgagg ttatgcgaaa accagtcacc attttcattg
5340tctaacatcg cctcagtcat ggacgtaggt gtctcacctg agaagttcgt agaaaccatg
5400aagttgatgg agcacagata cggtgccaaa gaattcgtca cttcaaaaga gggaatcttg
5460gatttgttgg ccccaggaac ctactatttg aaggaggtcg actctttgta cagaaggttc
5520tatggaaaga agggagacga cggatctgtc gcaaacggtc agtaaatcgg cggcgtcggc
5580gatcgcgtta aggcggccgc tggcgaggga gatatttcaa cctgggccta acagtaaaga
5640tatcctcctc aaaactggtg cacttaatcg ctgaatttgt tctggcttct cttctttttc
5700tttattcccc ccatgggcca aaaaaaatag tactatcagg aatttggcgc cgggtcacga
5760tatacgtgta cagtgaccta ggcgacgcca caaggaaaaa ggaaaaaaac agaaaaaaca
5820acaaaaacta aaacaaacac gaaaacttta atagatctaa gtgaagtagt ggtgaggcaa
5880ttggagtgac atagcagcta ctacaactac aaaaaaggcg cgccacggtc gtgcggatat
5940gaaagaggtc gttatagctt ctgccgtcag gaccgccatc ggatcttacg gtaagtcatt
6000aaaggacgtc cctgccgttg atttaggagc caccgcaatt aaagaggccg ttaaaaaggc
6060aggtataaag ccagaggacg tcaacgaggt catcttggga aatgtcttac aagccggatt
6120aggtcaaaac ccagcaagac aagcatcatt caaagccggt ttacctgtcg agatacctgc
6180aatgaccatc aacaaggttt gcggttcagg attaaggacc gtttctttag cagcacagat
6240cattaaggct ggagatgcag acgttatcat tgctggtggt atggaaaaca tgtcaagagc
6300cccatacttg gctaataacg ccaggtgggg atataggatg ggaaacgcca agtttgtcga
6360cgaaatgatt actgacggat tgtgggacgc cttcaatgac tatcacatgg gtataaccgc
6420agaaaacatt gccgagaggt ggaatatctc aagagaagaa caggatgagt ttgcattggc
6480ctcacagaaa aaagcagagg aggcaataaa gtcaggtcag tttaaggatg aaatcgtccc
6540agtcgtcatc aagggaagaa agggtgagac agttgtcgac accgacgaac accctagatt
6600tggttcaacc atcgagggat tagcaaagtt gaagccagcc ttcaagaaag acggaaccgt
6660aaccgccggt aatgcatctg gattgaacga ttgcgcagca gttttggtca taatgtcagc
6720cgagaaagct aaggagttgg gtgtcaagcc attggcaaaa attgtttcat acggatcagc
6780cggtgtcgac cctgccatca tgggttacgg acctttttac gccaccaagg ctgcaatcga
6840aaaggccggt tggaccgtag atgaattgga tttgatcgag tcaaacgagg cctttgccgc
6900ccaatcattg gctgtcgcca aggacttgaa gttcgacatg aacaaggtca acgtcaacgg
6960tggtgccatc gcattgggtc accctatcgg agcctctggt gccaggatct tggttacctt
7020ggtccacgcc atgcagaaga gggacgcaaa gaagggtttg gccaccttgt gcatcggtgg
7080aggtcaggga acagctatct tgttagagaa atgcagcccc tcagcccccc tagcgtcgaa
7140taaaagacat tggtacatga tatcaaacag aattttaaca tttcttgatc cagtttgtaa
7200acaaaacaaa caatttttct accatttaac ttcataccat cggcgagagc cgaacaggaa
7260aaaaaagaag tctccggtta tcgtaagcag tatcaaataa taagaatgta tgtgtgtgca
7320atttgttata cccacgaaga agtgcgcagt agagttagaa aaccaactga gtaatcttta
7380ctcccgacaa tcgtccaata atcctcttgt tgctaggaac gtgatgatgg atttcgtttg
7440aaatccggac ggaaaactca aaagaagtcc aaccaccaac cattttcgag cctcaagaat
7500ctctaagcag gtttctttac taaggggatg gcctttctgt cctggacatt ttttccttcc
7560ttttttcatt tccttgaaag gaacagattt tttttgactt ttgccacaca gctgcactat
7620ctcaacccct tttacatttt aagttttcgg gttgaatggc cggtgtttaa accccagcgc
7680ctggcggg
7688945025DNAArtificial SequenceSynthetic, Integration construct i476
94caggatccga cggcacggcc acgcgtttaa accgcctggg ataggatagt agcaactctt
60ggaggagagc attgtcagtt gtccagtctc tgaagttaag tagtaagttt gcggagtcaa
120agggggatgg cttttgccat ttgtgagagt tgtgcggcag catcttattc aaatagagct
180gtattctgaa gacctcttgt agaacatcat ccatactaaa aagtaaatcg tcctgtccca
240ttacgagctg tattagtgct gtgaccctct gtatatttac gttgccatga agaaggtaat
300gggcgatatt ttgatacaat tcctgagttg catgttggat tgagtttacg aagggtcgcc
360agacggccag aaacctccag gcggagttaa caactagtaa tacggcatcc atgtttgcat
420cagcgccgag cctataccag tcactgagta gacgttttct tgctcttttt atgtcctgac
480ttcttttgac gagggggcat tctctagaga cacaggcagt tgcttccagc aactgccgta
540cggccgttct catgctgtcg aggatttttt ttgggacgat attgtcatta tagggcagtg
600tgtgacttat gaattgttgt agaaggacgt ctgtgatgtt ggagatatgt attttgttaa
660ctcttcttga gacgatttgg ccctggatag cgaagcgtgc ggttacaaat aggtcgtctt
720gttcaagaag gtaggcgagg acattatcta tcagtacaaa catcttagta gtgtctgagg
780agagggttga ttgtttatgt atttttgcga aatatatata tatatattct acacagatat
840atacatattt gtttttcggg ctcattcttt cttctttgcc agaggctcac cgctcaagag
900gtccgctaat tctggagcga ttgttattgt tttttctttt cttcttctat tcgaaaccca
960gtttttgatt tgaatgcgag ataaactggt attcttcatt agattctcta ggcccttggt
1020atctagatat gggttctcga tgttctttgc aaaccaactt tctagtattc ggacattttc
1080ttttgtaaac cggtgtcctc tgtaaggttt agtacttttg tttatcatat cttgagttac
1140cacattaaat accaacccat ccgccgattt atttttctgt gtaagttgat aattacttct
1200atcgttttct atgctgcgca tttctttgag taatacagta atggtagtag tgagttgaga
1260tgttgtttgc aacaacttct tctcctcatc actaatctta cggtttttgt tggccctaga
1320taagaatcct aatatatccc ttaattcaac ttcttcttct gttgttacac tctctggtaa
1380cttaggtaaa ttacagcaaa tagaaaagag ctttttattt atgtctagta tgctggattt
1440aaactcatct gtgatttgtg gatttaaaag gtctttaatg ggtattttat tcattttttc
1500ttgcttatct tccttttttt cttgcccact tctaagctga tttcaatctc tcctttatat
1560atatttttaa gttccaacat tttatgtttc aaaacattaa tgatgtctgg gttttgtttg
1620ggatgcaatt tattgcttcc caatgtagaa aagtacatca tatgaaacaa cttaaactct
1680taactacttc ttttaacctt cactttttat gaaatgtatc aaccatatat aataacttaa
1740tagacgacat tcacaatatg tttacttcga agcctgcttt caaaattaag aacaaagcat
1800ccaaatcata cagaaacaca gcggtttcaa aaaagctgaa agaaaaacgt ctagctgagc
1860atgtgaggcc aagctgcttc aatattattc gaccactcaa gaaagatatc cagattcctg
1920ttccttcctc tcgattttta aataaaatcc aaattcacag gatagcgtct ggaagtcaaa
1980atactcagtt tcgacagttc aataagacat ctataaaatc ttcaaagaaa tatttaaact
2040catttatggc ttttagagca tattactcac agtttggctc cggtgtaaaa caaaatgtct
2100tgtcttctct gctcgctgaa gaatggcacg cggacaaaat gcagcacgga atatgggact
2160acttcgcgca acagtataat tttataaacc ctggttttgg ttttgtagag tggttgacga
2220ataattatgc tgaagtacgt ggtgacggat attgggaaga tgtgtttgta catttggcct
2280tatagagtgt ggtcgtggcg gaggttgttt atctttcgag tactgaatgt tgtcagtata
2340gctatcctat ttgaaactcc ccatcgtctt gctcttgttc ccaatgtttg tttatacact
2400catatggcta tacccttatc tacttgcctc ttttgtttat gtctatgtat ttgtataaaa
2460tatgatatta ctcagactca agcaaacaat caatgctcac acgcggccag ggggagcctc
2520gacactagta atacacatca tcgtcctaca agttcatcaa agtgttggac agacaactat
2580accagcatgg atctcttgta tcggttcttt tctcccgctc tctcgcaata acaatgaaca
2640ctgggtcaat catagcctac acaggtgaac agagtagcgt ttatacaggg tttatacggt
2700gattcctacg gcaaaaattt ttcatttcta aaaaaaaaaa gaaaaatttt tctttccaac
2760gctagaagga aaagaaaaat ctaattaaat tgatttggtg attttctgag agttcccttt
2820ttcatatatc gaattttgaa tataaaagga gatcgaaaaa atttttctat tcaatctgtt
2880ttctggtttt atttgatagt ttttttgtgt attattatta tggattagta ctggtttata
2940tgggtttttc tgtataactt ctttttattt tagtttgttt aatcttattt tgagttacat
3000tatagttccc taactgcaag agaagtaaca ttaaaaatga aaaagcctga actcaccgcg
3060acgtctgtcg agaagtttct gatcgaaaag ttcgacagcg tctccgacct gatgcagctc
3120tcggagggcg aagaatctcg tgctttcagc ttcgatgtag gagggcgtgg atatgtcctg
3180cgggtaaata gctgcgccga tggtttctac aaagatcgtt atgtttatcg gcactttgca
3240tcggccgcgc tcccgattcc ggaagtgctt gacattgggg aattcagcga gagcctgacc
3300tattgcatct cccgccgtgc acagggtgtc acgttgcaag acctgcctga aaccgaactg
3360cccgctgttc tgcagccggt cgcggaggcc atggatgcga tcgctgcggc cgatcttagc
3420cagacgagcg ggttcggccc attcggaccg caaggaatcg gtcaatacac tacatggcgt
3480gatttcatat gcgcgattgc tgatccccat gtgtatcact ggcaaactgt gatggacgac
3540accgtcagtg cgtccgtcgc gcaggctctc gatgagctga tgctttgggc cgaggactgc
3600cccgaagtcc ggcacctcgt gcacgcggat ttcggctcca acaatgtcct gacggacaat
3660ggccgcataa cagcggtcat tgactggagc gaggcgatgt tcggggattc ccaatacgag
3720gtcgccaaca tcttcttctg gaggccgtgg ttggcttgta tggagcagca gacgcgctac
3780ttcgagcgga ggcatccgga gcttgcagga tcgccgcggc tccgggcgta tatgctccgc
3840attggtcttg accaactcta tcagagcttg gttgacggca atttcgatga tgcagcttgg
3900gcgcagggtc gatgcgacgc aatcgtccga tccggagccg ggactgtcgg gcgtacacaa
3960atcgcccgca gaagcgcggc cgtctggacc gatggctgtg tagaagtact cgccgatagt
4020ggaaaccgac gccccagcac tcgtccgagg gcaaaggaat aggtttaact tgatactact
4080agattttttc tcttcattta taaaattttt ggttataatt gaagctttag aagtatgaaa
4140aaatcctttt ttttcattct ttgcaaccaa aataagaagc ttcttttatt cattgaaatg
4200atgaatataa acctaacaaa agaaaaagac tcgaatatca aacattaaaa aaaaataaaa
4260gaggttatct gttttcccat ttagttggag tttgcatttt ctaatagata gaactctcaa
4320ttaatgtgga tttagtttct ctgttcgttt ttttttgttt tgttctcact gtatttacat
4380ttctatttag tatttagtta ttcatataat cttaacttct cgaggagctc cgctcgtcca
4440acgccggcgg acctcggagg ttgtttatct ttcgagtact gaatgttgtc agtatagcta
4500tcctatttga aactccccat cgtcttgctc ttgttcccaa tgtttgttta tacactcata
4560tggctatacc cttatctact tgcctctttt gtttatgtct atgtatttgt ataaaatatg
4620atattactca gactcaagca aacaatcaat tcttagcatc attctttgtt cttatcttaa
4680ccataaacga tcttgatgtg acttttgtaa tttgaacgaa ttggctatac gggacggatg
4740acaaatgcac cattactcta ggttgttgtt ggatcttaac aaaccgtaaa ggtaaactgc
4800ccatgcggtt cacatgactt ttgactttcc tttgtttgct agttaccttc ggcttcacaa
4860tttgtttttc cacttttcta acaggtttat cacctttcaa acttatcttt atcttattcg
4920ccttcttggg tgcctccaca gtagaggtta cttccttttt aatatgtact tttaggatac
4980tttcacgctt tataacacgg tgtttaaacc ccagcgcctg gcggg
5025953665DNAArtificial SequenceSynthetic, Integration construct i477
95agctcgagga cggcacggcc acgcgtttaa accgccaagc ttttcaattc atcttttttt
60tttttgttct tttttttgat tccggtttct ttgaaatttt tttgattcgg taatctccga
120gcagaaggaa gaacgaagga aggagcacag acttagattg gtatatatac gcatatgtgg
180tgttgaagaa acatgaaatt gcccagtatt cttaacccaa ctgcacagaa caaaaacctg
240caggaaacga agataaatca tgtcgaaagc tacatataag gaacgtgctg ctactcatcc
300tagtcctgtt gctgccaagc tatttaatat catgcacgaa aagcaaacaa acttgtgtgc
360ttcattggat gttcgtacca ccaaggaatt actggagtta gttgaagcat taggtcccaa
420aatttgttta ctaaaaacac atgtggatat cttgactgat ttttccatgg agggcacagt
480taagccgcta aaggcattat ccgccaagta caatttttta ctcttcgaag acagaaaatt
540tgctgacatt ggtaatacag tcaaattgca gtactctgcg ggtgtataca gaatagcaga
600atgggcagac attacgaatg cacacggtgt ggtgggccca ggtattgtta gcggtttgaa
660gcaggcggca gaagaagtaa caaaggaacc tagaggcctt ttgatgttag cagaattgtc
720atgcaagggc tccctatcta ctggagaata tactaagggt actgttgaca ttgcgaagag
780tgacaaagat tttgttatcg gctttattgc tcaaagagac atgggtggaa gagatgaagg
840ttacgattgg ttgattatga cacccggtgt gggtttagat gacaagggag acgcattggg
900tcaacagtat agaaccgtgg atgatgtggt ctctacagga tctgacatta ttattgttgg
960aagcgctcgt ccaacgccgg cggacctatg gcgcaagttt tccgctttgt aatatatatt
1020tatacccctt tcttctctcc cctgcaatat aatagtttaa ttctaatatt aataatatcc
1080tatattttct tcatttaccg gcgcactctc gcccgaacga cctcaaaatg tctgctacat
1140tcataataac caaaagctca taactttttt ttttgaacct gaatatatat acatcacata
1200tcactgctgg tccttgccga ccagcgtata caatctcgat agttggtttc ccgttctttc
1260cactcccgtc atggactaca acaagagatc ttcggtctca accgtgccta atgcagctcc
1320cataagagtc ggattcgtcg gtctcaacgc agccaaagga tgggcaatca agacacatta
1380ccccgccata ctgcaactat cgtcacaatt tcaaatcact gccttataca gtccaaaaat
1440tgagacttct attgccacca tccagcgtct aaaattgagt aatgccactg cttttcccac
1500tttagagtca tttgcatcat cttccactat agatatgata gtgatagcta tccaagtggc
1560cagtcattat gacgttgtta tgcctctctt ggaattctcc aaaaataatc cgaacctcaa
1620gtatcttttc gtagaatggg cccttgcatg ttcactagat caagccgaat ccatttataa
1680ggctgctgct gaacgtgggg ttcaaaccat catctcttta caaggtcgta aatcaccata
1740tattttgaga gcaaaagaat taatatctca aggctatatc ggcgacatta attctatcga
1800gattgctgga aatggcggtt ggtacggcta cgaaaggcct gttaaatcac caaaatacat
1860ctatgaaatc gggaacggtg tagatctggt aaccacaaca tttggtcaca caatcgatat
1920tttacaatac atgacaagtt cgtacttttc caggataaat gcaatggttt tcaataatat
1980tccagagcaa gagctgatag atgagcgtgg taaccgattg ggccagcgag tcccaaagac
2040agtaccggat catcttttat tccaaggcac attgttaaat ggcaatgttc cagtgtcatg
2100cagtttcaaa ggtggcaaac ctaccaaaaa atttaccaaa aatttggtca ttgatattca
2160cggtaccaag ggagatttga aacttgaagg cgatgccgga ttcgcagaaa tttcaaatct
2220ggtcctttac tacagtggaa ctagagcaaa cgacttcccg ctagctaatg gacaacaagc
2280tcctttagac ccggggtatg atgcaggtaa agaaatcatg gaagtatatc atttacgaaa
2340ttataatgcc attgtcggta atattcatcg actgtatcaa tctatctctg acttccactt
2400caatacaaag aaaattcctg aattaccctc acaatttgta atgcaaggtt tcgatttcga
2460aggctttccc accttgatgg atgctctgat attacacagg ttaatcgaga gcgtttataa
2520aagtaacatg atgggctcca cattaaacgt tagcaatatc tcgcattata gtttataaaa
2580gcatcttgcc ctgtgcttgg cccccagtgc agcgaacgtt ataaaaacga atactgagta
2640tatatctatg taaaacaacc atatcatttc ttgttctgaa ctttgtttac ctaactagtt
2700ttaaatttcc ctttttcgtg catgcgggtg ttcttattta ttagcatact acatttgaaa
2760tatcaaattt ccttagtaga aaagtgagag aaggtgcact gacacaaaaa ataaaatccc
2820cgcgtgcttg gccggccgtc ttcattggat gttcgtacca ccaaggaatt actggagtta
2880gttgaagcat taggtcccaa aatttgttta ctaaaaacac atgtggatat cttgactgat
2940ttttccatgg agggcacagt taagccgcta aaggcattat ccgccaagta caatttttta
3000ctcttcgaag acagaaaatt tgctgacatt ggtaatacag tcaaattgca gtactctgcg
3060ggtgtataca gaatagcaga atgggcagac attacgaatg cacacggtgt ggtgggccca
3120ggtattgtta gcggtttgaa gcaggcggca gaagaagtaa caaaggaacc tagaggcctt
3180ttgatgttag cagaattgtc atgcaagggc tccctatcta ctggagaata tactaagggt
3240actgttgaca ttgcgaagag tgacaaagat tttgttatcg gctttattgc tcaaagagac
3300atgggtggaa gagatgaagg ttacgattgg ttgattatga cacccggtgt gggtttagat
3360gacaagggag acgcattggg tcaacagtat agaaccgtgg atgatgtggt ctctacagga
3420tctgacatta ttattgttgg aagaggacta tttgcaaagg gaagggatgc taaggtagag
3480ggtgaacgtt acagaaaagc aggctgggaa gcatatttga gaagatgcgg ccagcaaaac
3540taaaaaactg tattataagt aaatgcatgt atactaaact cacaaattag agcttcaatt
3600taattatatc agttattacc cgggaatctc ggtgtttaaa ccccagcgcc tggcgggtct
3660agatc
36659610623DNAArtificial SequenceSynthetic, Integration construct i94
96atgagtgata gggaattcgt cacggtagat cccgtcacta tcataatcaa agaatgcatt
60aatttatcga cagcgatgcg gaaatactct aaatttacct ctcaatctgg agtggccgct
120ttgctggggg gaggaagtga aatatttagc aatcaagatg actacttggc tcacacattc
180aacaatttga ataccaacaa gcacaatgat ccatttttat ctggattcat tcagttaaga
240cttatgttga ataaactgaa aaatctagat aatatagatt cactaaccat attgcagcca
300tttttattaa ttgtgagtac aagttccatt tctggttaca tcacttccct ggccctggac
360tctttgcaga aattctttac cttgaatatc atcaatgaat catcgcaaaa ctatattggt
420gcacacaggg cgacggtaaa tgctctaaca cattgtaggt ttgaaggatc tcaacaactt
480tctgatgatt cagttctttt gaaagtcgtg tttttactgc gttcaatcgt cgactcacct
540tacggagatt tattatcaaa ctctatcata tatgacgtat tgcaaacgat tctttcattg
600gcttgtaata acagaaggag cgaagtcctt aggaatgctg cacaatcaac aatgatagcc
660gttaccgtaa agattttctc aaaactaaag actattgagc ctgttaatgt gaatcaaata
720tacatcaatg atgaaagtta cacaaatgat gtattgaagg ccgatacaat tggcacaaat
780gtagaatcca aagaagaagg aagtcaagaa gatcccatcg gcatgaaagt gaataatgag
840gaagctatta gcgaggacga tggcattgaa gaagagcata ttcattcaga gaagagcaca
900aatggcgccg aacaactaga tattgtgcaa aaaacaacaa gatcaaattc caggatccaa
960gcgtatgctg atgataacta tggattgccc gtggttaggc aatatttaaa cttattacta
1020tcattgattg cgccagaaaa tgaattaaaa cattcatact ccactagaat atttggccta
1080gagttaattc aaacggcatt agaaatttca ggtgatcgat tgcagctata cccacggctt
1140tttacactga tatcagatcc tattttcaaa agcattttgt ttatcataca gaacactaca
1200aaattatcac tacttcaagc tacattgcag ctatttacta ctctagttgt tatattgggc
1260aacaacttac aattacagat cgagctcact ctaacaagaa tattttctat tcttttagat
1320gatggtaccg caaataactc gagttctgaa aataagaaca agccatcaat aataaaggaa
1380cttctaattg agcaaatatc catcttatgg actaggtcgc catctttttt tacttctact
1440tttatcaatt tcgattgtaa tctcgatagg gcagacgttt ccataaactt tttgaaggct
1500ttgactaaat tggccttacc agaatccgcc ttaactacca cagaaagtgt accacccatt
1560tgccttgagg gattggtctc cctagtcgat gatatgttcg atcacatgaa ggacattgac
1620agagaagaat ttggcaggca aaagaatgaa atggaaatct taaaaaagag ggaccgtaaa
1680acagagttta ttgaatgtac caatgcattc aatgaaaagc ccaaaaaggg tattccgatg
1740ttaatagaaa aaggtttcat tgcttccgac tccgataaag atattgcgga gtttcttttc
1800aataataaca accgtatgaa taaaaaaaca atcggtttgc tactttgcca tccggacaaa
1860gtaagcttgt tgaatgaata tattcgtttg tttgattttt cagggttaag ggtcgatgaa
1920gctattagaa ttttgttgac gaaatttagg ttgcctggtg aatcgcaaca aattgaaaga
1980atcatcgaag ccttctcgtc tgcgtattgt gaaaatcaag attacgatcc atccaaaatc
2040agtgacaacg cggaggatga catttctact gttcaaccag acgctgattc tgttttcatt
2100ttaagttatt caattattat gttgaacact gacctacata accctcaagt gaaggaacac
2160atgtcatttg aagattactc tggtaactta aagggatgct gtaatcacaa agacttccca
2220ttctggtatt tggatagaat ttactgttca atcagagata aagaaattgt tatgcctgaa
2280gagcaccacg gcaacgaaaa gtggtttgaa gatgcttgga ataacttgat atcttcaact
2340actgttataa ctgaaataaa aaaagacaca caatctgtca tggataaatt aacacccttg
2400gagcttttga actttgatag agcaattttt aaacaagttg gcccaagtat tgtcagtact
2460ttattcaaca tttacgtagt tgcatctgat gaccatatat ctaccagaat gataacaagt
2520ttggacaaat gttcctatat ttccgcattt tttgacttca aagatctctt taatgatata
2580ctaaactcca ttgctaaggg cactactttg attaattcaa gccatgacga tgaactttca
2640actttagctt ttgaatatgg cccaatgcca ctggtgcaaa ttaaattcga agacactaac
2700actgagatcc cggttagtac agatgctgtt agatttggta gatcatttaa gggtcaacta
2760aatacagttg tttttttccg gattattcgc aggaacaaag atcctaaaat tttctccaag
2820gaattatggt taaacattgt taatattata ctaacattgt acgaagactt gattttgtct
2880cctgatattt tccctgattt acaaaaaaga ctgaaattaa gcaacttgcc taagccatct
2940cctgaaattt ctattaacaa gagcaaagaa agcaaaggtc tcttatcaac atttgcttct
3000tatttaaaag gtgatgaaga acccacagaa gaggaaatca aatcctcaaa aaaagcgatg
3060gagtgcataa agtcgagtaa tattgccgcc tctgtctttg gaaatgaatc aaatataaca
3120gcggatttaa taaaaacttt actagactcc gccaaaactg agaaaaacgc agataattcc
3180aggtattttg aagcagaact tttatttatc atcgaattga ctattgcatt atttctattt
3240tgcaaagagg agaaagaatt aggaaagttc atacttcaaa aagttttcca actttctcac
3300acgaaaggcc tcacgaaaag gactgttcgt agaatgctaa catacaaaat tttgttaatt
3360tcgttatgtg cggatcagac ggagtacttg tccaaattaa taaacgatga gctgttaaaa
3420aagggggata tttttaccca aaaatttttt gcaactaatc aaggtaagga atttttgaag
3480agactatttt cattgaccga atcagagttt tatagaggat ttttactagg aaatgagaat
3540ttttggaaat ttttaagaaa agttacagca atgaaagagc agagcgagag catttttgaa
3600tatttaaatg aatcgatcaa gacagacagc aatattttga caaatgagaa cttcatgtgg
3660gtcctaggac tattagatga aatttcatca atgggtgccg ttggaaatca ctgggaaata
3720gaatacaaga aattgacaga aagtggtcat aaaattgata aggagaatcc atacaagaaa
3780tcgatcgaat tatcattgaa atccattcaa ctaacatcac acttgctgga agataataac
3840gatctgcgta aaaacgagat attcgctatt attcaagctt tggcacatca atgcatcaat
3900ccgtgtaagc agataagtga atttgcagtg gtaacgctag agcagacgct catcaataaa
3960atcgaaattc caactaatga gatggaatcg gtagaagaat taattgaggg cggattacta
4020ccgttgctaa attcgagtga aacacaggaa gaccagaaaa tcctcatttc atccatatta
4080acaataattt caaatgttta tttgcattat ttgaaactag ggaagacaag caacgaaacg
4140tttttgaaaa ttttgagtat tttcaataaa tttgtagagg actcagatat tgaaaaaaag
4200ctacagcaat taatacttga taagaagagt attgagaagg gcaacggttc atcatctcat
4260ggatctgcac atgaacaaac accagagtca aacgacgttg aaattgaggc tactgcgcca
4320attgatgaca atacagacga tgataacaaa ccgaagttat ctgatgtaga aaaggattaa
4380agatgctaag agatagtgat gatatttcat aaataatgta attctatata tgttaattac
4440cttttttgcg aggcatattt atggtgaagg ataagttttg accatcaaag aaggttaatg
4500tggctgtggt ttcagggtcc atacccggga gttatgacaa ttacaacaac agaattcttt
4560ctatatatgc acgaacttgt aatatggaag aaattatgac gtacaaacta taaagtaaat
4620attttacgta acacatggtg ctgttgtgct tctttttcaa gagaatacca atgacgtatg
4680actaagttta ggatttaatg caggtgacgg acccatcttt caaacgattt atatcagtgg
4740cgtccaaatt gttaggtttt gttggttcag caggtttcct gttgtgggtc atatgacttt
4800gaaccaaatg gccggctgct agggcagcac ataaggataa ttcacctgcc aagacggcac
4860aggcaactat tcttgctaat tgacgtgcgt tggtaccagg agcggtagca tgtgggcctc
4920ttacacctaa taagtccaac atggcacctt gtggttctag aacagtacca ccaccgatgg
4980tacctacttc gatggatggc atggatacgg aaattctcaa atcaccgtcc acttctttca
5040tcaatgttat acagttggaa ctttcgacat tttgtgcagg atcttgtcct aatgccaaga
5100aaacagctgt cactaaatta gctgcatgtg cgttaaatcc accaacagac ccagccattg
5160cagatccaac caaattctta gcaatgttca actcaaccaa tgcggaaaca tcacttttta
5220acacttttct gacaacatca ccaggaatag tagcttctgc gacgacactc ttaccacgac
5280cttcgatcca gttgatggca gctggttttt tgtcggtaca gtagttacca gaaacggaga
5340caacctccat atcttcccag ccatactctt ctaccatttg ctttaatgag tattcgacac
5400ccttagaaat catattcata cccattgcgt caccagtagt tgttctaaat ctcatgaaga
5460gtaaatctcc tgctagacaa gtttgaatat gttgcagacg tgcaaatctt gatgtagagt
5520taaaagcttt tttaattgcg ttttgtccct cttctgagtc taaccatatc ttacaggcac
5580cagatctttt caaagttggg aaacggacta ctgggcctct tgtcatacca tccttagtta
5640aaacagttgt tgcaccaccg ccagcattga ttgccttaca gccacgcatg gcagaagcta
5700ccaaacaacc ctctgtagtt gccattggta tatgataaga tgtaccatcg ataaccaagg
5760ggcctataac accaacgggc aaaggcatgt aacctataac attttcacaa caagcgccaa
5820atacgcggtc gtagtcataa tttttatatg gtaaacgatc agatgctaat acaggagctt
5880ctgccaaaat tgaaagagcc ttcctacgta ccgcaaccgc tctcgtagta tcacctaatt
5940ttttctccaa agcgtacaaa ggtaacttac cgtgaataac caaggcagcg acctctttgt
6000tcttcaattg ttttgtattt ccactactta ataatgcttc taattcttct aaaggacgta
6060ttttcttatc caagctttca atatcgcggg aatcatcttc ctcactagat gatgaaggtc
6120ctgatgagct cgattgcgca gatgataaac ttttgacttt cgatccagaa atgactgttt
6180tattggttaa aactggtgta gaagcctttt gtacaggagc agtaaaagac ttcttggtga
6240cttcagtctt caccaattgg tctgcagcca ttatagtttt ttctccttga cgttaaagta
6300tagaggtata ttaacaattt tttgttgata cttttatgac atttgaataa gaagtaatac
6360aaaccgaaaa tgttgaaagt attagttaaa gtggttatgc agcttttgca tttatatatc
6420tgttaataga tcaaaaatca tcgcttcgct gattaattac cccagaaata aggctaaaaa
6480actaatcgca ttattatcct atggttgtta atttgattcg ttgatttgaa ggtttgtggg
6540gccaggttac tgccaatttt tcctcttcat aaccataaaa gctagtattg tagaatcttt
6600attgttcgga gcagtgcggc gcgaggcaca tctgcgtttc aggaacgcga ccggtgaaga
6660ccaggacgca cggaggagag tcttccgtcg gagggctgtc gcccgctcgg cggcttctaa
6720tccgtacttc aatatagcaa tgagcagtta agcgtattac tgaaagttcc aaagagaagg
6780tttttttagg ctaagataat ggggctcttt acatttccac aacatataag taagattaga
6840tatggatatg tatatggtgg tattgccatg taatatgatt attaaacttc tttgcgtcca
6900tccaaaaaaa aagtaagaat ttttgaaaat tcaatataaa tgaaactctc aactaaactt
6960tgttggtgtg gtattaaagg aagacttagg ccgcaaaagc aacaacaatt acacaataca
7020aacttgcaaa tgactgaact aaaaaaacaa aagaccgctg aacaaaaaac cagacctcaa
7080aatgtcggta ttaaaggtat ccaaatttac atcccaactc aatgtgtcaa ccaatctgag
7140ctagagaaat ttgatggcgt ttctcaaggt aaatacacaa ttggtctggg ccaaaccaac
7200atgtcttttg tcaatgacag agaagatatc tactcgatgt ccctaactgt tttgtctaag
7260ttgatcaaga gttacaacat cgacaccaac aaaattggta gattagaagt cggtactgaa
7320actctgattg acaagtccaa gtctgtcaag tctgtcttga tgcaattgtt tggtgaaaac
7380actgacgtcg aaggtattga cacgcttaat gcctgttacg gtggtaccaa cgcgttgttc
7440aactctttga actggattga atctaacgca tgggatggta gagacgccat tgtagtttgc
7500ggtgatattg ccatctacga taagggtgcc gcaagaccaa ccggtggtgc cggtactgtt
7560gctatgtgga tcggtcctga tgctccaatt gtatttgact ctgtaagagc ttcttacatg
7620gaacacgcct acgattttta caagccagat ttcaccagcg aatatcctta cgtcgatggt
7680catttttcat taacttgtta cgtcaaggct cttgatcaag tttacaagag ttattccaag
7740aaggctattt ctaaagggtt ggttagcgat cccgctggtt cggatgcttt gaacgttttg
7800aaatatttcg actacaacgt tttccatgtt ccaacctgta aattggtcac aaaatcatac
7860ggtagattac tatataacga tttcagagcc aatcctcaat tgttcccaga agttgacgcc
7920gaattagcta ctcgcgatta tgacgaatct ttaaccgata agaacattga aaaaactttt
7980gttaatgttg ctaagccatt ccacaaagag agagttgccc aatctttgat tgttccaaca
8040aacacaggta acatgtacac cgcatctgtt tatgccgcct ttgcatctct attaaactat
8100gttggatctg acgacttaca aggcaagcgt gttggtttat tttcttacgg ttccggttta
8160gctgcatctc tatattcttg caaaattgtt ggtgacgtcc aacatattat caaggaatta
8220gatattacta acaaattagc caagagaatc accgaaactc caaaggatta cgaagctgcc
8280atcgaattga gagaaaatgc ccatttgaag aagaacttca aacctcaagg ttccattgag
8340catttgcaaa gtggtgttta ctacttgacc aacatcgatg acaaatttag aagatcttac
8400gatgttaaaa aataatcttc ccccatcgat tgcatcttgc tgaaccccct tcataaatgc
8460tttatttttt tggcagcctg ctttttttag ctctcattta atagagtagt tttttaatct
8520atatactagg aaaactcttt atttaataac aatgatatat atatattcca gtggtgcatg
8580aacgcatgag aaagcccccg gaagatcatc ttccgggggc tttttttttg gcgcgcgata
8640cagaccggtt cagacaggat aaagaggaac gcagaatgtt agacaacacc cgcttacgca
8700tagctattca gaaatcaggc cgtttaagcg atgattcacg agaattgctg gcccgctgcg
8760gcataaaaat taatttacac actcagcgcc tgattgcgat ggcggaaaac atgccgattg
8820atatcctgcg cgtgcgtgat gatgacattc cgggtctggt aatggatggc gtggtcgatc
8880tcggtattat cggcgaaaac gtgctggaag aagagctact caaccgccgc gcacagggcg
8940aagatccacg ctatttaacc ctgcgccgtc ttgacttcgg cggctgccgt ttatcgctgg
9000caacaccggt tgacgaagcc tgggacggcc cggccgcgct ggacggtaaa cgtatcgcta
9060cctcatatcc gcacctcctc aaacgctacc tcgaccagaa aggcgtctct tttaaatcgt
9120gtctgttaaa tggttctgtc gaagtcgcgc cgcgcgcggg gctggccgac gctatctgcg
9180atttggtctc taccggcgcg acgcttgaag ctaacggcct gcgtgaagtc gaagttatct
9240accgctctaa agcctgtctg attcagcgcg acggtgagat ggcacagagc aagcaagagc
9300tgatcgataa attgctgacc cgtattcagg gcgtgattca ggcgcgcgaa tcgaaataca
9360tcatgatgca cgcgccaagt gaacgcctgg aagaggttat cgccctgctg ccaggcgccg
9420aaaggccgac aattctgccg ctggcaggcg agcaacagcg cgtggcgatg cacatggtca
9480gcagcgaaac gttgttctgg gaaaccatgg agaaactgaa agcgcttggc gccagctcga
9540ttctggtact gccgatcgag aagatgatgg agtgatctga cgcctgatgg cgctgcgctt
9600atcaggccta cgtaatgcgt tgaaaaactg tattataagt aaatgcatgt atactaaact
9660cacaaattag agcttcaatt taattatatc agttattacc cgggaatctc ggtcgtaatg
9720atttctataa tgacgaaaaa aaaaaaattg gaaagaaaaa gcttcatggc ctttataaaa
9780aggaactatc caatacctcg ccagaaccaa gtaacagtat tttacggggc acaaatcaag
9840aacaataaga caggactgta aagatggacg cattgaactc caaagaacaa caagagttcc
9900aaaaagtagt ggaacaaaag caaatgaagg atttcatgcg tttgtactct aatctggtag
9960aaagatgttt cacagactgt gtcaatgact tcacaacatc aaagctaacc aataaggaac
10020aaacatgcat catgaagtgc tcagaaaagt tcttgaagca tagcgaacgt gtagggcagc
10080gtttccaaga acaaaacgct gccttgggac aaggcttggg ccgataaggt gtactggcgt
10140atatatatct aattatgtat ctctggtgta gcccattttt agcatgtaaa tataaagaga
10200aaccatatct aatctaacca aatccaaaca aaattcaata gttactatcg cttttttctt
10260tctgtatcgc aaataagtga aaattaaaaa agaaagatta aattggaagt tggatatggg
10320ctggaacagc agcagtaatc ggtatcgggt tcgccactaa tgacgtccta cgattgcact
10380caacagacct tgacgctcac gccgtagcgg gcgacaagtc aaacggaaca accgttgccg
10440ttcccatcgg agtccgacct aggccgaact ccgtgaattt ctgataacaa cggtcggtaa
10500agactggttc cccagtatat ttcttctctc aggagcaggg gccaatgcca aaagcgacat
10560taacccggag gacaaggctc cactgtgttc caccgaattt cccacctgat aatatctgat
10620aac
10623978479DNAArtificial SequenceSynthetic, Integration construct i467
97gacggcacgg ccacgcgttt aaaccgccct ccaagctgac ataaatcgca ctttgtatct
60actttttttt attcgaaaac aaggcacaac aatgaatcta tcgccctgtg agattttcaa
120tctcaagttt gtgtaataga tagcgttata ttatagaact ataaaggtcc ttgaatatac
180atagtgtttc attcctatta ctgtatatgt gactttacat tgttacttcc gcggctattt
240gacgttttct gcttcaggtg cggcttggag ggcaaagtgt cagaaaatcg gccaggccgt
300atgacacaaa agagtagaaa acgagatctc aaatatctcg aggcctgtcc tctatacaac
360cgcccagctc tctgacaaag ctccagaacg gttgtctttt gtttcgaaaa gccaaggtcc
420cttataattg ccctccattt tgtgtcacct atttaagcaa aaaattgaaa gtttactaac
480ctttcattaa agagaaataa caatattata aaaagcgctt aaagctcaca cgcggccagg
540gggagccgtt catcatctca tggatctgca catgaacaaa caccagagtc aaacgacgtt
600gaaattgagg ctactgcgcc aattgatgac aatacagacg atgataacaa accgaagtta
660tctgatgtag aaaaggatta aagatgctaa gagatagtga tgatatttca taaataatgt
720aattctatat atgttaatta ccttttttgc gaggcatatt tatggtgaag gataagtttt
780gaccatcaaa gaaggttaat gtggctgtgg tttcagggtc cataaagctt ttcaattcat
840cttttttttt tttgttcttt tttttgattc cggtttcttt gaaatttttt tgattcggta
900atctccgagc agaaggaaga acgaaggaag gagcacagac ttagattggt atatatacgc
960atatgtggtg ttgaagaaac atgaaattgc ccagtattct taacccaact gcacagaaca
1020aaaacctgca ggaaacgaag ataaatcatg tcgaaagcta catataagga acgtgctgct
1080actcatccta gtcctgttgc tgccaagcta tttaatatca tgcacgaaaa gcaaacaaac
1140ttgtgtgctt cattggatgt tcgtaccacc aaggaattac tggagttagt tgaagcatta
1200ggtcccaaaa tttgtttact aaaaacacat gtggatatct tgactgattt ttccatggag
1260ggcacagtta agccgctaaa ggcattatcc gccaagtaca attttttact cttcgaagac
1320agaaaatttg ctgacattgg taatacagtc aaattgcagt actctgcggg tgtatacaga
1380atagcagaat gggcagacat tacgaatgca cacggtgtgg tgggcccagg tattgttagc
1440ggtttgaagc aggcggcaga agaagtaaca aaggaaccta gaggcctttt gatgttagca
1500gaattgtcat gcaagggctc cctatctact ggagaatata ctaagggtac tgttgacatt
1560gcgaagagtg acaaagattt tgttatcggc tttattgctc aaagagacat gggtggaaga
1620gatgaaggtt acgattggtt gattatgaca cccggtgtgg gtttagatga caagggagac
1680gcattgggtc aacagtatag aaccgtggat gatgtggtct ctacaggatc tgacattatt
1740attgttggaa gaggactatt tgcaaaggga agggatgcta aggtagaggg tgaacgttac
1800agaaaagcag gctgggaagc atatttgaga agatgcggcc agcaaaacta aaaaactgta
1860ttataagtaa atgcatgtat actaaactca caaattagag cttcaattta attatatcag
1920ttattacccg ggaatctcgg tcgtaatgat ttctataatg acgaaaaaaa aaaaattgga
1980aagaaaaagc ttcatggcct ttataaaaag gaactatcca atacctcgcc agaaccaagt
2040aacagtattt tacggggcac aaatcaagaa caataagaca ggactgtaaa gatggacgca
2100tcgctcgtcc aacgccggcg gacctgtttt caatagttcg gtaatattaa cggataccta
2160ctattatccc ctagtaggct cttttcacgg agaaattcgg gagtgttttt tttccgtgcg
2220cattttctta gctatattct tccagcttcg cctgctgccc ggtcatcgtt cctgtcacgt
2280agtttttccg gattcgtccg gctcatataa taccgcaata aacacggaat atctcgttcc
2340gcggattcgg ttaaactctc ggtcgcggat tatcacagag aaagcttcgt ggagaatttt
2400tccagatttt ccgctttccc cgatgttggt atttccggag gtcattatac tgaccgccat
2460tataatgact gtacaacgac cttctggaga aagaaacaac tcaataacga tgtgggacat
2520tgggggccca ctcaaaaaat ctggggacta tatccccaga gaatttctcc agaagagaag
2580aaaagtcaaa gttttttttc gcttgggggt tgcatataaa tacaggcgct gttttatctt
2640cagcatgaat attccataat tttacttaat agcttttcat aaataataga atcacaaaca
2700aaatttacat ctgagttaaa caatcatgac aatcaaggaa cataaagtag tttatgaagc
2760tcacaacgta aaggctctta aggctcctca acatttttac aacagccaac ccggcaaggg
2820ttacgttact gatatgcaac attatcaaga aatgtatcaa caatctatca atgagccaga
2880aaaattcttt gataagatgg ctaaggaata cttgcattgg gatgctccat acaccaaagt
2940tcaatctggt tcattgaaca atggtgatgt tgcatggttt ttgaacggta aattgaatgc
3000atcatacaat tgtgttgaca gacatgcctt tgctaatccc gacaagccag ctttgatcta
3060tgaagctgat gacgaatccg acaacaaaat catcacattt ggtgaattac tcagaaaagt
3120ttcccaaatc gctggtgtct taaaaagctg gggcgttaag aaaggtgaca cagtggctat
3180ctatttgcca atgattccag aagcggtcat tgctatgttg gctgtggctc gtattggtgc
3240tattcactct gttgtctttg ctgggttctc cgctggttcg ttgaaagatc gtgtcgttga
3300cgctaattct aaagtggtca tcacttgtga tgaaggtaaa agaggtggta agaccatcaa
3360cactaaaaaa attgttgacg aaggtttgaa cggagtcgat ttggtttccc gtatcttggt
3420tttccaaaga actggtactg aaggtattcc aatgaaggcc ggtagagatt actggtggca
3480tgaggaggcc gctaagcaga gaacttacct acctcctgtt tcatgtgacg ctgaagatcc
3540tctattttta ttatacactt ccggttccac tggttctcca aagggtgtcg ttcacactac
3600aggtggttat ttattaggtg ccgctttaac aactagatac gtttttgata ttcacccaga
3660agatgttctc ttcactgccg gtgacgtcgg ctggatcacg ggtcacacct atgctctata
3720tggtccatta accttgggta ccgcctcaat aattttcgaa tccactcctg cctacccaga
3780ttatggtaga tattggagaa ttatccaacg tcacaaggct acccatttct atgtggctcc
3840aactgcttta agattaatca aacgtgtagg tgaagccgaa attgccaaat atgacacttc
3900ctcattacgt gtcttgggtt ccgtcggtga accaatctct ccagacttat gggaatggta
3960tcatgaaaaa gtgggtaaca aaaactgtgt catttgtgac actatgtggc aaacagagtc
4020tggttctcat ttaattgctc ctttggcagg tgctgtccca acaaaacctg gttctgctac
4080cgtgccattc tttggtatta acgcttgtat cattgaccct gttacaggtg tggaattaga
4140aggtaatgat gtcgaaggtg tccttgccgt taaatcacca tggccatcaa tggctagatc
4200tgtttggaac caccacgacc gttacatgga tacttacttg aaaccttatc ctggtcacta
4260tttcacaggt gatggtgctg gtagagatca tgatggttac tactggatca ggggtagagt
4320tgacgacgtt gtaaatgttt ccggtcatag attatccaca tcagaaattg aagcatctat
4380ctcaaatcac gaaaacgtct cggaagctgc tgttgtcggt attccagatg aattgaccgg
4440tcaaaccgtc gttgcatatg tttccctaaa agatggttat ctacaaaaca acgctactga
4500aggtgatgca gaacacatca caccagataa tttacgtaga gaattgatct tacaagttag
4560gggtgagatt ggtcctttcg cctcaccaaa aaccattatt ctagttagag atctaccaag
4620aacaaggtca ggaaagatta tgagaagagt tctaagaaag gttgcttcta acgaagccga
4680acagctaggt gacctaacta ctttggccaa cccagaagtt gtacctgcca tcatttctgc
4740tgtagagaac caatttttct ctcaaaaaaa gaaataaatt gaattgaatt gaaatcgata
4800gatcaatttt tttcttttct ctttccccat cctttacgct aaaataatag tttattttat
4860tttttgaata ttttttattt atatacgtat atatagacta ttatttatct tttaatgatt
4920attaagattt ttattaaaaa aaaattcgct cctcttttaa tgcctttatg cagttttttt
4980ttcccattcg atatttctat gttcgggttc agcgtatttt aagtttaata actcgaaaat
5040tctgcgttcg ttaaagcttt cgagaaggat attatttcga aataaaccgt gttgtgtaag
5100cttgaagcct ttttgcgctg ccaatattct tatccatcta ttgtactctt tagatccagt
5160atagtgtatt cttcctgctc caagctcatc ccatccccgc gtgcttggcc ggccgttttg
5220ccagcttact atccttcttg aaaatatgca ctctatatct tttagttctt aattgcaaca
5280catagatttg ctgtataacg aattttatgc tattttttaa atttggagtt cagtgataaa
5340agtgtcacag cgaatttcct cacatgtagg gaccgaattg tttacaagtt ctctgtacca
5400ccatggagac atcaaaaatt gaaaatctat ggaaagatat ggacggtagc aacaagaata
5460tagcacgagc cgcggagttc atttcgttac ttttgatatc actcacaact attgcgaagc
5520gcttcagtga aaaaatcata aggaaaagtt gtaaatatta ttggtagtat tcgtttggta
5580aagtagaggg ggtaattttt cccctttatt ttgttcatac attcttaaat tgctttgcct
5640ctccttttgg aaagctatac ttcggagcac tgttgagcga aggctcatta gatatatttt
5700ctgtcatttt ccttaaccca aaaataaggg aaagggtcca aaaagcgctc ggacaactgt
5760tgaccgtgat ccgaaggact ggctatacag tgttcacaaa atagccaagc tgaaaataat
5820gtgtagctat gttcagttag tttggctagc aaagatataa aagcaggtcg gaaatattta
5880tgggcattat tatgcagagc atcaacatga taaaaaaaaa cagttgaata ttccctcaaa
5940aatgtcttac accgtcggaa cctacttggc cgagaggttg gtccagatcg gattgaagca
6000ccacttcgcc gtcgccggtg actacaactt ggtcttgttg gacaacttgt tgttgaacaa
6060gaacatggag caggtctatt gctgcaacga gttgaactgc ggtttctcag cagaaggtta
6120tgcaagagcc aagggagcag ccgctgccgt cgtcacctac tcagtcggtg cattatcagc
6180attcgatgca attggaggtg cttacgctga gaacttgcca gtcatcttga tctctggagc
6240acctaacaac aacgaccatg ctgctggtca cgtattgcac cacgccttgg gtaaaacaga
6300ctaccactac cagttggaaa tggcaaaaaa tattaccgca gccgcagagg ccatctacac
6360cccagaggaa gcacctgcca aaattgacca cgtcataaag accgctttga gagagaagaa
6420gcctgtttac ttggagatcg cctgcaacat cgcttctatg ccatgcgccg cacctggtcc
6480agcctctgct ttgttcaacg acgaggcctc tgacgaagct tcattgaacg ccgcagtcga
6540agagacatta aagttcatcg ccaacaggga caaagttgcc gtcttagtcg gttcaaagtt
6600gagggccgct ggtgccgaag aggcagctgt caagttcgct gacgccttgg gaggagccgt
6660cgccaccatg gccgcagcaa aatctttctt tcctgaggag aacccacatt acatcggaac
6720ctcatggggt gaagtatcat atcctggagt agaaaaaacc atgaaagagg ccgatgccgt
6780aatagcattg gctcctgtct tcaacgacta ctcaaccaca ggatggactg atataccaga
6840tccaaagaaa ttagtcttgg ctgagcctag gtctgtcgtc gtaaacggta tcaggttccc
6900ttctgttcat ttgaaggact acttaacaag attggcccaa aaggtatcta aaaagactgg
6960tgccttggac ttcttcaagt cattaaacgc aggagaattg aaaaaagcag caccagccga
7020tccatcagcc ccattagtta acgctgaaat cgctagacaa gtagaggctt tgttgactcc
7080aaacactacc gtcatagctg agacaggtga ctcttggttc aacgcacaga gaatgaaatt
7140gccaaatggt gccagggtcg agtatgaaat gcagtgggga catataggtt ggtcagtccc
7200agccgccttt ggatacgcag taggtgcccc tgagaggagg aacatattga tggttggtga
7260tggttcattc caattaacag cccaggaggt agcccaaatg gtcaggttga agttgcctgt
7320catcatcttc ttgatcaaca attacggata caccatcgag gtcatgatcc acgacggacc
7380ttacaacaac atcaaaaact gggactacgc cggtttgatg gaggttttca acggtaacgg
7440tggttatgac tcaggagccg gtaagggatt aaaggctaag accggtggtg aattggctga
7500agcaattaag gtcgcattgg ccaacaccga tggacctaca ttgattgaat gcttcatcgg
7560aagggaggac tgcaccgagg aattggttaa atggggtaaa agggtagccg ctgctaattc
7620aagaaaacca gttaataaat tattataata agtgaattta ctttaaatct tgcatttaaa
7680taaattttct ttttatagct ttatgactta gtttcaattt atatactatt ttaatgacat
7740tttcgattca ttgattgaaa gctttgtgtt ttttcttgat gcgctattgc attgttcttg
7800tctttttcgc cacatgtaat atctgtagta gatacctgat acattgtgga tgctgagtga
7860aattttagtt aataatggag gcgctcttaa taattttggg gatattggct taacctgcag
7920gccgcgagcg ccgatataaa ctaatgattt taaatcgtta aaaaaatatg cgaattctgt
7980ggatcgaaca caggacctcc agataacttg accgaagttt tttcttcagt ctggcgctct
8040cccaactgag ctaaatccgc ttactatttg ttatcagttc ccttcatatc tacatagaat
8100aggttaagta ttttattagt tgccagaaga actactgata gttgggaata tttggtgaat
8160aatgaagatt gggtgaataa tttgataatt ttgagattca attgttaatc aatgttacaa
8220tattatgtat acagagtata ctagaagttc tcttcggaga tcttgaagtt cacaaaaggg
8280aatcgatatt tctacataat attatcatta cttcttcccc atcttatatt tgtcattcat
8340tattgattat gatcaatgca ataatgattg gtagttgcca aacatttaat acgatcctct
8400gtaatatttc tatgaataat tatcacagca acgttcaatt atcttcaatt ccggtgttta
8460aaccccagcg cctggcggg
84799810959DNAArtificial SequenceSynthetic, Integration construct i601
98gacggcacgg ccacgcgttt aaaccgccct ccaagctgac ataaatcgca ctttgtatct
60actttttttt attcgaaaac aaggcacaac aatgaatcta tcgccctgtg agattttcaa
120tctcaagttt gtgtaataga tagcgttata ttatagaact ataaaggtcc ttgaatatac
180atagtgtttc attcctatta ctgtatatgt gactttacat tgttacttcc gcggctattt
240gacgttttct gcttcaggtg cggcttggag ggcaaagtgt cagaaaatcg gccaggccgt
300atgacacaaa agagtagaaa acgagatctc aaatatctcg aggcctgtcc tctatacaac
360cgcccagctc tctgacaaag ctccagaacg gttgtctttt gtttcgaaaa gccaaggtcc
420cttataattg ccctccattt tgtgtcacct atttaagcaa aaaattgaaa gtttactaac
480ctttcattaa agagaaataa caatattata aaaagcgctt aaagctcaca cgcggccagg
540gggagccgtt catcatctca tggatctgca catgaacaaa caccagagtc aaacgacgtt
600gaaattgagg ctactgcgcc aattgatgac aatacagacg atgataacaa accgaagtta
660tctgatgtag aaaaggatta aagatgctaa gagatagtga tgatatttca taaataatgt
720aattctatat atgttaatta ccttttttgc gaggcatatt tatggtgaag gataagtttt
780gaccatcaaa gaaggttaat gtggctgtgg tttcagggtc cataaagctt ttcaattcat
840cttttttttt tttgttcttt tttttgattc cggtttcttt gaaatttttt tgattcggta
900atctccgagc agaaggaaga acgaaggaag gagcacagac ttagattggt atatatacgc
960atatgtggtg ttgaagaaac atgaaattgc ccagtattct taacccaact gcacagaaca
1020aaaacctgca ggaaacgaag ataaatcatg tcgaaagcta catataagga acgtgctgct
1080actcatccta gtcctgttgc tgccaagcta tttaatatca tgcacgaaaa gcaaacaaac
1140ttgtgtgctt cattggatgt tcgtaccacc aaggaattac tggagttagt tgaagcatta
1200ggtcccaaaa tttgtttact aaaaacacat gtggatatct tgactgattt ttccatggag
1260ggcacagtta agccgctaaa ggcattatcc gccaagtaca attttttact cttcgaagac
1320agaaaatttg ctgacattgg taatacagtc aaattgcagt actctgcggg tgtatacaga
1380atagcagaat gggcagacat tacgaatgca cacggtgtgg tgggcccagg tattgttagc
1440ggtttgaagc aggcggcaga agaagtaaca aaggaaccta gaggcctttt gatgttagca
1500gaattgtcat gcaagggctc cctatctact ggagaatata ctaagggtac tgttgacatt
1560gcgaagagtg acaaagattt tgttatcggc tttattgctc aaagagacat gggtggaaga
1620gatgaaggtt acgattggtt gattatgaca cccggtgtgg gtttagatga caagggagac
1680gcattgggtc aacagtatag aaccgtggat gatgtggtct ctacaggatc tgacattatt
1740attgttggaa gcgctcgtcc aacgccggcg gacctatggc gcaagttttc cgctttgtaa
1800tatatattta tacccctttc ttctctcccc tgcaatataa tagtttaatt ctaatattaa
1860taatatccta tattttcttc atttaccggc gcactctcgc ccgaacgacc tcaaaatgtc
1920tgctacattc ataataacca aaagctcata actttttttt ttgaacctga atatatatac
1980atcacatgtc actgctggtc cttgccgacc agcgtataca atctcgatag ttggtttccc
2040gttctttcca ctcccgtcat ggactacaac aagagatctt cggtctcaac cgtgcctaat
2100gcagctccca taagagtcgg attcgtcggt ctcaacgcag ccaaaggatg ggcaatcaag
2160acacattacc ccgccatact gcaactatcg tcacaatttc aaatcactgc cttatacagt
2220ccaaaaattg agacttctat tgccaccatc cagcgtctaa aattgagtaa tgccactgct
2280tttcccactt tagagtcatt tgcatcatct tccactatag atatgatagt gatagctatc
2340caagtggcca gtcattatga cgttgttatg cctctcttgg aattctccaa aaataatccg
2400aacctcaagt atcttttcgt agaatgggcc cttgcatgtt cactagatca agccgaatcc
2460atttataagg ctgctgctga acgtggggtt caaaccatca tctctttaca aggtcgtaaa
2520tcaccatata ttttgagagc aaaagaatta atatctcaag gctatatcgg cgacattaat
2580tctatcgaga ttgctggaaa tggcggttgg tacggctacg aaaggcctgt taaatcacca
2640aaatacatct atgaaatcgg gaacggtgta gatctggtaa ccacaacatt tggtcacaca
2700atcgatattt tacaatacat gacaagttcg tacttttcca ggataaatgc aatggttttc
2760aataatattc cagagcaaga gctgatagat gagcgtggta accgattggg ccagcgagtc
2820ccaaagacag taccggatca tcttttattc caaggcacat tgttaaatgg caatgttcca
2880gtgtcatgca gtttcaaagg tggcaaacct accaaaaaat ttaccaaaaa tttggtcatt
2940gatattcacg gtaccaaggg agatttgaaa cttgaaggcg atgccggatt cgcagaaatt
3000tcaaatctgg tcctttacta cagtggaact agagcaaacg acttcccgct agctaatgga
3060caacaagctc ctttagaccc ggggtatgat gcaggtaaag aaatcatgaa agtatatcat
3120ttacgaaatt ataatgccat tgtcggtaat attcatcgac tgtatcaatc tatctctgac
3180ttccacttca atacaaagaa aattcctgaa ttaccctcac aatttgtaat gcaaggtttc
3240gatttcgaag gctttcccac cttgatggat gctctgatat tacacaggtt aatcgagagc
3300gtttataaaa gtaacatgat gggctccaca ttaaacgtta gcaatatctc gcattatagt
3360ttataaaagc atcttgccct gtgcttggcc cccagtgcag cgaacgttat aaaaacgaat
3420actgagtata tatctatgta aaacaaccat atcatttctt gttctgaact ttgtttacct
3480aactagtttt aaatttccct ttttcgtgca tgcgggtgtt cttatttatt agcatactac
3540atttgaaata tcaaatttcc ttagtagaaa agtgagagaa ggtgcactga cacaaaaaat
3600aaaatccccg cgtgcttggc cggccgtctt cattggatgt tcgtaccacc aaggaattac
3660tggagttagt tgaagcatta ggtcccaaaa tttgtttact aaaaacacat gtggatatct
3720tgactgattt ttccatggag ggcacagtta agccgctaaa ggcattatcc gccaagtaca
3780attttttact cttcgaagac agaaaatttg ctgacattgg taatacagtc aaattgcagt
3840actctgcggg tgtatacaga atagcagaat gggcagacat tacgaatgca cacggtgtgg
3900tgggcccagg tattgttagc ggtttgaagc aggcggcaga agaagtaaca aaggaaccta
3960gaggcctttt gatgttagca gaattgtcat gcaagggctc cctatctact ggagaatata
4020ctaagggtac tgttgacatt gcgaagagtg acaaagattt tgttatcggc tttattgctc
4080aaagagacat gggtggaaga gatgaaggtt acgattggtt gattatgaca cccggtgtgg
4140gtttagatga caagggagac gcattgggtc aacagtatag aaccgtggat gatgtggtct
4200ctacaggatc tgacattatt attgttggaa gaggactatt tgcaaaggga agggatgcta
4260aggtagaggg tgaacgttac agaaaagcag gctgggaagc atatttgaga agatgcggcc
4320agcaaaacta aaaaactgta ttataagtaa atgcatgtat actaaactca caaattagag
4380cttcaattta attatatcag ttattacccg ggaatctcgg tcgtaatgat ttctataatg
4440acgaaaaaaa aaaaattgga aagaaaaagc ttcatggcct ttataaaaag gaactatcca
4500atacctcgcc agaaccaagt aacagtattt tacggggcac aaatcaagaa caataagaca
4560ggactgtaaa gatggacgca tcgctcgtcc aacgccggcg gacctgtttt caatagttcg
4620gtaatattaa cggataccta ctattatccc ctagtaggct cttttcacgg agaaattcgg
4680gagtgttttt tttccgtgcg cattttctta gctatattct tccagcttcg cctgctgccc
4740ggtcatcgtt cctgtcacgt agtttttccg gattcgtccg gctcatataa taccgcaata
4800aacacggaat atctcgttcc gcggattcgg ttaaactctc ggtcgcggat tatcacagag
4860aaagcttcgt ggagaatttt tccagatttt ccgctttccc cgatgttggt atttccggag
4920gtcattatac tgaccgccat tataatgact gtacaacgac cttctggaga aagaaacaac
4980tcaataacga tgtgggacat tgggggccca ctcaaaaaat ctggggacta tatccccaga
5040gaatttctcc agaagagaag aaaagtcaaa gttttttttc gcttgggggt tgcatataaa
5100tacaggcgct gttttatctt cagcatgaat attccataat tttacttaat agcttttcat
5160aaataataga atcacaaaca aaatttacat ctgagttaaa caatcatgac aatcaaggaa
5220cataaagtag tttatgaagc tcacaacgta aaggctctta aggctcctca acatttttac
5280aacagccaac ccggcaaggg ttacgttact gatatgcaac attatcaaga aatgtatcaa
5340caatctatca atgagccaga aaaattcttt gataagatgg ctaaggaata cttgcattgg
5400gatgctccat acaccaaagt tcaatctggt tcattgaaca atggtgatgt tgcatggttt
5460ttgaacggta aattgaatgc atcatacaat tgtgttgaca gacatgcctt tgctaatccc
5520gacaagccag ctttgatcta tgaagctgat gacgaatccg acaacaaaat catcacattt
5580ggtgaattac tcagaaaagt ttcccaaatc gctggtgtct taaaaagctg gggcgttaag
5640aaaggtgaca cagtggctat ctatttgcca atgattccag aagcggtcat tgctatgttg
5700gctgtggctc gtattggtgc tattcactct gttgtctttg ctgggttctc cgctggttcg
5760ttgaaagatc gtgtcgttga cgctaattct aaagtggtca tcacttgtga tgaaggtaaa
5820agaggtggta agaccatcaa cactaaaaaa attgttgacg aaggtttgaa cggagtcgat
5880ttggtttccc gtatcttggt tttccaaaga actggtactg aaggtattcc aatgaaggcc
5940ggtagagatt actggtggca tgaggaggcc gctaagcaga gaacttacct acctcctgtt
6000tcatgtgacg ctgaagatcc tctattttta ttatacactt ccggttccac tggttctcca
6060aagggtgtcg ttcacactac aggtggttat ttattaggtg ccgctttaac aactagatac
6120gtttttgata ttcacccaga agatgttctc ttcactgccg gtgacgtcgg ctggatcacg
6180ggtcacacct atgctctata tggtccatta accttgggta ccgcctcaat aattttcgaa
6240tccactcctg cctacccaga ttatggtaga tattggagaa ttatccaacg tcacaaggct
6300acccatttct atgtggctcc aactgcttta agattaatca aacgtgtagg tgaagccgaa
6360attgccaaat atgacacttc ctcattacgt gtcttgggtt ccgtcggtga accaatctct
6420ccagacttat gggaatggta tcatgaaaaa gtgggtaaca aaaactgtgt catttgtgac
6480actatgtggc aaacagagtc tggttctcat ttaattgctc ctttggcagg tgctgtccca
6540acaaaacctg gttctgctac cgtgccattc tttggtatta acgcttgtat cattgaccct
6600gttacaggtg tggaattaga aggtaatgat gtcgaaggtg tccttgccgt taaatcacca
6660tggccatcaa tggctagatc tgtttggaac caccacgacc gttacatgga tacttacttg
6720aaaccttatc ctggtcacta tttcacaggt gatggtgctg gtagagatca tgatggttac
6780tactggatca ggggtagagt tgacgacgtt gtaaatgttt ccggtcatag attatccaca
6840tcagaaattg aagcatctat ctcaaatcac gaaaacgtct cggaagctgc tgttgtcggt
6900attccagatg aattgaccgg tcaaaccgtc gttgcatatg tttccctaaa agatggttat
6960ctacaaaaca acgctactga aggtgatgca gaacacatca caccagataa tttacgtaga
7020gaattgatct tacaagttag gggtgagatt ggtcctttcg cctcaccaaa aaccattatt
7080ctagttagag atctaccaag aacaaggtca ggaaagatta tgagaagagt tctaagaaag
7140gttgcttcta acgaagccga acagctaggt gacctaacta ctttggccaa cccagaagtt
7200gtacctgcca tcatttctgc tgtagagaac caatttttct ctcaaaaaaa gaaataaatt
7260gaattgaatt gaaatcgata gatcaatttt tttcttttct ctttccccat cctttacgct
7320aaaataatag tttattttat tttttgaata ttttttattt atatacgtat atatagacta
7380ttatttatct tttaatgatt attaagattt ttattaaaaa aaaattcgct cctcttttaa
7440tgcctttatg cagttttttt ttcccattcg atatttctat gttcgggttc agcgtatttt
7500aagtttaata actcgaaaat tctgcgttcg ttaaagcttt cgagaaggat attatttcga
7560aataaaccgt gttgtgtaag cttgaagcct ttttgcgctg ccaatattct tatccatcta
7620ttgtactctt tagatccagt atagtgtatt cttcctgctc caagctcatc ccatccccgc
7680gtgcttggcc ggccgttttg ccagcttact atccttcttg aaaatatgca ctctatatct
7740tttagttctt aattgcaaca catagatttg ctgtataacg aattttatgc tattttttaa
7800atttggagtt cagtgataaa agtgtcacag cgaatttcct cacatgtagg gaccgaattg
7860tttacaagtt ctctgtacca ccatggagac atcaaaaatt gaaaatctat ggaaagatat
7920ggacggtagc aacaagaata tagcacgagc cgcggagttc atttcgttac ttttgatatc
7980actcacaact attgcgaagc gcttcagtga aaaaatcata aggaaaagtt gtaaatatta
8040ttggtagtat tcgtttggta aagtagaggg ggtaattttt cccctttatt ttgttcatac
8100attcttaaat tgctttgcct ctccttttgg aaagctatac ttcggagcac tgttgagcga
8160aggctcatta gatatatttt ctgtcatttt ccttaaccca aaaataaggg aaagggtcca
8220aaaagcgctc ggacaactgt tgaccgtgat ccgaaggact ggctatacag tgttcacaaa
8280atagccaagc tgaaaataat gtgtagctat gttcagttag tttggctagc aaagatataa
8340aagcaggtcg gaaatattta tgggcattat tatgcagagc atcaacatga taaaaaaaaa
8400cagttgaata ttccctcaaa aatgtcttac accgtcggaa cctacttggc cgagaggttg
8460gtccagatcg gattgaagca ccacttcgcc gtcgccggtg actacaactt ggtcttgttg
8520gacaacttgt tgttgaacaa gaacatggag caggtctatt gctgcaacga gttgaactgc
8580ggtttctcag cagaaggtta tgcaagagcc aagggagcag ccgctgccgt cgtcacctac
8640tcagtcggtg cattatcagc attcgatgca attggaggtg cttacgctga gaacttgcca
8700gtcatcttga tctctggagc acctaacaac aacgaccatg ctgctggtca cgtattgcac
8760cacgccttgg gtaaaacaga ctaccactac cagttggaaa tggcaaaaaa tattaccgca
8820gccgcagagg ccatctacac cccagaggaa gcacctgcca aaattgacca cgtcataaag
8880accgctttga gagagaagaa gcctgtttac ttggagatcg cctgcaacat cgcttctatg
8940ccatgcgccg cacctggtcc agcctctgct ttgttcaacg acgaggcctc tgacgaagct
9000tcattgaacg ccgcagtcga agagacatta aagttcatcg ccaacaggga caaagttgcc
9060gtcttagtcg gttcaaagtt gagggccgct ggtgccgaag aggcagctgt caagttcgct
9120gacgccttgg gaggagccgt cgccaccatg gccgcagcaa aatctttctt tcctgaggag
9180aacccacatt acatcggaac ctcatggggt gaagtatcat atcctggagt agaaaaaacc
9240atgaaagagg ccgatgccgt aatagcattg gctcctgtct tcaacgacta ctcaaccaca
9300ggatggactg atataccaga tccaaagaaa ttagtcttgg ctgagcctag gtctgtcgtc
9360gtaaacggta tcaggttccc ttctgttcat ttgaaggact acttaacaag attggcccaa
9420aaggtatcta aaaagactgg tgccttggac ttcttcaagt cattaaacgc aggagaattg
9480aaaaaagcag caccagccga tccatcagcc ccattagtta acgctgaaat cgctagacaa
9540gtagaggctt tgttgactcc aaacactacc gtcatagctg agacaggtga ctcttggttc
9600aacgcacaga gaatgaaatt gccaaatggt gccagggtcg agtatgaaat gcagtgggga
9660catataggtt ggtcagtccc agccgccttt ggatacgcag taggtgcccc tgagaggagg
9720aacatattga tggttggtga tggttcattc caattaacag cccaggaggt agcccaaatg
9780gtcaggttga agttgcctgt catcatcttc ttgatcaaca attacggata caccatcgag
9840gtcatgatcc acgacggacc ttacaacaac atcaaaaact gggactacgc cggtttgatg
9900gaggttttca acggtaacgg tggttatgac tcaggagccg gtaagggatt aaaggctaag
9960accggtggtg aattggctga agcaattaag gtcgcattgg ccaacaccga tggacctaca
10020ttgattgaat gcttcatcgg aagggaggac tgcaccgagg aattggttaa atggggtaaa
10080agggtagccg ctgctaattc aagaaaacca gttaataaat tattataata agtgaattta
10140ctttaaatct tgcatttaaa taaattttct ttttatagct ttatgactta gtttcaattt
10200atatactatt ttaatgacat tttcgattca ttgattgaaa gctttgtgtt ttttcttgat
10260gcgctattgc attgttcttg tctttttcgc cacatgtaat atctgtagta gatacctgat
10320acattgtgga tgctgagtga aattttagtt aataatggag gcgctcttaa taattttggg
10380gatattggct taacctgcag gccgcgagcg ccgatataaa ctaatgattt taaatcgtta
10440aaaaaatatg cgaattctgt ggatcgaaca caggacctcc agataacttg accgaagttt
10500tttcttcagt ctggcgctct cccaactgag ctaaatccgc ttactatttg ttatcagttc
10560ccttcatatc tacatagaat aggttaagta ttttattagt tgccagaaga actactgata
10620gttgggaata tttggtgaat aatgaagatt gggtgaataa tttgataatt ttgagattca
10680attgttaatc aatgttacaa tattatgtat acagagtata ctagaagttc tcttcggaga
10740tcttgaagtt cacaaaaggg aatcgatatt tctacataat attatcatta cttcttcccc
10800atcttatatt tgtcattcat tattgattat gatcaatgca ataatgattg gtagttgcca
10860aacatttaat acgatcctct gtaatatttc tatgaataat tatcacagca acgttcaatt
10920atcttcaatt ccggtgttta aaccccagcg cctggcggg
10959997329DNAArtificial SequenceSynthetic, Integration construct i2125
99taattttaca agtagtgtct tcatgacgga ttcatagtct atccaagcgt ttgcccaaaa
60ttttgcagta aatttaatgt tttctgtata ggataatggt gcgccattca agtcccgcga
120aaaatgactg atgtctacag gacaggggcg caatatatgt tctctgacat tgcacctttt
180gaatatatca tgtgtttgtt ctgctatctg cttgtagaag ggtacgctaa cagagccggc
240ggcattgtaa aaagttctcc tttcgcggaa ggatgagtca aaaagcatgt gacaatgaaa
300taatcaaatt gtgacatctg ctgacgcggg atcgttcctt cgtattgtct agattgtaat
360ctatataaca tactacgaat ataaaagagg gactacaaga tatttctagc gcaaactact
420gctttactgt ctcacaatgt ctctgattgg aagataccta agaaaattat ttaactacat
480atctacaaaa tcaaagcatc taggataatt atactctatt tctcaacaag taattggttg
540tttggccgag cggtctaagg cgcctgattc aagaaatatc ttgaccgcag ttaactgtgg
600gaatactcag gtatcgtaag atgcaagagt tcgaatctct tagcaaccat tatttttttc
660ctcaacataa cgagaacaca caggggcgct atcgcacaga atcaaattcg atgactggaa
720attttttgtt aatttcagag gtcgcctgac gcatatacct ttttcaactg aaaaattggg
780agaaaaagga aaggtgagag cgccggaacc ggcttttcat atagaataga gaagcgttca
840tgactaaatg cttgcatcac aatacttgaa gttgacaata ttatttaagg acctattgtt
900ttttccaata ggtggttagc aatcgtctta ctttctaact tttcttacct tttacatttc
960agcaatatat atatatatat ttcaaggata taccattcta atgtctgccc ctaagaagat
1020cgtcgttttg ccaggtgacc acgttggtca agaaatcaca gccgaagcca ttaaggttct
1080taaagctatt tctgatgttc gttccaatgt caagttcgat ttcgaaaatc atttaattgg
1140tggtgctgct atcgatgcta caggtgttcc acttccagat gaggcgctgg aagcctccaa
1200gaaggctgat gccgttttgt taggtgctgt gggtggtcct aaatggggta ccggtagtgt
1260tagacctgaa caaggtttac taaaaatccg taaagaactt caattgtacg ccaacttaag
1320accatgtaac tttgcatccg actctctttt agacttatct ccaatcaagc cacaatttgc
1380taaaggtact gacttcgttg ttgtcagaga attagtggga ggtatttact ttggtaagag
1440aaaggaagac gatggtgatg gtgtcgcttg ggatagtgaa caatacaccg ttccagaagt
1500gcaaagaatc acaagaatgg ccgctttcat ggccctacaa catgagccac cattgcctat
1560ttggtccttg gataaagcta atgttttggc ctcttcaaga ttatggagaa aaactgtgga
1620ggaaaccatc aagaacgaat tccctacatt gaaggttcaa catcaattga ttgattctgc
1680cgccatgatc ctagttaaga acccaaccca cctaaatggt attataatca ccagcaacat
1740gtttggtgat atcatctccg atgaagcctc cgttatccca ggttccttgg gtttgttgcc
1800atctgcgtcc ttggcctctt tgccagacaa gaacaccgca tttggtttgt acgaaccatg
1860ccacggttct gctccagatt tgccaaagaa taaggtcaac cctatcgcca ctatcttgtc
1920tgctgcaatg atgttgaaat tgtcattgaa cttgcctgaa gaaggtaagg ccattgaaga
1980tgcagttaaa aaggttttgg atgcaggtat cagaactggt gatttaggtg gttccaacag
2040taccaccgaa gtcggtgatg ctgtcgccga agaagttaag aaaatccttg cttaaaaaga
2100ttctcttttt ttatgatatt tgtacataaa ctttataaat gaaattcata atagaaacga
2160cacgaaatta caaaatggaa tatgttcata gggtagacga aactatatac gcaatctaca
2220tacatttatc aagaaggaga aaaaggagga tgtaaaggaa tacaggtaag caaattgata
2280ctaatggctc aacgtgataa ggaaaaagaa ttgcacttta acattaatat tgacaaggag
2340gagggcttcg agcgtcccaa aaccttctca agcaaggttt tcagtataat gttacatgcg
2400tacacgcgtc tgtacagaaa aaaaagaaaa atttgaaata taaataacgt tcttaatact
2460aacataacta taaaaaaata aatagggacc tagacttcag gttgtctaac tccttccttt
2520tcggttagag cggatcttag ctagctcaaa cgaccatcgg gtggacgaag aatgacttca
2580tgtaagactt catatctcct tctgcatgtg taaatccgtc gtttacacta tagagaacct
2640cacacattct agccaaattg atggcaggca taagcaaagg aaacggaacg gcagttggac
2700gcaacgactc tcggttgata actttccatg catcctcaac cttacggcta atgtactcgc
2760aggcctcttc ttcactggcc ccagattctt tcgaatagca ttcgatagaa cttgcaacat
2820gccctcgttc ttgttcttct ttatgagaca cgatatcatc catcagacgg ataataacac
2880acgacgcttt tacgataggc gggtacgaag acacccactt aaacgtatct tcattgacga
2940tgtccccacg accaacgtaa ctccgagcgg tcataagccc gtaagtcccc gtaaccatgc
3000taacgctcat gtactcctct aaagtaggca tgtagccttc ctttaaccat ctagcttcaa
3060ctagataatt tcttaccagt tctttggcca tttccttaac gtagtggatt tgataagttt
3120taccttcttt ctcaagactc tcctccattt caacgtgaag gttgacaagc tcttgataga
3180tcaatttcat gtattctggt agcatgtcga gacatgatat tgaccacctc tcgacagctt
3240gcgtgaaaat ctccaactcc tcgtatgttc cgtagttatc aaatgtatca tccaggacta
3300ccagccacat acacgacttc ataagaaaca tacgagtacg tgcatgctga ggttcataat
3360aaatactcaa aatccaaaaa tatccctcga cgactctgtc acgaacaaac ggtagtttgt
3420tctgcaaatc gaggtccttc caccacttac aaatatgcga caattccttt ttgtgcatag
3480attggagcac agaaaaatcc agcttcgcta gcttcaataa aacttcatca tgactagtct
3540cctgttgata gattggcata tagtgaagag cttctattcg agccagtctg cgtctgagtg
3600gctgctttaa tgcctgatga atctgtgtac gtagagatga atcacagctt ggatctttag
3660caattatatc gagatgaacc ttactgaact ccaaggcgtt atctaagata gtttcatcct
3720caaccctcat aaacgccgcc tcatagagag ctaaaatacc ttgagcatca ttacagaggc
3780tttctttaaa ctttcccttt tcgtccataa aatctttaaa cactccactc gaaacgttga
3840atccctgttg tctaagtaat cgaaaccata gcgagattga ctgaagattt tctttatcga
3900cccactgctc tccgtaagta acgtgaatat gttgcaaagc ttcctcaatt tcctcctcaa
3960aatggtaagc aattccaaga cgctgcacgg catcgatcag ctcgatgagt ttaacatgtt
4020gcataggctc atttgatcct ttgattgtaa taagttcttt cttaacctct tccttcagtt
4080cctctacgag ttgcttcttc ataaccaaat cctcgggttc atcgtatgtt aaaaactggt
4140caccccaaat agacgcgttg aaatttgtgg tatgtctgat tacgtccggt ttagtagaat
4200ccttgtcatc gactaccaat ggggaggtac tagaagatga ggaaacagaa gaaataggta
4260aagtagacat ttatattgaa ttttcaaaaa ttcttacttt ttttttggat ggacgcaaag
4320aagtttaata atcatattac atggcaatac caccatatac atatccatat ctaatcttac
4380ttatatgttg tggaaatgta aagagcccca ttatcttagc ctaaaaaaac cttctctttg
4440gaactttcag taatacgctt aactgctcat tgctatattg aagtacggat tagaagccgc
4500cgagcgggcg acagccctcc gacggaagac tctcctccgt gcgtcctggt cttcaccggt
4560cgcgttcctg aaacgcagat gtgcctcgcg ccgcactgct ccgaacaata aagattctac
4620aatactagct tttatggtta tgaagaggaa aaattggcag taacctggcc ccacaaacct
4680tcaaatcaac gaatcaaatt aacaaccata ggataataat gcgattagtt ttttagcctt
4740atttctgggg taattaatca gcgaagcgat gatttttgat ctattaacag atatataaat
4800gcaaaagctg cataaccact ttaactaata ctttcaacat tttcggtttg tattacttct
4860tattcaaatg tcataaaagt atcaacaaaa aattgttaat atacctctat actttaacgt
4920caaggagaaa aaactataat gtcaaccttg cctatttctt ctgtctcatc ttcttcatct
4980acctctccat tggtcgtaga cgataaggac tctactaaac cagacgtcat caggcacacc
5040acgaatttca acgcttctat atggggagac cagtttttaa cttacgacga acctgaggat
5100ttggtcatga aaaaacagtt ggtcgaagaa ttgaaggagg aggtcaagaa ggagttgatt
5160acaatcaagg gatcaaacga acctatgcag cacgttaagt tgatcgaatt aatagatgct
5220gtccaaagat tgggtatagc ctaccacttc gaggaggaaa tcgaggaggc tttacaacat
5280atacacgtca catacggtga acagtgggtc gataaagaga atttgcagtc tatctcattg
5340tggttcaggt tgttaaggca acaaggtttt aatgtttcat ctggagtttt caaggacttt
5400atggacgaga aaggtaaatt caaggagtct ttgtgcaacg atgctcaggg tattttagca
5460ttgtatgagg ccgcatttat gagggttgaa gacgagacta tcttagataa cgcattggag
5520ttctccaagg tccacttaga cattattgct aaagacccat catgtgactc ttctttgaga
5580actcaaatac accaggcatt aaagcaacct ttgaggagaa ggttggctag aatcgaagca
5640ttacactata tgccaatata tcagcaggaa acctcacacg acgaagtttt gttaaagtta
5700gcaaaattgg acttctctgt cttgcagtca atgcataaga aggagttgtc tcatatctgc
5760aagtggtgga aggatttaga tttacaaaat aagttgccat tcgtcagaga tagggttgta
5820gagggatact tctggatctt gtctatatac tatgagcctc agcacgccag aaccagaatg
5880ttcttaatga agtcctgcat gtggttagta gtattagacg acaccttcga caattatgga
5940acatacgagg aattggagat ctttactcaa gccgttgaga gatggtctat ttcttgcttg
6000gacatgttgc cagagtatat gaagttgatc taccaggagt tagttaactt gcacgtcgaa
6060atggaggaat ctttggagaa agagggaaag acataccaga ttcactatgt caaggaaatg
6120gccaaagagt tggtaaggaa ctatttggtt gaggccagat ggttgaaaga gggttatatg
6180cctaccttgg aggagtacat gtcagtctca atggttactg gtacctatgg tttgatgact
6240gccagatcat acgtcggaag aggtgatatc gtaaatgagg ataccttcaa gtgggtttct
6300tcataccctc ctatcgttaa ggcctcttgc gtcataatta ggttgatgga tgacattgtt
6360tctcataagg aggaacagga gaggggtcac gtagcctcat caatagagtg ctattcaaaa
6420gagtctggtg catcagagga agaggcatgt gaatacatct ctagaaaagt agaggatgcc
6480tggaaggtca ttaacaggga gtcattgaga cctactgctg taccttttcc tttgttgatg
6540cctgctatca acttggcaag gatgtgcgaa gttttgtatt cagtaaacga tggtttcact
6600cacgccgaag gtgatatgaa atcatatatg aaatcttttt tcgtacatcc tatggtagta
6660taagcgaatt tcttatgatt tatgattttt attattaaat aagttataaa aaaaataagt
6720gtatacaaat tttaaagtga ctcttaggtt ttaaaacgaa aattcttatt cttgagtaac
6780tctttcctgt aggtcaggtt gctttctcag gtatagcatg aggtcgctct cttttgtaac
6840gaatttgatg aatatatttt tactttttat ataagctatt ttgtagatat tgacttttta
6900cgatttattt gtaacaatga gaattactcc atttctgaac ttcagtaaat agcgagtgat
6960tctgtacttt gcgagaaccg gtggacattt ggtattttgc cttacaagaa caacctatac
7020aaacgtttca atatctaatt ctttgtaatc cattgtttta cgagacatat aatgtgatat
7080atagatgaac tttacgtata aaatgatata tttaaaacta gcaactgcgt gcgtaagaca
7140aactgaaata ggccatttac ggaaaagaaa tttaataatg tcgactggaa actgaaacca
7200ggaggagtag aaattggtta aattgattag ctaaaattta ctcgttgtgg acagagtttg
7260agccaagcgg aatgttttca aggctttctt tgtttcgaag ggcagctctg gctcctgccc
7320ctatgagaa
73291004016DNAArtificial SequenceSynthetic, Integration construct i2608
100tggaacacgg agtaaaatat tgtgtgtatg ggcacaaacc cttggaaata gcttagcatt
60tgccgttggc ctgatgatct gaccattccc tttagtagag aaagaaagtc gcttcaagct
120aacccagttt tctttttttt ttatcactta tcagtcctat tcggagatac aggcaacaag
180tgatagaggg cccattatga atacgcacct ctatgtattt ccgagatacg attactccag
240ttcctcttac aagaaatgca taaaaatagt tacaattaat tagaacaaga acttatttag
300aacacgttca cactgagtaa gaactcttgt cccttattag ccttgatagt gctgaaaaaa
360agaaaaaaaa caaaaaaaag aaataaaata acggcaaaca gcaaaggcca cagatctgta
420ttcatgctac ttctgcaata tcaatcactt actggcaagt gcgtataaat taaacctatg
480acggcacggc cacgcgttta aaccgccttc tttatcatca tatttactta tatctttaac
540agattccaaa ccctaaagtg tccgaatttt caatagggcg aacttgaaga ataaccaagg
600tcaataatat atcttttagt ataaccctga aatttgccct ataaaaatct agggtttctg
660tgtggtttcc gggtgagtca tacggctttt ttgaatttct ttttttgcag ttgtctctat
720caatgaaaat ttcgaggaag acgataaggt taagataagt agataagaga atgatacgag
780ataaagcaca aattagcaga aagaagagtg gttgcgaaca gagtaaaccg aatcagggaa
840tccctttttg caaaaacatc aattatcctt ttcttttttt tacgtatata tctggaacag
900aaatatataa gttactatta tacttatagt tggatccagt ttttaatctg tcgtcaatcg
960aaagtttatt tcagagttct tcagacttct taactcctgt aaaaacaaaa aaaaaaaaag
1020gcatagcagc tcacacgcgg ccagggggag ccaccatata catatccata tctaatctta
1080cttatatgtt gtggaaatgt aaagagcccc attatcttag cctaaaaaaa ccttctcttt
1140ggaactttca gtaatacgct taactgctca ttgctatatt gaagtacgga ttagaagccg
1200ccgagcgggc gacagccctc cgacggaaga ctctcctccg tgcgtcctgg tcttcaccgg
1260tcgcgttcct gaaacgcaga tgtgcctcgc gccgcactgc tccgaacaat aaagattcta
1320caatactagc ttttatggtt atgaagagga aaaattggca gtaacctggc cccacaaacc
1380ttcaaatcaa cgaatcaaat taacaaccat aggataataa tgcgattagt tttttagcct
1440tatttctggg gtaattaatc agcgaagcga tgatttttga tctattaaca gatatataaa
1500tgcaaaagct gcataaccac tttaactaat actttcaaca ttttcggttt gtattacttc
1560ttattcaaat gtcataaaag tatcaacaaa aaattgttaa tatacctcta tactttaacg
1620tcaaggagaa aaaactataa tggaaaactt tccaaccgag tacttcttga acaccaccgt
1680caggttgttg gagtacatta ggtacaggga ctcaaactat accagggagg agaggattga
1740gaacttacac tacgcctaca acaaagccgc ccaccacttc gcccagccaa gacagcagca
1800gttgttgaag gtcgacccta agagattgca agcttcattg cagaccattg tcggtatggt
1860tgtatattca tgggccaagg tatctaaaga gtgtatggca gacttgtcaa tccactatac
1920ctacaccttg gtattggacg attcaaaaga cgacccatac cctactatgg taaactactt
1980cgatgactta caagcaggta gagaacaggc tcatccttgg tgggctttag taaacgagca
2040ctttccaaac gtattgaggc attttggtcc tttttgctca ttgaacttga tcaggtctac
2100cttagacttc ttcgagggtt gctggataga acaatacaat tttggaggat tcccaggttc
2160tcacgactac ccacagttct tgagaagaat gaacggttta ggacactgcg tcggtgcctc
2220tttgtggcca aaggagcagt tcaatgaaag atcattgttt ttggagatca cttcagccat
2280agctcaaatg gaaaattgga tggtctgggt taatgatttg atgtcatttt acaaggagtt
2340cgacgacgag agggatcaga tctctttggt aaagaactac gttgtttctg acgagatatc
2400attacacgag gccttagaaa aattgaccca ggataccttg cactcttcaa agcaaatggt
2460tgcagttttc tcagacaagg accctcaagt aatggacacc atagagtgct tcatgcatgg
2520ttatgtcaca tggcatttat gcgacaggag gtacaggttg tctgaaatct acgagaaagt
2580caaggaggaa aagactgagg atgcccaaaa attttgcaag ttctacgagc aagctgccaa
2640tgtaggagcc gtttcacctt ctgagtgggc ctatccacca gtcgcccagt tagctaacgt
2700aagatcaaag gacgtcaaag aggtccagaa accattttta tcatctatag aattagttga
2760ataagctagc taagatccgc tctaaccgaa aaggaaggag ttagacaacc tgaagtctag
2820gtccctattt atttttttat agttatgtta gtattaagaa cgttatttat atttcaaatt
2880tttctttttt ttctgtacag acgcgtgtac gcatgtaaca ttatactgaa aaccttgctt
2940gagaaggttt tgggacgctc gaagaacctg caggccgcga gcgccgatat atgacgtttt
3000attacctttg atcacatttc cacgccattt cgcattctca ccctcataag tcatacaccg
3060aaaagaaagt ttaagggatc aatgagctta ctataatctc agtatattta tttttatcga
3120tgattcacca caacaatctt gctcccgaaa agaaagcaga cggagtagaa gcatttgaaa
3180ctccttcaga ccttcaagta tatatatata tatatatata tgtatatgtg tacattttca
3240cgctaatact aatgtataat tagaagataa tttttactca tttttcgtta tcttcacgtc
3300acccgaacct agaaccaaat gtcattttca cgatatgtaa atagtgaaat aggcaaaaac
3360gccaaaaagt agtaagcgca acatacaccg gtgtttaaac cccagcgcct ggcgggtaaa
3420ccattaaaga atatctcgac cagaatctaa cagatataca tgttccgata atgtctgagt
3480taggtgagta ttctaaatta gaaaacaaag agcttagaac ggagtttgaa ttgacaaatt
3540ttccttttcc aggcacaact gataacgact ccgatgacgg aagccaaggg cagaactctt
3600tgaatatcat tactcctgac atggatgata ctctggttaa tgatgtactt cgagaaaacg
3660ataaaaagtc tagtatgaga atggctttta tgaatctagc aaactctatt cttggtgccg
3720gaataattac tcagccgttc gcgatcaaaa atgctggtat attaggcggg ctattatcat
3780acgtagccct cggatttata gttgattgga cgttaagact tattgtcatt aacttgactc
3840ttgctggcaa gagaacatac cagggtacgg tcgaacatgt aatgggtaaa aaagggaaat
3900tgctgattct atttacaaac gggttatttg catttggtgg atgtattggt tattgcataa
3960ttattgggga tacgataccc cacgtactca gagctatatt cagccagaac gatggt
401610111880DNAArtificial SequenceSynthetic, Integration construct i2127
101gacggcacgg ccacgcgttt aaaccgcctc atagtctatc caagcgtttg cccaaaattt
60tgcagtaaat ttaatgtttt ctgtatagga taatggtgcg ccattcaagt cccgcgaaaa
120atgactgatg tctacaggac aggggcgcaa tatatgttct ctgacattgc accttttgaa
180tatatcatgt gtttgttctg ctatctgctt gtagaagggt acgctaacag agccggcggc
240attgtaaaaa gttctccttt cgcggaagga tgagtcaaaa agcatgtgac aatgaaataa
300tcaaattgtg acatctgctg acgcgggatc gttccttcgt attgtctaga ttgtaatcta
360tataacatac tacgaatata aaagagggac tacaagatat ttctagcgca aactactgct
420ttactgtctc acaatgtctc tgattggaag atacctaaga aaattattta actacatatc
480tacaaaatca aagcatccgc tcgtccaacg ccggcggacc tgagcgacct catgctatac
540ctgagaaagc aacctgacct acaggaaaga gttactcaag aataagaatt ttcgttttaa
600aacctaagag tcactttaaa atttgtatac acttattttt tttataactt atttaataat
660aaaaatcata aatcataaga aattcgctta gactaccata gggtgaacaa agaatgactt
720catgtatgat ttcatgtcac cctcggcgtg ggtgaaaccg tcattaactg aatataagac
780ttcgcacatt cttgctaagt ttatggcagg cattaataat gggaaaggga ctgcggttgg
840cctcaatgac tctctgttga taactttcca tgcatcttcg acttttctag agatgtactc
900acaggcttct tcttcagatg ctcctgattc ttttgaataa cactcgatag atgatgctac
960atgtcccctc tcttgttcct ctttgtgaga tacaatatca tccatcaacc ttataataac
1020gcatgaggcc tttacgatag gtggataaga tgatacccac ttgaatgtgt cttcgtttac
1080aatgtctcct ctaccgacat aagatctagc agtcattaat ccgtaggttc cagtgaccat
1140agaaacagac atatattcct ccaaggtagg catgtaaccc tccttcaacc atctagcttc
1200taccaagtag tttcttacca actcttttgc catctccttg acatagtgga tctgataagt
1260tttaccctct ttctccaaag attcttccat ctcgacgtgt aagttgacta actcctggta
1320gatcaacttc atatactctg gtaacatgtc caagcatgaa attgaccatc tctctacagc
1380ttgagtgaag atctctaatt cctcgtaggt accgtaattg tcaaaagtgt cgtctaaaac
1440gaccaaccac atgcaagact tcattaagaa cattcttgtt ctagcgtgct gaggctcgta
1500gtagatagac aatatccaga aatatccctc aacgactctg tctctaacaa aaggcaactt
1560attctgcaaa tccaaatcct tccaccattt gcagatatga gacaattcct ttttatgcat
1620tgactgcaat acagagaagt ccaatttggc caacttcaac aaaacttcat catgtgatgt
1680ttcctgctga tagataggca tatagtgcaa ggcttctatc cttgctaacc ttctcctcaa
1740aggttgcttc aatgcttgat gtatttgtgt tcttaaagaa gagtcgcatg aaggatcctt
1800tgcgatgatg tctaagtgga ctttagagaa ttccaatgcg ttgtctaata tagtctcgtc
1860ctctaccctc ataaaggcag cttcatataa tgccaaaatt ccttgagcat cgttgcataa
1920tgactcctta aactttccct tttcgtccat gaaatcttta aagacacctg aagagacgtt
1980gaatccctgt tgccttaaca acctaaacca taaagagatt gattgcaagt tctccttgtc
2040aacccattgt tctccataag taacatgaat atgctgcaat gcctcttcaa tctcctcttc
2100gaaatgatat gcaattccta acctttgaac agcgtcaatt aactctatca acttgacgtg
2160ttgcataggc tcgtttgaac cttttatggt gatcaactcc ttcttaacct cctcctttaa
2220ctcctcgacc aactgttttt tcatgactaa atcctctggt tcgtcatagg tcaagaactg
2280gtctccccat atagaggcgt tgaagttcgt tgtatgcctt atgacgtctg gctttgtaga
2340atctttgtcg tctacaacca atggtgaggt agaagatgag gatgagactg aagatatagg
2400caatgttgac attgtaaagt tagttggttg cgcgacttcg ggtggggtaa gtatagaggt
2460atattaacaa ttttttgttg atacttttat gacatttgaa taagaagtaa tacaaaccga
2520aaatgttgaa agtattagtt aaagtggtta tgcagctttt gcatttatat atctgttaat
2580agatcaaaaa tcatcgcttc gctgattaat taccccagaa ataaggctaa aaaactaatc
2640gcattattat cctatggttg ttaatttgat tcgttgattt gaaggtttgt ggggccaggt
2700tactgccaat ttttcctctt cataaccata aaagctagta ttgtagaatc tttattgttc
2760ggagcagtgc ggcgcgaggc acatctgcgt ttcaggaacg cgaccggtga agaccaggac
2820gcacggagga gagtcttccg tcggagggct gtcgcccgct cggcggcttc taatccgtac
2880ttcaatatag caatgagcag ttaagcgtat tactgaaagt tccaaagaga aggttttttt
2940aggctaagat aatggggctc tttacatttc cacaacatat aagtaagatt agatatggat
3000atgtatatgg tggtattgcc atgtaatatg attattaaac ttctttgcgt ccatccaaaa
3060aaaaagtaac gcacgcacac tcccgacaga caactagctt gataatgtca actttgccta
3120tttcttctgt gtcatcttcc tcttctacat caccattagt cgtggacgac aaagattcaa
3180ccaagcccga cgttatcaga catacaacga atttcaatgc ttctatttgg ggagatcaat
3240tcttgaccta tgatgagcct gaagatttag ttatgaagaa acaattagtg gaggaattaa
3300aagaggaagt taagaaggaa ttgataacta tcaaaggttc aaatgagccc atgcagcatg
3360tgaaattgat tgaattaatt gatgctgttc aacgtttagg tatagcttac cattttgaag
3420aagagatcga ggaagctttg caacatatgc atgttaccta tggtgaacag tgggtggata
3480aggaaaattt acagagtatt tcattgtggt tcaggttgtt gcgtcaacag ggctttaacg
3540tctcctctgg cgttttcaaa gactttatgg acgaaaaagg taaattcaaa gagtctttat
3600gcaatgatgc acaaggaata ttagccttat atgaagctgc atttatgagg gttgaagatg
3660aaaccatctt agacaatgct ttggaattct caaaagttca tttagatatc atagcaaaag
3720acccatcttg cgattcttca ttgcgtacac aaatccatca agccttaaaa caacctttaa
3780gaaggagatt agcaaggatt gaagcattac attacatgcc aatctaccaa caggaaacat
3840ctcatgatga agtattgttg aaattagcca agttggattt cagtgttttg cagtctatgc
3900ataaaaagga attgtcacat atctgtaagt ggtggaaaga tttagattta caaaataagt
3960taccttttgt acgtgatcgt gttgtcgaag gctacttctg gatattgtcc atatactatg
4020agccacaaca cgctagaaca agaatgtttt tgatgaaatc atgcatgtgg ttagtagttt
4080tggacgatac ttttgataat tatggaacat acgaagaatt ggagattttt actcaagccg
4140tcgagagatg gtctatctca tgcttagata tgttgcccga atatatgaaa ttaatctacc
4200aagaattagt caatttgcat gtggaaatgg aagaatcttt ggaaaaggag ggaaagacct
4260atcagattca ttacgttaag gagatggcta aagaattagt tcgtaattac ttagtagaag
4320caagatggtt gaaggaaggt tatatgccta ctttagaaga atacatgtct gtttctatgg
4380ttactggtac ttatggtttg atgactgcaa ggtcctatgt tggcagagga gacattgtta
4440atgaagacac attcaaatgg gtttctagtt acccacctat tgttaaagct tcctgtgtaa
4500taattagatt aatggacgat attgtatctc acaaggaaga acaagaaaga ggacatgtgg
4560cttcatctat agaatgttac tctaaagaat caggtgcttc tgaagaggaa gcatgtgaat
4620atattagtag gaaagttgag gatgcctgga aagtaatcaa tagagaatct ttgcgtccaa
4680cagccgttcc cttccctttg ttaatgccag caataaactt agctagaatg tgtgaggtct
4740tgtactctgt taatgatggt tttactcatg ctgagggtga catgaaatct tatatgaagt
4800ccttcttcgt tcatcctatg gtcgtttgag ctagctaaga tccgctctaa ccgaaaagga
4860aggagttaga caacctgaag tctaggtccc tatttatttt tttatagtta tgttagtatt
4920aagaacgtta tttatatttc aaatttttct tttttttctg tacagacgcg tgtacgcatg
4980taacattata ctgaaaacct tgcttgagaa ggttttggga cgctcgaaga acctgcaggc
5040cgcgagcgcc gatggtctaa ggcgcctgat tcaagaaata tcttgaccgc agttaactgt
5100gggaatactc aggtatcgta agatgcaaga gttcgaatct cttagcaacc attatttttt
5160tcctcaacat aacgagaaca cacaggggcg ctatcgcaca gaatcaaatt cgatgactgg
5220aaattttttg ttaatttcag aggtcgcctg acgcatatac ctttttcaac tgaaaaattg
5280ggagaaaaag gaaaggtgag agcgccggaa ccggcttttc atatagaata gagaagcgtt
5340catgactaaa tgcttgcatc acaatacttg aagttgacaa tattatttaa ggacctattg
5400ttttttccaa taggtggtta gcaatcgtct tactttctaa cttttcttac cttttacatt
5460tcagcaatat atatatatat atttcaagga tataccattc taatgtctgc ccctaagaag
5520atcgtcgttt tgccaggtga ccacgttggt caagaaatca cagccgaagc cattaaggtt
5580cttaaagcta tttctgatgt tcgttccaat gtcaagttcg atttcgaaaa tcatttaatt
5640ggtggtgctg ctatcgatgc tacaggtgtt ccacttccag atgaggcgct ggaagcctcc
5700aagaaggctg atgccgtttt gttaggtgct gtgggtggtc ctaaatgggg tactggtagt
5760gttagacctg aacaaggttt actaaaaatc cgtaaagaac ttcaattgta cgccaactta
5820agaccatgta actttgcatc cgactctctt ttagacttat ctccaatcaa gccacaattt
5880gctaaaggta ctgacttcgt tgttgtcaga gaattagtgg gaggtattta ctttggtaag
5940agaaaggaag acgatggtga tggtgtcgct tgggatagtg aacaatacac cgttccagaa
6000gtgcaaagaa tcacaagaat ggccgctttc atggccctac aacatgagcc accattgcct
6060atttggtcct tggataaagc taatgttttg gcctcttcaa gattatggag aaaaactgtg
6120gaggaaacca tcaagaacga attccctaca ttgaaggttc aacatcaatt gattgattct
6180gccgccatga tcctagttaa gaacccaacc cacctaaatg gtattataat caccagcaac
6240atgtttggtg atatcatctc cgatgaagcc tccgttatcc caggttcctt gggtttgttg
6300ccatctgcgt ccttggcctc tttgccagac aagaacaccg catttggttt gtacgaacca
6360tgccacggtt ctgctccaga tttgccaaag aataaggtca accctatcgc cactatcttg
6420tctgctgcaa tgatgttgaa attgtcattg aacttgcctg aagaaggtaa ggccattgaa
6480gatgcagtta aaaaggtttt ggatgcaggt atcagaactg gtgatttagg tggttccaac
6540agtaccaccg aagtcggtga tgctgtcgcc gaagaagtta agaaaatcct tgcttaaaaa
6600gattctcttt ttttatgata tttgtacata aactttataa atgaaattca taatagaaac
6660gacacgaaat tacaaaatgg aatatgttca tagggtagac gaaactatat acgcaatcta
6720catacattta tcaagaagga gaaaaaggag gatgtaaagg aatacaggta agcaaattga
6780tactaatggc tcaacgtgat cggcgctcgc ggcctgcagg ttcttcgagc gtcccaaaac
6840cttctcaagc aaggttttca gtataatgtt acatgcgtac acgcgtctgt acagaaaaaa
6900aagaaaaatt tgaaatataa ataacgttct taatactaac ataactataa aaaaataaat
6960agggacctag acttcaggtt gtctaactcc ttccttttcg gttagagcgg atcttagcta
7020gctcaaacga ccatcgggtg gacgaagaat gacttcatgt aagacttcat atctccttct
7080gcatgtgtaa atccgtcgtt tacactatag agaacctcac acattctagc caaattgatg
7140gcaggcataa gcaaaggaaa cggaacggca gttggacgca acgactctcg gttgataact
7200ttccatgcat cctcaacctt acggctaatg tactcgcagg cctcttcttc actggcccca
7260gattctttcg aatagcattc gatagaactt gcaacatgcc ctcgttcttg ttcttcttta
7320tgagacacga tatcatccat cagacggata ataacacacg acgcttttac gataggcggg
7380tacgaagaca cccacttaaa cgtatcttca ttgacgatgt ccccacgacc aacgtaactc
7440cgagcggtca taagcccgta agtccccgta accatgctaa cgctcatgta ctcctctaaa
7500gtaggcatgt agccttcctt taaccatcta gcttcaacta gataatttct taccagttct
7560ttggccattt ccttaacgta gtggatttga taagttttac cttctttctc aagactctcc
7620tccatttcaa cgtgaaggtt gacaagctct tgatagatca atttcatgta ttctggtagc
7680atgtcgagac atgatattga ccacctctcg acagcttgcg tgaaaatctc caactcctcg
7740tatgttccgt agttatcaaa tgtatcatcc aggactacca gccacataca cgacttcata
7800agaaacatac gagtacgtgc atgctgaggt tcataataaa tactcaaaat ccaaaaatat
7860ccctcgacga ctctgtcacg aacaaacggt agtttgttct gcaaatcgag gtccttccac
7920cacttacaaa tatgcgacaa ttcctttttg tgcatagatt ggagcacaga aaaatccagc
7980ttcgctagct tcaataaaac ttcatcatga ctagtctcct gttgatagat tggcatatag
8040tgaagagctt ctattcgagc cagtctgcgt ctgagtggct gctttaatgc ctgatgaatc
8100tgtgtacgta gagatgaatc acagcttgga tctttagcaa ttatatcgag atgaacctta
8160ctgaactcca aggcgttatc taagatagtt tcatcctcaa ccctcataaa cgccgcctca
8220tagagagcta aaataccttg agcatcatta cagaggcttt ctttaaactt tcccttttcg
8280tccataaaat ctttaaacac tccactcgaa acgttgaatc cctgttgtct aagtaatcga
8340aaccatagcg agattgactg aagattttct ttatcgaccc actgctctcc gtaagtaacg
8400tgaatatgtt gcaaagcttc ctcaatttcc tcctcaaaat ggtaagcaat tccaagacgc
8460tgcacggcat cgatcagctc gatgagttta acatgttgca taggctcatt tgatcctttg
8520attgtaataa gttctttctt aacctcttcc ttcagttcct ctacgagttg cttcttcata
8580accaaatcct cgggttcatc gtatgttaaa aactggtcac cccaaataga cgcgttgaaa
8640tttgtggtat gtctgattac gtccggttta gtagaatcct tgtcatcgac taccaatggg
8700gaggtactag aagatgagga aacagaagaa ataggtaaag tagacattat caagctagtt
8760gtctgtcggg agtgtgcgtg cgttactttt tttttggatg gacgcaaaga agtttaataa
8820tcatattaca tggcaatacc accatataca tatccatatc taatcttact tatatgttgt
8880ggaaatgtaa agagccccat tatcttagcc taaaaaaacc ttctctttgg aactttcagt
8940aatacgctta actgctcatt gctatattga agtacggatt agaagccgcc gagcgggcga
9000cagccctccg acggaagact ctcctccgtg cgtcctggtc ttcaccggtc gcgttcctga
9060aacgcagatg tgcctcgcgc cgcactgctc cgaacaataa agattctaca atactagctt
9120ttatggttat gaagaggaaa aattggcagt aacctggccc cacaaacctt caaatcaacg
9180aatcaaatta acaaccatag gataataatg cgattagttt tttagcctta tttctggggt
9240aattaatcag cgaagcgatg atttttgatc tattaacaga tatataaatg caaaagctgc
9300ataaccactt taactaatac tttcaacatt ttcggtttgt attacttctt attcaaatgt
9360cataaaagta tcaacaaaaa attgttaata tacctctata cttaccccac ccgaagtcgc
9420gcaaccaact aactttacaa tgtcaacctt gcctatttct tctgtctcat cttcttcatc
9480tacctctcca ttggtcgtag acgataagga ctctactaaa ccagacgtca tcaggcacac
9540cacgaatttc aacgcttcta tatggggaga ccagttttta acttacgacg aacctgagga
9600tttggtcatg aaaaaacagt tggtcgaaga attgaaggag gaggtcaaga aggagttgat
9660tacaatcaag ggatcaaacg aacctatgca gcacgttaag ttgatcgaat taatagatgc
9720tgtccaaaga ttgggtatag cctaccactt cgaggaggaa atcgaggagg ctttacaaca
9780tatacacgtc acatacggtg aacagtgggt cgataaagag aatttgcagt ctatctcatt
9840gtggttcagg ttgttaaggc aacaaggttt taatgtttca tctggagttt tcaaggactt
9900tatggacgag aaaggtaaat tcaaggagtc tttgtgcaac gatgctcagg gtattttagc
9960attgtatgag gccgcattta tgagggttga agacgagact atcttagata acgcattgga
10020gttctccaag gtccacttag acattattgc taaagaccca tcatgtgact cttctttgag
10080aactcaaata caccaggcat taaagcaacc tttgaggaga aggttggcta gaatcgaagc
10140attacactat atgccaatat atcagcagga aacctcacac gacgaagttt tgttaaagtt
10200agcaaaattg gacttctctg tcttgcagtc aatgcataag aaggagttgt ctcatatctg
10260caagtggtgg aaggatttag atttacaaaa taagttgcca ttcgtcagag atagggttgt
10320agagggatac ttctggatct tgtctatata ctatgagcct cagcacgcca gaaccagaat
10380gttcttaatg aagtcctgca tgtggttagt agtattagac gacaccttcg acaattatgg
10440aacatacgag gaattggaga tctttactca agccgttgag agatggtcta tttcttgctt
10500ggacatgttg ccagagtata tgaagttgat ctaccaggag ttagttaact tgcacgtcga
10560aatggaggaa tctttggaga aagagggaaa gacataccag attcactatg tcaaggaaat
10620ggccaaagag ttggtaagga actatttggt tgaggccaga tggttgaaag agggttatat
10680gcctaccttg gaggagtaca tgtcagtctc aatggttact ggtacctatg gtttgatgac
10740tgccagatca tacgtcggaa gaggtgatat cgtaaatgag gataccttca agtgggtttc
10800ttcataccct cctatcgtta aggcctcttg cgtcataatt aggttgatgg atgacattgt
10860ttctcataag gaggaacagg agaggggtca cgtagcctca tcaatagagt gctattcaaa
10920agagtctggt gcatcagagg aagaggcatg tgaatacatc tctagaaaag tagaggatgc
10980ctggaaggtc attaacaggg agtcattgag acctactgct gtaccttttc ctttgttgat
11040gcctgctatc aacttggcaa ggatgtgcga agttttgtat tcagtaaacg atggtttcac
11100tcacgccgaa ggtgatatga aatcatatat gaaatctttt ttcgtacatc ctatggtagt
11160ataagcgaat ttcttatgat ttatgatttt tattattaaa taagttataa aaaaaataag
11220tgtatacaaa ttttaaagtg actcttaggt tttaaaacga aaattcttat tcttgagtaa
11280ctctttcctg taggtcaggt tgctttctca ggtatagcat gaggtcgctc aggtccgccg
11340gcgttggacg agcgtctttt gtaacgaatt tgatgaatat atttttactt tttatataag
11400ctattttgta gatattgact ttttacgatt tatttgtaac aatgagaatt actccatttc
11460tgaacttcag taaatagcga gtgattctgt actttgcgag aaccggtgga catttggtat
11520tttgccttac aagaacaacc tatacaaacg tttcaatatc taattctttg taatccattg
11580ttttacgaga catataatgt gatatataga tgaactttac gtataaaatg atatatttaa
11640aactagcaac tgcgtgcgta agacaaactg aaataggcca tttacggaaa agaaatttaa
11700taatgtcgac tggaaactga aaccaggagg agtagaaatt ggttaaattg attagctaaa
11760atttactcgt tgtggacaga gtttgagcca agcggaatgt tttcaaggct ttctttgttt
11820cgaagggcag ctctggctcc tgcccctatg agggcggttt aaacgcgtgg ccgtgccgtc
118801026896DNAArtificial SequenceSynthetic, Integration construct i569
102gacggcacgg ccacgcgttt aaaccgccct ccaagctgac ataaatcgca ctttgtatct
60actttttttt attcgaaaac aaggcacaac aatgaatcta tcgccctgtg agattttcaa
120tctcaagttt gtgtaataga tagcgttata ttatagaact ataaaggtcc ttgaatatac
180atagtgtttc attcctatta ctgtatatgt gactttacat tgttacttcc gcggctattt
240gacgttttct gcttcaggtg cggcttggag ggcaaagtgt cagaaaatcg gccaggccgt
300atgacacaaa agagtagaaa acgagatctc aaatatctcg aggcctgtcc tctatacaac
360cgcccagctc tctgacaaag ctccagaacg gttgtctttt gtttcgaaaa gccaaggtcc
420cttataattg ccctccattt tgtgtcacct atttaagcaa aaaattgaaa gtttactaac
480ctttcattaa agagaaataa caatattata aaaagcgccg ctcgtccaac gccggcggac
540ctgttttcaa tagttcggta atattaacgg atacctacta ttatccccta gtaggctctt
600ttcacggaga aattcgggag tgtttttttt ccgtgcgcat tttcttagct atattcttcc
660agcttcgcct gctgcccggt catcgttcct gtcacgtagt ttttccggat tcgtccggct
720catataatac cgcaataaac acggaatatc tcgttccgcg gattcggtta aactctcggt
780cgcggattat cacagagaaa gcttcgtgga gaatttttcc agattttccg ctttccccga
840tgttggtatt tccggaggtc attatactga ccgccattat aatgactgta caacgacctt
900ctggagaaag aaacaactca ataacgatgt gggacattgg gggcccactc aaaaaatctg
960gggactatat ccccagagaa tttctccaga agagaagaaa agtcaaagtt ttttttcgct
1020tgggggttgc atataaatac aggcgctgtt ttatcttcag catgaatatt ccataatttt
1080acttaatagc ttttcataaa taatagaatc acaaacaaaa tttacatctg agttaaacaa
1140tcatgacaat caaggaacat aaagtagttt atgaagctca caacgtaaag gctcttaagg
1200ctcctcaaca tttttacaac agccaacccg gcaagggtta cgttactgat atgcaacatt
1260atcaagaaat gtatcaacaa tctatcaatg agccagaaaa attctttgat aagatggcta
1320aggaatactt gcattgggat gctccataca ccaaagttca atctggttca ttgaacaatg
1380gtgatgttgc atggtttttg aacggtaaat tgaatgcatc atacaattgt gttgacagac
1440atgcctttgc taatcccgac aagccagctt tgatctatga agctgatgac gaatccgaca
1500acaaaatcat cacatttggt gaattactca gaaaagtttc ccaaatcgct ggtgtcttaa
1560aaagctgggg cgttaagaaa ggtgacacag tggctatcta tttgccaatg attccagaag
1620cggtcattgc tatgttggct gtggctcgta ttggtgctat tcactctgtt gtctttgctg
1680ggttctccgc tggttcgttg aaagatcgtg tcgttgacgc taattctaaa gtggtcatca
1740cttgtgatga aggtaaaaga ggtggtaaga ccatcaacac taaaaaaatt gttgacgaag
1800gtttgaacgg agtcgatttg gtttcccgta tcttggtttt ccaaagaact ggtactgaag
1860gtattccaat gaaggccggt agagattact ggtggcatga ggaggccgct aagcagagaa
1920cttacctacc tcctgtttca tgtgacgctg aagatcctct atttttatta tacacttccg
1980gttccactgg ttctccaaag ggtgtcgttc acactacagg tggttattta ttaggtgccg
2040ctttaacaac tagatacgtt tttgatattc acccagaaga tgttctcttc actgccggtg
2100acgtcggctg gatcacgggt cacacctatg ctctatatgg tccattaacc ttgggtaccg
2160cctcaataat tttcgaatcc actcctgcct acccagatta tggtagatat tggagaatta
2220tccaacgtca caaggctacc catttctatg tggctccaac tgctttaaga ttaatcaaac
2280gtgtaggtga agccgaaatt gccaaatatg acacttcctc attacgtgtc ttgggttccg
2340tcggtgaacc aatctctcca gacttatggg aatggtatca tgaaaaagtg ggtaacaaaa
2400actgtgtcat ttgtgacact atgtggcaaa cagagtctgg ttctcattta attgctcctt
2460tggcaggtgc tgtcccaaca aaacctggtt ctgctaccgt gccattcttt ggtattaacg
2520cttgtatcat tgaccctgtt acaggtgtgg aattagaagg taatgatgtc gaaggtgtcc
2580ttgccgttaa atcaccatgg ccatcaatgg ctagatctgt ttggaaccac cacgaccgtt
2640acatggatac ttacttgaaa ccttatcctg gtcactattt cacaggtgat ggtgctggta
2700gagatcatga tggttactac tggatcaggg gtagagttga cgacgttgta aatgtttccg
2760gtcatagatt atccacatca gaaattgaag catctatctc aaatcacgaa aacgtctcgg
2820aagctgctgt tgtcggtatt ccagatgaat tgaccggtca aaccgtcgtt gcatatgttt
2880ccctaaaaga tggttatcta caaaacaacg ctactgaagg tgatgcagaa cacatcacac
2940cagataattt acgtagagaa ttgatcttac aagttagggg tgagattggt cctttcgcct
3000caccaaaaac cattattcta gttagagatc taccaagaac aaggtcagga aagattatga
3060gaagagttct aagaaaggtt gcttctaacg aagccgaaca gctaggtgac ctaactactt
3120tggccaaccc agaagttgta cctgccatca tttctgctgt agagaaccaa tttttctctc
3180aaaaaaagaa ataaattgaa ttgaattgaa atcgatagat caattttttt cttttctctt
3240tccccatcct ttacgctaaa ataatagttt attttatttt ttgaatattt tttatttata
3300tacgtatata tagactatta tttatctttt aatgattatt aagattttta ttaaaaaaaa
3360attcgctcct cttttaatgc ctttatgcag tttttttttc ccattcgata tttctatgtt
3420cgggttcagc gtattttaag tttaataact cgaaaattct gcgttcgtta aagctttcga
3480gaaggatatt atttcgaaat aaaccgtgtt gtgtaagctt gaagcctttt tgcgctgcca
3540atattcttat ccatctattg tactctttag atccagtata gtgtattctt cctgctccaa
3600gctcatccca tccccgcgtg cttggccggc cgttttgcca gcttactatc cttcttgaaa
3660atatgcactc tatatctttt agttcttaat tgcaacacat agatttgctg tataacgaat
3720tttatgctat tttttaaatt tggagttcag tgataaaagt gtcacagcga atttcctcac
3780atgtagggac cgaattgttt acaagttctc tgtaccacca tggagacatc aaaaattgaa
3840aatctatgga aagatatgga cggtagcaac aagaatatag cacgagccgc ggagttcatt
3900tcgttacttt tgatatcact cacaactatt gcgaagcgct tcagtgaaaa aatcataagg
3960aaaagttgta aatattattg gtagtattcg tttggtaaag tagagggggt aatttttccc
4020ctttattttg ttcatacatt cttaaattgc tttgcctctc cttttggaaa gctatacttc
4080ggagcactgt tgagcgaagg ctcattagat atattttctg tcattttcct taacccaaaa
4140ataagggaaa gggtccaaaa agcgctcgga caactgttga ccgtgatccg aaggactggc
4200tatacagtgt tcacaaaata gccaagctga aaataatgtg tagctatgtt cagttagttt
4260ggctagcaaa gatataaaag caggtcggaa atatttatgg gcattattat gcagagcatc
4320aacatgataa aaaaaaacag ttgaatattc cctcaaaaat gtcttacacc gtcggaacct
4380acttggccga gaggttggtc cagatcggat tgaagcacca cttcgccgtc gccggtgact
4440acaacttggt cttgttggac aacttgttgt tgaacaagaa catggagcag gtctattgct
4500gcaacgagtt gaactgcggt ttctcagcag aaggttatgc aagagccaag ggagcagccg
4560ctgccgtcgt cacctactca gtcggtgcat tatcagcatt cgatgcaatt ggaggtgctt
4620acgctgagaa cttgccagtc atcttgatct ctggagcacc taacaacaac gaccatgctg
4680ctggtcacgt attgcaccac gccttgggta aaacagacta ccactaccag ttggaaatgg
4740caaaaaatat taccgcagcc gcagaggcca tctacacccc agaggaagca cctgccaaaa
4800ttgaccacgt cataaagacc gctttgagag agaagaagcc tgtttacttg gagatcgcct
4860gcaacatcgc ttctatgcca tgcgccgcac ctggtccagc ctctgctttg ttcaacgacg
4920aggcctctga cgaagcttca ttgaacgccg cagtcgaaga gacattaaag ttcatcgcca
4980acagggacaa agttgccgtc ttagtcggtt caaagttgag ggccgctggt gccgaagagg
5040cagctgtcaa gttcgctgac gccttgggag gagccgtcgc caccatggcc gcagcaaaat
5100ctttctttcc tgaggagaac ccacattaca tcggaacctc atggggtgaa gtatcatatc
5160ctggagtaga aaaaaccatg aaagaggccg atgccgtaat agcattggct cctgtcttca
5220acgactactc aaccacagga tggactgata taccagatcc aaagaaatta gtcttggctg
5280agcctaggtc tgtcgtcgta aacggtatca ggttcccttc tgttcatttg aaggactact
5340taacaagatt ggcccaaaag gtatctaaaa agactggtgc cttggacttc ttcaagtcat
5400taaacgcagg agaattgaaa aaagcagcac cagccgatcc atcagcccca ttagttaacg
5460ctgaaatcgc tagacaagta gaggctttgt tgactccaaa cactaccgtc atagctgaga
5520caggtgactc ttggttcaac gcacagagaa tgaaattgcc aaatggtgcc agggtcgagt
5580atgaaatgca gtggggacat ataggttggt cagtcccagc cgcctttgga tacgcagtag
5640gtgcccctga gaggaggaac atattgatgg ttggtgatgg ttcattccaa ttaacagccc
5700aggaggtagc ccaaatggtc aggttgaagt tgcctgtcat catcttcttg atcaacaatt
5760acggatacac catcgaggtc atgatccacg acggacctta caacaacatc aaaaactggg
5820actacgccgg tttgatggag gttttcaacg gtaacggtgg ttatgactca ggagccggta
5880agggattaaa ggctaagacc ggtggtgaat tggctgaagc aattaaggtc gcattggcca
5940acaccgatgg acctacattg attgaatgct tcatcggaag ggaggactgc accgaggaat
6000tggttaaatg gggtaaaagg gtagccgctg ctaattcaag aaaaccagtt aataaattat
6060tataataagt gaatttactt taaatcttgc atttaaataa attttctttt tatagcttta
6120tgacttagtt tcaatttata tactatttta atgacatttt cgattcattg attgaaagct
6180ttgtgttttt tcttgatgcg ctattgcatt gttcttgtct ttttcgccac atgtaatatc
6240tgtagtagat acctgataca ttgtggatgc tgagtgaaat tttagttaat aatggaggcg
6300ctcttaataa ttttggggat attggcttaa cctgcaggcc gcgagcgccg atataaacta
6360atgattttaa atcgttaaaa aaatatgcga attctgtgga tcgaacacag gacctccaga
6420taacttgacc gaagtttttt cttcagtctg gcgctctccc aactgagcta aatccgctta
6480ctatttgtta tcagttccct tcatatctac atagaatagg ttaagtattt tattagttgc
6540cagaagaact actgatagtt gggaatattt ggtgaataat gaagattggg tgaataattt
6600gataattttg agattcaatt gttaatcaat gttacaatat tatgtataca gagtatacta
6660gaagttctct tcggagatct tgaagttcac aaaagggaat cgatatttct acataatatt
6720atcattactt cttccccatc ttatatttgt cattcattat tgattatgat caatgcaata
6780atgattggta gttgccaaac atttaatacg atcctctgta atatttctat gaataattat
6840cacagcaacg ttcaattatc ttcaattccg gtgtttaaac cccagcgcct ggcggg
68961037038DNAArtificial SequenceSynthetic, Integration construct i2124
103aagaaggacg tgagaaaact ttaacatctg cttggtaagg gcctcattta attctggatt
60attgtacccg tgaataacac accaccacga cgacatggcg tcgatcacct cgacgtccac
120tggtgagtcg gtatccaaca ccagcttgca tccgtgagca ctctttaccg gataaacgtt
180caatggtgaa ctcaatgacg tataaggatg ccaaatatgt tttttatcaa agtctagcag
240ttccgcgaca tctggtgtat atgaaatttc ttgagacatt agttgttatc ctagcaatag
300aaaacgaatt gcgctgttga catcctcccg accaaaagaa aatgaaatat acaaacaatg
360gctatttata attcaaaatt attgggcaaa acaaaataaa atcccgctgg tagttcgttt
420actgaagtat ataaagagat atactttttt ccacaagtag gccagtgaaa agaactcaaa
480aaatcactag cgcacaggtc gttcatcatc tcatggatct gcacatgaac aaacaccaga
540gtcaaacgac gttgaaattg aggctactgc gccaattgat gacaatacag acgatgataa
600caaaccgaag ttatctgatg tagaaaagga ttaaagatgc taagagatag tgatgatatt
660tcataaataa tgtaattcta tatatgttaa ttaccttttt tgcgaggcat atttatggtg
720aaggataagt tttgaccatc aaagaaggtt aatgtggctg tggtttcagg gtccataaag
780cttttcaatt catctttttt ttttttgttc ttttttttga ttccggtttc tttgaaattt
840ttttgattcg gtaatctccg agcagaagga agaacgaagg aaggagcaca gacttagatt
900ggtatatata cgcatatgtg gtgttgaaga aacatgaaat tgcccagtat tcttaaccca
960actgcacaga acaaaaacct gcaggaaacg aagataaatc atgtcgaaag ctacatataa
1020ggaacgtgct gctactcatc ctagtcctgt tgctgccaag ctatttaata tcatgcacga
1080aaagcaaaca aacttgtgtg cttcattgga tgttcgtacc accaaggaat tactggagtt
1140agttgaagca ttaggtccca aaatttgttt actaaaaaca catgtggata tcttgactga
1200tttttccatg gagggcacag ttaagccgct aaaggcatta tccgccaagt acaatttttt
1260actcttcgaa gacagaaaat ttgctgacat tggtaataca gtcaaattgc agtactctgc
1320gggtgtatac agaatagcag aatgggcaga cattacgaat gcacacggtg tggtgggccc
1380aggtattgtt agcggtttga agcaggcggc agaagaagta acaaaggaac ctagaggcct
1440tttgatgtta gcagaattgt catgcaaggg ctccctatct actggagaat atactaaggg
1500tactgttgac attgcgaaga gcgacaaaga ttttgttatc ggctttattg ctcaaagaga
1560catgggtgga agagatgaag gttacgattg gttgattatg acacccggtg tgggtttaga
1620tgacaaggga gacgcattgg gtcaacagta tagaaccgtg gatgatgtgg tctctacagg
1680atctgacatt attattgttg gaagaggact atttgcaaag ggaagggatg ctaaggtaga
1740gggtgaacgt tacagaaaag caggctggga agcatatttg agaagatgcg gccagcaaaa
1800ctaaaaaact gtattataag taaatgcatg tatactaaac tcacaaatta gagcttcaat
1860ttaattatat cagttattac ccgggaatct cggtcgtaat gatttctata atgacgaaaa
1920aaaaaaaatt ggaaagaaaa agcttcatgg cctttataaa aaggaactat ccaatacctc
1980gccagaacca agtaacagta ttttacgggg cacaaatcaa gaacaataag acaggactgt
2040aaagatggac gcatgagcga cctcatgcta tacctgagaa agcaacctga cctacaggaa
2100agagttactc aagaataaga attttcgttt taaaacctaa gagtcacttt aaaatttgta
2160tacacttatt ttttttataa cttatttaat aataaaaatc ataaatcata agaaattcgc
2220ttagactacc atagggtgaa caaagaatga cttcatgtat gatttcatgt caccctcggc
2280gtgggtgaaa ccgtcattaa ctgaatataa gacttcgcac attcttgcta agtttatggc
2340aggcattaat aatgggaaag ggactgcggt tggcctcaat gactctctgt tgataacttt
2400ccatgcatct tcgacttttc tagagatgta ctcacaggct tcttcttcag atgctcctga
2460ttcttttgaa taacactcga tagatgatgc tacatgtccc ctctcttgtt cctctttgtg
2520agatacaata tcatccatca accttataat aacgcatgag gcctttacga taggtggata
2580agatgatacc cacttgaatg tgtcttcgtt tacaatgtct cctctaccga cataagatct
2640agcagtcatt aatccgtagg ttccagtgac catagaaaca gacatatatt cctccaaggt
2700aggcatgtaa ccctccttca accatctagc ttctaccaag tagtttctta ccaactcttt
2760tgccatctcc ttgacatagt ggatctgata agttttaccc tctttctcca aagattcttc
2820catctcgacg tgtaagttga ctaactcctg gtagatcaac ttcatatact ctggtaacat
2880gtccaagcat gaaattgacc atctctctac agcttgagtg aagatctcta attcctcgta
2940ggtaccgtaa ttgtcaaaag tgtcgtctaa aacgaccaac cacatgcaag acttcattaa
3000gaacattctt gttctagcgt gctgaggctc gtagtagata gacaatatcc agaaatatcc
3060ctcaacgact ctgtctctaa caaaaggcaa cttattctgc aaatccaaat ccttccacca
3120tttgcagata tgagacaatt cctttttatg cattgactgc aatacagaga agtccaattt
3180ggccaacttc aacaaaactt catcatgtga tgtttcctgc tgatagatag gcatatagtg
3240caaggcttct atccttgcta accttctcct caaaggttgc ttcaatgctt gatgtatttg
3300tgttcttaaa gaagagtcgc atgaaggatc ctttgcgatg atgtctaagt ggactttaga
3360gaattccaat gcgttgtcta atatagtctc gtcctctacc ctcataaagg cagcttcata
3420taatgccaaa attccttgag catcgttgca taatgactcc ttaaactttc ccttttcgtc
3480catgaaatct ttaaagacac ctgaagagac gttgaatccc tgttgcctta acaacctaaa
3540ccataaagag attgattgca agttctcctt gtcaacccat tgttctccat aagtaacatg
3600aatatgctgc aatgcctctt caatctcctc ttcgaaatga tatgcaattc ctaacctttg
3660aacagcgtca attaactcta tcaacttgac gtgttgcata ggctcgtttg aaccttttat
3720ggtgatcaac tccttcttaa cctcctcctt taactcctcg accaactgtt ttttcatgac
3780taaatcctct ggttcgtcat aggtcaagaa ctggtctccc catatagagg cgttgaagtt
3840cgttgtatgc cttatgacgt ctggctttgt agaatctttg tcgtctacaa ccaatggtga
3900ggtagaagat gaggatgaga ctgaagatat aggcaatgtt gacatttata ttgaattttc
3960aaaaattctt actttttttt tggatggacg caaagaagtt taataatcat attacatggc
4020aataccacca tatacatatc catatctaat cttacttata tgttgtggaa atgtaaagag
4080ccccattatc ttagcctaaa aaaaccttct ctttggaact ttcagtaata cgcttaactg
4140ctcattgcta tattgaagta cggattagaa gccgccgagc gggcgacagc cctccgacgg
4200aagactctcc tccgtgcgtc ctggtcttca ccggtcgcgt tcctgaaacg cagatgtgcc
4260tcgcgccgca ctgctccgaa caataaagat tctacaatac tagcttttat ggttatgaag
4320aggaaaaatt ggcagtaacc tggccccaca aaccttcaaa tcaacgaatc aaattaacaa
4380ccataggata ataatgcgat tagtttttta gccttatttc tggggtaatt aatcagcgaa
4440gcgatgattt ttgatctatt aacagatata taaatgcaaa agctgcataa ccactttaac
4500taatactttc aacattttcg gtttgtatta cttcttattc aaatgtcata aaagtatcaa
4560caaaaaattg ttaatatacc tctatacttt aacgtcaagg agaaaaaact ataatgtcaa
4620ctttgcctat ttcttctgtg tcatcttcct cttctacatc accattagtc gtggacgaca
4680aagattcaac caagcccgac gttatcagac atacaacgaa tttcaatgct tctatttggg
4740gagatcaatt cttgacctat gatgagcctg aagatttagt tatgaagaaa caattagtgg
4800aggaattaaa agaggaagtt aagaaggaat tgataactat caaaggttca aatgagccca
4860tgcagcatgt gaaattgatt gaattaattg atgctgttca acgtttaggt atagcttacc
4920attttgaaga agagatcgag gaagctttgc aacatatgca tgttacctat ggtgaacagt
4980gggtggataa ggaaaattta cagagtattt cattgtggtt caggttgttg cgtcaacagg
5040gctttaacgt ctcctctggc gttttcaaag actttatgga cgaaaaaggt aaattcaaag
5100agtctttatg caatgatgca caaggaatat tagccttata tgaagctgca tttatgaggg
5160ttgaagatga aaccatctta gacaatgctt tggaattctc aaaagttcat ttagatatca
5220tagcaaaaga cccatcttgc gattcttcat tgcgtacaca aatccatcaa gccttaaaac
5280aacctttaag aaggagatta gcaaggattg aagcattaca ttacatgcca atctaccaac
5340aggaaacatc tcatgatgaa gtattgttga aattagccaa gttggatttc agtgttttgc
5400agtctatgca taaaaaggaa ttgtcacata tctgtaagtg gtggaaagat ttagatttac
5460aaaataagtt accttttgta cgtgatcgtg ttgtcgaagg ctacttctgg atattgtcca
5520tatactatga gccacaacac gctagaacaa gaatgttttt gatgaaatca tgcatgtggt
5580tagtagtttt ggacgatact tttgataatt atggaacata cgaagaattg gagattttta
5640ctcaagccgt cgagagatgg tctatctcat gcttagatat gttgcccgaa tatatgaaat
5700taatctacca agaattagtc aatttgcatg tggaaatgga agaatctttg gaaaaggagg
5760gaaagaccta tcagattcat tacgttaagg agatggctaa agaattagtt cgtaattact
5820tagtagaagc aagatggttg aaggaaggtt atatgcctac tttagaagaa tacatgtctg
5880tttctatggt tactggtact tatggtttga tgactgcaag gtcctatgtt ggcagaggag
5940acattgttaa tgaagacaca ttcaaatggg tttctagtta cccacctatt gttaaagctt
6000cctgtgtaat aattagatta atggacgata ttgtatctca caaggaagaa caagaaagag
6060gacatgtggc ttcatctata gaatgttact ctaaagaatc aggtgcttct gaagaggaag
6120catgtgaata tattagtagg aaagttgagg atgcctggaa agtaatcaat agagaatctt
6180tgcgtccaac agccgttccc ttccctttgt taatgccagc aataaactta gctagaatgt
6240gtgaggtctt gtactctgtt aatgatggtt ttactcatgc tgagggtgac atgaaatctt
6300atatgaagtc cttcttcgtt catcctatgg tcgtttgagc tagctaagat ccgctctaac
6360cgaaaaggaa ggagttagac aacctgaagt ctaggtccct atttattttt ttatagttat
6420gttagtatta agaacgttat ttatatttca aatttttctt ttttttctgt acagacgcgt
6480gtacgcatgt aacattatac tgaaaacctt gcttgagaag gttttgggac gctcgaagtt
6540taaataaaaa agttgcaagg ctttcatcag ctatatataa gtagcatggt atgaacagag
6600taggggcagt gttcctattt gtatatgaaa gaaatttttt tttgtctatt gttccagatc
6660gtcacaggac ggaaataaga atgtctagtt cagaaaggtc agaagtcaag tttgacaagc
6720actttaattg gtggtcccta ttaggtatcg cgttctcatt aagttgctca tgggtcggta
6780tctcagcgtc gatggccgtt ggtattgcca gtggagggcc actgcttatc atctatgggt
6840tgataattgc tgcttttttc agtctcatgt gtggtatatc tctgggagat tttgctgcta
6900tcctgccaaa cagcagcggt ggttcatttt gggttcttaa aatgttggaa caagaatcag
6960tcactttgaa aacccctgag tacgaggacc cttctgacga tgatgaagaa gtgttcctcg
7020agaattattg tcaaactt
70381044376DNAArtificial SequenceSynthetic, Integration construct i65
104gtttaaaccc tggaaattcg gtgtccttct cattatctat cagcatgtac tcggcggtaa
60aaacatcctt tgaaggattt tgaatgatgg gtcccaaaaa tctttttctg tggaaagaac
120cgatactact atgattcgca ttaacgccgt tattaacggt taactgatag tctttgttgc
180ataaactaaa cttacccttc gaaatacgat tagcatacct gccgatcgtg gcgcctatat
240aagcactatc aggattcaaa tacccttcct cattttcata gccaagaaca actgattgtc
300cgttcacttt caggtcaaca atgctggcgc ccaaattggc aaacgtggct tgaaatctgg
360tgccggcacc aatagtcaca aatcttgcgt cataacgcat atcttcagcg gaaaatctgg
420cctcgacacc ccttaactgg taaccaaaag gattctcagt agtccatttc cataaatcct
480tgcaggagtc ttcaacctgc aactcggtct gccatttcag ttcgcgtttg gccctatctg
540gtttagccgt caagttcaaa acatcacctg ctcttctgcc cgtaactttg tatggaagat
600caataccaga agctttgcag aatgcatgat aaacttcaaa aactgtagaa cctttaccgg
660aacccaagtt ccactcacga cacaaacctt cattttcatt gtaggcctct aggtattgca
720gggctgcaat atgacctttt gctagatcaa ctacgtggat ataatccctg atcggggtac
780catctctgga atcataatcg tctccgaaga tgtaaagctt ctcgcgccta ccaacagcta
840cttgagccat atatggcaac aaattgtttg gtatacctag cggatcttct ccgattaatc
900cagagggatg tgcgccaatt gggttaaaat aacgcaagat agcaaacttc caactttttt
960tgtcgctatt gtaaagatca ttcaagatat tctcaatggc gtatttcgta tgaccatacg
1020gattagtagg ccctaaggga cattcttctg ggataggaat catatttggg aatctcgtag
1080catcaccata gacagtagca gaagatgaaa aaacaaattt ggaaacgttg tattgttgca
1140ttaactctaa taaaacgaca gttcccaaaa tgttattgtg atagtatctc agcgggattt
1200gtgtagattc acctacagcc tttaaaccag caaagtgaat taccgaatca attttatatt
1260ctttgaaaac cttttccaga ccttttcggt cacacaaatc aacctcatag aagggaatgt
1320gatgcttggt caagacctct aacctggcta cagaatcata agttgaattc gacaggttat
1380cagcaacaac acagtcatat ccattctcaa ttagctctac cacagtgtgt gaaccaatgt
1440atccagcacc acctgtaacc aaaacaattt tagaagtact ttcactttgt aactgagctg
1500tgtcgacact agtaatacac atcatcgtcc tacaagttca tcaaagtgtt ggacagacaa
1560ctataccagc atggatctct tgtatcggtt cttttctccc gctctctcgc aataacaatg
1620aacactgggt caatcatagc ctacacaggt gaacagagta gcgtttatac agggtttata
1680cggtgattcc tacggcaaaa atttttcatt tctaaaaaaa aaaagaaaaa tttttctttc
1740caacgctaga aggaaaagaa aaatctaatt aaattgattt ggtgattttc tgagagttcc
1800ctttttcata tatcgaattt tgaatataaa aggagatcga aaaaattttt ctattcaatc
1860tgttttctgg ttttatttga tagttttttt gtgtattatt attatggatt agtactggtt
1920tatatgggtt tttctgtata acttcttttt attttagttt gtttaatctt attttgagtt
1980acattatagt tccctaactg caagagaagt aacattaaaa atgaaaaagc ctgaactcac
2040cgcgacgtct gtcgagaagt ttctgatcga aaagttcgac agcgtctccg acctgatgca
2100gctctcggag ggcgaagaat ctcgtgcttt cagcttcgat gtaggagggc gtggatatgt
2160cctgcgggta aatagctgcg ccgatggttt ctacaaagat cgttatgttt atcggcactt
2220tgcatcggcc gcgctcccga ttccggaagt gcttgacatt ggggaattca gcgagagcct
2280gacctattgc atctcccgcc gtgcacaggg tgtcacgttg caagacctgc ctgaaaccga
2340actgcccgct gttctgcagc cggtcgcgga ggccatggat gcgatcgctg cggccgatct
2400tagccagacg agcgggttcg gcccattcgg accgcaagga atcggtcaat acactacatg
2460gcgtgatttc atatgcgcga ttgctgatcc ccatgtgtat cactggcaaa ctgtgatgga
2520cgacaccgtc agtgcgtccg tcgcgcaggc tctcgatgag ctgatgcttt gggccgagga
2580ctgccccgaa gtccggcacc tcgtgcacgc ggatttcggc tccaacaatg tcctgacgga
2640caatggccgc ataacagcgg tcattgactg gagcgaggcg atgttcgggg attcccaata
2700cgaggtcgcc aacatcttct tctggaggcc gtggttggct tgtatggagc agcagacgcg
2760ctacttcgag cggaggcatc cggagcttgc aggatcgccg cggctccggg cgtatatgct
2820ccgcattggt cttgaccaac tctatcagag cttggttgac ggcaatttcg atgatgcagc
2880ttgggcgcag ggtcgatgcg acgcaatcgt ccgatccgga gccgggactg tcgggcgtac
2940acaaatcgcc cgcagaagcg cggccgtctg gaccgatggc tgtgtagaag tactcgccga
3000tagtggaaac cgacgcccca gcactcgtcc gagggcaaag gaataggttt aacttgatac
3060tactagattt tttctcttca tttataaaat ttttggttat aattgaagct ttagaagtat
3120gaaaaaatcc ttttttttca ttctttgcaa ccaaaataag aagcttcttt tattcattga
3180aatgatgaat ataaacctaa caaaagaaaa agactcgaat atcaaacatt aaaaaaaaat
3240aaaagaggtt atctgttttc ccatttagtt ggagtttgca ttttctaata gatagaactc
3300tcaattaatg tggatttagt ttctctgttc gttttttttt gttttgttct cactgtattt
3360acatttctat ttagtattta gttattcata taatcttaac ttctcgagac tcataacttt
3420agcatcacaa aatacgcaat aataacgagt agtaacactt ttatagttca tacatgcttc
3480aactacttaa taaatgattg tatgataatg ttttcaatgt aagagatttc gattatccac
3540aaactttaaa acacagggac aaaattcttg atatgctttc aaccgctgcg ttttggatac
3600ctattcttga catgatatga ctaccatttt gttattgtac gtggggcagt tgacgtctta
3660tcatatgtca aagtcatttg cgaagttctt ggcaagttgc caactgacga gatgcagtaa
3720aaagagattg ccgtcttgaa actttttgtc cttttttttt tccggggact ctacgagaac
3780cctttgtcct actgattaat tttgtactga atttggacaa ttcagatttt agtagacaag
3840cgcgaggagg aaaagaaatg acagaaaaat tccgatggac aagaagatag gaaaaaaaaa
3900aagctttcac cgatttccta gaccggaaaa aagtcgtatg acatcagaat gaaaaatttt
3960caagttagac aaggacaaaa tcaggacaaa ttgtaaagat ataataaact atttgattca
4020gcgccaattt gcccttttcc attttccatt aaatctctgt tctctcttac ttatatgatg
4080attaggtatc atctgtataa aactcctttc ttaatttcac tctaaagcat accccataga
4140gaagatcttt cggttcgaag acattcctac gcataataag aataggaggg aataatgcca
4200gacaatctat cattacattt aagcggctct tcaaaaagat tgaactctcg ccaacttatg
4260gaatcttcca atgagacctt tgcgccaaat aatgtggatt tggaaaaaga gtataagtca
4320tctcagagta atataactac cgaagtttat gaggcatcga gctttgaagt ttaaac
43761057686DNAArtificial SequenceSynthetic, Integration construct i10
105agcgcccaat acgcaaaccg cctctccccg cgcgttggcc gattcattaa tgcagctggc
60acgacaggtt tcccgactgg aaagcgggca gtgagcgcaa cgcaattaat gtgagttagc
120tcactcatta ggcaccccag gctttacact ttatgcttcc ggctcgtatg ttgtgtggaa
180ttgtgagcgg ataacaattt cacacaggaa acagctatga ccatgattac gccaagcttg
240gtaccgagct cggatccact agtaacggcc gccagtgtgc tggaattcgc ccttctcgag
300aagttaagat tatatgaata actaaatact aaatagaaat gtaaatacag tgagaacaaa
360acaaaaaaaa acgaacagag aaactaaatc cacattaatt gagagttcta tctattagaa
420aatgcaaact ccaactaaat gggaaaacag ataacctctt ttattttttt ttaatgtttg
480atattcgagt ctttttcttt tgttaggttt atattcatca tttcaatgaa taaaagaagc
540ttcttatttt ggttgcaaag aatgaaaaaa aaggattttt tcatacttct aaagcttcaa
600ttataaccaa aaattttata aatgaagaga aaaaatctag tagtatcaag ttaaacttaa
660cggccttttg ccagatattg attcatctct tcttccggca ccattccacc tcccgtcgcc
720cacaccagat gagtggtatt acgcagttgt tctgcgctga aaccgtgcat ctgttggtaa
780cttactgatg cacacacgcg ctgaggtccg gccatacccg ccagtgccga aggttcaaga
840cgaatacctt cttcctgcgc cagccagcca agcatgtcat acatggtttg atcgctaagg
900gtatagaagc catccagcag acgctccatt gcccgcccga caaagcctga tgcgcgacca
960actgcaaggc catccgctgc ggtaaggttg tcgataccaa tatcctgaac agaaatctga
1020tcgtgtaatc ctgtatggac gcctaacaac atacaagggg agtgcgttgg ttcggcaaaa
1080aagcagtgaa catgatcgcc aaacgccagt ttaagcccga atgcgacgcc accaggacca
1140ccgccaacac cacacggcag atagacaaac agagggttat cagcatcgac gatacggcct
1200tgctgggcaa attgcgcttt aagacgctgg ccagcgacgg aatacccaag gaacaacgtg
1260cgggaatttt cgtcatcaat aaagaaacag ttcgggtcag actgcgctgc tttacgtcct
1320tcctcgacgg caacaccata atcttgctca tattccacga ccgtaacgcc atgcgtgcgc
1380agtttcgctt ttttccatgc ccgggcatca gcagacatat gaactgtcac cttaaagcca
1440atgcgggcgc tcataatgcc gattgataac cccagatttc cggttgagcc cacagcaatg
1500ctgtattggc taaagaactg tttaaactcc ggagaaagca gtttgctgta gtcatcatca
1560agcgtcagca accccgcttc cagagccagt ttttctgcgt gtgccaggac ttcataaatc
1620ccgccgcgtg cttttatgga gccggaaatg ggcaaatggc tatctttttt cagtaacagt
1680tgcccgctga tcggttgctg atattctttt tccagccgtt tttgcatagc tcgaatggca
1740accagttctg attcaataat ccccccagtg gcagcagttt caggaaatgc ttttgccaga
1800tagggtgcaa aacgggataa gcgcgcatgg gcgtcctgaa catcctgttc ggtcaggcca
1860acataaggta aaccttcagc caatgaggtc gtgccaggat taaaccaggt ggtttcttta
1920agagcaacca gatcctttac caacggatac tgggcgatga gcgagttcat tttagcgttt
1980tccattttta atgttacttc tcttgcagtt agggaactat aatgtaactc aaaataagat
2040taaacaaact aaaataaaaa gaagttatac agaaaaaccc atataaacca gtactaatcc
2100ataataataa tacacaaaaa aactatcaaa taaaaccaga aaacagattg aatagaaaaa
2160ttttttcgat ctccttttat attcaaaatt cgatatatga aaaagggaac tctcagaaaa
2220tcaccaaatc aatttaatta gatttttctt ttccttctag cgttggaaag aaaaattttt
2280cttttttttt ttagaaatga aaaatttttg ccgtaggaat caccgtataa accctgtata
2340aacgctactc tgttcacctg tgtaggctat gattgaccca gtgttcattg ttattgcgag
2400agagcgggag aaaagaaccg atacaagaga tccatgctgg tatagttgtc tgtccaacac
2460tttgatgaac ttgtaggacg atgatgtgta ttactagtgt cgacgtattc caatgagaat
2520cgctagaaat gctttaccag aactagacta cttgtcgcag atcacttttg aactgtatga
2580gagtacggat gcttctggtc aaaaatcgca ttccattaga ctgaaaatgt ctcctgggtg
2640tcatactcaa gatccgttag atgttcaatt agatgacagg cattatatta gttgtattcc
2700aaagatttcc ctgacgaagc atttggatat ggactacgtt caacagaaat tgagaaacaa
2760atttaccagg gtcattatgc ctccgaaatt tacaccagta aacattacga gccccaactt
2820gagtttccag aaacgcaaaa ccagaagaaa gtcggtatct gttgagaagt tgaagcttcc
2880tgcctcgtcc ggatcttcat catctacctc cgttaacaag acattagatt agtgatcaca
2940cccaattttt aatttagcaa cccaaaataa ataagtattt actcaacttt tttttaataa
3000aaaaaaactt aattgaattt tgctcgcgat ctttaggtcc ggggttttcg ttgaaccctt
3060agacgagcaa attagcgcca taaggatata cgtcagagca cattaattag tgacatatac
3120ctatataaag agcaaccttc tccgatagac ttgtaattta tcttatttca tttcctaaca
3180ctttggtcga agaagaggga taaaaacaga cgaaaacaca tttaagggct atacaaagat
3240gggaaagcta ttacaattgg cattgcatcc ggtcgagatg aaggcagctt tgaagctgaa
3300gttttgcaga acaccgctat tctccatcta tgatcagtcc acgtctccat atctcttgca
3360ctgtttcgaa ctgttgaact tgacctccag atcgtttgct gctgtgatca gagagctgca
3420tccagaattg agaaactgtg ttactctctt ttatttgatt ttaagggctt tggataccat
3480cgaagacgat atgtccatcg aacacgattt gaaaattgac ttgttgcgtc acttccacga
3540gaaattgttg ttaactaaat ggagtttcga cggaaatgcc cccgatgtga aggacagagc
3600cgttttgaca gatttcgaat cgattcttat tgaattccac aaattgaaac cagaatatca
3660agaagtcatc aaggagatca ccgagaaaat gggtaatggt atggccgact acatcttaga
3720tgaaaattac aacttgaatg ggttgcaaac cgtccacgac tacgacgtgt actgtcacta
3780cgtagctggt ttggtcggtg atggtttgac ccgtttgatt gtcattgcca agtttgccaa
3840cgaatctttg tattctaatg agcaattgta tgaaagcatg ggtcttttcc tacaaaaaac
3900caacatcatc agagattaca atgaagattt ggtcgatggt agatccttct ggcccaagga
3960aatctggtca caatacgctc ctcagttgaa ggacttcatg aaacctgaaa acgaacaact
4020ggggttggac tgtataaacc acctcgtcta agggcgaatt ctgcagatat ccatcacact
4080ggcggccgct cgagcatgca tctagagggc ccaattcgcc ctatagtgag tcgtattaca
4140attcactggc cgtcgtttta caacgtcgtg actgggaaaa ccctggcgtt acccaactta
4200atcgccttgc agcacatccc cctttcgcca gctggcgtaa tagcgaagag gcccgcaccg
4260atcgcccttc ccaacagttg cgcagcctga atggcgaatg gacgcgccct gtagcggcgc
4320attaagcgcg gcgggtgtgg tggttacgcg cagcgtgacc gctacacttg ccagcgccct
4380agcgcccgct cctttcgctt tcttcccttc ctttctcgcc acgttcgccg gctttccccg
4440tcaagctcta aatcgggggc tccctttagg gttccgattt agtgctttac ggcacctcga
4500ccccaaaaaa cttgattagg gtgatggttc acgtagtggg ccatcgccct gatagacggt
4560ttttcgccct ttgacgttgg agtccacgtt ctttaatagt ggactcttgt tccaaactgg
4620aacaacactc aaccctatct cggtctattc ttttgattta taagggattt tgccgatttc
4680ggcctattgg ttaaaaaatg agctgattta acaaaaattt aacgcgaatt ttaacaaaat
4740tcagggcgca agggctgcta aaggaagcgg aacacgtaga aagccagtcc gcagaaacgg
4800tgctgacccc ggatgaatgt cagctactgg gctatctgga caagggaaaa cgcaagcgca
4860aagagaaagc aggtagcttg cagtgggctt acatggcgat agctagactg ggcggtttta
4920tggacagcaa gcgaaccgga attgccagct ggggcgccct ctggtaaggt tgggaagccc
4980tgcaaagtaa actggatggc tttcttgccg ccaaggatct gatggcgcag gggatcaaga
5040tctgatcaag agacaggatg aggatcgttt cgcatgattg aacaagatgg attgcacgca
5100ggttctccgg ccgcttgggt ggagaggcta ttcggctatg actgggcaca acagacaatc
5160ggctgctctg atgccgccgt gttccggctg tcagcgcagg ggcgcccggt tctttttgtc
5220aagaccgacc tgtccggtgc cctgaatgaa ctgcaggacg aggcagcgcg gctatcgtgg
5280ctggccacga cgggcgttcc ttgcgcagct gtgctcgacg ttgtcactga agcgggaagg
5340gactggctgc tattgggcga agtgccgggg caggatctcc tgtcatccca ccttgctcct
5400gccgagaaag tatccatcat ggctgatgca atgcggcggc tgcatacgct tgatccggct
5460acctgcccat tcgaccacca agcgaaacat cgcatcgagc gagcacgtac tcggatggaa
5520gccggtcttg tcgatcagga tgatctggac gaagagcatc aggggctcgc gccagccgaa
5580ctgttcgcca ggctcaaggc gcgcatgccc gacggcgagg atctcgtcgt gacccatggc
5640gatgcctgct tgccgaatat catggtggaa aatggccgct tttctggatt catcgactgt
5700ggccggctgg gtgtggcgga ccgctatcag gacatagcgt tggctacccg tgatattgct
5760gaagagcttg gcggcgaatg ggctgaccgc ttcctcgtgc tttacggtat cgccgctccc
5820gattcgcagc gcatcgcctt ctatcgcctt cttgacgagt tcttctgaat tgaaaaagga
5880agagtatgag tattcaacat ttccgtgtcg cccttattcc cttttttgcg gcattttgcc
5940ttcctgtttt tgctcaccca gaaacgctgg tgaaagtaaa agatgctgaa gatcagttgg
6000gtgcacgagt gggttacatc gaactggatc tcaacagcgg taagatcctt gagagttttc
6060gccccgaaga acgttttcca atgatgagca cttttaaagt tctgctatgt ggcgcggtat
6120tatcccgtat tgacgccggg caagagcaac tcggtcgccg catacactat tctcagaatg
6180acttggttga gtactcacca gtcacagaaa agcatcttac ggatggcatg acagtaagag
6240aattatgcag tgctgccata accatgagtg ataacactgc ggccaactta cttctgacaa
6300cgatcggagg accgaaggag ctaaccgctt ttttgcacaa catgggggat catgtaactc
6360gccttgatcg ttgggaaccg gagctgaatg aagccatacc aaacgacgag cgtgacacca
6420cgatgcctgt agcaatggca acaacgttgc gcaaactatt aactggcgaa ctacttactc
6480tagcttcccg gcaacaatta atagactgga tggaggcgga taaagttgca ggaccacttc
6540tgcgctcggc ccttccggct ggctggttta ttgctgataa atctggagcc ggtgagcgtg
6600ggtctcgcgg tatcattgca gcactggggc cagatggtaa gccctcccgt atcgtagtta
6660tctacacgac ggggagtcag gcaactatgg atgaacgaaa tagacagatc gctgagatag
6720gtgcctcact gattaagcat tggtaactgt cagaccaagt ttactcatat atactttaga
6780ttgatttaaa acttcatttt taatttaaaa ggatctaggt gaagatcctt tttgataatc
6840tcatgaccaa aatcccttaa cgtgagtttt cgttccactg agcgtcagac cccgtagaaa
6900agatcaaagg atcttcttga gatccttttt ttctgcgcgt aatctgctgc ttgcaaacaa
6960aaaaaccacc gctaccagcg gtggtttgtt tgccggatca agagctacca actctttttc
7020cgaaggtaac tggcttcagc agagcgcaga taccaaatac tgttcttcta gtgtagccgt
7080agttaggcca ccacttcaag aactctgtag caccgcctac atacctcgct ctgctaatcc
7140tgttaccagt ggctgctgcc agtggcgata agtcgtgtct taccgggttg gactcaagac
7200gatagttacc ggataaggcg cagcggtcgg gctgaacggg gggttcgtgc acacagccca
7260gcttggagcg aacgacctac accgaactga gatacctaca gcgtgagcta tgagaaagcg
7320ccacgcttcc cgaagggaga aaggcggaca ggtatccggt aagcggcagg gtcggaacag
7380gagagcgcac gagggagctt ccagggggaa acgcctggta tctttatagt cctgtcgggt
7440ttcgccacct ctgacttgag cgtcgatttt tgtgatgctc gtcagggggg cggagcctat
7500ggaaaaacgc cagcaacgcg gcctttttac ggttcctggc cttttgctgg ccttttgctc
7560acatgttctt tcctgcgtta tcccctgatt ctgtggataa ccgtattacc gcctttgagt
7620gagctgatac cgctcgccgc agccgaacga ccgagcgcag cgagtcagtg agcgaggaag
7680cggaag
768610633DNAArtificial SequenceSynthetic, Primer LX-268-139-S2D-F
106ggtcaccata tggacactct gccgatctct tcc
3310734DNAArtificial SequenceSynthetic, Primer LX-268-139-S2D-R
107gtataaggat cctcatacga ccatagggtg tacg
341081725DNAArtificial SequenceSynthetic, FS_D_3.5 coding sequence
108atgtctactt tacctatttc ttctgtttcc tcatcttcta gtacctcccc attggtagtc
60gatgacaagg attctactaa accggacgta atcagacata ccacaaattt caacgcgtct
120atttggggtg accagttttt aacatacgat gaacccgagg atttggttat gaagaagcaa
180ctcgtagagg aactgaagga agaggttaag aaagaactta ttacaatcaa aggatcaaat
240gagcctatgc aacatgttaa actcatcgag ctgatcgatg ccgtgcagcg tcttggaatt
300gcttaccatt ttgaggagga aattgaggaa gctttgcaac atattcacgt tacttacgga
360gagcagtggg tcgataaaga aaatcttcag tcaatctcgc tatggtttcg attacttaga
420caacagggat tcaacgtttc gagtggagtg tttaaagatt ttatggacga aaagggaaag
480tttaaagaaa gcctctgtaa tgatgctcaa ggtattttag ctctctatga ggcggcgttt
540atgagggttg aggatgaaac tatcttagat aacgccttgg agttcagtaa ggttcatctc
600gatataattg ctaaagatcc aagctgtgat tcatctctac gtacacagat tcatcaggca
660ttaaagcagc cactcagacg cagactggct cgaatagaag ctcttcacta tatgccaatc
720tatcaacagg agactagtca tgatgaagtt ttattgaagc tagcgaagct ggatttttct
780gtgctccaat ctatgcacaa aaaggaattg tcgcatattt gtaagtggtg gaaggacctc
840gatttgcaga acaaactacc gtttgttcgt gacagagtcg tcgagggata tttttggatt
900ttgagtattt attatgaacc tcagcatgca cgtactcgta tgtttcttat gaagtcgtgt
960atgtggctgg tagtcctgga tgatacattt gataactacg gaacatacga ggagttggag
1020attttcacgc aagctgtcga gaggtggtca atatcatgtc tcgacatgct accagaatac
1080atgaaattga tctatcaaga gcttgtcaac cttcacgttg aaatggagga gagtcttgag
1140aaagaaggta aaacttatca aatccactac gttaaggaaa tggccaaaga actggtaaga
1200aattatctag ttgaagctag atggttaaag gaaggctaca tgcctacttt agaggagtac
1260atgagcgtta gcatggttac ggggacttac gggcttatga ccgctcggag ttacgttggt
1320cgtggggaca tcgtcaatga agatacgttt aagtgggtgt cttcgtaccc gcctatcgta
1380aaagcgtcgt gtgttattat ccgtctgatg gatgatatcg tgtctcataa agaagaacaa
1440gaacgagggc atgttgcaag ttctatcgaa tgctattcga aagaatctgg ggccagtgaa
1500gaagaggcct gcgagtacat tagccgtaag gttgaggatg catggaaagt tatcaaccga
1560gagtcgttgc gtccaactgc cgttccgttt cctttgctta tgcctgccat caatttggct
1620agaatgtgtg aggttctcta tagtgtaaac gacggattta cacatgcaga aggagatatg
1680aagtcttaca tgaagtcatt cttcgtccac ccgatggtcg tttga
172510956DNAArtificial SequenceSynthetic, Primer LX-268-130-4-S2D-R
109ctttaacgtc aaggagaaaa aaccccggat ccatggacac tctgccgatc tcttcc
5611059DNAArtificial SequenceSynthetic, Primer LX-268-130-3-S2D-F
110ccttcctttt cggttagagc ggatcttagc tagctcatac gaccataggg tgtacgaag
59111574PRTArtificial SequenceSynthetic, A. annua b-farnesene synthase
amino acid sequence 111Met Ser Thr Leu Pro Ile Ser Ser Val Ser Phe Ser
Ser Ser Thr Ser1 5 10
15Pro Leu Val Val Asp Asp Lys Val Ser Thr Lys Pro Asp Val Ile Arg
20 25 30His Thr Met Asn Phe Asn Ala
Ser Ile Trp Gly Asp Gln Phe Leu Thr 35 40
45Tyr Asp Glu Pro Glu Asp Leu Val Met Lys Lys Gln Leu Val Glu
Glu 50 55 60Leu Lys Glu Glu Val Lys
Lys Glu Leu Ile Thr Ile Lys Gly Ser Asn65 70
75 80Glu Pro Met Gln His Val Lys Leu Ile Glu Leu
Ile Asp Ala Val Gln 85 90
95Arg Leu Gly Ile Ala Tyr His Phe Glu Glu Glu Ile Glu Glu Ala Leu
100 105 110Gln His Ile His Val Thr
Tyr Gly Glu Gln Trp Val Asp Lys Glu Asn 115 120
125Leu Gln Ser Ile Ser Leu Trp Phe Arg Leu Leu Arg Gln Gln
Gly Phe 130 135 140Asn Val Ser Ser Gly
Val Phe Lys Asp Phe Met Asp Glu Lys Gly Lys145 150
155 160Phe Lys Glu Ser Leu Cys Asn Asp Ala Gln
Gly Ile Leu Ala Leu Tyr 165 170
175Glu Ala Ala Phe Met Arg Val Glu Asp Glu Thr Ile Leu Asp Asn Ala
180 185 190Leu Glu Phe Thr Lys
Val His Leu Asp Ile Ile Ala Lys Asp Pro Ser 195
200 205Cys Asp Ser Ser Leu Arg Thr Gln Ile His Gln Ala
Leu Lys Gln Pro 210 215 220Leu Arg Arg
Arg Leu Ala Arg Ile Glu Ala Leu His Tyr Met Pro Ile225
230 235 240Tyr Gln Gln Glu Thr Ser His
Asp Glu Val Leu Leu Lys Leu Ala Lys 245
250 255Leu Asp Phe Ser Val Leu Gln Ser Met His Lys Lys
Glu Leu Ser His 260 265 270Ile
Cys Lys Trp Trp Lys Asp Leu Asp Leu Gln Asn Lys Leu Pro Tyr 275
280 285Val Arg Asp Arg Val Val Glu Gly Tyr
Phe Trp Ile Leu Ser Ile Tyr 290 295
300Tyr Glu Pro Gln His Ala Arg Thr Arg Met Phe Leu Met Lys Thr Cys305
310 315 320Met Trp Leu Val
Val Leu Asp Asp Thr Phe Asp Asn Tyr Gly Thr Tyr 325
330 335Glu Glu Leu Glu Ile Phe Thr Gln Ala Val
Glu Arg Trp Ser Ile Ser 340 345
350Cys Leu Asp Met Leu Pro Glu Tyr Met Lys Leu Ile Tyr Gln Glu Leu
355 360 365Val Asn Leu His Val Glu Met
Glu Glu Ser Leu Glu Lys Glu Gly Lys 370 375
380Thr Tyr Gln Ile His Tyr Val Lys Glu Met Ala Lys Glu Leu Val
Arg385 390 395 400Asn Tyr
Leu Val Glu Ala Arg Trp Leu Lys Glu Gly Tyr Met Pro Thr
405 410 415Leu Glu Glu Tyr Met Ser Val
Ser Met Val Thr Gly Thr Tyr Gly Leu 420 425
430Met Ile Ala Arg Ser Tyr Val Gly Arg Gly Asp Ile Val Thr
Glu Asp 435 440 445Thr Phe Lys Trp
Val Ser Ser Tyr Pro Pro Ile Ile Lys Ala Ser Cys 450
455 460Val Ile Val Arg Leu Met Asp Asp Ile Val Ser His
Lys Glu Glu Gln465 470 475
480Glu Arg Gly His Val Ala Ser Ser Ile Glu Cys Tyr Ser Lys Glu Ser
485 490 495Gly Ala Ser Glu Glu
Glu Ala Cys Glu Tyr Ile Ser Arg Lys Val Glu 500
505 510Asp Ala Trp Lys Val Ile Asn Arg Glu Ser Leu Arg
Pro Thr Ala Val 515 520 525Pro Phe
Pro Leu Leu Met Pro Ala Ile Asn Leu Ala Arg Met Cys Glu 530
535 540Val Leu Tyr Ser Val Asn Asp Gly Phe Thr His
Ala Glu Gly Asp Met545 550 555
560Lys Ser Tyr Met Lys Ser Phe Phe Val His Pro Met Val Val
565 5701121725DNAArtificial SequenceSynthetic, A.
annua b-farnesene synthase nucleotide sequence 112atgtcgactc
ttcctatttc tagtgtttca ttctcttcat ctacgtcacc tttggttgtt 60gacgataaag
ttagcacgaa accagatgtt atccgccata ccatgaattt caatgctagc 120atatggggag
atcaatttct tacatatgat gagccagaag atttggttat gaagaaacaa 180cttgttgaag
agctcaaaga ggaagtcaag aaagagctaa taacgatcaa aggttcaaat 240gaaccgatgc
agcatgtcaa gttgatagaa cttattgatg cagtccaacg gcttggcata 300gcctatcatt
ttgaagagga gattgaagaa gccttgcaac atatccatgt tacatatggc 360gagcagtggg
tcgataaaga aaacctacaa agcatttctc tttggttccg actcctacga 420caacaaggct
tcaacgtctc atcaggagta ttcaaggact ttatggacga gaagggaaaa 480tttaaggaat
ccttatgtaa tgatgctcag ggaattcttg ctctgtatga agcggcattt 540atgagggtgg
aagatgaaac aatactagat aatgcgctcg agttcactaa agttcacctt 600gacatcatag
ccaaggatcc ttcttgtgac tcttccctaa gaacccaaat acaccaagcg 660ttaaagcagc
cacttaggag aaggctggca aggattgagg cgttgcatta catgcctatc 720taccaacaag
aaacatccca cgatgaggtc ttactgaagc ttgcaaaatt agattttagc 780gtgcttcagt
cgatgcacaa aaaggaactt agccacattt gcaaatggtg gaaggatttg 840gacctccaaa
ataagcttcc ttatgttcga gacagggtgg tggaaggcta tttttggata 900ctatccatct
attacgagcc tcaacatgct cgaacaagaa tgttcctaat gaaaacatgc 960atgtggttag
tcgttttaga tgatacattt gataattatg gtacttatga agaactcgaa 1020atctttacac
aagctgttga aagatggtca ataagctgcc tggatatgct tccagaatac 1080atgaaactaa
tatatcaaga gcttgtgaat cttcacgtgg aaatggagga atcacttgaa 1140aaggagggaa
aaacatatca aattcactat gtcaaggaga tggcaaaaga gttggttcgc 1200aattacttgg
tagaagccag atggctaaaa gaggggtaca tgccaactct tgaggagtac 1260atgtctgtgt
caatggtgac tggtacctat ggcttgatga tagcgagatc ttatgtcggc 1320aggggtgata
tcgtcaccga ggataccttt aaatgggtgt cctcgtatcc tcctattata 1380aaagcttcat
gtgtgattgt aagacttatg gatgatattg tcagccacaa ggaggaacaa 1440gagagaggcc
atgttgcttc aagcatcgaa tgctattcta aggaaagtgg tgcatcagag 1500gaggaagcgt
gtgaatatat ctcaagaaaa gttgaagatg catggaaagt tataaaccga 1560gagtcgctca
ggcctacagc tgtcccattt cctctactta tgcctgcaat caaccttgca 1620cgtatgtgtg
aagtcctata tagcgtcaac gatggcttca ctcatgctga gggagacatg 1680aaaagttaca
tgaaatcgtt cttcgttcac cctatggttg tctaa
172511347DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2090
113cacgttcgcc ggccaaatta aagcagatct agatcggtga aaacatc
4711450DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2091
114gaagaaatag gcaaagttga catggatccg tttagtccgt attgctattg
5011550DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2092
115cacgttcgcc ggccaaatta aagcagatct ctctacaacc gcagggaaat
501164309DNAArtificial SequenceSynthetic, Construct D 116gaagatccga
ggcctagctt taacgaacgc agaattttcg agttattaaa cttaaaatac 60gctgaacccg
aacatagaaa tatcgaatgg gaaaaaaaaa ctgcataaag gcattaaaag 120aggagcgaat
ttttttttaa taaaaatctt aataatcatt aaaagataaa taatagtcta 180tatatacgta
tataaataaa aaatattcaa aaaataaaat aaactattat tttagcgtaa 240aggatgggga
aagagaaaag aaaaaaattg atctatcgat ttcaattcaa ttcaatttat 300ttcttttcgg
ataagaaagc aacacctggc aattccttac cttccaataa ttccaaagaa 360gcaccaccac
cagtagagac atgggagagt caaacgacca taggatgaac gaagaaggac 420ttcatataag
atttcatgtc accctcagca tgagtaaaac catcattaac agagtacaag 480acctcacaca
ttctagctaa gtttattgct ggcattaaca aagggaaggg aacggctgtt 540ggacgcaaag
attctctatt gattactttc caggcatcct caactttcct actaatatat 600tcacatgctt
cctcttcaga agcacctgat tctttagagt aacattctat agatgaagcc 660acatgtcctc
tttcttgttc ttccttgtga gatacaatat cgtccattaa tcttactatt 720acacaggaag
ctttaataat aggtgggtaa ctagaaaccc atttgaatgt gtcttcagta 780acaatgtctc
ctctgccaac ataggacctt gcaatcatca aaccataagt accagtaacc 840atagaaacag
acatgtattc ttctaaagta ggcatataac cttccttcaa ccatcttgct 900tctactaagt
aattacgaac taattcttta gccatctcct taacgtaatg aatctgatag 960gtctttccct
ccttttccaa agattcttcc atttccacat gcaaattgac taattcttgg 1020tagattaatt
tcatatattc gggcaacata tctaagcatg agatagacca tctctcgacg 1080gcttgagtaa
aaatctccaa ttcttcgtat gttccataat tatcaaaagt atcgtccaaa 1140actactaacc
acatgcatgt tttcatcaaa aacattcttg ttctagcgtg ttgtggctca 1200tagtatatgg
acaatatcca gaagtagcct tcgacaacac gatcacgtac ataaggtaac 1260ttattttgta
aatctaaatc tttccaccac ttacagatat gtgacaattc ctttttatgc 1320atagactgca
aaacactgaa atccaacttg gctaatttca acaatacttc atcatgagat 1380gtttcctgtt
ggtagattgg catgtaatgt aatgcttcaa tccttgctaa tctccttctt 1440aaaggttgtt
ttaaggcttg atggatttgt gtacgcaatg aagaatcgca agatgggtct 1500tttgctatga
tatctaaatg aacttttgtg aattccaaag cattgtctaa gatggtttca 1560tcttcaaccc
tcataaatgc agcttcatat aaggctaata ttccttgtgc atcattgcat 1620aaagactctt
tgaatttacc tttttcgtcc ataaagtctt tgaaaacgcc agaggagacg 1680ttaaagccct
gttgacgcaa caacctgaac cacaatgaaa tactctgtaa attttcctta 1740tccacccact
gttcaccata ggtaacatgt atatgttgca aagcttcctc gatctcttct 1800tcaaaatggt
aagctatacc taaacgttga acagcatcaa ttaattcaat caatttcaca 1860tgctgcatgg
gctcatttga acctttgata gttatcaatt ccttcttaac ttcctctttt 1920aattcctcca
ctaattgttt cttcataact aaatcttcag gctcatcata ggtcaagaat 1980tgatctcccc
aaatagaagc attgaaattc attgtatgtc tgataacgtc gggcttggtt 2040gagactttgt
cgtccacgac taatggtgat gtagaagagg aaaatgacac agaagaaata 2100ggcaaagttg
acatggatcc ggggtttttt ctccttgacg ttaaagtata gaggtatatt 2160aacaattttt
tgttgatact tttattacat ttgaataaga agtaatacaa accgaaaatg 2220ttgaaagtat
tagttaaagt ggttatgcag tttttgcatt tatatatctg ttaatagatc 2280aaaaatcatc
gcttcgctga ttaattaccc cagaaataag gctaaaaaac taatcgcatt 2340atcatcctat
ggttgttaat ttgattcgtt catttgaagg tttgtggggc caggttactg 2400ccaatttttc
ctcttcataa ccataaaagc tagtattgta gaatctttat tgttcggagc 2460agtgcggcgc
gaggcacatc tgcgtttcag gaacgcgacc ggtgaagacg aggacgcacg 2520gaggagagtc
ttccttcgga gggctgtcac ccgctcggcg gcttctaatc cgtactagat 2580ctgctttaat
ttggccggcg aacgtggcga gaaaggaagg gaagaaagcg aaaggagcgg 2640gcgctagggc
gctggcaagt gtagcggtca cgctgcgcgt aaccaccaca cccgccgcgc 2700ttaatgcgcc
gctacagggc gcgtcgcgcc attcgccatt caggctgcgc aactgttggg 2760aagggcgatc
ggtgcgggcc tcttcgctat tacgccagct gaattggagc gacctcatgc 2820tatacctgag
aaagcaacct gacctacagg aaagagttac tcaagaataa gaattttcgt 2880tttaaaacct
aagagtcact ttaaaatttg tatacactta ttttttttat aacttattta 2940ataataaaaa
tcataaatca taagaaattc gcttattcaa ctaattctat agatgataaa 3000aatggtttct
ggacctcttt gacgtccttt gatcttacgt tagctaactg ggcgactggt 3060ggataggccc
actcagaagg tgaaacggct cctacattgg cagcttgctc gtagaacttg 3120caaaattttt
gggcatcctc agtcttttcc tccttgactt tctcgtagat ttcagacaac 3180ctgtacctcc
tgtcgcataa atgccatgtg acataaccat gcatgaagca ctctatggtg 3240tccattactt
gagggtcctt gtctgagaaa actgcaacca tttgctttga agagtgcaag 3300gtatcctggg
tcaatttttc taaggcctcg tgtaatgata tctcgtcaga aacaacgtag 3360ttctttacca
aagagatctg atccctctcg tcgtcgaact ccttgtaaaa tgacatcaaa 3420tcattaaccc
agaccatcca attttccatt tgagctatgg ctgaagtgat ctccaaaaac 3480aatgatcttt
cattgaactg ctcctttggc cacaaagagg caccgacgca gtgtcctaaa 3540ccgttcattc
ttctcaagaa ctgtgggtag tcgtgagaac ctgggaatcc tccaaaattg 3600tattgttcta
tccagcaacc ctcgaagaag tctaaggtag acctgatcaa gttcaatgag 3660caaaaaggac
caaaatgcct caatacgttt ggaaagtgct cgtttactaa agcccaccaa 3720ggatgagcct
gttctctacc tgcttgtaag tcatcgaagt agtttaccat agtagggtat 3780gggtcgtctt
ttgaatcgtc caataccaag gtgtaggtat agtggattga caagtctgcc 3840atacactctt
tagatacctt ggcccatgaa tatacaacca taccgacaat ggtctgcaat 3900gaagcttgca
atctcttagg gtcgaccttc aacaactgct gctgtcttgg ctgggcgaag 3960tggtgggcgg
ctttgttgta ggcgtagtgt aagttctcaa tcctctcctc cctggtatag 4020tttgagtccc
tgtacctaat gtactccaac aacctgacgg tggtgttcaa gaagtactcg 4080gttggaaagt
tttccatgaa ttcgaatttt caaaaattct tacttttttt ttggatggac 4140gcaaagaagt
ttaataatca tattacatgg cattaccacc atatacatat ccatatacat 4200atccatatct
aatcttactt atatgttgtg gaaatgtaaa gagccccatt atcttagcct 4260aaaaaaacct
tctctttgga actttcagta atacgcttaa ctgctcatt
43091175714DNAArtificial SequenceSynthetic, Expression plasmid pAM1490
117ttcttgaaga cgaaagggcc tcgtgatacg cctattttta taggttaatg tcatgataat
60aatggtttct tagacgtcag gtggcacttt tcggggaaat gtgcgcggaa cccctatttg
120tttatttttc taaatacatt caaatatgta tccgctcatg agacaataac cctgataaat
180gcttcaataa tattgaaaaa ggaagagtat gagtattcaa catttccgtg tcgcccttat
240tccctttttt gcggcatttt gccttcctgt ttttgctcac ccagaaacgc tggtgaaagt
300aaaagatgct gaagatcagt tgggtgcacg agtgggttac atcgaactgg atctcaacag
360cggtaagatc cttgagagtt ttcgccccga agaacgtttt ccaatgatga gcacttttaa
420agttctgcta tgtggcgcgg tattatcccg tgttgacgcc gggcaagagc aactcggtcg
480ccgcatacac tattctcaga atgacttggt tgagtactca ccagtcacag aaaagcatct
540tacggatggc atgacagtaa gagaattatg cagtgctgcc ataaccatga gtgataacac
600tgcggccaac ttacttctga caacgatcgg aggaccgaag gagctaaccg cttttttgca
660caacatgggg gatcatgtaa ctcgccttga tcgttgggaa ccggagctga atgaagccat
720accaaacgac gagcgtgaca ccacgatgcc tgcagcaatg gcaacaacgt tgcgcaaact
780attaactggc gaactactta ctctagcttc ccggcaacaa ttaatagact ggatggaggc
840ggataaagtt gcaggaccac ttctgcgctc ggcccttccg gctggctggt ttattgctga
900taaatctgga gccggtgagc gtgggtctcg cggtatcatt gcagcactgg ggccagatgg
960taagccctcc cgtatcgtag ttatctacac gacggggagt caggcaacta tggatgaacg
1020aaatagacag atcgctgaga taggtgcctc actgattaag cattggtaac tgtcagacca
1080agtttactca tatatacttt agattgattt aaaacttcat ttttaattta aaaggatcta
1140ggtgaagatc ctttttgata atctcatgac caaaatccct taacgtgagt tttcgttcca
1200ctgagcgtca gaccccgtag aaaagatcaa aggatcttct tgagatcctt tttttctgcg
1260cgtaatctgc tgcttgcaaa caaaaaaacc accgctacca gcggtggttt gtttgccgga
1320tcaagagcta ccaactcttt ttccgaaggt aactggcttc agcagagcgc agataccaaa
1380tactgtcctt ctagtgtagc cgtagttagg ccaccacttc aagaactctg tagcaccgcc
1440tacatacctc gctctgctaa tcctgttacc agtggctgct gccagtggcg ataagtcgtg
1500tcttaccggg ttggactcaa gacgatagtt accggataag gcgcagcggt cgggctgaac
1560ggggggttcg tgcacacagc ccagcttgga gcgaacgacc tacaccgaac tgagatacct
1620acagcgtgag ctatgagaaa gcgccacgct tcccgaaggg agaaaggcgg acaggtatcc
1680ggtaagcggc agggtcggaa caggagagcg cacgagggag cttccagggg gaaacgcctg
1740gtatctttat agtcctgtcg ggtttcgcca cctctgactt gagcgtcgat ttttgtgatg
1800ctcgtcaggg gggcggagcc tatggaaaaa cgccagcaac gcggcctttt tacggttcct
1860ggccttttgc tggccttttg ctcacatgtt ctttcctgcg ttatcccctg attctgtgga
1920taaccgtatt accgcctttg agtgagctga taccgctcgc cgcagccgaa cgaccgagcg
1980cagcgagtca gtgagcgagg aagcggaaga gcgcctgatg cggtattttc tccttacgca
2040tctgtgcggt atttcacacc gcatatatgg tgcactctca gtacaatctg ctctgatgcc
2100gcatagttaa gccagtatac actccgctat cgctacgtga ctgggtcatg gctgcgcccc
2160gacacccgcc aacacccgct gacgcgccct gacgggcttg tctgctcccg gcatccgctt
2220acagacaagc tgtgaccgtc tccgggagct gcatgtgtca gaggttttca ccgtcatcac
2280cgaaacgcgc gaggcagctg cggtaaagct catcagcgtg gtcgtgaagc gattcacaga
2340tgtctgcctg ttcatccgcg tccagctcgt tgagtttctc cagaagcgtt aatgtctggc
2400ttctgataaa gcgggccatg ttaagggcgg ttttttcctg tttggtcact gatgcctccg
2460tgtaaggggg atttctgttc atgggggtaa tgataccgat gaaacgagag aggatgctca
2520cgatacgggt tactgatgat gaacatgccc ggttactgga acgttgtgag ggtaaacaac
2580tggcggtatg gatgcggcgg gaccagagaa aaatcactca gggtcaatgc cagcgcttcg
2640ttaatacaga tgtaggtgtt ccacagggta gccagcagca tcctgcgatg cagatccgga
2700acataatggt gcagggcgct gacttccgcg tttccagact ttacgaaaca cggaaaccga
2760agaccattca tgttgttgct caggtcgcag acgttttgca gcagcagtcg cttcacgttc
2820gctcgcgtat cggtgattca ttctgctaac cagtaaggca accccgccag cctagccggg
2880tcctcaacga caggagcacg atcatgcgca cccgtggcca ggacccaacg ctgcccgaga
2940tgcgccgcgt gcggctgctg gagatggcgg acgcgatgga tatgttctgc caagggttgg
3000tttgcgcatt cacagttctc cgcaagaatt gattggctcc aattcttgga gtggtgaatc
3060cgttagcgag gtgccgccgg cttccattca ggtcgaggtg gcccggctcc atgcaccgcg
3120acgcaacgcg gggaggcaga caaggtatag ggcggcgcct acaatccatg ccaacccgtt
3180ccatgtgctc gccgaggcgg cataaatcgc cgtgacgatc agcggtccag tgatcgaagt
3240taggctggta agagccgcga gcgatccttg aagctgtccc tgatggtcgt catctacctg
3300cctggacagc atggcctgca acgcgggcat cccgatgccg ccggaagcga gaagaatcat
3360aatggggaag gccatccagc ctcgcgtcgc gaacgccagc aagacgtagc ccagcgcgtc
3420ggccgccatg ccggcgataa tggcctgctt ctcgccgaaa cgtttggtgg cgggaccagt
3480gacgaaggct tgagcgaggg cgtgcaagat tccgaatacc gcaagcgaca ggccgatcat
3540cgtcgcgctc cagcgaaagc ggtcctcgcc gaaaatgacc cagagcgctg ccggcacctg
3600tcctacgagt tgcatgataa agaagacagt cataagtgcg gcgacgatag tcatgccccg
3660cgcccaccgg aaggagctga ctgggttgaa ggctctcaag ggcatcggtc gagatcccgg
3720tgcctaatga gtgagctaac ttacattaat tgcgttgcgc tcactgcccg ctttccagtc
3780gggaaacctg tcgtgccagc tgcattaatg aatcggccaa cgcgcgggga gaggcggttt
3840gcgtattggg cgccagggtg gtttttcttt tcaccagtga gacgggcaac agctgattgc
3900ccttcaccgc ctggccctga gagagttgca gcaagcggtc cacgctggtt tgccccagca
3960ggcgaaaatc ctgtttgatg gtggttaacg gcgggatata acatgagctg tcttcggtat
4020cgtcgtatcc cactaccgag atatccgcac caacgcgcag cccggactcg gtaatggcgc
4080gcattgcgcc cagcgccatc tgatcgttgg caaccagcat cgcagtggga acgatgccct
4140cattcagcat ttgcatggtt tgttgaaaac cggacatggc actccagtcg ccttcccgtt
4200ccgctatcgg ctgaatttga ttgcgagtga gatatttatg ccagccagcc agacgcagac
4260gcgccgagac agaacttaat gggcccgcta acagcgcgat ttgctggtga cccaatgcga
4320ccagatgctc cacgcccagt cgcgtaccgt cttcatggga gaaaataata ctgttgatgg
4380gtgtctggtc agagacatca agaaataacg ccggaacatt agtgcaggca gcttccacag
4440caatggcatc ctggtcatcc agcggatagt taatgatcag cccactgacg cgttgcgcga
4500gaagattgtg caccgccgct ttacaggctt cgacgccgct tcgttctacc atcgacacca
4560ccacgctggc acccagttga tcggcgcgag atttaatcgc cgcgacaatt tgcgacggcg
4620cgtgcagggc cagactggag gtggcaacgc caatcagcaa cgactgtttg cccgccagtt
4680gttgtgccac gcggttggga atgtaattca gctccgccat cgccgcttcc actttttccc
4740gcgttttcgc agaaacgtgg ctggcctggt tcaccacgcg ggaaacggtc tgataagaga
4800caccggcata ctctgcgaca tcgtataacg ttactggttt cacattcacc accctgaatt
4860gactctcttc cgggcgctat catgccatac cgcgaaaggt tttgcgccat tcgatggtgt
4920ccgggatctc gacgctctcc cttatgcgac tcctgcatta ggaagcagcc cagtagtagg
4980ttgaggccgt tgagcaccgc cgccgcaagg aatggtgcat gcaaggagat ggcgcccaac
5040agtcccccgg ccacggggcc tgccaccata cccacgccga aacaagcgct catgagcccg
5100aagtggcgag cccgatcttc cccatcggtg atgtcggcga tataggcgcc agcaaccgca
5160cctgtggcgc cggtgatgcc ggccacgatg cgtccggcgt agaggatcga gatctcgatc
5220ccgcgaaatt aatacgactc actatagggg aattgtgagc ggataacaat tcccctctag
5280aaataatttt gtttaacttt aagaaggaga tataccatgg gcagcagcca tcatcatcat
5340catcacagca gcggcctgga agttctgttc caggggcccc atatgctcga ggatccggct
5400gctaacaaag cccgaaagga agctgagttg gctgctgcca ccgctgagca ataactagca
5460taaccccttg gggcctctaa acgggtcttg aggggttttt tgctgaaagg aggaactata
5520tccggatatc ccgcaagagg cccggcagta ccggcataac caagcctatg cctacagcat
5580ccagggtgac ggtgccgagg atgacgatga gcgcattgtt agatttcata cacggtgcct
5640gactgcgtta gcaatttaac tgtgataaac taccgcatta aagcttatcg atgataagct
5700gtcaaacatg agaa
57141181725DNAArtificial SequenceSynthetic, FS_A coding sequence
118atgtcaactt tgcctatttc ttctgtgtca ttttcctctt ctacatcacc attagtcgtg
60gacgacaaag tctcaaccaa gcccgacgtt atcagacata caatgaattt caatgcttct
120atttggggag atcaattctt gacctatgat gagcctgaag atttagttat gaagaaacaa
180ttagtggagg aattaaaaga ggaagttaag aaggaattga taactatcaa aggttcaaat
240gagcccatgc agcatgtgaa attgattgaa ttaattgatg ctgttcaacg tttaggtata
300gcttaccatt ttgaagaaga gatcgaggaa gctttgcaac atatacatgt tacctatggt
360gaacagtggg tggataagga aaatttacag agtatttcat tgtggttcag gttgttgcgt
420caacagggct ttaacgtctc ctctggcgtt ttcaaagact ttatggacga aaaaggtaaa
480ttcaaagagt ctttatgcaa tgatgcacaa ggaatattag ccttatatga agctgcattt
540atgagggttg aagatgaaac catcttagac aatgctttgg aattcacaaa agttcattta
600gatatcatag caaaagaccc atcttgcgat tcttcattgc gtacacaaat ccatcaagcc
660ttaaaacaac ctttaagaag gagattagca aggattgaag cattacatta catgccaatc
720taccaacagg aaacatctca tgatgaagta ttgttgaaat tagccaagtt ggatttcagt
780gttttgcagt ctatgcataa aaaggaattg tcacatatct gtaagtggtg gaaagattta
840gatttacaaa ataagttacc ttatgtacgt gatcgtgttg tcgaaggcta cttctggata
900ttgtccatat actatgagcc acaacacgct agaacaagaa tgtttttgat gaaaacatgc
960atgtggttag tagttttgga cgatactttt gataattatg gaacatacga agaattggag
1020atttttactc aagccgtcga gagatggtct atctcatgct tagatatgtt gcccgaatat
1080atgaaattaa tctaccaaga attagtcaat ttgcatgtgg aaatggaaga atctttggaa
1140aaggagggaa agacctatca gattcattac gttaaggaga tggctaaaga attagttcgt
1200aattacttag tagaagcaag atggttgaag gaaggttata tgcctacttt agaagaatac
1260atgtctgttt ctatggttac tggtacttat ggtttgatga ttgcaaggtc ctatgttggc
1320agaggagaca ttgttactga agacacattc aaatgggttt ctagttaccc acctattatt
1380aaagcttcct gtgtaatagt aagattaatg gacgatattg tatctcacaa ggaagaacaa
1440gaaagaggac atgtggcttc atctatagaa tgttactcta aagaatcagg tgcttctgaa
1500gaggaagcat gtgaatatat tagtaggaaa gttgaggatg cctggaaagt aatcaataga
1560gaatctttgc gtccaacagc cgttcccttc cctttgttaa tgccagcaat aaacttagct
1620agaatgtgtg aggtcttgta ctctgttaat gatggtttta ctcatgctga gggtgacatg
1680aaatcttata tgaagtcctt cttcgttcat cctatggtcg tttga
17251191725DNAArtificial SequenceSynthetic, FS_B coding sequence
119atgtcaacat tgcctatatc ttcagtctca ttctcatctt ctacctcacc attggttgta
60gacgacaaag tttctacaaa gccagacgtc ataaggcata caatgaactt caacgcctct
120atatggggag accagttctt gacctatgac gaaccagagg atttagtcat gaaaaaacag
180ttggtcgagg agttaaagga ggaggttaag aaggagttga tcaccataaa aggttcaaac
240gagcctatgc aacacgtcaa gttgatagag ttaattgacg ctgttcaaag gttaggaatt
300gcatatcatt tcgaagagga gattgaagag gcattgcagc atattcatgt tacttatgga
360gaacaatggg ttgacaagga gaacttgcaa tcaatctctt tatggtttag gttgttaagg
420caacagggat tcaacgtctc ttcaggtgtc tttaaagatt tcatggacga aaagggaaag
480tttaaggagt cattatgcaa cgatgctcaa ggaattttgg cattatatga agctgccttt
540atgagggtag aggacgagac tatattagac aacgcattgg aattcactaa agtccactta
600gacatcatcg caaaggatcc ttcatgcgac tcttctttaa gaacacaaat acatcaagca
660ttgaagcaac ctttgaggag aaggttagca aggatagaag ccttgcacta tatgcctatc
720tatcagcagg aaacatcaca tgatgaagtt ttgttgaagt tggccaaatt ggacttctct
780gtattgcagt caatgcataa aaaggaattg tctcatatct gcaaatggtg gaaggatttg
840gatttgcaga ataagttgcc ttatgttaga gacagagtcg ttgagggata tttctggata
900ttgtctatct actacgagcc tcagcacgct agaacaagaa tgttcttaat gaagacttgc
960atgtggttgg tcgttttaga cgacactttt gacaattacg gtacctacga ggaattagag
1020atcttcactc aagctgtaga gagatggtca atttcatgct tggacatgtt accagagtat
1080atgaagttga tctaccagga gttagtcaac ttacacgtcg agatggaaga atctttggag
1140aaagagggta aaacttatca gatccactat gtcaaggaga tggcaaaaga gttggtaaga
1200aactacttgg tagaagctag atggttgaag gagggttaca tgcctacctt ggaggaatat
1260atgtctgttt ctatggtcac tggaacctac ggattaatga ttgctagatc ttatgtcggt
1320agaggagaca ttgtaaccga agacacattc aagtgggtat catcttatcc acctatcata
1380aaggcctcat gcgttattgt aaggttgatg gatgatattg tatctcacaa agaggaacaa
1440gagaggggac atgtagcatc atctatcgag tgttattcaa aagaatcagg agcatctgaa
1500gaagaagcct gtgagtacat ctctagaaaa gtcgaagatg catggaaagt tatcaacaga
1560gagtcattga ggccaaccgc agtccctttc ccattattaa tgcctgccat aaacttagca
1620agaatgtgcg aagtcttata ttcagttaat gacggtttca cccacgccga gggtgacatg
1680aaatcataca tgaagtcatt ctttgttcac cctatggtag tctaa
17251201725DNAArtificial SequenceSynthetic, FS_C coding sequence
120atgtcaacct tgcctatttc ttctgtctca ttctcttcat ctacctctcc attggtcgta
60gacgataagg tctctactaa accagacgtc atcaggcaca ccatgaattt caacgcttct
120atatggggag accagttttt aacttacgac gaacctgagg atttggtcat gaaaaaacag
180ttggtcgaag aattgaagga ggaggtcaag aaggagttga ttacaatcaa gggatcaaac
240gaacctatgc agcacgttaa gttgatcgaa ttaatagatg ctgtccaaag attgggtata
300gcctaccact tcgaggagga aatcgaggag gctttacaac atatacacgt cacatacggt
360gaacagtggg tcgataaaga gaatttgcag tctatctcat tgtggttcag gttgttaagg
420caacaaggtt ttaatgtttc atctggagtt ttcaaggact ttatggacga gaaaggtaaa
480ttcaaggagt ctttgtgcaa cgatgctcag ggtattttag cattgtatga ggccgcattt
540atgagggttg aagacgagac tatcttagat aacgcattgg agttcaccaa ggtccactta
600gacattattg ctaaagaccc atcatgtgac tcttctttga gaactcaaat acaccaggca
660ttaaagcaac ctttgaggag aaggttggct agaatcgaag cattacacta tatgccaata
720tatcagcagg aaacctcaca cgacgaagtt ttgttaaagt tagcaaaatt ggacttctct
780gtcttgcagt caatgcataa gaaggagttg tctcatatct gcaagtggtg gaaggattta
840gatttacaaa ataagttgcc atacgtcaga gatagggttg tagagggata cttctggatc
900ttgtctatat actatgagcc tcagcacgcc agaaccagaa tgttcttaat gaagacctgc
960atgtggttag tagtattaga cgacaccttc gacaattatg gaacatacga ggaattggag
1020atctttactc aagccgttga gagatggtct atttcttgct tggacatgtt gccagagtat
1080atgaagttga tctaccagga gttagttaac ttgcacgtcg aaatggagga atctttggag
1140aaagagggaa agacatacca gattcactat gtcaaggaaa tggccaaaga gttggtaagg
1200aactatttgg ttgaggccag atggttgaaa gagggttata tgcctacctt ggaggagtac
1260atgtcagtct caatggttac tggtacctat ggtttgatga ttgccagatc atacgtcgga
1320agaggtgata tcgtaacaga ggataccttc aagtgggttt cttcataccc tcctatcatt
1380aaggcctctt gcgtcatagt caggttgatg gatgacattg tttctcataa ggaggaacag
1440gagaggggtc acgtagcctc atcaatagag tgctattcaa aagagtctgg tgcatcagag
1500gaagaggcat gtgaatacat ctctagaaaa gtagaggatg cctggaaggt cattaacagg
1560gagtcattga gacctactgc tgtacctttt cctttgttga tgcctgctat caacttggca
1620aggatgtgcg aagttttgta ttcagtaaac gatggtttca ctcacgccga aggtgatatg
1680aaatcatata tgaaatcttt tttcgtacat cctatggtag tataa
172512129DNAArtificial SequenceSynthetic, Primer AM-288-110-CPK1849
121gacacagaag aaataggcaa agttgacat
2912229DNAArtificial SequenceSynthetic, Primer AM-288-110-CPK1903
122cggatccatg tcaactttgc ctatttctt
2912320DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2039
123gaagatccga ggcctagctt
2012444DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2040
124ccaccagtag agacatggga gagtcaaacg accataggat gaac
4412544DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2041
125gttcatccta tggtcgtttg actctcccat gtctctactg gtgg
4412639DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2042
126ggcttctaat ccgtactaga tctgctttaa tttggccgg
3912739DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2043
127ccggccaaat taaagcagat ctagtacgga ttagaagcc
3912833DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2044
128caggtatagc atgaggtcgc tccaattcag ctg
3312933DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2045
129cagctgaatt ggagcgacct catgctatac ctg
3313020DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2046
130aatgagcagt taagcgtatt
2013145DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2051
131gaagaaatag gcaaagttga catggatccg ttctcgaggc agccg
4513250DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2052
132cacgttcgcc ggccaaatta aagcagatct ccacgatgtt gataatgagc
5013350DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2053
133gaagaaatag gcaaagttga catggatccg ttcttaattg ttattcgtac
5013450DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2054
134cacgttcgcc ggccaaatta aagcagatct tccaggtatg ggtttgagga
5013550DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2055
135gaagaaatag gcaaagttga catggatccg tgtgatgatg ttttatttgt
5013642DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2056
136ccggccaaat taaagcagat ctaacggcgg gattcctcta tg
4213750DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2059
137gaagaaatag gcaaagttga catggatccg tttgattgat ttgactgtgt
5013850DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2060
138cacgttcgcc ggccaaatta aagcagatct gtaataaaca caccccgcgt
5013950DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2061
139gaagaaatag gcaaagttga catggatccg ttttagttta tgtatgtgtt
5014046DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2062
140cacgttcgcc ggccaaatta aagcagatct acgaagagtt tgaatc
4614150DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2063
141gaagaaatag gcaaagttga catggatccg tttgaatatg tattacttgg
5014250DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2064
142cacgttcgcc ggccaaatta aagcagatct cctcctttcc ccatgtttcc
5014350DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2065
143gaagaaatag gcaaagttga catggatccg tgttgtattt agtttttttt
5014450DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2066
144cacgttcgcc ggccaaatta aagcagatct tccttctttt cctcttgata
5014550DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2067
145gaagaaatag gcaaagttga catggatccg cttgactata cttttttata
5014644DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2068
146cacgttcgcc ggccaaatta aagcagatct ttgcatcgcc ctgc
4414750DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2073
147gaagaaatag gcaaagttga catggatccg gtttagttaa ttatagttcg
5014850DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2074
148cacgttcgcc ggccaaatta aagcagatct acccaaaatg tgaaagaaat
5014949DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2079
149gaagaaatag gcaaagttga catggatccg tgttttatat ttgttgtaa
4915038DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2080
150ccaaattaaa gcagatctgg catttgcaag aattactc
3815150DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2085
151gaagaaatag gcaaagttga catggatccg ggctatttgc ttatatgtat
5015250DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2086
152cacgttcgcc ggccaaatta aagcagatct atttcctttt cttcctctta
5015346DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2087
153gaagaaatag gcaaagttga catggatccg tttgttcttt ctggaa
4615450DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2088
154cacgttcgcc ggccaaatta aagcagatct tgtgttacgt atctttgatg
5015549DNAArtificial SequenceSynthetic, Primer AM-288-160-CPK2089
155gaagaaatag gcaaagttga catggatccg gttttagtgt gtgaatgaa
4915611151DNAArtificial SequenceSynthetic, Expression plasmid pAM552
156tcgcgcgttt cggtgatgac ggtgaaaacc tctgacacat gcagctcccg gagacggtca
60cagcttgtct gtaagcggat gccgggagca gacaagcccg tcagggcgcg tcagcgggtg
120ttggcgggtg tcggggctgg cttaactatg cggcatcaga gcagattgta ctgagagtgc
180accatatcga ctacgtcgta aggccgtttc tgacagagta aaattcttga gggaactttc
240accattatgg gaaatgcttc aagaaggtat tgacttaaac tccatcaaat ggtcaggtca
300ttgagtgttt tttatttgtt gtattttttt ttttttagag aaaatcctcc aatatcaaat
360taggaatcgt agtttcatga ttttctgtta cacctaactt tttgtgtggt gccctcctcc
420ttgtcaatat taatgttaaa gtgcaattct ttttccttat cacgttgagc cattagtatc
480aatttgctta cctgtattcc tttactatcc tcctttttct ccttcttgat aaatgtatgt
540agattgcgta tatagtttcg tctaccctat gaacatattc cattttgtaa tttcgtgtcg
600tttctattat gaatttcatt tataaagttt atgtacaaat atcataaaaa aagagaatct
660ttttaagcaa ggattttctt aacttcttcg gcgacagcat caccgacttc ggtggtactg
720ttggaaccac ctaaatcacc agttctgata cctgcatcca aaaccttttt aactgcatct
780tcaatggcct taccttcttc aggcaagttc aatgacaatt tcaacatcat tgcagcagac
840aagatagtgg cgatagggtc aaccttattc tttggcaaat ctggagcaga accgtggcat
900ggttcgtaca aaccaaatgc ggtgttcttg tctggcaaag aggccaagga cgcagatggc
960aacaaaccca aggaacctgg gataacggag gcttcatcgg agatgatatc accaaacatg
1020ttgctggtga ttataatacc atttaggtgg gttgggttct taactaggat catggcggca
1080gaatcaatca attgatgttg aaccttcaat gtagggaatt cgttcttgat ggtttcctcc
1140acagtttttc tccataatct tgaagaggcc aaaagattag ctttatccaa ggaccaaata
1200ggcaatggtg gctcatgttg tagggccatg aaagcggcca ttcttgtgat tctttgcact
1260tctggaacgg tgtattgttc actatcccaa gcgacaccat caccatcgtc ttcctttctc
1320ttaccaaagt aaatacctcc cactaattct ctgacaacaa cgaagtcagt acctttagca
1380aattgtggct tgattggaga taagtctaaa agagagtcgg atgcaaagtt acatggtctt
1440aagttggcgt acaattgaag ttctttacgg atttttagta aaccttgttc aggtctaaca
1500ctaccggtac cccatttagg accagccaca gcacctaaca aaacggcatc aaccttcttg
1560gaggcttcca gcgcctcatc tggaagtggg acacctgtag catcgatagc agcaccacca
1620attaaatgat tttcgaaatc gaacttgaca ttggaacgaa catcagaaat agctttaaga
1680accttaatgg cttcggctgt gatttcttga ccaacgtggt cacctggcaa aacgacgatc
1740ttcttagggg cagacattac aatggtatat ccttgaaata tatataaaaa aaggcgcctt
1800agaccgctcg gccaaacaac caattacttg ttgagaaata gagtataatt atcctataaa
1860tataacgttt ttgaacacac atgaacaagg aagtacagga caattgattt tgaagagaat
1920gtggattttg atgtaattgt tgggattcca tttttaataa ggcaataata ttaggtatgt
1980ggatatacta gaagttctcc tcgaccgtcg atatgcggtg tgaaataccg cacagatgcg
2040taaggagaaa ataccgcatc aggaaattgt aaacgttaat attttgttaa aattcgcgtt
2100aaatttttgt taaatcagct cattttttaa ccaataggcc gaaatcggca aaatccctta
2160taaatcaaaa gaatagaccg agatagggtt gagtgttgtt ccagtttgga acaagagtcc
2220actattaaag aacgtggact ccaacgtcaa agggcgaaaa accgtctatc agggcgatgg
2280cccactacgt ggaagatccg aggcctagct ttaacgaacg cagaattttc gagttattaa
2340acttaaaata cgctgaaccc gaacatagaa atatcgaatg ggaaaaaaaa actgcataaa
2400ggcattaaaa gaggagcgaa ttttttttta ataaaaatct taataatcat taaaagataa
2460ataatagtct atatatacgt atataaataa aaaatattca aaaaataaaa taaactatta
2520ttttagcgta aaggatgggg aaagagaaaa gaaaaaaatt gatctatcga tttcaattca
2580attcaattta tttcttttcg gataagaaag caacacctgg caattcctta ccttccaata
2640attccaaaga agcaccacca ccagtagaga catgggagac ccgggccatg gttagataga
2700catagggtaa actagcaatg atttgatcaa atgcttgtat tcatctccca ttctcgtaaa
2760attgtcttta cctgcatatt ggacctctaa aaattggcaa agatatataa cagccataag
2820taaaggtctt gggatattct ttgttgttaa atactctctg tttatgtctt tccaaacgtc
2880ctccacttcc ttataaatca gtgtctgagc atattcttcg ttgacattgt attccttcat
2940gtaagattct aaagagcttg aactatgttt tctctcctgt tccgctttat gagtcatcag
3000gtcatttaat ctcctaccca gaataccact gtaacggaat aaaggcggag cagatacagc
3060ccactcaact gattccttag tgaaaatatc gctcattcct agataacagg tagttgttag
3120caagtttgca ccaccagtga taataactac gggatcgtgc tcttcagttg tcggtatgtg
3180tccttcatta gcccatttcg cttctaccat tagattcctt acgaattctt taacgaactc
3240cttcccacag ttgaataaat cagttctacc ttctttggcc agaaactcct ccatttctgt
3300gtaggtatcc atgaataatt tgtaaatagg cttcatgtat tccggcaacg tgtctaagca
3360ggtgatcgac catctttcca cggcttcagt gaaaatcttt aactcctcgt aagttccata
3420tgcgtcatac gtgtcatcaa taagtgttat cacagcaact gccttagtga aaaaaactct
3480agctcttgaa tactggggtt cgtaaccaga acctaaaccc caaaaatagc attcaacgat
3540acgatctctc agacatgggg catttttctt aatatcaaat gccttccacc acttgcatac
3600gtgactcaac tcttccttat gtaggctctg caatagattg aactccagtt tagctaactt
3660tagcagagtt ttattatggg agtcttgttg ctgatagaag ggtatgtact gggcggcctc
3720gatccttggc aatctcttcc acaatggttg ctttaaagct ctctggattt cagtgaataa
3780agcggggttt gtactaaacg cgtcctttgt cataatcgat agccttgatc ttgtgaatcc
3840cagggcatct tcaagaatta tttcgcccgg aactctcatg gacgtagcct catataattc
3900caacaatcct tcaacatcat tcgctaacga ttgtttaaaa gcaccattct tgtctttata
3960gttattaaac acatcacacg tgacatagta tccttgttta cgcatcagcc taaaccataa
4020gctagacctg tcgccattcc aattatcacc ataggtctcg taaatacatt gcaatgcatg
4080atcaatttca cgttcaaaat gatacggaat acctaaacgt tgaatctcgt caatcagctt
4140caacaaattt gcatgtttca taggaatatc caatgcttcc tttaacaact gtcttacttc
4200cttctttaga tcgtttacta tttgctccac accctgttca acttgtttct cataaatcaa
4260aaattgatcg ccccaaatag aaggtgggaa atttgcaatt ggccttatag gtttctcttc
4320agtcaaggcc attgttttct gcagatccgg ggttttttct ccttgacgtt aaagtataga
4380ggtatattaa caattttttg ttgatacttt tattacattt gaataagaag taatacaaac
4440cgaaaatgtt gaaagtatta gttaaagtgg ttatgcagtt tttgcattta tatatctgtt
4500aatagatcaa aaatcatcgc ttcgctgatt aattacccca gaaataaggc taaaaaacta
4560atcgcattat catcctatgg ttgttaattt gattcgttca tttgaaggtt tgtggggcca
4620ggttactgcc aatttttcct cttcataacc ataaaagcta gtattgtaga atctttattg
4680ttcggagcag tgcggcgcga ggcacatctg cgtttcagga acgcgaccgg tgaagacgag
4740gacgcacgga ggagagtctt ccttcggagg gctgtcaccc gctcggcggc ttctaatccg
4800tactaagatc tgctttaatt tggccggcga acgtggcgag aaaggaaggg aagaaagcga
4860aaggagcggg cgctagggcg ctggcaagtg tagcggtcac gctgcgcgta accaccacac
4920ccgccgcgct taatgcgccg ctacagggcg cgtcgcgcca ttcgccattc aggctgcgca
4980actgttggga agggcgatcg gtgcgggcct cttcgctatt acgccagctg aattggagcg
5040acctcatgct atacctgaga aagcaacctg acctacagga aagagttact caagaataag
5100aattttcgtt ttaaaaccta agagtcactt taaaatttgt atacacttat tttttttata
5160acttatttaa taataaaaat cataaatcat aagaaattcg cttatttaga agtgtcaaca
5220acgtatctac caacgatttg acccttttcc atcttttcgt aaatttctgg caaggtagac
5280aagccgacaa ccttgattgg agacttgacc aaacctctgg cgaagaattg ttaattaaga
5340gtcagtcgac ttaaaaacta gggaccaata gcaattctgt tttacgttgc attgttgcac
5400ctgaactttc cgtcatgtca atttgatcat atgaaactcc attgggcaac ttccagttga
5460aatgataaag aatgttggct agtggcagtt gaacattggc caaacctaac gcagcgccag
5520gacacatacg acgtccagcc ccaaatggta aatattcata ttcggcgccc atcactgttg
5580ccgaagagtt ttcaaatctt tcaggtataa acgcttctgc atccttccag tattcaggat
5640ctctattgat cgcaaacaca ttaacgatta atttcgtttt gttagggata ttataaccag
5700ccaagtttac tggctgacga cattctctag gtagcactaa cggcaagggt gggtgtagtc
5760taagagtctc tttgatgacc atattcaagt aggacaattc ttgtatatct tcttcatgta
5820ttttttcttt cccattcaag gccttacgta attcagcctg aaccttttcc attgctttcg
5880gacattttat tagctcgctt atagcccatt ctatggtaga acttgaagtg tcggtccctg
5940caccgaacat gtccaaaatt attgctttga tattatccga agtcagagga aactcagcag
6000aatcctttaa tctaagtaat acatctaata gggtttcgtt ggttttggat gacgtattta
6060cggtatgttc agctaccaaa ttgtcaatta agttatcaat ctttttacgt aggctagtta
6120atcttgctct cttaccgctc aagtgatgca agaacttttt agatgggaaa atatcggcaa
6180catcgaaacc gcctgtttgt ctcagtattt ctttaacaat ttcagtaagt tccttttgat
6240ctttaattcc cttaccaaac gcagcacggg atagtatagt ggcaattagt ttaaaaacgt
6300tttcacttaa atttactggt ctaccactac ctgaagcctt tatttcctgg actaaattcc
6360aacattcttc ttccctcaac gattgaaatg acttaacctt ttttacagac aacaattcaa
6420gagtacaaat cttccttaat tgtctccagt attccccata tggagcaagg acaacatcag
6480tgttatgata taaaactatt tccccagtta aagtttcggg tctattagcg aaagtaatat
6540cgtaggttgt aagaatttcc ttagcccact taggactcga cacgactatt gtgggtacct
6600ctcccaattg aaggtgcatt agcgaaccat attttctcgc taaatccctt acacccctgt
6660gtggtgtggt tccgatcaaa tggtgcatgt gaccaatgat gggtagcctc caaggttccg
6720gcaaggactt tttagttgac ttacttctag tggcaaattt gtacacgaac aacaaaatag
6780ttgctaaagc aattgatgta gttaaagata gtgccatagc ctttaaaatt gacttcattg
6840ttttcctagg cctttagtga gggttgaatt cgaattttca aaaattctta cttttttttt
6900ggatggacgc aaagaagttt aataatcata ttacatggca ttaccaccat atacatatcc
6960atatacatat ccatatctaa tcttacttat atgttgtgga aatgtaaaga gccccattat
7020cttagcctaa aaaaaccttc tctttggaac tttcagtaat acgcttaact gctcattgct
7080atattgaagt acggattaga agccgccgag cgggtgacag ccctccgaag gaagactctc
7140ctccgtgcgt cctcgtcttc accggtcgcg ttcctgaaac gcagatgtgc ctcgcgccgc
7200actgctccga acaataaaga ttctacaata ctagctttta tggttatgaa gaggaaaaat
7260tggcagtaac ctggccccac aaaccttcaa atgaacgaat caaattaaca accataggat
7320gataatgcga ttagtttttt agccttattt ctggggtaat taatcagcga agcgatgatt
7380tttgatctat taacagatat ataaatgcaa aaactgcata accactttaa ctaatacttt
7440caacattttc ggtttgtatt acttcttatt caaatgtaat aaaagtatca acaaaaaatt
7500gttaatatac ctctatactt taacgtcaag gagaaaaaac cccaagctct agctaagatc
7560cgctctaacc gaaaaggaag gagttagaca acctgaagtc taggtcccta tttatttttt
7620tatagttatg ttagtattaa gaacgttatt tatatttcaa atttttcttt tttttctgta
7680cagacgcgtg tacgcatgta acattatact gaaaaccttg cttgagaagg ttttgggacg
7740ctcgaagatc cagctgcatt aatgaatcgg ccaacgcgcg gggagaggcg gtttgcgtat
7800tgggcgctct tccgcttcct cgctcactga ctcgctgcgc tcggtcgttc ggctgcggcg
7860agcggtatca gctcactcaa aggcggtaat acggttatcc acagaatcag gggataacgc
7920aggaaagaac atgtgagcaa aaggccagca aaaggccagg aaccgtaaaa aggccgcgtt
7980gctggcgttt ttccataggc tccgcccccc tgacgagcat cacaaaaatc gacgctcaag
8040tcagaggtgg cgaaacccga caggactata aagataccag gcgtttcccc ctggaagctc
8100cctcgtgcgc tctcctgttc cgaccctgcc gcttaccgga tacctgtccg cctttctccc
8160ttcgggaagc gtggcgcttt ctcatagctc acgctgtagg tatctcagtt cggtgtaggt
8220cgttcgctcc aagctgggct gtgtgcacga accccccgtt cagcccgacc gctgcgcctt
8280atccggtaac tatcgtcttg agtccaaccc ggtaagacac gacttatcgc cactggcagc
8340agccactggt aacaggatta gcagagcgag gtatgtaggc ggtgctacag agttcttgaa
8400gtggtggcct aactacggct acactagaag gacagtattt ggtatctgcg ctctgctgaa
8460gccagttacc ttcggaaaaa gagttggtag ctcttgatcc ggcaaacaaa ccaccgctgg
8520tagcggtggt ttttttgttt gcaagcagca gattacgcgc agaaaaaaag gatctcaaga
8580agatcctttg atcttttcta cggggtctga cgctcagtgg aacgaaaact cacgttaagg
8640gattttggtc atgagattat caaaaaggat cttcacctag atccttttaa attaaaaatg
8700aagttttaaa tcaatctaaa gtatatatga gtaaacttgg tctgacagtt accaatgctt
8760aatcagtgag gcacctatct cagcgatctg tctatttcgt tcatccatag ttgcctgact
8820ccccgtcgtg tagataacta cgatacggga gggcttacca tctggcccca gtgctgcaat
8880gataccgcga gacccacgct caccggctcc agatttatca gcaataaacc agccagccgg
8940aagggccgag cgcagaagtg gtcctgcaac tttatccgcc tccatccagt ctattaattg
9000ttgccgggaa gctagagtaa gtagttcgcc agttaatagt ttgcgcaacg ttgttgccat
9060tgctacaggc atcgtggtgt cacgctcgtc gtttggtatg gcttcattca gctccggttc
9120ccaacgatca aggcgagtta catgatcccc catgttgtgc aaaaaagcgg ttagctcctt
9180cggtcctccg atcgttgtca gaagtaagtt ggccgcagtg ttatcactca tggttatggc
9240agcactgcat aattctctta ctgtcatgcc atccgtaaga tgcttttctg tgactggtga
9300gtactcaacc aagtcattct gagaatagtg tatgcggcga ccgagttgct cttgcccggc
9360gtcaatacgg gataataccg cgccacatag cagaacttta aaagtgctca tcattggaaa
9420acgttcttcg gggcgaaaac tctcaaggat cttaccgctg ttgagatcca gttcgatgta
9480acccactcgt gcacccaact gatcttcagc atcttttact ttcaccagcg tttctgggtg
9540agcaaaaaca ggaaggcaaa atgccgcaaa aaagggaata agggcgacac ggaaatgttg
9600aatactcata ctcttccttt ttcaatatta ttgaagcatt tatcagggtt attgtctcat
9660gagcggatac atatttgaat gtatttagaa aaataaacaa ataggggttc cgcgcacatt
9720tccccgaaaa gtgccacctg aacgaagcat ctgtgcttca ttttgtagaa caaaaatgca
9780acgcgagagc gctaattttt caaacaaaga atctgagctg catttttaca gaacagaaat
9840gcaacgcgaa agcgctattt taccaacgaa gaatctgtgc ttcatttttg taaaacaaaa
9900atgcaacgcg agagcgctaa tttttcaaac aaagaatctg agctgcattt ttacagaaca
9960gaaatgcaac gcgagagcgc tattttacca acaaagaatc tatacttctt ttttgttcta
10020caaaaatgca tcccgagagc gctatttttc taacaaagca tcttagatta ctttttttct
10080cctttgtgcg ctctataatg cagtctcttg ataacttttt gcactgtagg tccgttaagg
10140ttagaagaag gctactttgg tgtctatttt ctcttccata aaaaaagcct gactccactt
10200cccgcgttta ctgattacta gcgaagctgc gggtgcattt tttcaagata aaggcatccc
10260cgattatatt ctataccgat gtggattgcg catactttgt gaacagaaag tgatagcgtt
10320gatgattctt cattggtcag aaaattatga acggtttctt ctattttgtc tctatatact
10380acgtatagga aatgtttaca ttttcgtatt gttttcgatt cactctatga atagttctta
10440ctacaatttt tttgtctaaa gagtaatact agagataaac ataaaaaatg tagaggtcga
10500gtttagatgc aagttcaagg agcgaaaggt ggatgggtag gttatatagg gatatagcac
10560agagatatat agcaaagaga tacttttgag caatgtttgt ggaagcggta ttcgcaatat
10620tttagtagct cgttacagtc cggtgcgttt ttggtttttt gaaagtgcgt cttcagagcg
10680cttttggttt tcaaaagcgc tctgaagttc ctatactttc tagagaatag gaacttcgga
10740ataggaactt caaagcgttt ccgaaaacga gcgcttccga aaatgcaacg cgagctgcgc
10800acatacagct cactgttcac gtcgcaccta tatctgcgtg ttgcctgtat atatatatac
10860atgagaagaa cggcatagtg cgtgtttatg cttaaatgcg tacttatatg cgtctattta
10920tgtaggatga aaggtagtct agtacctcct gtgatattat cccattccat gcggggtatc
10980gtatgcttcc ttcagcacta ccctttagct gttctatatg ctgccactcc tcaattggat
11040tagtctcatc cttcaatgct atcatttcct ttgatattgg atcatactaa gaaaccatta
11100ttatcatgac attaacctat aaaaataggc gtatcacgag gccctttcgt c
1115115779DNAArtificial SequenceSynthetic, Primer ADS-A13-F 157ggagaaaaaa
ccccggatcc atggccttga ctgaagagaa acctataagg ccaattnnka 60atttcccacc
ttctatttg
7915853DNAArtificial SequenceSynthetic, Primer ADS-C260-F 158catttgatat
taagaaaaat gccccannkc tgagagatcg tatcgttgaa tgc
5315930DNAArtificial SequenceSynthetic, Primer ADS-C260-R 159catttttctt
aatatcaaat gccttccacc
3016051DNAArtificial SequenceSynthetic, Primer ADS-A291-F 160caagagctag
agtttttttc actaagnnkg ttgctgtgat aacacttatt g
5116125DNAArtificial SequenceSynthetic, Primer ADS-A291-R 161gaaaaaaact
ctagctcttg aatac
2516246DNAArtificial SequenceSynthetic, Primer ADS-M341-F 162catgaagcct
atttacaaat tattcnnkga tacctacaca gaaatg
4616326DNAArtificial SequenceSynthetic, Primer ADS-M341-R 163aatttgtaaa
taggcttcat gtattc
2616449DNAArtificial SequenceSynthetic, Primer ADS-M406-F 164gttattatca
ctggtggtgc aaacttgcta nnkactacct gttatctag
4916530DNAArtificial SequenceSynthetic, Primer ADS-M406-R 165gtttgcacca
ccagtgataa taactacggg
3016649DNAArtificial SequenceSynthetic, Primer ADS-M418-F 166gttatctagg
aatgagcgat attttcnnka aggaatcagt tgagtgggc
4916724DNAArtificial SequenceSynthetic, Primer ADS-M418-R 167cgctcattcc
tagataacag gtag
2416844DNAArtificial SequenceSynthetic, Primer ADS-F432-F 168gggctgtatc
tgctccgcct ttannkcgtt acagtggtat tctg
4416926DNAArtificial SequenceSynthetic, Primer ADS-F432-R 169ggcggagcag
atacagccca ctcaac
2617050DNAArtificial SequenceSynthetic, Primer ADS-G439-F 170ctttattccg
ttacagtggt attctgnnka ggagattaaa tgacctgatg
5017124DNAArtificial SequenceSynthetic, Primer ADS-G439-R 171gaataccact
gtaacggaat aaag
2417239DNAArtificial SequenceSynthetic, Primer ADS-SM-5' 172gaaaaaaccc
cggatccatg gccttgactg aagagaaac
3917344DNAArtificial SequenceSynthetic, Primer ADS-SM-3' 173ggttagagcg
gatcttagct agcttagata gacatagggt aaac
44174546PRTArtificial SequenceSynthetic, Artemisia annua
Amorpha-4,11-diene Synthase A291V mutant 174Met Ala Leu Thr Glu Glu
Lys Pro Ile Arg Pro Ile Ala Asn Phe Pro1 5
10 15Pro Ser Ile Trp Gly Asp Gln Phe Leu Ile Tyr Glu
Lys Gln Val Glu 20 25 30Gln
Gly Val Glu Gln Ile Val Asn Asp Leu Lys Lys Glu Val Arg Gln 35
40 45Leu Leu Lys Glu Ala Leu Asp Ile Pro
Met Lys His Ala Asn Leu Leu 50 55
60Lys Leu Ile Asp Glu Ile Gln Arg Leu Gly Ile Pro Tyr His Phe Glu65
70 75 80Arg Glu Ile Asp His
Ala Leu Gln Cys Ile Tyr Glu Thr Tyr Gly Asp 85
90 95Asn Trp Asn Gly Asp Arg Ser Ser Leu Trp Phe
Arg Leu Met Arg Lys 100 105
110Gln Gly Tyr Tyr Val Thr Cys Asp Val Phe Asn Asn Tyr Lys Asp Lys
115 120 125Asn Gly Ala Phe Lys Gln Ser
Leu Ala Asn Asp Val Glu Gly Leu Leu 130 135
140Glu Leu Tyr Glu Ala Thr Ser Met Arg Val Pro Gly Glu Ile Ile
Leu145 150 155 160Glu Asp
Ala Leu Gly Phe Thr Arg Ser Arg Leu Ser Ile Met Thr Lys
165 170 175Asp Ala Phe Ser Thr Asn Pro
Ala Leu Phe Thr Glu Ile Gln Arg Ala 180 185
190Leu Lys Gln Pro Leu Trp Lys Arg Leu Pro Arg Ile Glu Ala
Ala Gln 195 200 205Tyr Ile Pro Phe
Tyr Gln Gln Gln Asp Ser His Asn Lys Thr Leu Leu 210
215 220Lys Leu Ala Lys Leu Glu Phe Asn Leu Leu Gln Ser
Leu His Lys Glu225 230 235
240Glu Leu Ser His Val Cys Lys Trp Trp Lys Ala Phe Asp Ile Lys Lys
245 250 255Asn Ala Pro Cys Leu
Arg Asp Arg Ile Val Glu Cys Tyr Phe Trp Gly 260
265 270Leu Gly Ser Gly Tyr Glu Pro Gln Tyr Ser Arg Ala
Arg Val Phe Phe 275 280 285Thr Lys
Val Val Ala Val Ile Thr Leu Ile Asp Asp Thr Tyr Asp Ala 290
295 300Tyr Gly Thr Tyr Glu Glu Leu Lys Ile Phe Thr
Glu Ala Val Glu Arg305 310 315
320Trp Ser Ile Thr Cys Leu Asp Thr Leu Pro Glu Tyr Met Lys Pro Ile
325 330 335Tyr Lys Leu Phe
Met Asp Thr Tyr Thr Glu Met Glu Glu Phe Leu Ala 340
345 350Lys Glu Gly Arg Thr Asp Leu Phe Asn Cys Gly
Lys Glu Phe Val Lys 355 360 365Glu
Phe Val Arg Asn Leu Met Val Glu Ala Lys Trp Ala Asn Glu Gly 370
375 380His Ile Pro Thr Thr Glu Glu His Asp Pro
Val Val Ile Ile Thr Gly385 390 395
400Gly Ala Asn Leu Leu Thr Thr Thr Cys Tyr Leu Gly Met Ser Asp
Ile 405 410 415Phe Thr Lys
Glu Ser Val Glu Trp Ala Val Ser Ala Pro Pro Leu Phe 420
425 430Arg Tyr Ser Gly Ile Leu Gly Arg Arg Leu
Asn Asp Leu Met Thr His 435 440
445Lys Ala Glu Gln Glu Arg Lys His Ser Ser Ser Ser Leu Glu Ser Tyr 450
455 460Met Lys Glu Tyr Asn Val Asn Glu
Glu Tyr Ala Gln Thr Leu Ile Tyr465 470
475 480Lys Glu Val Glu Asp Val Trp Lys Asp Ile Asn Arg
Glu Tyr Leu Thr 485 490
495Thr Lys Asn Ile Pro Arg Pro Leu Leu Met Ala Val Ile Tyr Leu Cys
500 505 510Gln Phe Leu Glu Val Gln
Tyr Ala Gly Lys Asp Asn Phe Thr Arg Met 515 520
525Gly Asp Glu Tyr Lys His Leu Ile Lys Ser Leu Leu Val Tyr
Pro Met 530 535 540Ser
Ile545175585PRTArtificial SequenceSynthetic, Artemisia annua
Amorpha-4,11-diene Synthase A291C mutant 175Ala Arg Thr Glu Met Ile
Ser Ile Ala Ala Asn Asn Ala Ala Met Arg1 5
10 15Pro His Ala Asp Ile Glu Asn Glu Ser Tyr Asn Thr
His Ala Ser Glu 20 25 30Ala
Cys Met Thr Ala Asn Thr Met Ala Leu Thr Glu Glu Lys Pro Ile 35
40 45Arg Pro Ile Ala Asn Phe Pro Pro Ser
Ile Trp Gly Asp Gln Phe Leu 50 55
60Ile Tyr Glu Lys Gln Val Glu Gln Gly Val Glu Gln Ile Val Asn Asp65
70 75 80Leu Lys Lys Glu Val
Arg Gln Leu Leu Lys Glu Ala Leu Asp Ile Pro 85
90 95Met Lys His Ala Asn Leu Leu Lys Leu Ile Asp
Glu Ile Gln Arg Leu 100 105
110Gly Ile Pro Tyr His Phe Glu Arg Glu Ile Asp His Ala Leu Gln Cys
115 120 125Ile Tyr Glu Thr Tyr Gly Asp
Asn Trp Asn Gly Asp Arg Ser Ser Leu 130 135
140Trp Phe Arg Leu Met Arg Lys Gln Gly Tyr Tyr Val Thr Cys Asp
Val145 150 155 160Phe Asn
Asn Tyr Lys Asp Lys Asn Gly Ala Phe Lys Gln Ser Leu Ala
165 170 175Asn Asp Val Glu Gly Leu Leu
Glu Leu Tyr Glu Ala Thr Ser Met Arg 180 185
190Val Pro Gly Glu Ile Ile Leu Glu Asp Ala Leu Gly Phe Thr
Arg Ser 195 200 205Arg Leu Ser Ile
Met Thr Lys Asp Ala Phe Ser Thr Asn Pro Ala Leu 210
215 220Phe Thr Glu Ile Gln Arg Ala Leu Lys Gln Pro Leu
Trp Lys Arg Leu225 230 235
240Pro Arg Ile Glu Ala Ala Gln Tyr Ile Pro Phe Tyr Gln Gln Gln Asp
245 250 255Ser His Asn Lys Thr
Leu Leu Lys Leu Ala Lys Leu Glu Phe Asn Leu 260
265 270Leu Gln Ser Leu His Lys Glu Glu Leu Ser His Val
Cys Lys Trp Trp 275 280 285Lys Ala
Phe Asp Ile Lys Lys Asn Ala Pro Cys Leu Arg Asp Arg Ile 290
295 300Val Glu Cys Tyr Phe Trp Gly Leu Gly Ser Gly
Tyr Glu Pro Gln Tyr305 310 315
320Ser Arg Ala Arg Val Phe Phe Thr Lys Cys Val Ala Val Ile Thr Leu
325 330 335Ile Asp Asp Thr
Tyr Asp Ala Tyr Gly Thr Tyr Glu Glu Leu Lys Ile 340
345 350Phe Thr Glu Ala Val Glu Arg Trp Ser Ile Thr
Cys Leu Asp Thr Leu 355 360 365Pro
Glu Tyr Met Lys Pro Ile Tyr Lys Leu Phe Met Asp Thr Tyr Thr 370
375 380Glu Met Glu Glu Phe Leu Ala Lys Glu Gly
Arg Thr Asp Leu Phe Asn385 390 395
400Cys Gly Lys Glu Phe Val Lys Glu Phe Val Arg Asn Leu Met Val
Glu 405 410 415Ala Lys Trp
Ala Asn Glu Gly His Ile Pro Thr Thr Glu Glu His Asp 420
425 430Pro Val Val Ile Ile Thr Gly Gly Ala Asn
Leu Leu Thr Thr Thr Cys 435 440
445Tyr Leu Gly Met Ser Asp Ile Phe Thr Lys Glu Ser Val Glu Trp Ala 450
455 460Val Ser Ala Pro Pro Leu Phe Arg
Tyr Ser Gly Ile Leu Gly Arg Arg465 470
475 480Leu Asn Asp Leu Met Thr His Lys Ala Glu Gln Glu
Arg Lys His Ser 485 490
495Ser Ser Ser Leu Glu Ser Tyr Met Lys Glu Tyr Asn Val Asn Glu Glu
500 505 510Tyr Ala Gln Thr Leu Ile
Tyr Lys Glu Val Glu Asp Val Trp Lys Asp 515 520
525Ile Asn Arg Glu Tyr Leu Thr Thr Lys Asn Ile Pro Arg Pro
Leu Leu 530 535 540Met Ala Val Ile Tyr
Leu Cys Gln Phe Leu Glu Val Gln Tyr Ala Gly545 550
555 560Lys Asp Asn Phe Thr Arg Met Gly Asp Glu
Tyr Lys His Leu Ile Lys 565 570
575Ser Leu Leu Val Tyr Pro Met Ser Ile 580
585176585PRTArtificial SequenceSynthetic, Artemisia annua
Amorpha-4,11-diene Synthase A291I mutant 176Ala Arg Thr Glu Met Ile
Ser Ile Ala Ala Asn Asn Ala Ala Met Arg1 5
10 15Pro His Ala Asp Ile Glu Asn Glu Ser Tyr Asn Thr
His Ala Ser Glu 20 25 30Ala
Ile Met Thr Ala Asn Thr Met Ala Leu Thr Glu Glu Lys Pro Ile 35
40 45Arg Pro Ile Ala Asn Phe Pro Pro Ser
Ile Trp Gly Asp Gln Phe Leu 50 55
60Ile Tyr Glu Lys Gln Val Glu Gln Gly Val Glu Gln Ile Val Asn Asp65
70 75 80Leu Lys Lys Glu Val
Arg Gln Leu Leu Lys Glu Ala Leu Asp Ile Pro 85
90 95Met Lys His Ala Asn Leu Leu Lys Leu Ile Asp
Glu Ile Gln Arg Leu 100 105
110Gly Ile Pro Tyr His Phe Glu Arg Glu Ile Asp His Ala Leu Gln Cys
115 120 125Ile Tyr Glu Thr Tyr Gly Asp
Asn Trp Asn Gly Asp Arg Ser Ser Leu 130 135
140Trp Phe Arg Leu Met Arg Lys Gln Gly Tyr Tyr Val Thr Cys Asp
Val145 150 155 160Phe Asn
Asn Tyr Lys Asp Lys Asn Gly Ala Phe Lys Gln Ser Leu Ala
165 170 175Asn Asp Val Glu Gly Leu Leu
Glu Leu Tyr Glu Ala Thr Ser Met Arg 180 185
190Val Pro Gly Glu Ile Ile Leu Glu Asp Ala Leu Gly Phe Thr
Arg Ser 195 200 205Arg Leu Ser Ile
Met Thr Lys Asp Ala Phe Ser Thr Asn Pro Ala Leu 210
215 220Phe Thr Glu Ile Gln Arg Ala Leu Lys Gln Pro Leu
Trp Lys Arg Leu225 230 235
240Pro Arg Ile Glu Ala Ala Gln Tyr Ile Pro Phe Tyr Gln Gln Gln Asp
245 250 255Ser His Asn Lys Thr
Leu Leu Lys Leu Ala Lys Leu Glu Phe Asn Leu 260
265 270Leu Gln Ser Leu His Lys Glu Glu Leu Ser His Val
Cys Lys Trp Trp 275 280 285Lys Ala
Phe Asp Ile Lys Lys Asn Ala Pro Cys Leu Arg Asp Arg Ile 290
295 300Val Glu Cys Tyr Phe Trp Gly Leu Gly Ser Gly
Tyr Glu Pro Gln Tyr305 310 315
320Ser Arg Ala Arg Val Phe Phe Thr Lys Ile Val Ala Val Ile Thr Leu
325 330 335Ile Asp Asp Thr
Tyr Asp Ala Tyr Gly Thr Tyr Glu Glu Leu Lys Ile 340
345 350Phe Thr Glu Ala Val Glu Arg Trp Ser Ile Thr
Cys Leu Asp Thr Leu 355 360 365Pro
Glu Tyr Met Lys Pro Ile Tyr Lys Leu Phe Met Asp Thr Tyr Thr 370
375 380Glu Met Glu Glu Phe Leu Ala Lys Glu Gly
Arg Thr Asp Leu Phe Asn385 390 395
400Cys Gly Lys Glu Phe Val Lys Glu Phe Val Arg Asn Leu Met Val
Glu 405 410 415Ala Lys Trp
Ala Asn Glu Gly His Ile Pro Thr Thr Glu Glu His Asp 420
425 430Pro Val Val Ile Ile Thr Gly Gly Ala Asn
Leu Leu Thr Thr Thr Cys 435 440
445Tyr Leu Gly Met Ser Asp Ile Phe Thr Lys Glu Ser Val Glu Trp Ala 450
455 460Val Ser Ala Pro Pro Leu Phe Arg
Tyr Ser Gly Ile Leu Gly Arg Arg465 470
475 480Leu Asn Asp Leu Met Thr His Lys Ala Glu Gln Glu
Arg Lys His Ser 485 490
495Ser Ser Ser Leu Glu Ser Tyr Met Lys Glu Tyr Asn Val Asn Glu Glu
500 505 510Tyr Ala Gln Thr Leu Ile
Tyr Lys Glu Val Glu Asp Val Trp Lys Asp 515 520
525Ile Asn Arg Glu Tyr Leu Thr Thr Lys Asn Ile Pro Arg Pro
Leu Leu 530 535 540Met Ala Val Ile Tyr
Leu Cys Gln Phe Leu Glu Val Gln Tyr Ala Gly545 550
555 560Lys Asp Asn Phe Thr Arg Met Gly Asp Glu
Tyr Lys His Leu Ile Lys 565 570
575Ser Leu Leu Val Tyr Pro Met Ser Ile 580
585
User Contributions:
Comment about this patent or add new information about this topic:
People who visited this patent also read: | |
Patent application number | Title |
---|---|
20130294832 | FLAME INDICATOR |
20130294831 | THERMOPLASTIC DIE BOX WITH QUICK HEIGHT ADJUSTMENT MECHANISM |
20130294830 | Road Construction Machine, Leveling Device, As Well As Method For Controlling The Milling Depth Or Milling Slope In A Road Construction Machine |
20130294829 | CHANGE-OVER COUPLING |
20130294828 | AUTOMATIC RELEASER WITH WIRELESS CONTROLS |