Patent application title: NOVEL HUMAN MICRORNAS ASSOCIATED WITH CANCER
Inventors:
Thomas Litman (Vaerlose, DK)
Søren Møller (Holte, DK)
Søren Morgenthaler Echwald (Humlebaek, DK)
Morten Lindow (Kobenhavn V, DK)
Anders Martin Bøgild Jacobsen (Kobenhavn V, DK)
Anders Staermose Krogh (Kobenhavn O, DK)
Sanne Nygaard (Bronshoj, DK)
Rolf Søkilde (Kobenhavn N, DK)
Assignees:
EXIQON A/S
IPC8 Class: AC07H2102FI
USPC Class:
514 44 R
Class name:
Publication date: 2012-07-19
Patent application number: 20120184603
Abstract:
The invention provides new sequences for human microRNAs associated with
cancer which may be used as molecular markers for cancer diagnostics or
as therapeutic targets or agents.Claims:
1. A compound which comprises a contiguous nucleobase sequence of between
a total of 8 to 30 nucleobases, wherein the contiguous sequence is
identical or complementary to a nucleotide sequence present in a nucleic
acid sequence selected from the group consisting of SEQ ID NOS 538, 539,
and 540.
2. The compound according to claim 1, wherein the contiguous nucleobase sequence is in the form of an oligonucleotide.
3. The compound according to claim 1, wherein the contiguous nucleotide sequence comprises at least one nucleotide analogue.
4. The compound according to claim 2, wherein the oligonucleotide comprises a total of less than 21 nucleobases.
5. The compound according to claim 4, wherein the oligonucleotide comprises a total of between 12 and 20 nucleobases.
6. A conjugate comprising the compound according to claim 1 and at least one non-nucleobase moiety covalently attached thereto.
7. A composition comprising a compound according to claim 1 or the conjugate according to claim 6, and at least one pharmaceutically acceptable diluent, carrier, salt or adjuvant.
8. The compound of claim 1, wherein said compound is a detection probe.
9. The compound of claim 8, wherein the contiguous nucleobase sequence forms a recognition sequence which is able to specifically hybridize or is complementary to, a RNA selected from the group consisting of SEQ ID NOs: 538, 539, and 540.
10. The compound of claim 8, wherein the oligonucleotide comprises nucleoside analogues with regular spacing over part or the entire nucleobases sequence.
11. The compound of claim 10, wherein the regular spacing is a nucleotide analogue at every second, third or fourth nucleobase position, or combination thereof.
12. A collection of detection probes which comprises at least one compound according to claim 8, and at least one further detection probe.
13. The collection of detection probes according to claim 12, which comprises at least one detection probe pair, and optionally at least one further detection probe, wherein one first member of the detection probe pair specifically hybridizes to, or is complementary to, a mature miRNA selected from the odd numbered SEQ IDs No 1-407, or the SEQ IDs listed in the first column of table 3, and the second member of the detection probe pair hybridizes, or is complementary to, the corresponding pre-mature miRNA even numbered SEQ IDs NO 2-408, or the SEQ IDs listed in the second column of table 3, wherein either the first member of the detection probe pair is unable to specifically hybridize to, or is not complementary to, the pre-mature miRNA, and/or the second member of the detection probe pair is unable to specifically hybridze to, or is not complementary to, the mature miRNA.
14. The collection of detection probes according to claim 13, which comprises at least two of said nonidentical detection probe pairs.
15. The collection of detection probes according to claim 12, which comprises at least one further detection probe comprising a recognition sequence consisting of nucleobases, wherein the detection probe is able to specifically hybridze to at least one RNA selected from the group comprising: hsa mIR 21, hsa-Let 7i, hsa miR 101, hsa miR 145, hsa miR 9, hsa miR122a, hsa miR 128b, hsa miR 149, hsa miR 125a, hsa miR 143, hsa miR 136, and hsa-miR 205.
16. The collection of detection probes according to claim 12, which further comprises at least one detection probe comprising a recognition sequence consisting of nucleobases, wherein the detection probe is able to specifically hybridize to at least one mRNA or DNA sequence associated with cancer.
17. The collection of detection probes according to claim 12 which comprises at least 5 detection probes.
18. The collection of detection probes according to 17, which comprises at least 30 detection probes.
19. A kit for the characterization of cancer, the kit comprising at least one compound according to claim 8, or a collection of detection probes according to claim 12.
20. A kit according to claim 19, wherein the kit is in the form of, or comprises, an oligonucleotide array.
21. The compound according to claim 3, wherein said nucleotide analogue is a LNA.
22. The compound of claim 1, wherein said compound has a total of 12 to 30 nucleobases.
23. The compound of claim 1, wherein said contiguous sequence is identical to a contiguous sequence present in a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 538, 539, and 540.
24. The compound of claim 23, wherein said compound comprises the sequence of SEQ ID NO: 538, 539, or 540.
25. The compound of claim 23, wherein said compound consists of the sequence of SEQ ID NO: 538, 539, or 540.
26. The compound of claim 1, wherein said contiguous sequence is complementary to a contiguous sequence present in a nucleic acid sequence selected from the group consisting of SEQ ID NOs: 538, 539, and 540.
27. The compound of claim 25, wherein said compound comprises a sequence complementary to SEQ ID NO: 538, 539, or 540.
28. The compound of claim 25, wherein said compound consists of a sequence complementary to SEQ ID NO: 538, 539, or 540.
Description:
CROSS-REFERENCE TO RELATED APPLICATIONS
[0001] This application is a divisional of U.S. application Ser. No. 11/975,644, filed Oct. 19, 2007, which claims benefit of U.S. provisional application Nos. 60/900,801, filed Feb. 7, 2007, and 60/853,410, filed Oct. 20, 2006, each of which is hereby incorporated by reference.
FIELD OF THE INVENTION
[0002] The present invention provides compounds which comprise novel nucleobase sequences which correspond to previously unknown miRNA sequences associated with cancer. The compounds may be used in therapeutics or diagnostics. The invention provides methods for treatment of cancer, and methods for the detection and analysis of non-coding RNAs associated with cancer, such as breast cancer. The invention furthermore relates to collections of oligonucleotide probes for detection and analysis of non-coding RNAs associated with cancer, such as breast cancer.
BACKGROUND OF THE INVENTION
[0003] The present invention relates to the detection and analysis of target nucleotide sequences associated with cancer. The invention provides novel microRNAs, oligonucleotide probes which can detect the novel microRNAs, and methods employing the use of oligonucleotide probes that are useful for detecting and analysing target nucleotide sequences associated with cancer.
[0004] MicroRNAs (miRNAs) have rapidly emerged as an important class of short endogenous RNAs that act as post-transcriptional regulators of gene expression by base-pairing with their target mRNAs. The 19-25 nucleotide (nt) mature miRNAs are processed sequentially from longer hairpin transcripts by the RNAse III ribonucleases Drosha (Lee, Y., et al., 2003. Nature 425: 415-419.) and Dicer (Hutvagner, G., et al., 2001. Science 293: 834-838, Ketting, R. F., et al., 2001. Genes Dev. 15: 2654-2659.). To date more than 3400 microRNAs have been annotated in vertebrates, invertebrates and plants according to the miRBase database release 7.1 in October 2005 (Griffiths-Jones, S. 2004. NAR 32 (Database issue), D109-D111), and many miRNAs that correspond to putative genes have also been identified. Some miRNAs have multiple loci in the genome (Reinhart, B. J., et al., 2002. Genes Dev. 16, 1616-1626.) and occasionally, several miRNA genes are arranged in tandem clusters (Lagos-Quintana, M., et al., 2001. Science 294: 853-858.). Recent bioinformatic predictions combined with array analyses, small RNA cloning and Northern blot validation indicate that the total number of miRNAs in vertebrate genomes is significantly higher than previously estimated and may be as many as 1000 (Bentwich, I., et al., 2005. Nat. Genet. 37: 766-770, Berezikov, E., et al., 2005. Cell 120: 21-24, Xie, X., Lu, J., et al., 2005. Nature 434: 338-345.).
[0005] In a series of publications during recent years, it has become clear that microRNAs are extensively involved in cancer pathogenesis, and microRNA has been shown to be differentially expressed in a number of cancers (Breast cancer: Iorio et al Cancer Res 2005; 65: 7065. Lung cancer: Yanaihara et al Cell Science 2006; 9: 189-198. Chronic lymphocytic leukaemia (CLL): Galin et al PNAS, 2004 101(32):11755-11760. Colon cancer: Cummins et al PNAS 2006, 103 (10):3687-3692. Prostate cancer: Volinia et al PNAS 2006; 103: 2257). In fact, in a landmark paper Lu et al (Nature 2005; 435:834-838) demonstrated that differential expression of microRNA in multiple cancers types, and that signatures based on approximately 200 microRNAs improve classification of poorly differentiated cancers over mRNA profiles.
[0006] Furthermore, the expected complexity of the "microRNA'nome" is far smaller than the human transcriptome with the total number of microRNAs being approximately limited to between 800 to 1000. Therefore, a microRNA cancer signature can be predicted to include from 5-20 microRNAs, suggesting that microRNA based theranostics will be of limited complexity and far more robust than mRNA profiles.
[0007] Taken together microRNA constitutes a new class of non-coding RNAs that plays a significant role in determining gene expression, microRNAs are differentially expressed in human cancers and a series of recent publication show that microRNA classify human cancers; in some cases improvement over mRNA classification is observed.
[0008] The present invention allows for the determination of microRNA signatures that improve the classification of early diagnosed cancers. The microRNA signatures--following from the role of microRNAs in cancer--reveal the true cancerous potential of the tumor, and enable physicians to select the appropriate treatment. microRNA based cancer classification may significantly benefit patient care, because recurrence rate may be improved due to adequate treatment of traditionally classified low risk patients, and suitable therapy, such as adjuvant chemotherapy for breast cancer may be deselected for the large group of patients that do not benefit from it.
[0009] PCT/DK2005/000838, and U.S. application Ser. No. 11/324,177, both hereby incorporated by reference, discloses methods for the detection of microRNAs (miRNAs) using oligonucleotides which comprise nucleotide analogues, such as locked nucletic acids (LNAs).
[0010] WO2005/098029, hereby incorporated by reference, discloses a method using oligonucleotides for the detection, quantification, monitoring of expression of siRNA and/or miRNA. It is suggested that the method can be used for determining the differences between nucleic acid samples from e.g. a cancer patient.
[0011] The Sanger Institute publishes known miRNA sequences in the miRBase database. To date there are 533 human siRNAs present in the miRBase database.
[0012] WO2006/015312 discloses sets of genetic markers which can be correlated with a prognosis of breast cancer.
[0013] Iorio et al, (Cancer Res 2005; 65 (16), pp 7065-7070) discloses miRNAs whose expression profile is altered between breast cancer tumors and non tumor cells.
SUMMARY OF THE INVENTION
[0014] The invention provides a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobase sequence present in a nucleobase sequence selected from the group consisting of: SEQ ID No 1 and/or 2; SEQ ID No 3 and/or 4; SEQ ID No 5 and/or 6; SEQ ID No 7 and/or 8; SEQ ID No 9 and/or 10; SEQ ID No 11 and/or 12; SEQ ID No 13 and/or 14; SEQ ID No 15 and/or 16; SEQ ID No 17 and/or 18; SEQ ID No 19 and/or 20; SEQ ID No 21 and/or 22; SEQ ID No 23 and/or 24; SEQ ID No 25 and/or 26; SEQ ID No 27 and/or 28; SEQ ID No 29 and/or 30; SEQ ID No 31 and/or 32; SEQ ID No 33 and/or 34; SEQ ID No 35 and/or 36; SEQ ID No 37 and/or 38; SEQ ID No 39 and/or 40; SEQ ID No 41 and/or 42; SEQ ID No 43 and/or 44; SEQ ID No 45 and/or 46; SEQ ID No 47 and/or 48; SEQ ID No 49 and/or 50; SEQ ID No 51 and/or 52; SEQ ID No 53 and/or 54; SEQ ID No 55 and/or 56; SEQ ID No 57 and/or 58; SEQ ID No 59 and/or 60; SEQ ID No 61 and/or 62; SEQ ID No 63 and/or 64; SEQ ID No 65 and/or 66; SEQ ID No 67 and/or 68; SEQ ID No 69 and/or 70; SEQ ID No 71 and/or 72; SEQ ID No 73 and/or 74; SEQ ID No 75 and/or 76; SEQ ID No 77 and/or 78; SEQ ID No 79 and/or 80; SEQ ID No 81 and/or 82; SEQ ID No 83 and/or 84; SEQ ID No 85 and/or 86; SEQ ID No 87 and/or 88; SEQ ID No 89 and/or 90; SEQ ID No 91 and/or 92; SEQ ID No 93 and/or 94; SEQ ID No 95 and/or 96; SEQ ID No 97 and/or 98; SEQ ID No 99 and/or 100; SEQ ID No 101 and/or 102; SEQ ID No 103 and/or 104; SEQ ID No 105 and/or 106; SEQ ID No 107 and/or 108; SEQ ID No 109 and/or 110; SEQ ID No 111 and/or 112; SEQ ID No 113 and/or 114; SEQ ID No 115 and/or 116; SEQ ID No 117 and/or 118; SEQ ID No 119 and/or 120; SEQ ID No 121 and/or 122; SEQ ID No 123 and/or 124; SEQ ID No 125 and/or 126; SEQ ID No 127 and/or 128; SEQ ID No 129 and/or 130; SEQ ID No 131 and/or 132; SEQ ID No 133 and/or 134; SEQ ID No 135 and/or 136; SEQ ID No 137 and/or 138; SEQ ID No 139 and/or 140; SEQ ID No 141 and/or 142; SEQ ID No 143 and/or 144; SEQ ID No 145 and/or 146; SEQ ID No 147 and/or 148; SEQ ID No 149 and/or 150; SEQ ID No 151 and/or 152; SEQ ID No 153 and/or 154; SEQ ID No 155 and/or 156; SEQ ID No 157 and/or 158; SEQ ID No 159 and/or 160; SEQ ID No 161 and/or 162; SEQ ID No 163 and/or 164; SEQ ID No 165 and/or 166; SEQ ID No 167 and/or 168; SEQ ID No 169 and/or 170; SEQ ID No 171 and/or 172; SEQ ID No 173 and/or 174; SEQ ID No 175 and/or 176; SEQ ID No 177 and/or 178; SEQ ID No 179 and/or 180; SEQ ID No 181 and/or 182; SEQ ID No 183 and/or 184; SEQ ID No 185 and/or 186; SEQ ID No 187 and/or 188; SEQ ID No 189 and/or 190; SEQ ID No 191 and/or 192; SEQ ID No 193 and/or 194; SEQ ID No 195 and/or 196; SEQ ID No 197 and/or 198; SEQ ID No 199 and/or 200; SEQ ID No 201 and/or 202; SEQ ID No 203 and/or 204; SEQ ID No 205 and/or 206; SEQ ID No 207 and/or 208; SEQ ID No 209 and/or 210; SEQ ID No 211 and/or 212; SEQ ID No 213 and/or 214; SEQ ID No 215 and/or 216; SEQ ID No 217 and/or 218; SEQ ID No 219 and/or 220; SEQ ID No 221 and/or 222; SEQ ID No 223 and/or 224; SEQ ID No 225 and/or 226; SEQ ID No 227 and/or 228; SEQ ID No 229 and/or 230; SEQ ID No 231 and/or 232; SEQ ID No 233 and/or 234; SEQ ID No 235 and/or 236; SEQ ID No 237 and/or 238; SEQ ID No 239 and/or 240; SEQ ID No 241 and/or 242; SEQ ID No 243 and/or 244; SEQ ID No 245 and/or 246; SEQ ID No 247 and/or 248; SEQ ID No 249 and/or 250; SEQ ID No 251 and/or 252; SEQ ID No 253 and/or 254; SEQ ID No 255 and/or 256; SEQ ID No 257 and/or 258; SEQ ID No 259 and/or 260; SEQ ID No 261 and/or 262; SEQ ID No 263 and/or 264; SEQ ID No 265 and/or 266; SEQ ID No 267 and/or 268; SEQ ID No 269 and/or 270; SEQ ID No 271 and/or 272; SEQ ID No 273 and/or 274; SEQ ID No 275 and/or 276; SEQ ID No 277 and/or 278; SEQ ID No 279 and/or 280; SEQ ID No 281 and/or 282; SEQ ID No 283 and/or 284; SEQ ID No 285 and/or 286; SEQ ID No 287 and/or 288; SEQ ID No 289 and/or 290; SEQ ID No 291 and/or 292; SEQ ID No 293 and/or 294; SEQ ID No 295 and/or 296; SEQ ID No 297 and/or 298; SEQ ID No 299 and/or 300; SEQ ID No 301 and/or 302; SEQ ID No 303 and/or 304; SEQ ID No 305 and/or 306; SEQ ID No 307 and/or 308; SEQ ID No 309 and/or 310; SEQ ID No 311 and/or 312; SEQ ID No 313 and/or 314; SEQ ID No 315 and/or 316; SEQ ID No 317 and/or 318; SEQ ID No 319 and/or 320; SEQ ID No 321 and/or 322; SEQ ID No 323 and/or 324; SEQ ID No 325 and/or 326; SEQ ID No 327 and/or 328; SEQ ID No 329 and/or 330; SEQ ID No 331 and/or 332; SEQ ID No 333 and/or 334; SEQ ID No 335 and/or 336; SEQ ID No 337 and/or 338; SEQ ID No 339 and/or 340; SEQ ID No 341 and/or 342; SEQ ID No 343 and/or 344; SEQ ID No 345 and/or 346; SEQ ID No 347 and/or 348; SEQ ID No 349 and/or 350; SEQ ID No 351 and/or 352; SEQ ID No 353 and/or 354; SEQ ID No 355 and/or 356; SEQ ID No 357 and/or 358; SEQ ID No 359 and/or 360; SEQ ID No 361 and/or 362; SEQ ID No 363 and/or 364; SEQ ID No 365 and/or 366; SEQ ID No 367 and/or 368; SEQ ID No 369 and/or 370; SEQ ID No 371 and/or 372; SEQ ID No 373 and/or 374; SEQ ID No 375 and/or 376; SEQ ID No 377 and/or 378; SEQ ID No 379 and/or 380; SEQ ID No 381 and/or 382; SEQ ID No 383 and/or 384; SEQ ID No 385 and/or 386; SEQ ID No 387 and/or 388; SEQ ID No 389 and/or 390; SEQ ID No 391 and/or 392; SEQ ID No 393 and/or 394; SEQ ID No 395 and/or 396; SEQ ID No 397 and/or 398; SEQ ID No 399 and/or 400; SEQ ID No 401 and/or 402; SEQ ID No 403 and/or 404; SEQ ID No 405 and/or 406 and SEQ ID No 407 and/or 408, SEQ ID NOs 411 and/or 412; SEQ ID NOs 413; 414 and/or 415; SEQ ID NOs 416 and/or 417; SEQ ID NOs 418; 420; 421 and/or 419; SEQ ID NOs 422 and/or 423; SEQ ID NOS 424 and/or 425; SEQ ID NOS 426; 428 and/or 427; SEQ ID NOS 429; 430; 431; 432 and/or 433; SEQ ID NOS 434 and/or 435; SEQ ID NOS 436 and/or 437; SEQ ID NOS 438 and/or 439; SEQ ID NOS 440 and/or 441, SEQ ID NOS 442 and/or 443, SEQ ID NOS 444, 445 and/or 446, SEQ ID NOS 447 and/or 448, SEQ ID NOS 449, 451 and/or 450, SEQ ID NOS 452 and/or 453, SEQ ID NOS 454 and/or 455, SEQ ID NOS 456 and/or 457, SEQ ID NOS 458 and/or 459, SEQ ID NOS 460 and/or 461, SEQ ID NOS 462 and/or 463, SEQ ID NOS 464 and/or 465, SEQ ID NOS 466, 468 and/or 467, SEQ ID NOS 469, 471, 472 and/or 470, SEQ ID NOS 473 and/or 474, SEQ ID NOS 475, 477 and/or 476, SEQ ID NOS 478 and/or 479, SEQ ID NOS 480 and/or 481, SEQ ID NOS 482 and/or 483, SEQ ID NOS 484 and/or 485, SEQ ID NOS 486 and/or 487, SEQ ID NOS 488 and/or 489, SEQ ID NOS 490, 492, 493 494, and/or 491, SEQ ID NOS 495, 497, 498, 499, 501, 496 and/or 500; SEQ ID NOS 502 and/or 503; SEQ ID NOS 504; 505 and/or 506; SEQ ID NOS 507 and/or 508; SEQ ID NOS 509 and/or 510; SEQ ID NOS 511 and/or 512; SEQ ID NOS 513 and/or 514; SEQ ID NOS 515, 517; and/or 516; SEQ ID NOS 518 and/or 519; SEQ ID NOS 520 and/or 521; SEQ ID NOS 522 and/or 523; SEQ ID NOS 524 and/or 525; SEQ ID NOS 526 and/or 527; SEQ ID NOS 528 and/or 529; SEQ ID NOS 530 and/or 531; SEQ ID NOS 532 and/or 533; SEQ ID NOS 534 and/or 535; SEQ ID NOS 536 and/or 537; SEQ ID NOS 538; 540 and/or 539; SEQ ID NOS 541; 543 and/or 542; SEQ ID NOS 544 and/or 545; SEQ ID NOS 546 and/or 547; SEQ ID NOS 548; 551; 552; 553; and/or 554; SEQ ID NOS 549; 552; 553 and/or 554; SEQ ID NOS 550; 553 and/or 554; SEQ ID NOS 555 and/or 556; SEQ ID NOS 557 and/or 558; and allelic variants thereof.
[0015] The above sequences and their naturally occurring allelic variants are referred to as `target nucleotide(s)` or `target sequence(s)` herein. Preferred groups of target sequences are according to the preferred groups or individual nucleobase sequences referred to herein.
[0016] The invention also provides for new molecular markers for cancer, and the use of such markers in the methods according to the invention, and for use in the collection of probes and/or kits according to the invention.
[0017] The invention also provides detection probes which comprise a continuous sequence of nucleobases according to the compound of the invention. In this respect, in the above list of sequences, from SEQ ID 1 to SEQ ID 408, the list is prepared to highlight pairs of sequences, the first being an odd number (e.g. SEQ ID NO 1), and the second being an even number (e.g. SEQ ID NO 2)--written as `SEQ ID NO 1 and/or 2`, in the above list. The odd number sequence in each pair corresponds to the mature miRNA sequence, whereas the even number corresponds to the pre-mature pre-miRNA sequence. This pairing of SEQ IDs is particularly important when considered the case where the compound of the invention is in the form of a detection probe, where pairs of detection probes (detection probe pairs) may be used to determine the level of a specific miRNA sequence present in the sample, compared to the level of the precursor form of that miRNA. This may provide useful diagnostic information, for example in cancer derived samples.
[0018] However, for SEQ ID NOs 411-558 the miRNAs and their corresponding pre-miRNAs, in addition to related miRNA (and/or related pre-miRNAs) are shown in Table 3. It will be noted that for some miRNAs there are more than one possible pre-miRNA precursor, and in some cases, some pre-miRNAs may result in more than one mature miRNA. Suitably the detection probe pairs may be selected from one (or more) miRNA and one (or more) of the corresponding pre-miRNAs.
DESCRIPTION OF INVENTION
Definitions
[0019] For the purposes of the subsequent detailed description of the invention the following definitions are provided for specific terms, which are used in the disclosure of the present invention:
[0020] In the present context "ligand" means something, which binds. Ligands may comprise biotin and functional groups such as: aromatic groups (such as benzene, pyridine, naphtalene, anthracene, and phenanthrene), heteroaromatic groups (such as thiophene, furan, tetrahydrofuran, pyridine, dioxane, and pyrimidine), carboxylic acids, carboxylic acid esters, carboxylic acid halides, carboxylic acid azides, carboxylic acid hydrazides, sulfonic acids, sulfonic acid esters, sulfonic acid halides, semicarbazides, thiosemicarbazides, aldehydes, ketones, primary alcohols, secondary alcohols, tertiary alcohols, phenols, alkyl halides, thiols, disulphides, primary amines, secondary amines, tertiary amines, hydrazines, epoxides, maleimides, C1-C20 alkyl groups optionally interrupted or terminated with one or more heteroatoms such as oxygen atoms, nitrogen atoms, and/or sulphur atoms, optionally containing aromatic or mono/polyunsaturated hydrocarbons, polyoxyethylene such as polyethylene glycol, oligo/polyamides such as poly-6-alanine, polyglycine, polylysine, peptides, oligo/polysaccharides, oligo/polyphosphates, toxins, antibiotics, cell poisons, and steroids, and also "affinity ligands", i.e. functional groups or biomolecules that have a specific affinity for sites on particular proteins, antibodies, poly- and oligosaccharides, and other biomolecules.
[0021] The singular form "a", "an" and "the" include plural references unless the context clearly dictates otherwise. For example, the term "a cell" includes a plurality of cells, including mixtures thereof. The term "a nucleic acid molecule" includes a plurality of nucleic acid molecules.
[0022] "Transcriptome" refers to the complete collection of transcriptional units of the genome of any species. In addition to protein-coding mRNAs, it also represents non-coding RNAs, such as small nucleolar RNAs, siRNAs, microRNAs and antisense RNAs, which comprise important structural and regulatory roles in the cell.
[0023] A "multi-probe library" or "library of multi-probes" comprises a plurality of multi-probes, such that the sum of the probes in the library are able to recognise a major proportion of a transcriptome, including the most abundant sequences, such that about 60%, about 70%, about 80%, about 85%, more preferably about 90%, and still more preferably 95%, of the target nucleic acids in the transcriptome, are detected by the probes.
[0024] "Sample" refers to a sample of cells, or tissue or fluid isolated from an organism or organisms, including but not limited to, for example, skin, plasma, serum, spinal fluid, lymph fluid, synovial fluid, urine, tears, blood cells, organs, tumors, and also to samples of in vitro cell culture constituents (including but not limited to conditioned medium resulting from the growth of cells in cell culture medium, recombinant cells and cell components).
[0025] The terms "Detection probes" or "detection probe" or "detection probe sequence" refer to an oligonucleotide or oligonucleotide analogue, which oligonucleotide or oligonucleotide analogue comprises a recognition sequence complementary to a nucleotide target, such as an RNA (or DNA) target sequence. It is preferable that the detection probe(s) are oligonucleotides, preferably where said recognition sequence is substituted with high-affinity nucleotide analogues, e.g. LNA, to increase the sensitivity and specificity of conventional oligonucleotides, such as DNA oligonucleotides, for hybridization to short target sequences, e.g. mature miRNAs, stem-loop precursor miRNAs, pri-miRNAs, siRNAs or other non-coding RNAs as well as miRNA binding sites in their cognate mRNA targets, mRNAs, mRNA splice variants, RNA-edited mRNAs, antisense RNAs and small nucleolar RNAs (snRNA).
[0026] The terms "miRNA" and "microRNA" refer to about 18-25 nt non-coding RNAs derived from endogenous genes. They are processed from longer (ca 75 nt) hairpin-like precursors termed pre-miRNAs. MicroRNAs assemble in complexes termed miRNPs and recognize their targets by antisense complementarity. If the microRNAs match 100% their target, i.e. the complementarity is complete, the target mRNA is cleaved, and the miRNA acts like a siRNA. If the match is incomplete, i.e. the complementarity is partial, then the translation of the target mRNA is blocked.
[0027] The terms "Small interfering RNAs" or "siRNAs" refer to 21-25 nt RNAs derived from processing of linear double-stranded RNA. siRNAs assemble in complexes termed RISC(RNA-induced silencing complex) and target homologous RNA sequences for endonucleolytic cleavage. Synthetic siRNAs also recruit RISCs and are capable of cleaving homologous RNA sequences
[0028] The term "RNA interference" (RNAi) refers to a phenomenon where double-stranded RNA homologous to a target mRNA leads to degradation of the targeted mRNA. More broadly defined as degradation of target mRNAs by homologous siRNAs.
[0029] The terms "microRNA precursor" or "miRNA precursor" or "pre-miRNA" or "premature miRNA" refer to polynucleotide sequences (approximately 70 nucleotides in length) that form hairpin-like structures having a loop region and a stem region. The stem region includes a duplex cre-ated by the pairing of opposite ends of the pre-miRNA polynucleotide sequence. The loop region connects the two halves of the stem region. The pre-miRNAs are transcribed as mono- or poly-cistronic, long, primary precursor transcripts (pri-miRNAs) that are then cleaved into individual pre-miRNAs by a nuclear RNAse III-like enzyme. Subsequently pre-miRNA hairpins are exported to the cytoplasm where they are processed by a second RNAse III-like enzyme into miRNAs. The target nucleic acid may be present in a premature miRNA sequence.
[0030] The fragments from the opposing arm, called the miRNA* (or "miRNA-star") sequences (Lau et al, Science (2001) 294:858-862) are found in libraries of cloned miRNAs but typically at much lower frequency than are the miRNAs. For example, in an effort that identified over 3400 clones representing 80 C. elegans miRNAs, only 38 clones representing 14 miRNAs* were found. This approximately 100-fold difference in cloning frequency indicates that the miRNA:miRNA* duplex is generally short lived compared to the miRNA single strand (Bartel et al, Cell (2004) 116:281-297). The target nucleic acid may be present in a miRNA* sequence.
[0031] The "miRNA precursor loop sequence" or "loop sequence of the miRNA precursor" or "loop region" of an miRNA precursor is the portion of an miRNA precursor that is not present in the stem region and that is not retained in the mature miRNA (or its complement) upon cleavage by a RNAse III-like enzyme.
[0032] The "miRNA precursor stem sequence" or "stem sequence of the miRNA precursor" or "stem region" of an miRNA precursor is the portion of an miRNA precursor created by the pairing of opposite ends of the pre-miRNA polynucleotide sequence, and in-cluding the portion of the miRNA precursor that will be retained in the "mature miRNA."
[0033] The term "Recognition sequence" refers to a nucleotide sequence that is complementary to a region within the target nucleotide sequence essential for sequence-specific hybridization between the target nucleotide sequence and the recognition sequence.
[0034] The terms "corresponding to" and "corresponds to" refer to the comparison between the nucleobase sequence of the compound of the invention, and the equivalent nucleotide sequence or the reverse complement thereof. Nucleobases sequences which "correspond to" a SEQ ID, therefore have between 8 and 30 contiguous nucleobases which form a sequence which is found with i) either the one or more of the SEQ ID(s), or ii) the reverse complement thereof. Nucleotide analogues are compared directly to their equivalent or corresponding natural nucleotides. Sequences which form the reverse complement of a SEQ ID are referred to as the complement sequence of the SEQ ID. In a preferably embodiment, the term complementary refers to fully or perfectly complementary.
[0035] The terms "homologues", "variants" and "fragments" in the context of `homologues, variants and fragments thereof` in relation to detection probe sequences and specific detection probes, refers to any sequence which has at least 8 consecutive nucleotide residues (or nucleotide analogues), such as at least 10 consecutive residues (or nucleotide analogues), such as at least 14 consecutive nucleotides (or nucleotide analogues), in common with at least one of the sequences, allowing for no more than 1 mismatch per 8 nucleotides (or nucleotide analogues), preferably with no more than 1 mismatch or no mismatch.
[0036] The term `natural allelic variants` and the term `allelic variants` encompasses both variants which although have a slightly different sequence (such as a homologue, fragment or variant), originate from the same chromosomal position, or the same position on an allelic chromosome, as the non-coding RNAs, and precursors thereof herein listed. The term `natural allelic variants` and the term `allelic variants` also encompasses mature non-coding RNAs encompasses, which may be differentially processed by the processing enzymes, as this may lead to variants of the same microRNAs having different lengths e.g. shortened by 1 or 2 nucleotides, despite originating from the same allelic chromosome position.
[0037] The term "label" as used herein refers to any atom or molecule which can be used to provide a detectable (preferably quantifiable) signal, and which can be attached to a nucleic acid or protein. Labels may provide signals detectable by fluorescence, radioactivity, colorimetric, X-ray diffraction or absorption, magnetism, enzymatic activity, and the like.
[0038] As used herein, the terms "nucleic acid", "polynucleotide" and "oligonucleotide" refer to primers, probes, oligomer fragments to be detected, oligomer controls and unlabeled blocking oligomers and shall be generic to polydeoxyribonucleotides (containing 2-deoxy-D-ribose), to polyribonucleotides (containing D-ribose), to any other type of polynucleotide which is an N glycoside of a purine or pyrimidine base, or modified purine or pyrimidine bases, and in one embodiment, nucleobases (a collective term used to describe both nucleotides and nucleotide analogues, such as LNA). There is no intended distinction in length between the term "nucleic acid", "polynucleotide" and "oligonucleotide", and these terms will be used interchangeably. These terms refer only to the primary structure of the molecule. Thus, these terms include double- and single-stranded DNA, as well as double- and single stranded RNA. The oligonucleotide is comprised of a sequence of approximately at least 3 nucleotides, preferably at least about 6 nucleotides, and more preferably at least about 8-30 nucleotides corresponding to a region of the designated target nucleotide sequence. "Corresponding" means identical to or complementary to the designated sequence. The oligonucleotide is not necessarily physically derived from any existing or natural sequence but may be generated in any manner, including chemical synthesis, DNA replication, reverse transcription or a combination thereof.
[0039] The terms "oligonucleotide" or "nucleic acid" intend a polynucleotide of genomic DNA or RNA, cDNA, semi synthetic, or synthetic origin which, by virtue of its origin or manipulation: (1) is not associated with all or a portion of the polynucleotide with which it is associated in nature; and/or (2) is linked to a polynucleotide other than that to which it is linked in nature; and (3) is not found in nature. Because mononucleotides are reacted to make oligonucleotides in a manner such that the 5'-phosphate of one mononucleotide pentose ring is attached to the 3' oxygen of its neighbour in one direction via a phosphodiester linkage, an end of an oligonucleotide is referred to as the "5' end" if its 5' phosphate is not linked to the 3' oxygen of a mononucleotide pentose ring and as the "3' end" if its 3' oxygen is not linked to a 5' phosphate of a subsequent mononucleotide pentose ring. As used herein, a nucleic acid sequence, even if internal to a larger oligonucleotide, also may be said to have a 5' and 3' ends. When two different, non-overlapping oligonucleotides anneal to different regions of the same linear complementary nucleic acid sequence, the 3' end of one oligonucleotide points toward the 5' end of the other; the former may be called the "upstream" oligonucleotide and the latter the "downstream" oligonucleotide.
[0040] By the term "SBC nucleobases" is meant "Selective Binding Complementary" nucleobases, i.e. modified nucleobases that can make stable hydrogen bonds to their complementary nucleobases, but are unable to make stable hydrogen bonds to other SBC nucleobases. As an example, the SBC nucleobase A', can make a stable hydrogen bonded pair with its complementary unmodified nucleobase, T. Likewise, the SBC nucleobase T' can make a stable hydrogen bonded pair with its complementary unmodified nucleobase, A. However, the SBC nucleobases A' and T' will form an unstable hydrogen bonded pair as compared to the base pairs A'-T and A-T'. Likewise, a SBC nucleobase of C is designated C' and can make a stable hydrogen bonded pair with its complementary unmodified nucleobase G, and a SBC nucleobase of G is designated G' and can make a stable hydrogen bonded pair with its complementary unmodified nucleobase C, yet C' and G' will form an unstable hydrogen bonded pair as compared to the base pairs C'-G and C-G'. A stable hydrogen bonded pair is obtained when 2 or more hydrogen bonds are formed e.g. the pair between A' and T, A and T', C and G', and C' and G. An unstable hydrogen bonded pair is obtained when 1 or no hydrogen bonds is formed e.g. the pair between A' and T', and C' and G'. Especially interesting SBC nucleobases are 2,6-diaminopurine (A', also called D) together with 2-thio-uracil (U', also called 2SU) (2-thio-4-oxo-pyrimidine) and 2-thio-thymine (T', also called 2ST) (2-thio-4-oxo-5-methyl-pyrimidine). FIG. 4 in PCT Publication No. WO 2004/024314 illustrates that the pairs A-2ST and D-T have 2 or more than 2 hydrogen bonds whereas the D-2ST pair forms a single (unstable) hydrogen bond. Likewise the SBC nucleobases pyrrolo-[2,3-d]pyrimidine-2(3H)-one (C', also called PyrroloPyr) and hypoxanthine (G', also called I) (6-oxo-purine) are shown in FIG. 4 in PCT Publication No. WO 2004/024314 where the pairs PyrroloPyr-G and C--I have 2 hydrogen bonds each whereas the PyrroloPyr-I pair forms a single hydrogen bond.
[0041] "SBC LNA oligomer" refers to a "LNA oligomer" containing at least one LNA monomer where the nucleobase is a "SBC nucleobase". By "LNA monomer with an SBC nucleobase" is meant a "SBC LNA monomer". Generally speaking SBC LNA oligomers include oligomers that besides the SBC LNA monomer(s) contain other modified or naturally occurring nucleotides or nucleosides. By "SBC monomer" is meant a non-LNA monomer with a SBC nucleobase. By "isosequential oligonucleotide" is meant an oligonucleotide with the same sequence in a Watson-Crick sense as the corresponding modified oligonucleotide e.g. the sequences agTtcATg is equal to agTscD2SUg where s is equal to the SBC DNA monomer 2-thio-t or 2-thio-u, D is equal to the SBC LNA monomer LNA-D and 2SU is equal to the SBC LNA monomer LNA 2SU.
[0042] The complement of a nucleic acid sequence as used herein refers to an oligonucleotide which, when aligned with the nucleic acid sequence such that the 5' end of one sequence is paired with the 3' end of the other, is in "antiparallel association." Bases not commonly found in natural nucleic acids may be included in the nucleic acids of the present invention include, for example, inosine and 7-deazaguanine. Complementarity may not be perfect; stable duplexes may contain mismatched base pairs or unmatched bases. Those skilled in the art of nucleic acid technology can determine duplex stability empirically considering a number of variables including, for example, the length of the oligonucleotide, percent concentration of cytosine and guanine bases in the oligonucleotide, ionic strength, and incidence of mismatched base pairs.
[0043] Stability of a nucleic acid duplex is measured by the melting temperature, or "Tm". The Tm of a particular nucleic acid duplex under specified conditions is the temperature at which half of the duplexes have disassociated.
[0044] The term "nucleobase" covers the naturally occurring nucleobases adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U) as well as non-naturally occurring nucleobases such as xanthine, diaminopurine, 8-oxo-N6-methyladenine, 7-deazaxanthine, 7-deazaguanine, N4,N4-ethanocytosin, N6,N6-ethano-2,6-diaminopurine, 5-methylcytosine, 5-(C3--C6)-alkynyl-cytosine, 5-fluorouracil, 5-bromouracil, pseudoisocytosine, 2-hydroxy-5-methyl-4-triazolopyridin, isocytosine, isoguanine, inosine and the "non-naturally occurring" nucleobases described in Benner et al., U.S. Pat. No. 5,432,272 and Susan M. Freier and Karl-Heinz Altmann, Nucleic Acid Research, 25: 4429-4443, 1997. The term "nucleobase" thus includes not only the known purine and pyrimidine heterocycles, but also heterocyclic analogues and tautomers thereof. Further naturally and non naturally occurring nucleobases include those disclosed in U.S. Pat. No. 3,687,808; in chapter 15 by Sanghvi, in Antisense Research and Application, Ed. S. T. Crooke and B. Lebleu, CRC Press, 1993; in Englisch, et al., Angewandte Chemie, International Edition, 30: 613-722, 1991 (see, especially pages 622 and 623, and in the Concise Encyclopedia of Polymer Science and Engineering, J. I. Kroschwitz Ed., John Wiley & Sons, pages 858-859, 1990, Cook, Anti-Cancer Drug Design 6: 585-607, 1991, each of which are hereby incorporated by reference in their entirety).
[0045] The term "nucleosidic base" or "nucleobase analogue" is further intended to include heterocyclic compounds that can serve as like nucleosidic bases including certain "universal bases" that are not nucleosidic bases in the most classical sense but serve as nucleosidic bases. Especially mentioned as a universal base is 3-nitropyrrole or a 5-nitroindole. Other preferred compounds include pyrene and pyridyloxazole derivatives, pyrenyl, pyrenylmethylglycerol derivatives and the like. Other preferred universal bases include, pyrrole, diazole or triazole derivatives, including those universal bases known in the art.
[0046] By "oligonucleotide," "oligomer," or "oligo" is meant a successive chain of monomers (e.g., glycosides of heterocyclic bases) connected via internucleoside linkages. The linkage between two successive monomers in the oligo consist of 2 to 4, desirably 3, groups/atoms selected from --CH2--, --O--, --S--, --NRH--, >C═O, >C═NRH, >C═S, --Si(R'')2--, --SO--, --S(O)2--, --P(O)2--, --PO(BH3)--, --P(O,S)--, --P(S)2--, --PO(R'')--, --PO(OCH3)--, and --PO(NHRH)--, where RH is selected from hydrogen and C1-4-alkyl, and R'' is selected from C1-6-alkyl and phenyl. Illustrative examples of such linkages are --CH2--CH2--CH2--, --CH2--CO--CH2--, --CH2--CHOH--CH2--, --O--CH2--O--, --O--CH2--CH2--, --O--CH2--CH═ (including R5 when used as a linkage to a succeeding monomer), --CH2--CH2--O--, --NRH--CH2--CH2--, --CH2--CH2--NRH--, --CH2--NRH--CH2--, --O--CH2--CH2--NRH--, --NRH--CO--O--, --NRH--CO--NRH--, --NRH--CS--NRH--, --NRH--C(═NRH)--NRH--, --NRH--CO--CH2--NRH--, --O--CO--O--, --O--CO--CH2--O--, --O--CH2--CO--O--, --CH2--CO--NRH--, --O--CO--NRH--, --NRH--CO--CH2--, --O--CH2--CO--NRH--, --O--CH2--CH2--NRH--, --CH═N--O--, --CH2--NRH--O--, --CH2--O--N=(including R5 when used as a linkage to a succeeding monomer), --CH2--O--NRH--, --CO--NRH--CH2--, --CH2--NRH--O--, --CH2--NRH--CO--, --O--NRH--CH2--, --O--NRH--, --O--CH2--S--, --S--CH2--O--, --CH2--CH2--S--, --O--CH2--CH2--S--, --S--CH2--CH═(including R5 when used as a linkage to a succeeding monomer), --S--CH2--CH2--, --S--CH2--CH2--O--, --S--CH2--CH2--S--, --CH2--S--CH2--, --CH2--SO--CH2--, --CH2--SO2--CH2--, --O--SO--O--, --O--S(O)2--O--, --O--S(O)2--CH2--, --O--S(O)2--NRH--, --NRH--S(O)2--CH2--, --O--S(O)2--CH2--, --O--P(O)2--O--, --O--P(O,S)--O--, --O--P(S)2--O--, --S--P(O)2--O--, --S--P(O,S)--O--, --S--P(S)2--O--, --O--P(O)2--S--, --O--P(O,S)--S--, --O--P(S)2--S--, --S--P(O)2--S--, --S--P(O,S)--S--, --S--P(S)2--S--, --O--PO(R'')--O--, --O--PO(OCH3)--O--, --O--PO(OCH2CH3)--O--, --O--PO(OCH2CH2S--R)--O--, --O--PO(BH3)--O--, --O--PO(NHRN)--O--, --O--P(O)2--NRH--, --NRH--P(O)2--O--, --O--P(O,NRH)--O--, --CH2--P(O)2--O--, --O--P(O)2--CH2--, and --O--Si(R'')2--O--; among which --CH2--CO--NRH--, --CH2--NRH--O--, --S--CH2--O--, --O--P(O)2--O--, --O--P(O,S)--O--, --O--P(S)2--O--, --NRH--P(O)2--O--, --O--P(O,NRH)--O--, --O--PO(R'')--O--, --O--PO(CH3)--O--, and --O--PO(NHRN)--O--, where RH is selected form hydrogen and C1-4-alkyl, and R'' is selected from C1-6-alkyl and phenyl, are especially desirable. Further illustrative examples are given in Mesmaeker et. al., Current Opinion in Structural Biology 1995, 5, 343-355 and Susan M. Freier and Karl-Heinz Altmann, Nucleic Acids Research, 1997, vol 25, pp 4429-4443. The left-hand side of the internucleoside linkage is bound to the 5-membered ring as substituent P* at the 3'-position, whereas the right-hand side is bound to the 5'-position of a preceding monomer.
[0047] By "LNA" or "LNA monomer" (e.g., an LNA nucleoside or LNA nucleotide) or an LNA oligomer (e.g., an oligonucleotide or nucleic acid) is meant a nucleoside or nucleotide analogue that includes at least one LNA monomer. LNA monomers as disclosed in PCT Publication WO 99/14226 are in general particularly desirable modified nucleic acids for incorporation into an oligonucleotide of the invention. Additionally, the nucleic acids may be modified at either the 3' and/or 5' end by any type of modification known in the art. For example, either or both ends may be capped with a protecting group, attached to a flexible linking group, attached to a reactive group to aid in attachment to the substrate surface, etc. Desirable LNA monomers and their method of synthesis also are disclosed in U.S. Pat. No. 6,043,060, U.S. Pat. No. 6,268,490, PCT Publications WO 01/07455, WO 01/00641, WO 98/39352, WO 00/56746, WO 00/56748 and WO 00/66604 as well as in the following papers: Morita et al., Bioorg. Med. Chem. Lett. 12(1):73-76, 2002; Hakansson et al., Bioorg. Med. Chem. Lett. 11(7):935-938, 2001; Koshkin et al., J. Org. Chem. 66(25):8504-8512, 2001; Kvaerno et al., J. Org. Chem. 66(16):5498-5503, 2001; Hakansson et al., J. Org. Chem. 65(17):5161-5166, 2000; Kvaerno et al., J. Org. Chem. 65(17):5167-5176, 2000; Pfundheller et al., Nucleosides Nucleotides 18(9):2017-2030, 1999; and Kumar et al., Bioorg. Med. Chem. Lett. 8(16):2219-2222, 1998.
[0048] Preferred LNA monomers, also referred to as "oxy-LNA" are LNA monomers which include bicyclic compounds as disclosed in PCT Publication WO 03/020739 wherein the bridge between R4' and R2' as shown in formula (I) below together designate --CH2--O-- or --CH2--CH2--O--.
[0049] By "LNA modified oligonucleotide" or "LNA substituted oligonucleotide" is meant a oligonucleotide comprising at least one LNA monomer of formula (I), described infra, having the below described illustrative examples of modifications:
##STR00001##
wherein X is selected from --O--, --S--, --N(RN)--, --C(R6R6*)--, --O--C(R7R7*)--, --C(R6R6*)--O--, --S--C(R7R7*)--, --C(R6R6*)--S--, --N(RN*)--C(R7R7*)--, --C(R6R6*)--N(RN*)--, and --C(R6R6*)--C(R7R7*).
[0050] B is selected from a modified base as discussed above e.g. an optionally substituted carbocyclic aryl such as optionally substituted pyrene or optionally substituted pyrenylmethylglycerol, or an optionally substituted heteroalicylic or optionally substituted heteroaromatic such as optionally substituted pyridyloxazole, optionally substituted pyrrole, optionally substituted diazole or optionally substituted triazole moieties; hydrogen, hydroxy, optionally substituted C1-4-alkoxy, optionally substituted C1-4-alkyl, optionally substituted C1-4-acyloxy, nucleobases, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands.
[0051] P designates the radical position for an internucleoside linkage to a succeeding monomer, or a 5'-terminal group, such internucleoside linkage or 5'-terminal group optionally including the substituent R5. One of the substituents R2, R2*, R3, and R3* is a group P* which designates an internucleoside linkage to a preceding monomer, or a 2'/3'-terminal group. The substituents of R1*, R4*, R5, R5*, R6, R6*, R7, R7*, RN, and the ones of R2, R2*, R3, and R3* not designating P* each designates a biradical comprising about 1-8 groups/atoms selected from --C(RaRb)--, --C(Ra)═C(Ra)--, --C(Ra)═N--, --C(Ra)--O--, --O--, --Si(Ra)2--, --C(Ra)--S, --S--, --SO2--, --C(Ra)--N(Rb--, --N(Ra)--, and >C=Q, wherein Q is selected from --O--, --S--, and --N(Ra)--, and Ra and Rb each is independently selected from hydrogen, optionally substituted C1-12-alkyl, optionally substituted C2-12-alkenyl, optionally substituted C2-12-alkynyl, hydroxy, C1-12-alkoxy, C2-12-alkenyloxy, carboxy, C1-12-alkoxycarbonyl, C1-12-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, hetero-aryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di(C1-6-alkyl)amino, carbamoyl, mono- and di(C1-6-alkyl)-amino-carbonyl, amino-C1-6-alkyl-aminocarbonyl, mono- and di(C1-6-alkyl)amino-C1-6-alkyl-aminocarbonyl, C1-6-alkyl-carbonylamino, carbamido, C1-6-alkanoyloxy, sulphono, C1-6-alkylsulphonyloxy, nitro, azido, sulphanyl, C1-6-alkylthio, halogen, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, where aryl and heteroaryl may be optionally substituted, and where two geminal substituents Ra and Rb together may designate optionally substituted methylene (═CH2), and wherein two non-geminal or geminal substituents selected from Ra, Rb, and any of the substituents R2, R2*, R3, R3*, R4*, R5, R5*, R6 and R6*, R7, and R7* which are present and not involved in P, P* or the biradical(s) together may form an associated biradical selected from biradicals of the same kind as defined before; the pair(s) of non-geminal substituents thereby forming a mono- or bicyclic entity together with (i) the atoms to which said non-geminal substituents are bound and (ii) any intervening atoms.
[0052] Each of the substituents R1*, R2, R2*, R3, R4*, R5, R5*, R6 and R6*, R7, and R7* which are present and not involved in P, P* or the biradical(s), is independently selected from hydrogen, optionally substituted C1-12-alkyl, optionally substituted C2-12-alkenyl, optionally substituted C2-12-alkynyl, hydroxy, C2-12-alkenyloxy, carboxy, C1-12-alkoxycarbonyl, C1-12-alkylcarbonyl, formyl, aryl, aryloxy-carbonyl, aryloxy, arylcarbonyl, heteroaryl, heteroaryloxy-carbonyl, heteroaryloxy, heteroarylcarbonyl, amino, mono- and di-(C1-6-alkyl)amino, carbamoyl, mono- and di(C1-6-alkyl)-amino-carbonyl, amino-C1-6-alkyl-aminocarbonyl, mono- and di(C1-6-alkyl)amino-C1-6-alkyl-aminocarbonyl, C1-6-alkyl-carbonylamino, carbamido, C1-6-alkanoyloxy, sulphono, C1-6-alkylsulphonyloxy, nitro, azido, sulphanyl, C1-6-alkylthio, halogen, DNA intercalators, photochemically active groups, thermochemically active groups, chelating groups, reporter groups, and ligands, where aryl and heteroaryl may be optionally substituted, and where two geminal substituents together may designate oxo, thioxo, imino, or optionally substituted methylene, or together may form a spiro biradical consisting of a 1-5 carbon atom(s) alkylene chain which is optionally interrupted and/or terminated by one or more heteroatoms/groups selected from --O--, --S--, and --(NRN)-- where RN is selected from hydrogen and C1-4-alkyl, and where two adjacent (non-geminal) substituents may designate an additional bond resulting in a double bond; and RN*, when present and not involved in a biradical, is selected from hydrogen and C1-4-alkyl; and basic salts and acid addition salts thereof.
[0053] Exemplary 5', 3', and/or 2' terminal groups include --H, --OH, halo (e.g., chloro, fluoro, iodo, or bromo), optionally substituted aryl, (e.g., phenyl or benzyl), alkyl (e.g., methyl or ethyl), alkoxy (e.g., methoxy), acyl (e.g. acetyl or benzoyl), aroyl, aralkyl, hydroxy, hydroxyalkyl, alkoxy, aryloxy, aralkoxy, nitro, cyano, carboxy, alkoxycarbonyl, aryloxycarbonyl, aralkoxycarbonyl, acylamino, aroylamino, alkylsulfonyl, arylsulfonyl, heteroarylsulfonyl, alkylsulfinyl, arylsulfinyl, heteroarylsulfinyl, alkylthio, arylthio, heteroarylthio, aralkylthio, heteroaralkylthio, amidino, amino, carbamoyl, sulfamoyl, alkene, alkyne, protecting groups (e.g., silyl, 4,4'-dimethoxytrityl, monomethoxytrityl, or trityl(triphenylmethyl)), linkers (e.g., a linker containing an amine, ethylene glycol, quinone such as anthraquinone), detectable labels (e.g., radiolabels or fluorescent labels), and biotin.
[0054] It is understood that references herein to a nucleic acid unit, nucleic acid residue, LNA monomer, or similar term are inclusive of both individual nucleoside units and nucleotide units and nucleoside units and nucleotide units within an oligonucleotide.
[0055] A "modified base" or other similar terms refer to a composition (e.g., a non-naturally occurring nucleobase or nucleosidic base), which can pair with a natural base (e.g., adenine, guanine, cytosine, uracil, and/or thymine) and/or can pair with a non-naturally occurring nucleobase or nucleosidic base. Desirably, the modified base provides a Tm differential of 15, 12, 10, 8, 6, 4, or 2° C. or less as described herein. Exemplary modified bases are described in EP 1 072 679 and WO 97/12896.
[0056] The term "chemical moiety" refers to a part of a molecule. "Modified by a chemical moiety" thus refer to a modification of the standard molecular structure by inclusion of an unusual chemical structure. The attachment of said structure can be covalent or non-covalent.
[0057] The term "inclusion of a chemical moiety" in an oligonucleotide probe thus refers to attachment of a molecular structure. Such as chemical moiety include but are not limited to covalently and/or non-covalently bound minor groove binders (MGB) and/or intercalating nucleic acids (INA) selected from a group consisting of asymmetric cyanine dyes, DAPI, SYBR Green I, SYBR Green II, SYBR Gold, PicoGreen, thiazole orange, Hoechst 33342, Ethidium Bromide, 1-O-(1-pyrenylmethyl)glycerol and Hoechst 33258. Other chemical moieties include the modified nucleobases, nucleosidic bases or LNA modified oligonucleotides.
[0058] "Oligonucleotide analogue" refers to a nucleic acid binding molecule capable of recognizing a particular target nucleotide sequence. A particular oligonucleotide analogue is peptide nucleic acid (PNA) in which the sugar phosphate backbone of an oligonucleotide is replaced by a protein like backbone. In PNA, nucleobases are attached to the uncharged polyamide backbone yielding a chimeric pseudopeptide-nucleic acid structure, which is homomorphous to nucleic acid forms.
[0059] "High affinity nucleotide analogue" or "affinity-enhancing nucleotide analogue" refers to a non-naturally occurring nucleotide analogue that increases the "binding affinity" of an oligonucleotide probe to its complementary recognition sequence when substituted with at least one such high-affinity nucleotide analogue.
[0060] As used herein, a probe with an increased "binding affinity" for a recognition sequence compared to a probe which comprises the same sequence but does not comprise a stabilizing nucleotide, refers to a probe for which the association constant (Ka) of the probe recognition segment is higher than the association constant of the complementary strands of a double-stranded molecule. In another preferred embodiment, the association constant of the probe recognition segment is higher than the dissociation constant (Kd) of the complementary strand of the recognition sequence in the target sequence in a double stranded molecule.
[0061] Monomers are referred to as being "complementary" if they contain nucleobases that can form hydrogen bonds according to Watson-Crick base-pairing rules (e.g. G with C, A with T or A with U) or other hydrogen bonding motifs such as for example diaminopurine with T, 5-methyl C with G, 2-thiothymidine with A, inosine with C, pseudoisocytosine with G, etc.
[0062] The term "succeeding monomer" relates to the neighbouring monomer in the 5'-terminal direction and the "preceding monomer" relates to the neighbouring monomer in the 3'-terminal direction.
[0063] The term "target nucleic acid" or "target ribonucleic acid" refers to any relevant nucleic acid of a single specific sequence, e.g., a biological nucleic acid, e.g., derived from a patient, an animal (a human or non-human animal), a cell, a tissue, an organism, etc. In one embodiment, the target nucleic acid is derived from a patient, e.g., a human patient. In this embodiment, the invention optionally further includes selecting a treatment, diagnosing a disease, or diagnosing a genetic predisposition to a disease, based upon detection of the target nucleic acid. Whilst the target may be a miRNA, such as the miRNA or pre-miRNA sequences disclosed herein, such as in the context of the target of a detection probe, the target is also used in the context as the target of the miRNA, i.e. the mRNA whose expression is regulated by the miRNA. Table 11 includes human genes whose mRNAs are targeted by the miRNAs disclosed herein.
[0064] "Target sequence" refers to a specific nucleic acid sequence within any target nucleic acid.
[0065] The term "stringent conditions", as used herein, is the "stringency" which occurs within a range from about Tm-5° C. (5° C. below the melting temperature (Tm) of the probe) to about 20° C. to 25° C. below Tm. As will be understood by those skilled in the art, the stringency of hybridization may be altered in order to identify or detect identical or related polynucleotide sequences. Hybridization techniques are generally described in Nucleic Acid Hybridization, A Practical Approach, Ed. Hames, B. D. and Higgins, S. J., IRL Press, 1985; Gall and Pardue, Proc. Natl. Acad. Sci., USA 63: 378-383, 1969; and John, et al. Nature 223: 582-587, 1969.
[0066] In one embodiment the term "specifically hybridise" is determined by whether the oligonucleotide or compound of the invention hybridises to the target nucleic acid sequence (e.g. a SEQ selected from SEQ ID NO 1-408) under stringent conditions.
[0067] The terms "contiguous sequence of nucleobases" and "contiguous nucleobase sequence" are used interchangeably.
DETAILED DESCRIPTION OF THE INVENTION
[0068] New microRNA Markers
[0069] The invention provides 558 new microRNA markers which have not previously been recognised as miRNAs and/or indicated in cancer. The 558 miRNAs were identified in cancer tissue and are considered to be useful indicators of cancer. The present invention provides a detailed expression analysis of both the pre- and mature forms of the miRNAs in various cancers and corresponding healthy tissues, and as such the present invention provides an extensive collection of miRNA sequences which, when in the form of detection probes, can be used, individually, or in the form of collections for cancer diagnostics, and for determining the origin of secondary cancers.
[0070] The new microRNA markers include mature miRNAs and the premature (pre-processed) miRNAs from which they originate.
[0071] The odd numbered SEQ IDs from 1 to 407 are novel mature miRNAs. The even numbers from 2 to 408 are the corresponding pre-mature miRNAs. For SEQ ID Nos 411-558 the miRNAs and their corresponding pre-miRNAs, in addition to related miRNA (and/or related pre-miRNAs) are shown in Table 3.
[0072] The invention provides for a nucleic acid or nucleobase sequence selected from the group consisting of SEQ ID NO 1-558 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid sequence present in said SEQ ID selected from the group consisting of SEQ ID 1-558.
[0073] In one embodiment the contiguous nucleobase sequence (which may be a nuclei acid sequence) is complementary to the (corresponding) region of said SEQ ID.
[0074] In one embodiment the sequence of nucleobases of the contiguous nucleobase sequence (which may be a nuclei acid sequence) is found within the (corresponding) region of said SEQ ID.
[0075] As in the above embodiments, and with reference to the list of embodiments herein and below, the term "corresponding to" may refer to a complementary sequence (preferably 100% complementary) or that the sequence is found within said sequence (i.e. homologous, preferably 100% homologus).
[0076] In one embodiment the SEQ ID is a mature miRNA sequence, i.e. selected from the odd numbered SEQ IDs present in the group consisting of SEQ IDs No 1-407 and/or column 1 of table 3.
[0077] In one embodiment the SEQ ID is a mature miRNA sequence, i.e. selected from the group of miRNAs present in the group consisting of the mature miRNAs listed in Table 5.
[0078] In one embodiment the SEQ ID is a premature miRNA sequence, i.e. selected from the group of pre-miRNAs listed in Table 4.
[0079] In one embodiment the SEQ ID is a pre-mature miRNA sequence, i.e. selected from the even numbered SEQ IDs present in the group consisting of SEQ IDs No 2-408 and/or column 2 of table 3.
[0080] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 1 or 2 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0081] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 3 or 4 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0082] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 5 or 6 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0083] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 7 or 8 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0084] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 9 or 10 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0085] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 11 or 12 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0086] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 13 or 14 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0087] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 15 or 16 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0088] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 17 or 18 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0089] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 19 or 20 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0090] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 21 or 22 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0091] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 23 or 24 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0092] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 25 or 26 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0093] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 27 or 28 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0094] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 29 or 30 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0095] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 31 or 32 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0096] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 33 or 34 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0097] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 35 or 36 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0098] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 37 or 38 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0099] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 39 or 40 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0100] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 41 or 42 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0101] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 43 or 44 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0102] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 45 or 46 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0103] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 47 or 48 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0104] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 49 or 50 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0105] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 51 or 52 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0106] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 53 or 54 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0107] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 55 or 56 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0108] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 57 or 58 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0109] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 59 or 60 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0110] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 61 or 62 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0111] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 63 or 64 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0112] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 65 or 66 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0113] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 67 or 68 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0114] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 69 or 70 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0115] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 71 or 72 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0116] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 73 or 74 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0117] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 75 or 76 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0118] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 77 or 78 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0119] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 79 or 80 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0120] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 81 or 82 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0121] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 83 or 84 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0122] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 85 or 86 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0123] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 87 or 88 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0124] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 89 or 90 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0125] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 91 or 92 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0126] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 93 or 94 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0127] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 95 or 96 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0128] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 97 or 98 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0129] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 99 or 100 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0130] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 101 or 102 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0131] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 103 or 104 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0132] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 105 or 106 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0133] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 107 or 108 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0134] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 109 or 110 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0135] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 111 or 112 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0136] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 113 or 114 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0137] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 115 or 116 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0138] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 117 or 118 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0139] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 119 or 120 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0140] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 121 or 122 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0141] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 123 or 124 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0142] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 125 or 126 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0143] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 127 or 128 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0144] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 129 or 130 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0145] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 131 or 132 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0146] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 133 or 134 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0147] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 135 or 136 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0148] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 137 or 138 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0149] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 139 or 140 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0150] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 141 or 142 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0151] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 143 or 144 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0152] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 145 or 146 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0153] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 147 or 148 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0154] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 149 or 150 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0155] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 151 or 152 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0156] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 153 or 154 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0157] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 155 or 156 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0158] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 157 or 158 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0159] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 159 or 160 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0160] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 161 or 162 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0161] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 163 or 164 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0162] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 165 or 166 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0163] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 167 or 168 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0164] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 169 or 170 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0165] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 171 or 172 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0166] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 173 or 174 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0167] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 175 or 176 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0168] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 177 or 178 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0169] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 179 or 180 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0170] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 181 or 182 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0171] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 183 or 184 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0172] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 185 or 186 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0173] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 187 or 188 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0174] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 189 or 190 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0175] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 191 or 192 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0176] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 193 or 194 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0177] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 195 or 196 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0178] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 197 or 198 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0179] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 199 or 200 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0180] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 201 or 202 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0181] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 203 or 204 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0182] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 205 or 206 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0183] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 207 or 208 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0184] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 209 or 210 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0185] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 211 or 212 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0186] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 213 or 214 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0187] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 215 or 216 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0188] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 217 or 218 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0189] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 219 or 220 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0190] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 221 or 222 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0191] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 223 or 224 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0192] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 225 or 226 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0193] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 227 or 228 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0194] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 229 or 230 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0195] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 231 or 232 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0196] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 233 or 234 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0197] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 235 or 236 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0198] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 237 or 238 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0199] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 239 or 240 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0200] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 241 or 242 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0201] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 243 or 244 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0202] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 245 or 246 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0203] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 247 or 248 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0204] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 249 or 250 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0205] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 251 or 252 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0206] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 253 or 254 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0207] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 255 or 256 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0208] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 257 or 258 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0209] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 259 or 260 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0210] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 261 or 262 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0211] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 263 or 264 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0212] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 265 or 266 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0213] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 267 or 268 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0214] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 269 or 270 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0215] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 271 or 272 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0216] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 273 or 274 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0217] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 275 or 276 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0218] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 277 or 278 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0219] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 279 or 280 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0220] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 281 or 282 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0221] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 283 or 284 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0222] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 285 or 286 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0223] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 287 or 288 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0224] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 289 or 290 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0225] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 291 or 292 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0226] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 293 or 294 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0227] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 295 or 296 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0228] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 297 or 298 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0229] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 299 or 300 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0230] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 301 or 302 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0231] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 303 or 304 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0232] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 305 or 306 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0233] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 307 or 308 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0234] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 309 or 310 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0235] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 311 or 312 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0236] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 313 or 314 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0237] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 315 or 316 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0238] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 317 or 318 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0239] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 319 or 320 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0240] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 321 or 322 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0241] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 323 or 324 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0242] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 325 or 326 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0243] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 327 or 328 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0244] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 329 or 330 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0245] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 331 or 332 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0246] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 333 or 334 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0247] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 335 or 336 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0248] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 337 or 338 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0249] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 339 or 340 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0250] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 341 or 342 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0251] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 343 or 344 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0252] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 345 or 346 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0253] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 347 or 348 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0254] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 349 or 350 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0255] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 351 or 352 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0256] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 353 or 354 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0257] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 355 or 356 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0258] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 357 or 358 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0259] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 359 or 360 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0260] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 361 or 362 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0261] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 363 or 364 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0262] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 365 or 366 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0263] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 367 or 368 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0264] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 369 or 370 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0265] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 371 or 372 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0266] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 373 or 374 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0267] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 375 or 376 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0268] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 377 or 378 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0269] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 379 or 380 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0270] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 381 or 382 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0271] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 383 or 384 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0272] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 385 or 386 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0273] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 387 or 388 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0274] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 389 or 390 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0275] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 391 or 392 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0276] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 393 or 394 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0277] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 395 or 396 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0278] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 397 or 398 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0279] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 399 or 400 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0280] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 401 or 402 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0281] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 403 or 404 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0282] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 405 or 406 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0283] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 407 or 408 and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0284] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 411 and/or 412, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0285] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 413, 414 and/or 415, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0286] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 416 and/or 417, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0287] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 418, 420, 421 and/or 419, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0288] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 422 and/or 423, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0289] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 424 and/or 425, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0290] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 426, 428 and/or 427, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0291] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 429, 430, 431, 432 and/or 433, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0292] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 434 and/or 435, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0293] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 436 and/or 437, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0294] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 438 and/or 439, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0295] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 440 and/or 441, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0296] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 442 and/or 443, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0297] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 444, 445 and/or 446, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0298] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 447 and/or 448, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0299] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 449, 451 and/or 450, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0300] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 452 and/or 453, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0301] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 454 and/or 455, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0302] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 456 and/or 457, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0303] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 458 and/or 459, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0304] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 460 and/or 461, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0305] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 462 and/or 463, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0306] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 464 and/or 465, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0307] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 466, 468 and/or 467, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0308] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 469, 471, 472 and/or 470, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0309] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 473 and/or 474, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0310] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 475, 477 and/or 476, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0311] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 478 and/or 479, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0312] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 480 and/or 481, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0313] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 482 and/or 483, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0314] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 484 and/or 485, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0315] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 486 and/or 487, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0316] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 488 and/or 489, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0317] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 490, 492, 493 494, and/or 491, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0318] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 495, 497, 498, 499, 501, 496 and/or 500, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0319] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 502 and/or 503, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0320] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 504, 505 and/or 506, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0321] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 507 and/or 508, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0322] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 509 and/or 510, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0323] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 511 and/or 512, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0324] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 513 and/or 514, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0325] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 515, 517, and/or 516, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0326] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 518 and/or 519, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0327] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 520 and/or 521, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0328] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 522 and/or 523, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0329] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 524 and/or 525, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0330] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 526 and/or 527, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0331] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 528 and/or 529, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0332] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 530 and/or 531, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0333] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 532 and/or 533, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0334] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 534 and/or 535, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0335] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 536 and/or 537, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0336] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 538, 540 and/or 539, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0337] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 541, 543 and/or 542, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0338] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 544 and/or 545, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0339] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 546 and/or 547, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0340] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 548, 551, 552, 553, and/or 554, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0341] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 549, 552, 553 and/or 554, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0342] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 550, 553 and/or 554, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0343] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 555 and/or 556, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
[0344] In one embodiment, the invention provides for a nucleic acid or nucleobase sequence SEQ ID No 557 and/or 558, and/or a compound which comprises a contiguous sequence of nucleobases of between 8 and 30 nucleobases in length, wherein the nucleobase sequence of the contiguous sequence corresponds to a contiguous nucleic acid or nucleobases sequence present in said SEQ IDs.
A Compound
[0345] In a preferred embodiment, in the compound of the invention, the contiguous sequence of nucleobases is in the form of, or comprises an oligonucleotide.
[0346] The oligonucleotide may comprise nucleotide nucleobases and/or nucleotide analogue nucleobases.
[0347] The oligonucleotide (compound) of the invention may, for example be used in antisense therapy or as a research tool or diagnostic for a disease.
[0348] The oligonucleotide (compound) of the invention may comprises at least one nucleotide analogue, such as a LNA.
[0349] The oligonucleotide (compound) of the invention may comprises between 8 to 30 nucleobases, such as 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, or 29 nucleobases, such as between 14 to 24 nucleobases, such as between 16 and 22 nucleobases, such as between 8 to 14 nucleobases, such as between 12 and 20 nucleobases.
[0350] The oligonucleotide (compound) of the invention may comprise other oligonucleotide analogues in combination with or without LNA. Such analogues may be selected from the group consisting of phosphorothioates or 2'-O-protected nucleotides or combinations thereof.
[0351] Suitable nucleotide analogues include those selected from the group consisting of Locked Nucleic Acid (LNA) units; 2'-O-alkyl-RNA units, 2'-OMe-RNA units, 2'-amino-DNA units, 2'-fluoro-DNA units, PNA units, HNA units, and INA units.
[0352] In one embodiment, the compound according to the invention comprises a duplex formed between the contiguous sequence of nucleobases and a further nucleobase sequence which is complementary to the contiguous sequence of nucleobases.
[0353] In one embodiment, the compound according to the invention is in the form of a siRNA or miRNA.
[0354] In one embodiment the compound of the invention is in the form of a miRNA mimic which can be introduced into a cell to repress the expression of one or more mRNA target(s) present in the cell (such as one or more of the mRNA targets listed in Table 11). miRNA mimics are typically fully complementary to the full length miRNA sequence.
[0355] The invention therefore provides a method of inducing or enhancing miRNA mediated repression of a mRNA target in a cell, said method comprising the step of introducing the compound of the invention into said cell, so as to repress the mRNA target. miRNA mimics are compounds comprising a contiguous nucleobase sequence which are homologous to a corresponding region of one, or more, of the miRNA sequences provided herein (i.e. sense compounds).
[0356] In one embodiment the compound of the invention is an anti-miR which can be introduced into a cell to deactivate miRNA alleviating the miRNA-induced repression of the mRNA target (i.e de-repression).
[0357] The invention therefore provides a method of reducing or deactivating a miRNA in a cell, said method comprising the step of introducing the compound of the invention into said cell, so as to reduce or deactivate said miRNA in the cell. AntimiR compounds comprise a contiguous nucleobase sequence which is complementary to a corresponding region of one, or more, of the miRNA sequences provided herein (i.e. antisense compounds).
[0358] Numerous examples of the application of miRNA micmics and antimiRs are known in the art (Guimaraes-Sternberg et al., Leukemia Research 30(5): 583-595, 2006). For example, WO2007/112754, which is hereby incorporated by reference, provides suitable designs for antimiR compounds according to the invention.
Conjugates
[0359] The invention also provides for a conjugate comprising the compound according to the invention and at least one non-nucleobase moiety covalently attached thereto. Suitable conjugates for use with oligonucleotides/oligonucleobases are known in the art, such as those disclosed in US 2006154888.
Pharmaceutical Composition
[0360] The invention also provides for a pharmaceutical composition comprising a compound according to the invention, or the conjugate according to the invention, and at least one pharmaceutically acceptable diluent, carrier, salt or adjuvant. Suitable pharmaceutically acceptable diluent, carrier, salt or adjuvant are known in the art, such as those disclosed in US 2006154888.
[0361] The compound may be formulated as a prodrug, which is activated once it enters into the cell (such as the prodrug formulations disclosed in US 2006154888).
First Medical Indication
[0362] The invention also provides for the use of a compound according to the invention or the conjugate according to the invention or the pharmaceutical composition according to the invention as a medicament, such as for the treatment of a disease or medical condition selected from the group consisting of: cancer, such as a form of cancer selected from the group consisting of; breast cancer, adrenal gland cancer, bladder cancer, colon cancer, Cervical cancer, cancer of the duodenum, cancer of the esophagus, cancer of the kidney, liver cancer, lung cancer, ovarian cancer, prostate cancer, rectal cancer, stomach cancer and uterine cancer.
[0363] In one embodiment, the type of said cancer may be selected from the group consisting of the following: A solid tumor; ovarian cancer, breast cancer, non-small cell lung cancer, renal cell cancer, bladder cancer, esophagus cancer, stomach cancer, prostate cancer, pancreatic cancer, lung cancer, cervical cancer, colon cancer, colorectal cancer, renal cell cancer;
[0364] The type of cancer may be selected from the group consisting of: A carcinoma, such as a carcinoma selected from the group consisting of ovarian carcinoma, breast carcinoma, non-small cell lung cancer, renal cell carcinoma, bladder carcinoma, recurrent superficial bladder cancer, stomach carcinoma, prostatic carcinoma, pancreatic carcinoma, lung carcinoma, cervical carcinoma, cervical dysplasia, laryngeal papillomatosis, colon carcinoma, colorectal carcinoma, carcinoid tumors, renal cell carcinoma, A basal cell carcinoma; A malignant melanoma, such as a malignant melanoma selected from the group consisting of superficial spreading melanoma, nodular melanoma, lentigo maligna melanoma, acral melagnoma, amelanotic melanoma and desmoplastic melanoma; A sarcoma, such as a sarcoma selected from the group consisting of osteosarcoma, Ewing's sarcoma, chondrosarcoma, malignant fibrous histiocytoma, fibrosarcoma and Kaposi's sarcoma; and a glioma.
[0365] In one embodiment the type of cancer is a teratoma.
Second Medical Indication
[0366] The invention also provides for the use of a compound according to the invention or the conjugate according to the invention or the pharmaceutical composition according to the invention, in the manufacture of a medicament for the treatment of a disease or medical condition selected from the group consisting of cancer, such as breast cancer, or one of the above listed forms of cancer.
Method of Treatment
[0367] The invention also provides for a method of performing therapy comprising administering the compound according to the invention or the conjugate according to the invention or the pharmaceutical composition according to the invention to a patient in need of therapy, such as a patient suffering from, or susceptible to be suffering from cancer, such as breast cancer, or a cancer selected from one of the above listed forms of cancer.
miRNA Seed--Method of Identifying Genes Regulated by miRNAs
[0368] The invention also provides for a method of identifying a target to an miRNA in an organism, comprising acts of: providing a conserved miRNA sequence selected from the group consisting of SEQ ID No 1-558 or natural allelic variants thereof; providing a genome of an organism; defining at least 6 nucleotides (such as between 6 and 30 nucleotides, such as at least 10, 12, 14 or at least 16 nucleotides) of the conserved miRNA sequence as an miRNA seed; identifying a conserved UTR of a gene within the genome of the organism; and identifying the gene as a target of the miRNA by determining whether the conserved UTR comprises a segment having perfect complementarity with the miRNA seed. Table 11 provides a list of human genes whose mRNA are targeted by the miRNAs of the invention.
Method of Modulating Gene Expression
[0369] A method according of modulating the expression of a gene associated with a disease or medical condition, comprising administering the compound according to the invention or the conjugate according to the invention or the pharmaceutical composition according to the invention to a cell so as to modulate the expression of the gene associated with the disease or medical condition. Table 11 provides a list of possible human genes whose mRNA are targeted by the miRNAs of the invention. As described above, the use of miRNA mimics or antimiRs can be used to (optionally) further repress the mRNA targets, or to silence (down-regulate) the miRNA, thereby inhibiting the function of the endogenous miRNA, causing de-repression and increased expression of the mRNA target.
Detection/Oligonucleotide Probes
Detection Probe and Recognition Sequence
[0370] Typically, an oligonucleotide probe (detection probe) of the invention includes a plurality of nucleotide analogue monomers and hybridizes to a miRNA or miRNA precursor. In one embodiment, the nucleotide analogue is LNA, such as alpha and/or xylo LNA monomers. In one embodiment, the oligonucleotide probe hybridizes to the loop sequence of a miRNA precursor, e.g., to 5 nucleotides of the miRNA precursor loop sequence or to the center of the miRNA precursor loop sequence. The oligonucleotide probe may or may not also hybridize to the stem sequence of the miRNA precursor. The oligonucleotide probe may have a number of nucleotide analogue monomers corresponding to 20% to 40% of the probe oligonucleotides. The probes may also have a spacing between nucleotide analogue monomers such that two of the plurality of nucleotide analogue monomers are disposed 3 or 4 nucleotides apart, or a combination thereof. Alternatively, each nucleotide analogue monomer in a probe may be spaced 3 or 4 nucleotides from the closest nucleotide analogue monomer. Typically, when nucleotide analogue monomers are spaced apart, only naturally-occurring nucleotides are disposed between the nucleotide analogue monomers. Alternatively, two, three, four, or more nucleotide analogue monomers may be disposed adjacent to one another. The adjacent nucleotide analogue monomers may or may not be disposed at the 3' or 5' end of the oligonucleotide probe or so that one of the nucleotide analogue monomers hybridizes to the center of the loop sequence of the miRNA precursor. The probe may include none or at most one mismatched base, deletion, or addition. Desirably, the probe hybridizes to the miRNA or precursor thereof under stringent conditions or high stringency conditions. Desirably, the melting point of the duplex formed between the probe and the miRNA precursor is at least 1° C. higher, e.g., at least 5° C., than the melting point of the duplex formed between the miRNA precursor and a nucleic acid sequence not having a nucleotide analogue monomer, or any modified backbone. The probe may include at least 70% DNA; at least 10% nucleotide analogue monomers; and/or at most 30% nucleotide analogue monomers.
[0371] The probe may further include a 5' or 3' amino group and/or a 5' or 3' label, e.g., a fluorescent (such as fluorescein) label, a radioactive label, or a label that is a complex including an enzyme (such as a complex containing digoxigenin (DIG). The probe is for example 8 nucleotides to 30 nucleotides long, e.g., 12 nucleotides long or 15 nucleotides long. Other potential modifications of probes are described herein.
[0372] The probe when hybridized to the miRNA or precursor thereof may or may not provide a substrate for RNase H. Preferably, the probes of the invention exhibit increased binding affinity for the target sequence by at least two-fold, e.g., at least 5-fold or 10-fold, compared to probes of the same sequence without nucleotide analogue monomers, under the same conditions for hybridization, e.g., stringent conditions or high stringency conditions.
[0373] The invention features a computer code for a preferred software program of the invention for the design and selection of the oligonucleotide probes. The invention provides a method, system, and computer program embedded in a computer readable medium ("a computer program product") for designing oligonucleotide probes having at least one stabilizing nucleobase, e.g., such as LNA. The method includes querying a database of target sequences (listed herein) and designing oligonucleotide probes which: i) have sufficient binding stability to bind their respective target sequence under stringent hybridization conditions, ii) have limited propensity to self-anneal, and iii) are capable of binding to and detecting/quantifying at least about 60%, at least about 70%, at least about 80%, at least about 90% or at least about 95% of their target sequences in the given database of miRNAs, miRNA precursors, or other RNA sequences.
[0374] The method further entails calculating stability based on the assumption that the oligonucleotide probes have at least one stabilizing nucleotide, such as an LNA monomer. In some cases, the calculated stability is used to eliminate oligonucleotide probe candidates with inadequate stability from the database of possible oligonucleotide probes prior to the query against the database to identify optimal sequences for the oligonucleotide probe.
[0375] In one embodiment, oligonucleotide probes were designed as reverse complementary sequences to the loop-region of the pre-miRNA. A stretch of 25 nucleotides were identified centered around the loop-region and a capture probe was designed for this 25-mer sequence using the same design rules as for capture probes for the mature miRNAs. This design process takes into account predictions of Tm of the capture probe, self-hybridization of the capture probe to it-self and intra-molecular secondary structures and the difference between Tm and self-hybridization Tm. Further criteria to the capture probe design, includes that, in one embodiment, LNA-residues are not allowed in the 3'-end to enhance synthesis yield. Inter-probe comparison of capture probes against different miRNAs ensure that capture probes are designed against regions of the miRNAs that differ the most from other miRNAs in order to optimize the discrimination between different miRNAs.
[0376] The compound of the invention may form a detection probe, such as oligonucleotide probes, including detection probe pairs, which are independently capable of detecting one of each of the herein listed (miRNA or pre-miRNA) nucleic acids.
[0377] Therefore the invention also provides for detection probes.
[0378] Each detection probe comprises a recognition sequence consisting of nucleobases or equivalent molecular entities.
[0379] The recognition sequence typically comprises of the contiguous sequence of nucleobases present in the compound of the invention, although in one embodiment, for use in a detection probe, the recognition sequence may be as short as 6 nucleotides, such as 6 or 7 nucleobases.
[0380] The recognition sequence of the diagnostic probe according to the invention corresponds to the target nucleotide sequence or sequences as referred to herein.
[0381] The target sequences with odd SEQ IDs (from SEQ ID NO 1 to 407) or in column 1 of table 3, or as shown in Table 5, represent mature miRNA sequences which are associated with cancer such as breast cancer. Therefore in one embodiment, the detection probe(s) according to the invention comprise a contiguous sequence of nucleobases of at least 6 nucleobases, wherein the contiguous sequence corresponds (i.e. is homolgous to or complementary) to a contiguous nucleotide sequence present in the odd numbered SEQ IDs NO 1 to 407 and/or the SEQ IDs listed in column 1 of table 3, or in Table 5.
[0382] The target sequences with even SEQ IDs (from SEQ ID NO 2 to 408) or in column 2 of table 3, or as shown in Table 4, represent pre-mature miRNA sequences which are associated with cancer such as breast cancer. Therefore in one embodiment, the detection probe(s) according to the invention comprise a contiguous sequence of nucleobases of at least 6 nucleobases, wherein the contiguous sequence corresponds to a contiguous nucleotide sequence present in the even numbered SEQ IDs NO 2 to 408 and/or the SEQ IDs listed in column 2 of table 3, or as shown in table 4.
[0383] In one embodiment, the detection probes are capable of specifically hybridizing to a target sequence selected from the group consisting of a nucleic acid sequence selected from the group consisting of SEQ ID No 1-558
[0384] In one embodiment, the detection probes are capable of specifically hybridizing to a target sequence selected from the group consisting of a nucleic acid sequence selected from the group shown in Table 5.
[0385] In one embodiment, the detection probes are capable of specifically hybridizing to a target sequence selected from the group consisting of a nucleic acid sequence selected from the group shown in Table 4.
[0386] In a preferred embodiment, detection probes which are capable of specifically hybridizing to a target sequence have a contiguous nucleobase sequence which is complementary to a corresponding region in the target sequence.
[0387] In one embodiment, the detection probes are capable of specifically hybridizing to a target sequence selected from the group consisting of a nucleic acid sequence selected from the group consisting of SEQ ID No 1-408 (odd and/or even SEQ IDs), and SEQ ID No 411-558 (i.e. the SEQ IDs listed in columns 1 and/or 2 of Table 3), and allelic variants thereof.
[0388] In one embodiment, the detection probes are capable of specifically hybridizing to a target sequence selected from the group consisting of a nucleic acid sequence selected from the group consisting of the even numbered SEQ IDs present in the group SEQ ID No 1-408, and/or the SEQ IDs listed in column 2 of table 3, and allelic variants thereof. These sequences are novel precursor miRNA sequences which are further processed to form mature non-coding RNAs.
[0389] In one embodiment, the detection probes are capable of specifically hybridizing to a target sequence selected from the group consisting of a nucleic acid sequence selected from the group consisting of the even numbered SEQ IDs present in the group SEQ ID No 1-408, and/or the SEQ IDs listed in column 1 of table 3, and allelic variants thereof. These sequences are novel mature miRNA.
[0390] In one embodiment, the detection probe or probes are capable of specifically hybridising to the precursor form of the non-coding RNA, but are not capable of specifically hybridising to the mature form of the non-coding RNA. Suitable detection probes are routinely designed and made utilising the sequence information available, e.g. by selecting a detection probe which at least partially hybridises to the loop structure which is cleaved during miRNA processing. It should be noted that several mature siRNAs may originate from more than one precursor, hence by designing specific probes for a particular precursor, highly specific detection probes for use in the invention may be used.
[0391] It will be understood that whilst in the preferred embodiment the target sequence are the miRNA or pre-miRNA precursors themselves, in one embodiment, the target sequence may be a further nucleotide or nucleobase sequence which retains the sequence information from the corresponding miRNA/pre-miRNA.
[0392] The detection element of the detection probes according to the invention may be single or double labeled (e.g. by comprising a label at each end of the probe, or an internal position). In one aspect, the detection probe comprises two labels capable of interacting with each other to produce a signal or to modify a signal, such that a signal or a change in a signal may be detected when the probe hybridizes to a target sequence. A particular aspect is when the two labels comprise a quencher and a reporter molecule.
[0393] A particular detection aspect of the invention referred to as a "molecular beacon with a stem region" is when the recognition segment is flanked by first and second complementary hairpin-forming sequences which may anneal to form a hairpin. A reporter label is attached to the end of one complementary sequence and a quenching moiety is attached to the end of the other complementary sequence. The stem formed when the first and second complementary sequences are hybridized (i.e., when the probe recognition segment is not hybridized to its target) keeps these two labels in close proximity to each other, causing a signal produced by the reporter to be quenched by fluorescence resonance energy transfer (FRET). The proximity of the two labels is reduced when the probe is hybridized to a target sequence and the change in proximity produces a change in the interaction between the labels. Hybridization of the probe thus results in a signal (e.g. fluorescence) being produced by the reporter molecule, which can be detected and/or quantified.
[0394] Preferably, the compound of the invention, such as the detection probes of the invention, are modified in order to increase the binding affinity of the probes for the target sequence by at least two-fold compared to probes of the same sequence without the modification, under the same conditions for hybridization or stringent hybridization conditions. The preferred modifications include, but are not limited to, inclusion of nucleobases, nucleosidic bases or nucleotides that have been modified by a chemical moiety or replaced by an analogue to increase the binding affinity. The preferred modifications may also include attachment of duplex-stabilizing agents e.g., such as minor-groove-binders (MGB) or intercalating nucleic acids (INA). Additionally, the preferred modifications may also include addition of non-discriminatory bases e.g., such as 5-nitroindole, which are capable of stabilizing duplex formation regardless of the nucleobase at the opposing position on the target strand. Finally, multi-probes composed of a non-sugar-phosphate backbone, e.g. such as PNA, that are capable of binding sequence specifically to a target sequence are also considered as a modification. All the different binding affinity-increasing modifications mentioned above will in the following be referred to as "the stabilizing modification(s)", and the tagging probes and the detection probes will in the following also be referred to as "modified oligonucleotide". More preferably the binding affinity of the modified oligonucleotide is at least about 3-fold, 4-fold, 5-fold, or 20-fold higher than the binding of a probe of the same sequence but without the stabilizing modification(s).
[0395] Most preferably, the stabilizing modification(s) is inclusion of one or more LNA nucleotide analogs. Probes from 8 to 30 nucleotides according to the invention may comprise from 1 to 8 stabilizing nucleotides, such as LNA nucleotides. When at least two LNA nucleotides are included, these may be consecutive or separated by one or more non-LNA nucleotides. In one aspect, LNA nucleotides are alpha-L-LNA and/or xylo LNA nucleotides as disclosed in PCT Publications No. WO 2000/66604 and WO 2000/56748.
[0396] In a preferable embodiment, each detection probe preferably comprises affinity enhancing nucleobase analogues, and wherein the recognition sequences exhibit a combination of high melting temperatures and low self-complementarity scores, said melting temperatures being the melting temperature of the duplex between the recognition sequence and its complementary DNA or RNA sequence.
[0397] This design provides for probes which are highly specific for their target sequences but which at the same time exhibits a very low risk of self-annealing (as evidenced by a low self-complementarity score)--self-annealing is, due to the presence of affinity enhancing nucleobases (such as LNA monomers) a problem which is more serious than when using conventional deoxyribonucleotide probes.
[0398] In one embodiment the recognition sequences exhibit a melting temperature (or a measure of melting temperature) corresponding to at least 5° C. higher than a melting temperature or a measure of melting temperature of the self-complementarity score under conditions where the probe hybridizes specifically to its complementary target sequence (alternatively, one can quantify the "risk of self-annealing" feature by requiring that the melting temperature of the probe-target duplex must be at least 5° C. higher than the melting temperature of duplexes between the probes or the probes internally).
[0399] In a preferred embodiment all of the detection probes include recognition sequences which exhibit a melting temperature or a measure of melting temperature corresponding to at least 5° C. higher than a melting temperature or a measure of melting temperature of the self-complementarity score under conditions where the probe hybridizes specifically to its complementary target sequence.
[0400] However, it is preferred that this temperature difference is higher, such as at least 10° C., such as at least 15, at least 20, at least 25, at least 30, at least 35, at least 40, at least 45, and at least 50° C. higher than a melting temperature or measure of melting temperature of the self-complementarity score.
[0401] In one embodiment, the affinity-enhancing nucleobase analogues are regularly spaced between the nucleobases in said detection probes. One reason for this is that the time needed for adding each nucleobase or analogue during synthesis of the probes of the invention is dependent on whether or not a nucleobase analogue is added. By using the "regular spacing strategy" considerable production benefits are achieved. Specifically for LNA nucleobases, the required coupling times for incorporating LNA amidites during synthesis may exceed that required for incorporating DNA amidites. Hence, in cases involving simultaneous parallel synthesis of multiple oligonucleotides on the same instrument, it is advantageous if the nucleotide analogues such as LNA are spaced evenly in the same pattern as derived from the 3'-end, to allow reduced cumulative coupling times for the synthesis. The affinity enhancing nucleobase analogues are conveniently regularly spaced as every 2nd, every 3rd, every 4th or every 5th nucleobase in the recognition sequence, and preferably as every 3rd nucleobase. Alternatively, the affinity enhancing nucleobase analogues may be spaced at a mixture of, for example every 2nd, every 3rd, every 4th nucleobase.
[0402] The presence of the affinity enhancing nucleobases in the recognition sequence preferably confers an increase in the binding affinity between a probe and its complementary target nucleotide sequence relative to the binding affinity exhibited by a corresponding probe, which only include nucleobases. Since LNA nucleobases/monomers have this ability, it is preferred that the affinity enhancing nucleobase analogues are LNA nucleobases.
[0403] In some embodiments, the 3' and 5' nucleobases are not substituted by affinity enhancing nucleobase analogues.
[0404] As detailed herein, one huge advantage of such probes for use in the method of the invention is their short lengths which surprisingly provides for high target specificity and advantages in detecting small RNAs and detecting nucleic acids in samples not normally suitable for hybridization detection strategies. It is, however, preferred that the probes comprise a recognition sequence is at least a 6-mer, such as at least a 7-mer, at least an 8-mer, at least a 9-mer, at least a 10-mer, at least an 11-mer, at least a 12-mer, at least a 13-mer, at least a 14-mer, at least a 15-mer, at least a 16-mer, at least a 17-mer, at least an 18-mer, at least a 19-mer, at least a 20-mer, at least a 21-mer, at least a 22-mer, at least a 23-mer, and at least a 24-mer. On the other hand, the recognition sequence is preferably at most a 25-mer, such as at most a 24-mer, at most a 23-mer, at most a 22-mer, at most a 21-mer, at most a 20-mer, at most a 19-mer, at most an 18-mer, at most a 17-mer, at most a 16-mer, at most a 15-mer, at most a 14-mer, at most a 13-mer, at most a 12-mer, at most an 11-mer, at most a 10-mer, at most a 9-mer, at most an 8-mer, at most a 7-mer, and at most a 6-mer.
[0405] The present invention provides oligonucleotide compositions and probe sequences for the use in detection, isolation, purification, amplification, identification, quantification, or capture of miRNAs, their target mRNAs, precursor RNAs, stem-loop precursor miRNAs, siRNAs, other non-coding RNAs, RNA-edited transcripts or alternative mRNA splice variants or single stranded DNA (e.g. viral DNA) characterized in that the probe sequences contain a number of nucleoside analogues.
[0406] In a preferred embodiment the number of nucleoside analogue corresponds to from 20 to 40% of the oligonucleotide of the invention.
[0407] In a preferred embodiment the probe sequences are substituted with a nucleoside analogue with regular spacing between the substitutions
[0408] In another preferred embodiment the probe sequences are substituted with a nucleoside analogue with irregular spacing between the substitutions
[0409] In a preferred embodiment the nucleoside analogue is LNA.
[0410] In a further preferred embodiment the detection probe sequences comprise a photochemically active group, a thermochemically active group, a chelating group, a reporter group, or a ligand that facilitates the direct of indirect detection of the probe or the immobilisation of the oligonucleotide probe onto a solid support.
[0411] In a further preferred embodiment:
(a) the photochemically active group, the thermochemically active group, the chelating group, the reporter group, or the ligand includes a spacer (K), said spacer comprising a chemically cleavable group; or (b) the photochemically active group, the thermochemically active group, the chelating group, the reporter group, or the ligand is attached via the biradical of at least one of the LNA(s) of the oligonucleotide.
[0412] Methods for defining and preparing probes and probe collections are disclosed in PCT/DK2005/000838.
[0413] In another aspect the invention features detection probe sequences containing a ligand, which said ligand means something, which binds. Such ligand-containing detection probes of the invention are useful for isolating and/or detecting target RNA molecules from complex nucleic acid mixtures, such as miRNAs, or their cognate target mRNAs, for example as shown in Table 11.
[0414] The invention therefore also provides for detection probes, such as oligonucleotide compositions, which are ligands to the molecular markers according to the invention.
[0415] In another aspect, the invention features detection probes whose sequences have been furthermore modified by Selectively Binding Complementary (SBC) nucleobases, i.e. modified nucleobases that can make stable hydrogen bonds to their complementary nucleobases, but are unable to make stable hydrogen bonds to other SBC nucleobases. Such SBC monomer substitutions are especially useful when highly self-complementary detection probe sequences are employed. As an example, the SBC nucleobase A', can make a stable hydrogen bonded pair with its complementary unmodified nucleobase, T. Likewise, the SBC nucleobase T' can make a stable hydrogen bonded pair with its complementary unmodified nucleobase, A. However, the SBC nucleobases A' and T' will form an unstable hydrogen bonded pair as compared to the base pairs A'-T and A-T'. Likewise, a SBC nucleobase of C is designated C' and can make a stable hydrogen bonded pair with its complementary unmodified nucleobase G, and a SBC nucleobase of G is designated G' and can make a stable hydrogen bonded pair with its complementary unmodified nucleobase C, yet C' and G' will form an unstable hydrogen bonded pair as compared to the base pairs C'-G and C-G'. A stable hydrogen bonded pair is obtained when 2 or more hydrogen bonds are formed e.g. the pair between A' and T, A and T', C and G', and C' and G. An unstable hydrogen bonded pair is obtained when 1 or no hydrogen bonds is formed e.g. the pair between A' and T', and C' and G'. Especially interesting SBC nucleobases are 2,6-diaminopurine (A', also called D) together with 2-thio-uracil (U', also called 2SU) (2-thio-4-oxo-pyrimidine) and 2-thio-thymine (T', also called 2ST) (2-thio-4-oxo-5-methyl-pyrimidine).
[0416] In another aspect, the detection probe sequences of the invention are covalently bonded to a solid support by reaction of a nucleoside phosphoramidite with an activated solid support, and subsequent reaction of a nucleoside phosphoramide with an activated nucleotide or nucleic acid bound to the solid support. In some embodiments, the solid support or the detection probe sequences bound to the solid support are activated by illumination, a photogenerated acid, or electric current. In other embodiments the detection probe sequences contain a spacer, e.g. a randomized nucleotide sequence or a non-base sequence, such as hexaethylene glycol, between the reactive group and the recognition sequence. Such covalently bonded detection probe sequence populations are highly useful for large-scale detection and expression profiling of mature miRNAs, stem-loop precursor miRNAs, siRNAs, piRNAs, snRNAs and other non-coding RNAs.
[0417] The present oligonucleotide compositions and detection probe sequences of the invention are highly useful and applicable for detection of individual small RNA molecules in complex mixtures composed of hundreds of thousands of different nucleic acids, such as detecting mature miRNAs, their target mRNAs, piRNAs, snRNAs or siRNAs, by Northern blot analysis or for addressing the spatiotemporal expression patterns of miRNAs, siRNAs or other non-coding RNAs as well as mRNAs by in situ hybridization in whole-mount.
[0418] The oligonucleotide compositions and detection probe sequences are especially applicable for accurate, highly sensitive and specific detection and quantitation of microRNAs and other non-coding RNAs, which are useful as biomarkers for diagnostic purposes of human diseases, such as cancer, including breast cancer and other cancers referred to herein, as well as for antisense-based intervention, targeted against tumorigenic miRNAs and other non-coding RNAs.
[0419] The detection probes, detection probe pairs, and oligonucleotide compositions and probe sequences which hybridise to the molecular markers according to the invention are furthermore applicable for sensitive and specific detection and quantitation of microRNAs, which can be used as biomarkers for the identification of the primary site of metastatic tumors of unknown origin.
Known miRNA/Pre-miRNA Control Sequences
[0420] The detection probes of the invention may be used in conjunction with other control detection probes against known sequences which are, for example associated with cancer, or the characteristic of cancer being investigated (+ve control detection probes).
[0421] In one embodiment the control detection probes may be a non-coding RNA, such as a miRNA, siRNA, piRNA or snRNA.
[0422] Suitable target sequences of non coding RNAs may be identified from the literature, for example the following publications disclose non coding RNA sequences associates with the corresponding form of cancer: Breast cancer: Iorio et al Cancer Res 2005; 65: 7065. Lung cancer: Yanaihara et al Cell Science 2006; 9: 189-198. Chronic lymphocytic leukaemia (CLL): Galin et al PNAS, 2004 101(32):11755-11760. Colon cancer: Cummins et al PNAS 2006, 103 (10):3687-3692. Prostate cancer: Volinia et al PNAS 2006; 103: 2257). Cancer: Lu et al (Nature 2005; 435:834-838).
[0423] Preferred +ve control detection probes include detection probes which specifically hybridise to a noncoding RNA selected from the group consisting of hsa mIR 21, hsa-Let 7i, hsa miR 101, hsa miR 145, hsa miR 9, hsa miR122a, hsa miR 128b, hsa miR 149, hsa miR 125a, hsa miR 143, hsa miR 136, which may be up-regulated in cancer cells, and hsa-miR 205, which may be down-regulated in breast cancer cells. The detection probes may be designed against either the mature miRNA, the pre-miRNA, or both--e.g. may form a control detection probe pair.
[0424] Detection probes prepared against mRNA and DNA markers (target nucleic acids) associated with cancer may also be used as controls, for example markers prepared against the Her-2 gene or mRNA, which is associated with breast cancer.
Method for the Characterisation of Cancer
[0425] The invention provides a method for the characterisation of cancer. The data obtained by the method can be used to provide information on one or more features of cancer.
[0426] The at least one feature of the cancer which is characterised by the method according to the invention may be selected from one or more of the following:
[0427] Diagnosis of cancer, the signal data can be used to determine whether the test sample comprises cells that are cancerous (i.e. presence or absence of cancer), and/or whether such cancer is a malignant cancer or a benign cancer.
[0428] The prognosis of the cancer, such as the speed at which the cancer may develop and or metastasize (i.e. spread from one part of the body to another) or the life expectancy of the patient with said cancer (such as less than five years, or greater than five years). In one embodiment the prognosis may be that the life expectancy of the patient is less than 5 years, such as less than 4 years, less than 3 years, less than two years, less than 1 year, less than six months or less than 3 months.
[0429] The origin of said cancer, this may be the cause of the cancer, or in the case of secondary cancer, the origin of the primary cancer. The origin may for example be selected from the following lists of cancer types.
[0430] The type of said cancer, such as a cancer selected from the group consisting of the following: A solid tumor; ovarian cancer, breast cancer, non-small cell lung cancer, renal cell cancer, bladder cancer, oesophagus cancer, stomach cancer, prostate cancer, pancreatic cancer, lung cancer, cervical cancer, colon cancer, colorectal cancer, renal cell cancer;
[0431] In one embodiment the type of said cancer is selected from the group consisting of; breast cancer, adrenal gland cancer, bladder cancer, colon cancer, Cervical cancer, cancer of the duodenum, cancer of the esophagus, cancer of the kidney, liver cancer, lung cancer, ovarian cancer, prostate cancer, rectal cancer, stomach cancer and uterine cancer.
[0432] The type of cancer may be selected from the group consisting of: A carcinoma, such as a carcinoma selected from the group consisting of ovarian carcinoma, breast carcinoma, non-small cell lung cancer, renal cell carcinoma, bladder carcinoma, recurrent superficial bladder cancer, stomach carcinoma, prostatic carcinoma, pancreatic carcinoma, lung carcinoma, cervical carcinoma, cervical dysplasia, laryngeal papillomatosis, colon carcinoma, colorectal carcinoma, carcinoid tumors, renal cell carcinoma, A basal cell carcinoma; A malignant melanoma, such as a malignant melanoma selected from the group consisting superficial spreading melanoma, nodular melanoma, lentigo maligna melanoma, acral melagnoma, amelanotic melanoma and desmoplastic melanoma; A sarcoma, such as a sarcoma selected from the group consisting of osteosarcoma, Ewing's sarcoma, chondrosarcoma, malignant fibrous histiocytoma, fibrosarcoma and Kaposi's sarcoma; and a glioma.
[0433] The use of non-coding RNA markers for determining the origin of cells is disclosed in U.S. application Ser. No. 11/324,177, which is hereby incorporated by reference.
[0434] Cancer of unknown primary site is a common clinical entity, accounting for 2% of all cancer diagnoses in the Surveillance, Epidemiology, and End Results (SEER) registries between 1973 and 1987 (C. Muir. Cancer of unknown primary site Cancer 1995. 75: 353-356). In spite of the frequency of this syndrome, relatively little attention has been given to this group of patients, and systematic study of the entity has lagged behind that of other areas in oncology. Widespread pessimism concerning the therapy and prognosis of these patients has been the major reason for the lack of effort in this area. The patient with carcinoma of unknown primary site is commonly stereotyped as an elderly, debilitated individual with metastases at multiple visceral sites. Early attempts at systemic therapy yielded low response rates and had a negligible effect on survival, thereby strengthening arguments for a nihilistic approach to these patients. The heterogeneity of this group has also made the design of therapeutic studies difficult; it is well recognized that cancers with different biologies from many primary sites are represented. In the past 10 years, substantial improvements have been made in the management and treatment of some patients with carcinoma of unknown primary site. The identification of treatable patients within this heterogeneous group has been made possible by the recognition of several clinical syndromes that predict chemotherapy responsiveness, and also by the development of specialized pathologic techniques that can aid in tumor characterization. Therefore, the optimal management of patients with cancer of unknown primary site now requires appropriate clinical and pathologic evaluation to identify treatable subgroups, followed by the administration of specific therapy. Many patients with adenocarcinoma of unknown primary site have widespread metastases and poor performance status at the time of diagnosis. The outlook for most of these patients is poor, with median survival of 4 to 6 months. However, subsets of patients with a much more favorable outlook are contained within this large group, and optimal initial evaluation enables the identification of these treatable subsets. In addition, empiric chemotherapy incorporating newer agents has produced higher response rates and probably improves the survival of patients with good performance status.
[0435] Fine-needle aspiration biopsy (FNA) provides adequate amounts of tissue for definitive diagnosis of poorly differentiated tumors, and identification of the primary source in about one fourth of cases (C. V. Reyes, K. S. Thompson, J. D. Jensen, and A. M. Chouelhury. Metastasis of unknown origin: the role of fine needle aspiration cytology Diagn Cytopathol 1998. 18: 319-322).
[0436] microRNAs have emerged as important non-coding RNAs, involved in a wide variety of regulatory functions during cell growth, development and differentiation. Some reports clearly indicate that microRNA expression may be indicative of cell differentiation state, which again is an indication of organ or tissue specification. Therefore a catalogue of mir tissue expression profiles may serve as the basis for a diagnostic tool determining the tissue origin of tumors of unknown origin. So, since it is possible to map miRNA in cells vs. the tissue origin of cell, the present invention presents a convenient means for detection of tissue origin of such tumors.
[0437] Hence, the present invention in general relates to a method for determining tissue origin of tumors comprising probing cells of the tumor with a collection of probes which is capable of mapping miRNA to a tissue origin.
[0438] miRNA typing according to the principles of the present example can be applied to RNA from a variety of normal tissues and tumor tissues (of known origin) and over time a database is build up, which consists of miRNA expression profiles from normal and tumor tissue. When subjecting RNA from a tumor tissue sample, the resulting miRNA profile can be analysed for its degree of identity with each of the profiles of the database--the closest matching profiles are those having the highest likelihood of representing a tumor having the same origin (but also other characteristics of clinical significance, such as degree of malignancy, prognosis, optimum treatment regimen and prediction of treatment success). The miRNA profile may of course be combined with other tumor origin determination techniques, cf. e.g. Xiao-Jun Ma et al., Arch Pathol Lab Med 130, 465-473, which demonstrates molecular classification of human cancers into 39 tumor classes using a microarray designed to detect RT-PCR amplified mRNA derived from expression of 92 tumor-related genes. The presently presented technology allows for an approach which is equivalent safe for the use of a miRNA detection assay instead of an mRNA detection assay.
[0439] The invention provides a method of characterising a tumor of unknown origin, such as a metastasis, or putative metastasis, wherein at least one mature miRNA species is detected in a sample of RNA from a tumor, (i.e. a first population of target molecules obtained from at least one test sample) thus providing a miRNA expression profile from the tumor, and subsequently comparing said miRNA expression profile with previously established miRNA expression profiles from normal tissue and/or tumor tissue.
[0440] In one embodiment the tumor may selected from the group consisting of; breast tumor, adrenal gland tumor, bladder tumor, colon tumor, Cervical tumor, tumor of the duodenum, tumor of the esophagus, tumor of the kidney, liver tumor, lung tumor, ovarian tumor, prostate tumor, rectal tumor, stomach tumor and a uterine tumor.
[0441] In one embodiment, the tumor may be a breast tumor, or it may be derived from a breast tumor.
[0442] The RNA may be total RNA isolated from the tumor, or a purified fraction thereof.
[0443] In one embodiment, the miRNA expression profile from the tumor and the previously established miRNA expression profiles provides for an indication of the origin of the tumor, the patient's prognosis, the optimum treatment regimen of the tumor and/or a prediction of the outcome of a given anti-tumor treatment.
[0444] The therapy outcome prediction, such as a prediction of the responsiveness of the cancer to chemotherapy and/or radiotherapy and/or the suitability of said cancer to hormone treatment, and such as the suitability of said cancer for removal by invasive surgery. In one embodiment, the therapy out come predication may be the prediction of the suitability of the treatment of the cancer to combined adjuvant therapy.
[0445] The therapy may be herceptin, which is frequently used for the treatment of oestrogen receptor positive cancers (such as breast cancer).
The Patient and Test Sample
[0446] Suitable samples may comprise a wide range of mammalian and human cells, including protoplasts; or other biological materials, which may harbour target nucleic acids. The methods are thus applicable to tissue culture mammalian cells, mammalian cells (e.g., blood, serum, plasma, reticulocytes, lymphocytes, urine, bone marrow tissue, cerebrospinal fluid or any product prepared from blood or lymph) or any type of tissue biopsy (e.g. a muscle biopsy, a liver biopsy, a kidney biopsy, a bladder biopsy, a bone biopsy, a cartilage biopsy, a skin biopsy, a pancreas biopsy, a biopsy of the intestinal tract, a thymus biopsy, a mammae biopsy, a uterus biopsy, a testicular biopsy, an eye biopsy or a brain biopsy, e.g., homogenized in lysis buffer), and archival tissue nucleic acids.
[0447] The test sample is typically obtained from a patient that has or is suspected of having cancer, such as breast cancer, or who is suspected of having a high risk of developing cancer. The method can, therefore be undertaken as a precautionary matter in the prevention of, or early diagnosis of cancer.
[0448] The patient (or organism) is a mammal, preferably a human being. The patient may be male or female, although this may depend on the type of tissue/cancer being investigated (e.g. ovarian cancer effects only women).
[0449] The test sample is typically obtained from the patient by biopsy or tissue sampling. When referring to the signal obtained from a test (or control) sample, it refers to the signal obtained from the hybridisation using the first (or further) population of molecules prepared from the test (or control) sample.
The Control Sample
[0450] In one embodiment, the control sample may be obtained from the same patient at the same time that the test sample is taken. In one embodiment, the control sample may be a sample taken previously, e.g. a sample of the same or a different cancer/tumor, the comparison of which may, for example, provide characterisation of the source of the new tumor, or progression of the development of an existing cancer, such as before, during or after treatment.
[0451] In one embodiment, the control sample may be taken from healthy tissue, for example tissue taken adjacent to the cancer, such as within 1 or 2 cm diameter from the external edge of said cancer. Alternatively the control sample may be taken from an equivalent position in the patients body, for example in the case of breast cancer, tissue may be taken from the breast which is not cancerous.
[0452] In one embodiment, the control sample may also be obtained from a different patient, e.g. it may be a control sample, or a collection of control samples, representing different types of cancer, for example those listed herein (i.e. cancer reference samples). Comparison of the test sample data with data obtained from such cancer reference samples may for example allow for the characterisation of the test cancer to a specific type and/or stage of cancer.
[0453] In one embodiment, at least one control sample is obtained, and a second population of nucleic acids from the at least one control sample is, in addition to the test sample, presented and hybridised against at least one detection probe.
[0454] The detection probe target for the test and control sample may be the same, the ratio of the signal obtained between the control and test sample being indicative of a differential quantification of the target.
[0455] In one embodiment, the control sample may be obtained from the same patient as the test sample.
[0456] In one embodiment, the control sample may be obtained from a non tumorous tissue, such as from tissue adjacent to said putative tumor, and/or from an equivalent position elsewhere in the body.
[0457] In one embodiment, the control sample may be obtained from a non tumorous (or cancerous) tissue selected from the group consisting; breast tissue, adrenal gland tissue, bladder tissue, colon tissue, Cervical tissue, tissue of the duodenum, tissue of the esophagus, tissue of the kidney, liver tissue, lung tissue, ovarian tissue, prostate tissue, rectal tissue, stomach tissue and uterine tissue.
[0458] In one embodiment, the control sample (or a further control sample) may be obtained from a tumorous (or cancerous) tissue selected from the group consisting; tumorous (or cancerous) breast tissue, tumorous (or cancerous) adrenal gland tissue, tumorous (or cancerous) bladder tissue, tumorous (or cancerous) colon tissue, tumorous (or cancerous) Cervical tissue, tumorous (or cancerous) tissue of the duodenum, tumorous (or cancerous) tissue of the esophagus, tumorous (or cancerous) tissue of the kidney, tumorous (or cancerous) liver tissue, tumorous (or cancerous) lung tissue, tumorous (or cancerous) ovarian tissue, tumorous (or cancerous) prostate tissue, tumorous (or cancerous) rectal tissue, tumorous (or cancerous) stomach tissue and tumorous (or cancerous) uterine tissue.
[0459] In one embodiment, the control sample may be obtained from a tumor tissue. In this embodiment, there may be one or more control samples, e.g. a panel of control samples which represent one or more tumor types. Thereby allowing comparison of the test sample, with on or more control samples which have a defined origin. Such control samples, such as a panel of control samples is particularly useful when determining the origin of a cancer (e.g. metastasis) of unknown origin. Such control samples may be selected from one or more of the following: A solid tumor; ovarian cancer, breast cancer, non-small cell lung cancer, renal cell cancer, bladder cancer, esophagus cancer, stomach cancer, prostate cancer, pancreatic cancer, lung cancer, cervical cancer, colon cancer, colorectal cancer, renal cell cancer; Such control samples may also be selected from one or more of the following: The type of cancer may be selected from the group consisting of: A carcinoma, such as a carcinoma selected from the group consisting of ovarian carcinoma, breast carcinoma, non-small cell lung cancer, renal cell carcinoma, bladder carcinoma, recurrent superficial bladder cancer, stomach carcinoma, prostatic carcinoma, pancreatic carcinoma, lung carcinoma, cervical carcinoma, cervical dysplasia, laryngeal papillomatosis, colon carcinoma, colorectal carcinoma, carcinoid tumors, renal cell carcinoma, A basal cell carcinoma; A malignant melanoma, such as a malignant melanoma selected from the group consisting superficial spreading melanoma, nodular melanoma, lentigo maligna melanoma, acral melagnoma, amelanotic melanoma and desmoplastic melanoma; A sarcoma, such as a sarcoma selected from the group consisting of osteosarcoma, Ewing's sarcoma, chondrosarcoma, malignant fibrous histiocytoma, fibrosarcoma and Kaposi's sarcoma; and a glioma.
[0460] Or, such control samples may be selected from one or more of the following: breast tumor, adrenal gland tumor, bladder tumor, colon tumor, Cervical tumor, tumor of the duodenum, tumor of the esophagus, tumor of the kidney, liver tumor, lung tumor, ovarian tumor, prostate tumor, rectal tumor, stomach tumor and a uterine tumor.
[0461] In one embodiment, the hybridisation signal obtained from the test sample is higher than the hybridisation signal obtained from the control sample.
[0462] In one embodiment, the hybridisation signal obtained from the test sample is lower than the hybridisation signal obtained from the control sample.
[0463] In one embodiment, at least two control samples are obtained, one control sample being obtained from said patient (see above), and at least one further control sample being obtained from a previously obtained sample of a cancer, such as a cancer of the same type as the test sample, or a different cancer such as those herein listed. The cancer may originate from the same patient or a different patient.
[0464] In one embodiment, the hybridisation signal obtained from the at least one further test sample is equivalent to or greater than the signal obtained from the either the signal obtained from the first control sample and/or the signal obtained from the test sample.
[0465] In one embodiment, the hybridisation signal obtained from the at least one further test sample is less than the signal obtained from the either the signal obtained from the first control sample and/or the signal obtained from the test sample.
[0466] In one embodiment, the test and control samples are hybridised to said at least one detection probe simultaneously, either in parallel hybridisations or in the same hybridisation experiment.
[0467] In one embodiment, the test and control sample or samples are hybridised to said at least one detection probe sequentially, either in the same hybridisation experiment, or different hybridisation experiments.
The RNA Fraction
[0468] In one embodiment, the RNA fraction may remain within the test sample, such as remain in the cells of the biopsy or tissue sample, for example for in situ hybridisation. The cells may still be living, or they may be dead. The cells may also be prepared for in situ hybridisation using methods known in the art, e.g. they may be treated with an agent to improve permeability of the cells; the cells may also be fixed or partially fixed.
[0469] The RNA fraction may be isolated from the test sample, such as a tissue sample.
[0470] The RNA fraction preferably comprises small RNAs such as those less than 100 bases in length. The RNA fraction preferably comprises miRNAs.
[0471] In one embodiment the RNA fraction may also comprise other RNA fractions such as mRNA, and/or in siRNAs and/or piRNAs.
[0472] In one embodiment, the RNA fraction comprises snRNAs.
[0473] The RNA fraction may also comprise other nucleic acids, for example the RNA fraction may be part of a total nucleic acid fraction which also comprises DNA, such as genomic and/or mitochondrial DNA. The RNA fraction may be purified. Care should be taken during RNA extraction to ensure at least a proportion of the non encoding RNAs, such as miRNA and siRNAs are retained during the extraction. Suitably, specific protocols for obtaining RNA fractions comprising or enriched with small RNAs, such as miRNAs may be used. The RNA fraction may undergo further purification to obtain an enriched RNA fraction, for example an RNA fraction enriched for non-coding RNAs. This can be achieved, for example, by removing mRNAs by use of affinity purification, e.g. using an oligodT column. RNA fractions enriched in miRNA and siRNA may be obtained using. In one embodiment the RNA fraction is not isolated from the test sample, for example when in situ hybridisation is performed, the RNA fraction remains in situ in the test sample, and the detection probes, typically labeled detection probes, are hybridised to a suitable prepared test sample.
[0474] In one embodiment the RNA fraction is used directly in the hybridisation with the at least one detection probe.
[0475] The RNA fraction may comprise the target molecule, e.g. the RNA fraction obtained from a test sample, the presence of the target molecule within the RNA fraction may indicate a particular feature of a cancer. Alternatively the RNA fraction may not comprise the target molecule, e.g. the RNA fraction obtained from a test sample, the absence of the target (complementary) molecule within the RNA fraction may indicate a particular feature of a cancer.
[0476] The RNA fraction comprises non coding RNA such as noncoding RNA selection from the group consisting of microRNA (miRNA), siRNA, piRNA and snRNA.
[0477] In one embodiment, prior to (or even during) said hybridisation, the RNA fraction may be used as a template to prepare a complement of the RNA present in the fraction, said compliment may be synthesised by template directed assembly of nucleoside, nucleotide and/or nucleotide analogue monomers, to produce, for example an oligonucleotides, such as a DNA oligonucleotide. The complement may be further copied and replicated. The compliment may represent the entire template RNA molecule, or may represent a population of fragments of template molecules, such as fragments than, preferably in average, retain at least 8 consecutive nucleoside units of said RNA template, such as at least 12 of said units or at least 14 of said units. It is preferred that at least 8 consecutive nucleoside units of said complementary target, such as at least 12 of said units or at least 14 of said units of said complementary target are retained. When the complementary target is a precursor RNA, or a molecule derived therefore, if is preferred that at least part of the loop structure of the precursor molecule is retained, as this will allow independent detection over the mature form of the non-coding RNA, or molecule derived there from.
[0478] Therefore, in one embodiment the RNA fraction itself is not used in the hybridisation, but a population of molecules, such as population of oligonucleotides which are derived from said RNA fraction, and retain sequence information contained within said RNA fraction, are used. It is envisaged that the population of molecules derived from said RNA fraction may be further manipulated or purified prior to the hybridisation step--for example they may be labeled, or a sub-fraction may be purified there from.
[0479] The target molecule (complementary target) may therefore be derived from RNA, but may actually comprise an alternative oligo backbone, for example DNA. The target molecule may, therefore also be a complement to the original RNA molecule, or part of the original RNA molecule from which it is derived.
[0480] In one embodiment, the RNA fraction is analysed and the population of target RNAs and optionally control nucleic acids are determined. For example the RNA fraction, or a nucleic acid fraction derived there from may be undergo quantitative analysis for specific target and control sequences, for example using oligonucleotide based sequencing, such as oligonucleotide micro-array hybridization. The data from the quantitative analysis may then be used in a virtual hybridisation with a detection probe sequence.
Hybridisation
[0481] Hybridisation refers to the bonding of two complementary single stranded nucleic acid polymers (such as oligonucleotides), such as RNA, DNA or polymers comprising or consisting of nucleotide analogues (such as LNA oligonucleotides). Hybridisation is highly specific, and may be controlled by regulation of the concentration of salts and temperature. Hybridisation occurs between complementary sequences, but may also occur between sequences which comprise some mismatches. The probes used in the methods of the present invention may, therefore be 100% complementary to the target molecule. Alternatively, in one embodiment the detection probes may comprise one or two mismatches. Typically a single mismatch will not unduly affect the specificity of binding, however two or more mismatches per 8 nucleotide/nucleotide residues usually prevents specific binding of the detection probe to the target species. The position of the mismatch may also be of importance, and as such the use of mismatches may be used to determine the specificity and strength of binding to target RNAs, or to allow binding to more than one allelic variant of mutation of a target species.
[0482] In one embodiment, the detection probe consists of no more than 1 mismatch.
[0483] In one embodiment, the detection probe consists of no more than 1 mismatch per 8 nucleotide/nucleotide analogue bases.
[0484] In one embodiment, hybridisation may also occur between a single stranded target molecule, such as a miRNA and a probe which comprises a complementary surface to the said target molecule, in this respect, it is the ability of the probe to form the specific bonding pattern with the target which is important.
[0485] Suitable methods for hybridisation include RNA in-situ hybridisation, dot blot hybridisation, reverse dot blot hybridisation, northern blot analysis, RNA protection assays, or expression profiling by microarrays. Such methods are standard in the art.
[0486] In one embodiment, the detection probe is capable of binding to the target non coding RNA sequence under stringent conditions, or under high stringency conditions.
[0487] Exiqon (Denmark) provide microarrays suitable for use in the methods of the invention (microRNA Expression Profiling with miRCURY® LNA Array).
[0488] The detection probe, such as each member of a collection of detection probes, may be bound (such as conjugated) to a bead. Luminex (Texas, USA) provides multiplex technology to allow the use of multiple detection probes to be used in a single hybridisation experiment. See also Panomics QuantigenePlex®.
[0489] Suitable techniques for performing in situ hybridisation are disclosed in PCT/DK2005/000838
PCR Hybridisation
[0490] Whilst it is recognised that many of the short noncoding RNAs which are targets for the detection probes are too short to be detected by amplification by standard PCR, methods of amplifying such short RNAs are disclosed in WO2005/098029. Therefore, the hybridisation may occur during PCR, such as RT-PCT or quantitative PCR (q-PCR).
[0491] However, in one embodiment, the hybridisation step does not comprise PCR such as RT-PCR or q-pCR.
The Target
[0492] The term the `target` `or complementary target` or `target nucleic acid` refers to a (typically non-coding) polynucleotide sequence associated with cancer, preferably an RNA sequence such as a miRNA, or precursor sequence thereof, or a sequence derived there from which retains the sequence information present the non-coding RNA sequence.
[0493] The list of preferred target sequences is provided herein.
[0494] Preferably the target is a human miRNA or precursor thereof.
[0495] In one embodiment the target may be one or more of the miRNA targets i.e. the mRNA targeted by the miRNA (see table 11).
The Signal
[0496] In one embodiment the target is labeled with a signal. In this respect the population of nucleic acids are labeled with a signal which can be detected. The hybridisation or the target molecules to the detection probe, which may be fixed to a solid surface, and subsequent removal of the remaining nucleic acids from the population, and therefore allows the determination of the level of signal from those labeled target which is bound to the detection probe. This may be appropriate when screening immobilised probes, such as arrays of detection probes.
[0497] In one embodiment the detection probe is labeled with a signal. This may be appropriate, for example, when performing in situ hybridisation and northern blotting, where the population of nucleic acids are immobilised.
[0498] It is also envisaged that both population of nucleic acids and detection probes are labeled. For example they may be labeled with fluorescent probes, such as pairs of FRET probes (Fluorescence resonance energy transfer), so that when hybridisation occurs, the FRET pair is formed, which causes a shift in the wavelength of fluorescent light emitted. It is also envisaged that pairs of detection probes may be used designed to hybridise to adjacent regions of the target molecule, and each detection probe carrying one half of a FRET pair, so that when the probes hybridise to their respective positions on the target, the FRET pair is formed, allowing the shift in fluorescence to be detected.
[0499] Therefore, it is also envisaged that neither the population of nucleic acid molecules or the detection probe need be immobilised.
[0500] Once the appropriate target RNA sequences have been selected, probes, such as the preferred LNA substituted detection probes are preferably chemically synthesized using commercially available methods and equipment as described in the art (Tetrahedron 54: 3607-30, 1998). For example, the solid phase phosphoramidite method can be used to produce short LNA probes (Caruthers, et al., Cold Spring Harbor Symp. Quant. Biol. 47:411-418, 1982, Adams, et al., J. Am. Chem. Soc. 105: 661 (1983).
[0501] Detection probes, such as LNA-containing-probes, can be labeled during synthesis. The flexibility of the phosphoramidite synthesis approach furthermore facilitates the easy production of detection probes carrying all commercially available linkers, fluorophores and labelling-molecules available for this standard chemistry. Detection probes, such as LNA-modified probes, may also be labeled by enzymatic reactions e.g. by kinasing using T4 polynucleotide kinase and gamma-32P-ATP or by using terminal deoxynucleotidyl transferase (TDT) and any given digoxygenin-conjugated nucleotide triphosphate (dNTP) or dideoxynucleotide triphosphate (ddNTP).
[0502] Detection probes according to the invention can comprise single labels or a plurality of labels. In one aspect, the plurality of labels comprise a pair of labels which interact with each other either to produce a signal or to produce a change in a signal when hybridization of the detection probe to a target sequence occurs.
[0503] In another aspect, the detection probe comprises a fluorophore moiety and a quencher moiety, positioned in such a way that the hybridized state of the probe can be distinguished from the unhybridized state of the probe by an increase in the fluorescent signal from the nucleotide. In one aspect, the detection probe comprises, in addition to the recognition element, first and second complementary sequences, which specifically hybridize to each other, when the probe is not hybridized to a recognition sequence in a target molecule, bringing the quencher molecule in sufficient proximity to said reporter molecule to quench fluorescence of the reporter molecule. Hybridization of the target molecule distances the quencher from the reporter molecule and results in a signal, which is proportional to the amount of hybridization.
[0504] In the present context, the term "label" means a reporter group, which is detectable either by itself or as a part of a detection series. Examples of functional parts of reporter groups are biotin, digoxigenin, fluorescent groups (groups which are able to absorb electromagnetic radiation, e.g. light or X-rays, of a certain wavelength, and which subsequently reemits the energy absorbed as radiation of longer wavelength; illustrative examples are DANSYL (5-dimethylamino)-1-naphthalenesulfonyl), DOXYL (N-oxyl-4,4-dimethyloxazolidine), PROXYL (N-oxyl-2,2,5,5-tetramethylpyrrolidine), TEMPO (N-oxyl-2,2,6,6-tetramethylpiperidine), dinitrophenyl, acridines, coumarins, Cy3 and Cy5 (trademarks for Biological Detection Systems, Inc.), erythrosine, coumaric acid, umbelliferone, Texas red, rhodamine, tetramethyl rhodamine, Rox, 7-nitrobenzo-2-oxa-1-diazole (NBD), pyrene, fluorescein, Europium, Ruthenium, Samarium, and other rare earth metals), radio isotopic labels, chemiluminescence labels (labels that are detectable via the emission of light during a chemical reaction), spin labels (a free radical (e.g. substituted organic nitroxides) or other paramagnetic probes (e.g. Cu2+, Mg2+) bound to a biological molecule being detectable by the use of electron spin resonance spectroscopy). Especially interesting examples are biotin, fluorescein, Texas Red, rhodamine, dinitrophenyl, digoxigenin, Ruthenium, Europium, Cy5, Cy3, etc.
Control Detection Probes
[0505] It is preferably in the method according to the invention that in addition to the detection probe for the target in question, at least one further detection probe is used, where the at least one further detection probe is capable of hybridising to a control nucleic acid (control target) present in said population of nucleic acids (such as the RNA fraction). The control nucleic acid is not the same as the target in question.
[0506] In one embodiment, the at least one further detection probe may be derived from or is capable of selectively hybridising with a molecule selected from the group consisting of: a pre-miRNA molecule; a pre-siRNA molecule; and a pre-piRNA molecule.
[0507] In another embodiment, the at least one further detection probe may be derived from or is capable of selectively hybridising with a molecule selected from the group consisting of a mature miRNA, a mature siRNA, a mature piRNA and a snRNA.
[0508] A preferred type of detection probe, which may be used with as a detection probe control and/or as a detection probe, is one which is capable of hybridising to the loop region of an immature miRNA, siRNA or piRNA. Recent research has shown that the processing of pre-microRNAs to mature microRNAs may be controlled in a cell specific manner (Obernosterer et al). In this respect the ratio between the immature and mature form can give valuable information which may be used to characterise the cancer test sample.
Detection Probes to Precursor Non-Coding RNAs
[0509] The present invention provides for detection probes for the detection of non coding RNA precursors, such as pre-miRNAs, pre-siRNAs and pre-piRNAs, and their targets. miRNAs are transcribed as mono- or poly-cistronic, long, primary precursor transcripts (pri-miRNAs) that are cleaved into ˜70-nt precursor hairpins, known as microRNA precursors (pre-miRNAs), by the nuclear RNase III-like enzyme Drosha (Lee et al., Nature 425:415-419, 2003). MicroRNA precursors (pre-miRNAs) form hairpins having a loop region and a stem region containing a duplex of the opposite ends of the RNA strand. Subsequently pre-miRNA hairpins are exported to the cytoplasm by Exportin-5 (Yi et al., Genes & Dev., 17:3011-3016, 2003; Bohnsack et al., RNA, 10:185-191, 2004), where they are processed by a second RNase III-like enzyme, termed Dicer, into ˜22-nt duplexes (Bernstein et al., Nature 409:363-366, 2001), followed by the asymmetric assembly of one of the two strands into a functional miRNP or miRISC (Khvorova et al., Cell 115:209-216, 2003). miRNAs can recognize regulatory targets while part of the miRNP complex and inhibit protein translation. Alternatively, the active RISC complex is guided to degrade the specific target mRNAs (Lipardi et al., Cell 107:297-307, 2001; Zhang et al., EMBO J. 21:5875-5885, 2002; Nykanen et al., Cell 107:309-321, 2001). There are several similarities between miRNP and the RNA-induced silencing complex, RISC, including similar sizes and both containing RNA helicase and the PPD proteins. It has therefore been proposed that miRNP and RISC are the same RNP with multiple functions (Ke et al., Curr. Opin. Chem. Biol. 7:516-523, 2003).
[0510] Most reports in the literature have described the processing of miRNAs to be complete, suggesting that intermediates like pri-miRNA and pre-miRNA rarely accumulate in cells and tissues. However, previous studies describing miRNA profiles of cells and tissues have only investigated size-fractionated RNAs pools. Consequently the presence of larger miRNA precursors has been overlooked.
[0511] Alterations in miRNA biogenesis resulting in different levels of mature miRNAs and their miRNA precursors could illuminate the mechanisms underlying many disease processes. For example, the 26 miRNA precursors were equally expressed in non-cancerous and cancerous colorectal tissues from patients, whereas the expression of ma-ture human miR143 and miR145 was greatly reduced in cancer tissues compared with non-cancer tissues, suggesting altered processing for specific miRNAs in human disease (Michael et al., Mol. Cancer Res. 1:882-891, 2003).
[0512] Connections between miRNAs, their precursors, and human diseases will only strengthen in parallel with the knowledge of miRNA, their precursors, and the gene networks that they control. Moreover, the understanding of the regulation of RNA-mediated gene expression is leading to the development of novel therapeutic approaches that will be likely to revolutionize the practice of medicine (Nelson et al., TIBS 28:534-540, 2003).
[0513] siRNAs and piRNAs are considered to undergo a similar processing from precursor molecules.
[0514] To this end, the invention provides oligonucleotide probes for precursors of non-coding RNAs, such as miRNA precursors, siRNA precursors, and piRNA precursors.
[0515] The detection probes for precursors may be a detection probe that hybridizes to a non-coding RNA precursor molecule, wherein at least part of said probe hybridizes to a portion of said precursor not present in the corresponding mature non coding RNA, e.g. the loop region.
[0516] Such oligonucleotide probes include a sequence complementary to the desired RNA sequence and preferably a substitution with nucleotide analogues, preferably high-affinity nucleotide analogues, e.g., LNA, to increase their sensitivity and specificity over conventional oligonucleotides, such as DNA oligonucleotides, for hybridization to the desired RNA sequences.
[0517] An exemplary oligonucleotide probe includes a plurality of nucleotide analogue monomers and hybridizes to a miRNA precursor. Desirably, the nucleotide analogue is LNA, wherein the LNA may be oxy-LNA, preferably beta-D-oxy-LNA, monomers. Desirably, the oligonucleotide probe will hybridize to part of the loop sequence of a miRNA precursor, e.g., to 5 nucleotides of the miRNA precursor loop sequence or to the center of the miRNA precursor loop sequence. In other embodiments, the oligonucleotide probe will hybridize to part of the stem sequence of a miRNA precursor.
[0518] The invention also features a method of measuring relative amounts of non coding RNAs, such as miRNa, piRNA and siRNA, and their precursors, such as pre-miRNAs, pre-siRNAs and pre-piRNAs.
[0519] This may be achieved by using a detection probe pair which comprises of i) a first detection probe that hybridizes to a non-coding RNA precursor molecule, wherein at least part of said probe hybridizes to a portion of said precursor not present in the corresponding mature non-coding RNA, and ii) a further detection probe that hybridizes to the mature non-coding RNA, but will not hybridise to the precursor non-coding RNA, e.g. by designing the detection probe to hybridise to the sequence which flanks the stem loop splice site of the precursor molecule. The ratio of signal of hybridisation thereby provides data which can provide said characterisation of said breast cancer.
[0520] Therefore, the invention further provides for a detection probe pair which consist of a detection probe which specifically hybridises to the pre-miRNA sequence and a further detection probe which specifically hybridises to the mature miRNA sequence. By designing, for example the pre-miRNA detection probe across the stem loop region, which is cleaved during the maturation process, the detection probe which specifically hybridises to the pre-mature miRNA does not specifically hybridise to the mature miRNA sequence. Therefore in a preferred embodiment, by comparing the signal obtained from each member of the detection probe pair it is possible to determine the comparative population of pre-miRNAs as compared to the corresponding mature miRNAs in a sample.
[0521] In one embodiment, the comparison is made by contacting a first probe that hybridizes to the mature noncoding RNA, such as mature miRNA, with the sample under a first condition that also allows the corresponding non-coding RNA precursor, such as miRNA precursor to hybridize; contacting the first probe or a second probe that hybridizes to mature non-coding RNA with the sample under a second condition that does not allow corresponding miRNA precursor to hybridize; comparing the amounts of the probes hybridized under the two conditions wherein the reduction in amount hybridized under the second condition compared to the first condition is indicative of the amount of the miRNA precursor in the sample.
[0522] Furthermore, the invention features a kit including a probe of the invention (or a detection probe pair according to the invention) and packaging and/or labeling indicative of the non-coding RNA and/or non-coding precursor (e.g. miRNA precursor), to which the probe (or probe pair) hybridizes and conditions under which the hybridization occurs. The kit provides for the isolation, purification, amplification, detection, identification, quantification, or capture of natural or synthetic nucleic acids. The probes are preferably immobilized onto a solid support, e.g., such as a bead or an array.
[0523] The invention also features a method of treating a disease or condition in a living organism using any combination of the probes and methods of the invention.
[0524] The invention further features a method of comparing relative amounts of miRNA and miRNA precursor in a sample by contacting the sample with a first probe that hybridizes to miRNA precursor and a second probe that hybridizes to miRNA; and detecting the amount of one or more signals indicative of the relative amounts of miRNA and miRNA precursor.
[0525] The invention also features a method of measuring relative amounts of miRNA and miRNA precursor in a sample by contacting a first probe that hybridizes to miRNA with the sample under conditions that also allow miRNA precursor to hybridize; contacting the first probe or a second probe that hybridizes to miRNA with the sample under conditions that do not allow miRNA precursor to hybridize; comparing the amounts of the probes hybridized under the two conditions wherein the reduction in amount hybridized under the second condition compared to the first condition is indicative of the amount of miRNA precursor in the sample.
[0526] The invention also features methods of using the probes of the invention as components of Northern blots, in situ hybridization, arrays, and various forms of PCR analysis including PCR, RT-PCR, and qPCR.
[0527] Any probe of the invention may be used in performing any method of the inven-ion. For example, any method of the invention may involve probes having labels. Furthermore, any method of the invention may also involve contacting a probe with miRNA precursor that is endogenously or exogenously produced. Such contacting may occur in vitro or in vivo, e.g., such as in the body of an animal, or within or without a cell, which may or may not naturally express the miRNA precursor.
[0528] Also, primarily with respect to miRNA precursors, nucleotide analogue containing probes, polynucleotides, and oligonucleotides are broadly applicable to antisense uses. To this end, the present invention provides a method for detection and functional analysis of non-coding antisense RNAs, as well as a method for detecting the overlapping regions between sense-antisense transcriptional units.
[0529] The oligonucleotide probes of invention are also useful for detecting, testing, diagnosing or quantifying miRNA precursors and their targets implicated in or connected to human disease, e.g., analyzing human samples for cancer diagnosis.
[0530] For example, pre-mir-138-2 is ubiquitously expressed, unlike its mature miRNA derivative. The presence of an unprocessed miRNA precursor in most tissues of the organism suggests miRNA precursors as possible diagnostic targets. We envision that miRNA precursor processing could be a more general feature of the regulation of miRNA expression and be used to identify underlying disease processes. One could also imagine that the unprocessed miRNA precursors might play a different role in the cell, irrespective of the function of the mature miRNA, providing further insights into underlying disease processes.
[0531] Imperfect processing of miRNA precursors to mature miRNA as detected by sample hybridization to oligonucleotide probes may provide diagnostic or prognostic in-formation. Specifically, the ratio between levels of mature and precursor transcripts of a given miRNA may hold prognostic or diagnostic information. Furthermore, specific spatial expression patterns of mature miRNA compared to miRNA precursor may likewise hold prognostic or diagnostic information. In addition, performing in situ hybridization using mature miRNA and/or miRNA precursor specific oligonucleotide probes could also detect abnormal expression levels. LNA-containing probes are particularly well-suited for these purposes.
[0532] The present invention enables discrimination between different polynucleotide transcripts and detects each variant in a nucleic acid sample, such as a sample derived from a patient, e.g., addressing the spatiotemporal expression patterns by RNA in situ hybridization. The methods are thus applicable to tissue culture animal cells, animal cells (e.g., blood, serum, plasma, reticulocytes, lymphocytes, urine, bone marrow tissue, cerebrospinal fluid or any product prepared from blood or lymph) or any type of tissue biopsy (e.g., a muscle biopsy, a liver biopsy, a kidney biopsy, a bladder biopsy, a bone biopsy, a cartilage biopsy, a skin biopsy, a pancreas biopsy, a biopsy of the intestinal tract, a thymus biopsy, a mammae biopsy, a uterus biopsy, a testicular biopsy, an eye biopsy or a brain biopsy, e.g., homogenized in lysis buffer), archival tissue nucleic acids such as formalin fixated paraffin embedded sections of the tissue and the like.
[0533] pre-mir-138-1 and pre-mir-138-2 and their shared mature miRNA derivative mir-138 differ in their expression levels across various tissues as detected by oligonucleotide probes. The differential expression of pre-mir-138-1 and pre-mir-138-2 and their derived mature miRNA mir-138. pre-mir-138-2 is expressed in all tissues, and mir-138 is expressed in a tissue-specific manner. Furthermore, the experiments suggest that an inhibitory factor is responsible for tissue-specific processing of pre-mir-138-2 into mir-138 and that this inhibitory factor is specific for certain miRNA precursors. This inhibitory factor acting on pre-138-2 may be capable of distinguishing pre-mir-138-1 from pre-mir-138-2 as well. pre-mir-138-1 and pre-mir-138-2 have different pre-mir sequences, particularly in the loop region, and thus the inhibitory factor may be capable of recognizing these sequence differences to achieve such specificity. It is hypothesized that recognition by an inhibitory factor is dependent on the differences in the loop sequence, e.g., the size of the loop sequence, between pre-mir-138-1 and pre-mir-138-2. It is therefore possible that an oligonucleotide probe capable of hybridizing specifically to the sequences that are different between pre-mir-138-1 and pre-mir-138-2, e.g. in the loop region, could be utilized to block the inhibitory effect of the inhibitory factor, thereby allowing the pre-mir-138-2 to be processed.
Signal Data
[0534] The signal data obtained from the hybridisation experiment may be a quantitative measurement of the level of signal detected.
[0535] The signal data obtained from the hybridisation experiment may be a qualitative measurement of the level of signal detected.
[0536] For example, in the case of non-coding RNAs whose presence of absence is indicative of the presence/or absence of a feature of the cancer, the detection of signal, i.e. positive signal data or negative signal data may be a direct indication of the feature in question.
[0537] In one embodiment the signal data may be used to obtain a ratio of the signals obtained between the test sample and a control sample, or a matrix between the signal between the control sample and more than one of the controls as herein provided. The ratio or matrix being indicative of the feature in question.
[0538] The signal data from numerous hybridisations, for example arrays of a collection of detection probes may provide signals from hybridisations with several different targets, and it is the differential pattern of targets which allows for one or more of the features in question to be determined. Typically, the determination of previously characterised cancers can provide a dataset which can subsequently be used for comparison with data obtained from samples from a patient, thereby allowing determination of the features.
[0539] Therefore, in one embodiment, the method of the invention comprises the hybridisation of the test sample and one or more control samples to both i) one or more target detection probes, such as a collection of detection probes, which may be in the form as listed above, such as an array such as a micro-array, and ii) one or more control detection probes, such as [0540] at least one normalising control probe and at least one mRNA marker control probe, or [0541] at least one normalising control probe and at least one DNA marker control probe and optionally at least one mRNA marker control probe. or [0542] at least one normalising control probe and at least one immature noncoding RNA, selected from immature miRNA, immature siRNA and immature piRNA, and optionally at least one DNA marker control probe and optionally at least one mRNA marker control probe.
Collection of Probes of the Invention
[0543] In one embodiment a collection of probes according to the present invention comprises at least 10 detection probes, 15 detection probes, such as at least 20, at least 25, at least 50, at least 75, at least 100, at least 200, at least 500, at least 1000, and at least 2000 members.
[0544] The collection of detection probes may comprise a majority of detection probes to the target as compared to the control probes.
[0545] In one embodiment, at least 10%, such as at least 20%, such as at least 30%, such as at least 40%, such as at least 50%, such at least 60%, such as at least 70%, such as at least 80%, such as at least 90 or 95% of the detection probes in the collection of detection probes may be capable of hybridizing to the respective population of target molecules (as opposed to control-targets).
[0546] The collection of detection probes preferably comprises at least one control detection probe, and may comprise a collection of control detection probes.
[0547] In one embodiment, the collection of probes according to the present invention consists of no more than 500 detection probes, such as no more than 200 detection probes, such as no more than 100 detection probes, such as no more than 75 detection probes, such as no more than 50 detection probes, such as no more that 50 detection probes, such as no more than 25 detection probes, such as no more than 20 detection probes.
[0548] In one embodiment, the collection of probes according to the present invention has between 3 and 100 detection probes, such as between 5 and 50 detection probes, such as between 10 and 25 detection probes.
[0549] In one embodiment, the collection of probes of the invention is capable of specifically detecting all or substantially all members of the transcriptome of an organism.
[0550] In another embodiment, the collection of probes is capable of specifically detecting all small non-coding RNAs of an organism, such as all miRNAs, piRNAs, snRNAs and/or siRNAs.
[0551] In a preferred embodiment, the collection of probes is capable of specifically detecting a subset of non-coding RNAs, preferably a subset which has been selected for their ability to act as markers for at least one type of cancer, and preferably appropriate control probes or collection of control probes.
[0552] In one embodiment, the affinity-enhancing nucleobase analogues are regularly spaced between the nucleobases in at least 80% of the members of said collection, such as in at least 90% or at least 95% of said collection (in one embodiment, all members of the collection contains regularly spaced affinity-enhancing nucleobase analogues).
[0553] In one embodiment of the collection of probes, all members contain affinity enhancing nucleobase analogues with the same regular spacing in the recognition sequences.
[0554] Also for production purposes, it is an advantage that a majority of the probes in a collection are of the same length. In preferred embodiments, the collection of probes of the invention is one wherein at least 80% of the members comprise recognition sequences of the same length, such as at least 90% or at least 95%.
[0555] As discussed above, it is advantageous, in order to avoid self-annealing, that at least one of the nucleobases in the recognition sequence is substituted with its corresponding selectively binding complementary (SBC) nucleobase.
[0556] Typically, the nucleobases in the sequence are selected from ribonucleotides and deoxyribonucleotides, preferably deoxyribonucleotides. It is preferred that the recognition sequence consists of affinity enhancing nucleobase analogues together with either ribonucleotides or deoxyribonucleotides.
[0557] In certain embodiments, each member of a collection is covalently bonded to a solid support. Such a solid support may be selected from a bead, a microarray, a chip, a strip, a chromatographic matrix, a microtiter plate, a fiber or any other convenient solid support generally accepted in the art.
[0558] The collection may be so constituted that at least 90% (such as at least 95%) of the recognition sequences exhibit a melting temperature or a measure of melting temperature corresponding to at least 5° C. higher than a melting temperature or a measure of melting temperature of the self-complementarity score under conditions where the probe hybridizes specifically to its complementary target sequence (or that at least the same percentages of probes exhibit a melting temperature of the probe-target duplex of at least 5° C. more than the melting temperature of duplexes between the probes or the probes internally).
[0559] As also detailed herein, each detection probe in a collection of the invention may include a detection moiety and/or a ligand, optionally placed in the recognition sequence but also placed outside the recognition sequence. The detection probe may thus include a photochemically active group, a thermochemically active group, a chelating group, a reporter group, or a ligand that facilitates the direct of indirect detection of the probe or the immobilisation of the oligonucleotide probe onto a solid support.
Methods/Uses of Probes and Probe Collections
[0560] Preferred methods/uses include: Specific isolation, purification, amplification, detection, identification, quantification, inhibition or capture of a target nucleotide sequence in a sample, wherein said target nucleotide sequence is associated with cancer, such as breast cancer, by contacting said sample with a member of a collection of probes or a probe defined herein under conditions that facilitate hybridization between said member/probe and said target nucleotide sequence. Since the probes are typically shorter than the complete molecule wherein they form part, the inventive methods/uses include isolation, purification, amplification, detection, identification, quantification, inhibition or capture of a molecule comprising the target nucleotide sequence.
[0561] Typically, the molecule which is isolated, purified, amplified, detected, identified, quantified, inhibited or captured is a small, non-coding RNA, e.g. a miRNA such as a mature miRNA. Typically the small, non-coding RNA has a length of at most 30 residues, such as at most 29, 28, 27, 26, 25, 24, 23, 22, 21, 20, 19, or 18 residues. The small non-coding RNA typically also has a length of at least 15 residues, such as at least 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29 or 30 residues.
[0562] As detailed in PCT/DK2005/000838, the specific hybridization between the short probes of the present invention to miRNA and the fact that miRNA can be mapped to various tissue origins, allows for an embodiment of the uses/methods of the present invention comprising identification of the primary site of metastatic tumors of unknown origin.
[0563] As also detailed in PCT/DK2005/000838, the short, but highly specific probes of the present invention allows hybridization assays to be performed on fixated embedded tissue sections, such as formalin fixated paraffin embedded sections. Hence, an embodiment of the uses/methods of the present invention are those where the molecule, which is isolated, purified, amplified, detected, identified, quantified, inhibited or captured, is DNA (single stranded such as viral DNA) or RNA present in a fixated, embedded sample such as a formalin fixated paraffin embedded sample.
[0564] The detection probes herein disclosed may also be used for detection and assessment of expression patterns for naturally occurring single stranded nucleic acids such as miRNAs, their target mRNAs, stem-loop precursor miRNAs, siRNAs, piRNAs, other non-coding RNAs, RNA-edited transcripts or alternative mRNA splice variants by RNA in-situ hybridisation, dot blot hybridisation, reverse dot blot hybridisation, or in Northern blot analysis or expression profiling by microarrays.
[0565] In one embodiment the hybridisation occurs in in situ hybridisation of a test sample, such as a biopsy, taken from a patient during an operation. The use of in situ hybridisation is preferred when the two dimensional location of the target molecule is to be used in determining the feature of the cancer. For example, cancers are often made up of vascular cells, connective tissue etc as well as cancerous cells, the use of in situ hybridisation therefore allows a morphological distinction to be made between hybridisation in non cancer cells and cancer cells within a sample. Typically the in situ hybridisation is performed using only a few detection probes, such as between 1 and three detection probes, such as two detection probes. One or two of the detection probes may be control probes. The in situ hybridisation may be performed during or subsequent to a method of therapy such as surgery for removal or biopsy of a cancer.
[0566] The detection probes herein disclosed may also be used for antisense-based intervention, targeted against tumorgenic single stranded nucleic acids such as miRNAs, their target mRNAs, stem-loop precursor miRNAs, siRNAs, piRNAs, other non-coding RNAs, RNA-edited transcripts or alternative mRNA splice variants or viral DNA in vivo in plants or animals, such as human, mouse, rat, by inhibiting their mode of action, e.g. the binding of mature miRNAs to their cognate target mRNAs.
[0567] Further embodiments includes the use of the detection probe as an aptamer in molecular diagnostics or (b) as an aptamer in RNA mediated catalytic processes or (c) as an aptamer in specific binding of antibiotics, drugs, amino acids, peptides, structural proteins, protein receptors, protein enzymes, saccharides, polysaccharides, biological cofactors, nucleic acids, or triphosphates or (d) as an aptamer in the separation of enantiomers from racemic mixtures by stereospecific binding or (e) for labelling cells or (f) to hybridise to non-protein coding cellular RNAs, miRNA (preferably) such as tRNA, rRNA, snRNA and scRNA, in vivo or in-vitro or (g) to hybridise to non-protein coding cellular RNAs, such as miRNA (preferably) tRNA, rRNA, snRNA and scRNA, in vivo or in-vitro or (h) in the construction of Taqman probes or Molecular Beacons.
[0568] The present invention also provides a kit for the isolation, purification, amplification, detection, identification, quantification, or capture of nucleic acids, wherein said nucleic acids are associated with cancer, such as the cancers herein disclosed, such as breast cancer, where the kit comprises a reaction body and one or more LNAs as defined herein. The LNAs are preferably immobilised onto said reactions body (e.g. by using the immobilising techniques described above).
[0569] For the kits according to the invention, the reaction body is preferably a solid support material, e.g. selected from borosilicate glass, soda-lime glass, polystyrene, polycarbonate, polypropylene, polyethylene, polyethyleneglycol terephthalate, polyvinylacetate, polyvinylpyrrolidinone, polymethylmethacrylate and polyvinylchloride, preferably polystyrene and polycarbonate. The reaction body may be in the form of a specimen tube, a vial, a slide, a sheet, a film, a bead, a pellet, a disc, a plate, a ring, a rod, a net, a filter, a tray, a microtitre plate, a stick, or a multi-bladed stick.
[0570] A written instruction sheet stating the optimal conditions for use of the kit typically accompanies the kits.
[0571] A preferred embodiment of the invention is a kit for the characterisation of cancer, such as the cancers listed herein. Such kits may allow the detection or quantification of target non-coding RNAs, such as miRNA (preferably), siRNAs, snRNAs, piRNAs, non-coding antisense transcripts or alternative splice variants.
[0572] The kit may comprise libraries of detection probes, which comprise one or more detection probes and optionally one or more control probes. The kit may also comprise detection probes for mRNAs (i.e. coding RNAs), and DNA, the presence or absence or level of which may also contribute to characterising the cancer. It is preferable that the kit comprises an array comprising a collection of detection probes, such as an oligonucleotide arrays or microarray.
[0573] The use of the kit therefore allows detection of non-coding RNAs which are associated with cancer, and whose level or presence or absence, may, either alone, or in conjunction with the level or presence or absence of other non-coding RNAs, and optionally coding RNAs, provide signal data which can be used to characterise said cancer.
[0574] In one aspect, the kit comprises in silico protocols for their use. The detection probes contained within these kits may have any or all of the characteristics described above. In one preferred aspect, a plurality of probes comprises at least one stabilizing nucleotide, such as an LNA nucleotide. In another aspect, the plurality of probes comprises a nucleotide coupled to or stably associated with at least one chemical moiety for increasing the stability of binding of the probe.
[0575] The invention therefore also provides for an array, such as a microarray which comprises one or more detection probe according to the invention, such as the collection of detection probes and optionally one or more control probe, preferably a collection of control probes. The array or microarray is particularly preferred for use in the method of the invention.
BRIEF DESCRIPTION OF THE FIGURES
[0576] FIG. 1: Separation of small RNAs from human breast cancer tissues on a denaturing 12.5% polyacrylamide gel. miRNAs in the size range of 15-30 nt and 30-100 nt were extracted from the gel.
[0577] FIG. 2: PAGE analysis (6% PAA) of PCR-amplified cDNAs obtained from the 15-30 nt (lane 1) and the 30-100 nt (lane 2) miRNA fraction (100 ng each). The gel was stained with ethidiumbromide.
[0578] FIG. 3: PAA gel (6%) electrophoresis of the gel purified cDNA fractions containing miRNA cDNA inserts of 15-30 bp (lane 1, 20 ng) and 30-100 bp (lane 2, 40 ng) and the resulting cDNA pool (lane 3, 33 ng). The gel was stained with ethidiumbromide.
[0579] FIG. 4: M-A plot showing all miRNA signals before averaging.
EXAMPLES
[0580] The invention will now be further illustrated with reference to the following examples. It will be appreciated that what follows is by way of example only and that modifications to detail may be made while still falling within the scope of the invention.
[0581] LNA-substituted probes may be prepared according to Example 1 of PCT/DK2005/000838.
Example 1
Identification of Novel miRNAs by 454 Pyrosequencing
[0582] Experimental Methods--Preparation of a cDNA-Pool from Human Breast Cancer Tissues for 454 Amplicon Sequencing
[0583] Tissue: Five different human breast cancer tissue samples (about 200 mg in total) were shipped in RNA later on dry ice to Vertis Biotechnologie AG for RNA purification and fractionation.
[0584] Preparation and gel purification of miRNAs: Tissues were ground under liquid nitrogen. RNA species smaller than 200 nt were enriched with the mirVana miRNA isolation kit (Ambion, Austin, Tex., USA). The small RNAs were then separated on a denaturing 12.5% polyacrylamide (PAA) gel. As molecular mass standard a mixture of oligonucleotides was used that range in size between 15 and 100 bases (see FIG. 1). The population of miRNAs with a length of 15-30 or 30-100 bases was obtained by passive elution of the RNAs from the gel. The miRNAs were then precipitated with ethanol and dissolved in water.
[0585] cDNA synthesis: For cDNA synthesis the miRNAs were first poly(A)-tailed using poly(A) polymerase followed by ligation of a RNA adapter to the 5''-phosphate of the miRNAs. First-strand cDNA synthesis was then performed using an oligo(dT)-linker primer and M-MLV-RNase H-reverse transcriptase. The resulting cDNAs were then PCR-amplified to about 20 ng/μl in cycle numbers indicated in Table 1 using Taq polymerase.
TABLE-US-00001 TABLE 1 Number of PCR cycles used for cDNA amplification, barcode sequences and size fraction of miRNA used for cDNA synthesis. 5'-TAG Number PCR cycles sequence RNA size cDNA size 1 20 ATCG 15-30 nt 119-134 bp 2 18 CAGC 30-100 nt 135-205 bp
[0586] The fusion primers used for PCR amplification were designed for amplicon sequencing according to the instructions of 454 Live Sciences. Barcode sequences for each cDNA species, which are attached to the 5'-ends of the cDNAs, are included in Table 1. The following adapter sequences flank the cDNA inserts:
TABLE-US-00002 5'-end (43 bases): (SEQ ID NO 409) 5'-GCCTCCCTCGCGCCATCAGCTNNNNGACCTTGGCTGTCACTCA-3'. 3'-end (61 bases): (SEQ ID NO 410) 5'-GCCTTGCCAGCCCGCTCAGACGAGACATCGCCCCGCTTTTTTTTTTT TTTTTTTTTTTTTT-3.
[0587] 454 adapter sequences are underlined.
[0588] The combined length of the flanking sequences is 104 bases. Therefore, PCR-products containing miRNA cDNAs of 15-30 nt and 30-100 nt must have a total length of 119-134 bp and 135-205 bp. PAGE analysis of the 2 cDNAs revealed that the cDNAs were of the expected size (FIG. 2).
[0589] Pool formation: The correct size ranges of 119-134 bp and 135-205 bp of both cDNAs were obtained by separate purification on 6% PAA-gels. For pool formation the purified cDNAs shown in lane 1 (15-30 bp inserts) and 2 (30-100 bp inserts) of FIG. 3 were mixed in a molar ratio of 3+1. The concentration of the cDNA pool is 11 ng/μl dissolved in 25 μl water. 3 μl of the gel purified pool was analyzed on a 6% PAA gel (FIG. 3, lane 3).
Example 2
Molecular Classification of Breast Cancer by microRNA Signatures
[0590] Breast cancer is the most frequent form of cancer among women worldwide. Currently, treatment and prognosis is based on clinical and histo-pathological graduation, such as TNM classification (tumor size, lymph node and distant metastases status) and estrogen receptor status. To improve both the selection of therapy and the evaluation of treatment response, more accurate determinants for prognosis and response, such as molecular tumor markers, are needed. The primary aim of this study was to study the expression patterns of microRNAs (miRNAs) in tumors and normal breast tissue to identify new molecular markers of breast cancer.
[0591] Biopsies from primary tumors and from the proximal tissue (1 cm from the border zone of tumor) were collected from female patients (age 55-69) undergoing surgery for invasive ductal carcinoma. Total-RNA was extracted following the "Fast RNA GREEN" protocol from Bio101. Assessment of miRNA levels was carried out on miRCURY® microarrays according to the manufacturers recommended protocol (Exiqon, Denmark).
[0592] The results from the miRNA analysis revealed numerous differentially expressed miRNAs, including those reported earlier to be associated with breast cancer, such as let-7a/d/f, miR-125a/b, miR-21, miR-32, and miR-136 [1]. In addition, we have identified several miRNAs that have not previously been connected with breast cancer.
RNA Extraction
[0593] Before use, all samples were kept at -80° C.
[0594] Two samples--ca. 100 mg of each--were used for RNA extraction:
PT (primary tumor) 1C (normal adjacent tissue, one cm from the primary tumor)
[0595] The samples were thawed on ice, and kept in RNAlater® (Cat#7020, Ambion) during disruption with a sterile scalpel into smaller ca. 1 mm wide slices.
[0596] To a FastPrep GREEN (Cat#6040-600, Bio101) tube containing lysis matrix was added:
500 μL CRSR-GREEN
500 μL PAR
100 μL CIA
[0597] 200 μL tissue
[0598] The tubes were placed in the FastPrep FP120 cell disruptor (Bio101) and run for 40 seconds at speed 6. This procedure was repeated twice, before cooling on ice for 5 min. The tubes were centrifuged at 4° C. and at maximum speed in an Eppendorf microcentrifuge for 10 min to enable separation into organic and water phases. The upper phase from each vial was transferred to new Eppendorf 1.5 mL tubes while avoiding the interphase. 500 μl CIA was added, vortexed for 10 seconds, and spun at max speed for 2 min to separate the phases. Again, the top phase was transferred to new Eppendorf tubes, while the interphase was untouched. 500 μL DIPS was added, vortexed, and incubated at room temperature for 2 min. The tubes were centrifuged for 5 min at max speed to pellet the RNA. The pellet was washed twice with 250 μL SEWS and left at room temperature for 10 min to air dry. 50 μL SAFE was added to dissolve the pellet, which was stored at -80° C. until use. QC of the RNA was performed with the Agilent 2100 BioAnalyser using the Agilent RNA6000 Nano kit. RNA concentrations were measured in a Nanoprop ND-1000 spectrophotometer. The PT was only 71 ng/μL, so it was concentrated in a speedvac for 15 min to 342 ng/μL. The 1C was 230 ng/μL, and was used as is.
RNA Labelling and Hybridization
[0599] Essentially, the instructions detailed in the "miRCURY Array labelling kit Instruction Manual" were followed:
[0600] All kit reagents were thawed on ice for 15 min, vortexed and spun down for 10 min. In a 0.6 mL Eppendorf tune, the following reagents were added:
2.5× labelling buffer, 8 μL Fluorescent label, 2 μL 1 μg total-RNA (2.92 μL (PT) and 4.35 μL (1C)) Labeling enzyme, 2 μL Nuclease-free water to 20 μL (5.08 μL (PT) and 3.65 μL (1C))
[0601] Each microcentrifuge tube was vortexed and spun for 10 min.
[0602] Incubation at 0° C. for 1 hour was followed by 15 min at 65° C., then the samples were kept on ice.
[0603] For hybridization, the 12-chamber TECAN HS4800Pro hybridization station was used.
[0604] 25 μL 2× hybridization buffer was added to each sample, vortexed and spun.
[0605] Incubation at 95° C. for 3 min was followed by centrifugation for 2 min.
[0606] The hybridization chambers were primed with 1×Hyb buffer.
[0607] 50 μl of the target preparation was injected into the Hyb station and incubated at 60° C. for 16 hours (overnight).
[0608] The slides were washed at 60° C. for 1 min with Buffer A twice, at 23° C. for 1 min with Buffer B twice, at 23° C. for 1 min with Buffer C twice, at 23° C. for 30 sec with Buffer C once.
[0609] The slides were dried for 5 min.
[0610] Scanning was performed in a ScanArray 4000XL (Packard Bioscience).
Results
[0611] The M-A plot (FIG. 4) shows the Log 2 fold ratio of tumor/normal (M) as a function of the Log 2
[0612] In this experiment, a total of 86 out of known 398 miRNAs were found to be differentially expressed between breast cancer and normal adjacent tissue.
Example 3
LNA-Substituted Detection Probes for Detection of microRNAs Associated with Breast Cancer in Humans
[0613] LNA nucleotides are depicted by capital letters, DNA nucleotides by lowercase letters, mC denotes LNA methyl-cytosine. The detection probes can be used to detect and analyze conserved vertebrate miRNAs, such as human miRNAs by RNA in situ hybridization, Northern blot analysis and by silencing using the probes as miRNA inhibitors. The LNA-modified probes can be conjugated with a variety of haptens or fluorochromes for miRNA in situ hybridization using standard methods. 5'-end labeling using T4 polynucleotide kinase and gamma-32P-ATP can be carried out by standard methods for Northern blot analysis. In addition, the LNA-modified probe sequences can be used as capture sequences for expression profiling by LNA oligonucleotide microarrays. Covalent attachment to the solid surfaces of the capture probes can be accomplished by incorporating a NH2--C6-- or a NH2--C6-hexaethylene glycol monomer or dimer group at the 5'-end or at the 3'-end of the probes during synthesis. As disclosed in PCT/DK2005/000838,
[0614] It is possible to map miRNA in cells to determine the tissue origin of these cells, the present invention presents a convenient means for detection of tissue origin of tumors.
[0615] Hence, the present invention in general relates to a method for determining tissue origin of breast tumors comprising probing cells of the tumor with a collection of probes which is capable of mapping miRNA to a tissue origin.
Example 4
Identification of Further Novel miRNAs
[0616] Further microRNAs and pre-miRNAs were identified using similar experimental techniques as Examples 1-3. These are microRNAs and pre-miRNAs are shown in columns 1 and 2 of table 3, and in some cases they were found to be related to the mircoRNAs (and pre-miRNAs) identified from the previous examples (as shown in columns 3 and 4 of table 3). The pre-miRNA sequences and their corresponding SEQ ID number, pre-miR ID number, are provided in table 4. The corresponding miRNA sequences and their corresponding SEQ ID number are provided in table 5.
TABLE-US-00003 TABLE 3 miRNA Pre-miRNA Related Related SEQ ID SEQ ID miRNAs pre-miRNAs Column 1 Column 2 SEQ IDs SEQ IDs 411 412 413 414 504 505 415 416 417 418 419 147 148 420 279 280 421 447 448 422 423 424 425 426 427 480 481 428 429 433 452 453 430 431 432 434 435 502 503 436 437 438 439 440 441 442 443 444 445 446 447 448 147 148 279 280 418 418 420 421 449 450 513 514 451 452 453 429 433 430 431 432 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 95 96 471 472 473 474 475 476 477 478 479 480 481 426 427 428 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 (429 et al. 1 (433 et al - 1 497 500 mismatch) mismatch) 498 541 542 499 543 501 502 503 434 435 504 505 506 507 508 509 510 511 512 513 514 449 450 451 530 531 532 533 515 516 517 518 519 228 229 245 246 520 521 239 240 273 274 522 523 524 525 526 527 187 188 528 529 245 246 518 519 530 531 513 514 532 533 532 533 513 514 530 531 534 535 371 372 391 392 536 537 538 539 540 541 542 431 433 543 432 495 496 497 498 499 500 501 544 545 546 547 548 551 552 553 554 549 552 548 551 553 550 554 550 553 548 551 554 549 552 555 556 557 558 175 553 (mismatch) 285 554 339 (mismatch) 548 549 550
TABLE-US-00004 TABLE 4 Pre-miRNA Sequences Seq ID premir_id name PreMiR sequence 2 9261 premiR_09261 ugaaaucaacgaaucaccuaccuaacuggguuagggcccuggcucc aucuccuuuaggaaaaccuucuguggggaguggggcuucgacccua acccaggugggcuguaacacugcuguguuuucuaaggggcagaguu uucuacuacuuuuccgcuggcccag 4 9252 premiR_09252 aggcagcucggcgggcggcgggcggcauucuggcgcggagcggagc ggcggcgggcgcagcuagcgggucggccgcggagcggaggugcagc ucggcuucccccggcaccccucccccucgggcgccagccccacccc uccgccggccgggccgaccc 6 9183 premiR_09183 aucacccucugaucgccgaucaccucugagacccaacuugcucaua aacaaaacugcccaugucgguccucugcccuggaccugugacacuc uggacuauuucuguguuuauuuguggccgaguguaacaaccauaua auaaaucaccucuuccgcuguuuua 8 9128 premiR_09128 auccugccuuggcuggaaaagccagccuuccacccagcgccccuaa aaugaucggguugacuccaguuuuguuacgaaaggaggccgggcug cugagaggcucccugaguucccuucguggucgcccgucacauugcc cugcuguauacuuaauaa 10 9242 premiR_09242 cagacaaagaggggcgugagggagcugccugcaggggaagaagccu uccguaucgagcugggcggucauuacacaggugcgcacagauaugg augaggaggggcgugagggagccacgugcagggcagcaaguccucu auaucuugagcuggguggucauu 12 9256 premiR_09256 acccccaaagcucuccugccugcuucugugugauauguuugauauu ggguuguuuaauuaggaaccaacuaaaugucaaacauauucuuaca gcagcaggugauucagcaccacccucuuucauacuucaaucucugg ggcuccugucucuuuuacugaa 14 9147 premiR_09147 auugaguagggcaaauuuuaaauggguauuauuuuucaucuucaaa caggcagaccuguuauccuaaacuaggugagucagcuuuugguaca ugugaugauuuucaguguaaccaaugauguaaugauucugccaaau gaaauauaaugauaucacuguaaaac 16 9111 premiR_09111 uuggcaggaaguuuccauggccaugcagccgcagggucacccugag ugcuuuucaggguggcagggccuugccucagauggccacaagggca ccucuccuuggauacuuuaugauucugugacgccagcuacuugguu ugcuuuuuguauuuuuaugcau 18 9294 premiR_09294 ucuacaaaauuggugguauugguacuguuccuguuggccgagugga gacugguguucucaaaccuggugugguggucaccuuugcuccaguc aacauuacaacagaaguaaaaucugucgaaaugcaccaugaagcuu ugagugaagcucuuccuggggacaaug 20 9192 premiR_09192 auagaaucaucuaaguauucagacacugcuuuccuaggaaauguua aacuccuugaggcaggcuggcuuccucaccaccuugugcacugcug cucccacaccacagugacuagcagcacauaaugguuugaauuaaag cugaaguaaaaaauauccaggucca 22 9245 premiR_09245 uguagcuuaccuccucaaagcaauacacugaaaauguuuagacggg cucacaucaccccauaaacaaauagguuugguccuagccuuucuau uagcucuuaguaagauuacacaugcaagcauccccguuccagugag uucacccucuaaaucaccacgau 24 9237 premiR_09237 auuugagaaggaggcugcugagaugggaaagugcuccuucaaguau gccugggucuuggauaaacugaaagcugagcgugaacaugguauca ccauugauaucucuuuguggaaauuugagaccagcaaguacuaugu gacuaucauugaugccccaggacaca 26 9125 premiR_09125 ugccuaauacugacucagaugcacaauccaguuaacccagaugugu gagaucuuccgguuugaaagaacuguauuggcaaggcaaaaucaac cuauuguagaauauauuuauuguauaucagcauggggauuauuaau auugcuaauaaaaccauuauuuguaaa 28 9234 premiR_09234 gggaaggauaaagggauggcaugguggggguuggaggcguggguuu uagaaccuaucccuuucuagcccugagcaaugcuugccccagaagg aguuggggcuaggcccauuccaauccuuccagccuaagauccagac uccaaggcaugccccag 30 9164 premiR_09164 ucaaucuggaggagcucaggguggccggcauucacaagaagguggc ccggaccaucggcauuucuguggauccgaggaggcggaacaagucc acggagucccugcaggcgaacgugcagcggcugaaggaguaccgcu ccaaacucauccucuuccccagga 32 9139 premiR_09139 accccauccaauuuaaucggguguuauuuaauuauacuacuauaau uguuguauuugcagguuugacuguucucagggaacgcugaagguuc auaacaguagugauuuguaauugugaggcuugaguguggaauugaa uuacuucauuagagaguaacc 34 9290 premiR_09290 ugguguggccaaggccaacacugagucgaccugauggagagaagaa ggcauguguccacuggcuccugaugaccaugcuuuggauguugcca acaaaauugggaucaucuaaucugaguccagcuugcuaauucuaaa gguauauauguaucuuuucacca 36 9154 premiR_09154 guuaaaaaaaguaaaaggaacucggcaaaucuuaccccgccuguuu accaaaaacaucaccucuagcauucucaguauuagaggcaccgccu gcccagugacaugcguuuaacggccgcgguacccuaacugugcaaa gguagcauaaucacuuguuccu 38 9269 premiR_09269 gaagaucacuacaacaauuugucugccuccaagguccucugaggca gcaggcucuggggcuucugcuguccuuuggagggugucuucugggu agagggaugggaaggaagggacccuuacccccggcucuucuccuga ccugccaauaaaaauuuauggucca 40 9296 premiR_09296 cacgcuuguggugaaaucaggaauuuuuaggacucuuagcggugga ucaaaaagaaaaaagaaaacaggacagaguaaaaucuugcuccaaa gcuuguguucuggcaaauaccgucugugucucgaaugugaaguugu uuccacuccucagagcccac 42 9141 premiR_09141 ccgugaagaggcgggcaugacacagcaagacgagaagacccuaugg agcuuuaauuuauuaaugcaaacaguaccuaacaaacccacagguc cuaaacuaccaaaccugcauuaaaaauuucgguuggggcgaccucg gagcagaacccaaccuccgag 44 9291 premiR_09291 cuuauuuacguuacuggcugaaagccugucugauaggauugacaug gagcacuaauuaaucaccuagggucuccucauuuacuaaucauauu gcacaaaacuucccugcugacugaggcucaagggcaaacugugggc uuccagccagcuuauuuuucauaa 46 9263 premiR_09263 gauucaugaguagcagugacaaaccuaccgagccuggugauagcug guuguccaagauagaaucuuagacaacucccuauaccagauccucu aauuaauuuuaauaaaggccuucuauuuauacuagccacaucaagc cuagccgucuacguacccacagaa 48 9251 premiR_09251 gggcagaagucugagccaguguuucaucaucguucuugcucugccu cggucuguacaucugugaaaugggacucccucucuguuguggaggc ccuggggacagcugggaggacuggaggggugguggggagguugugg uccuuauuagacauucagauacc 50 9300 premiR_09300 ggcaagaacaaguaccuuacgaaagacagcaaaaagggagccaaga aguggcugauccauuuucuuuuuuucuuuuuucuuuuuuuugagac agucuugcucuaucccccuggcuggaauacaauggugugaucucag cucacugcaaccuccgccuc 52 9127 premiR_09127 caggccuuucugaaggaguuauucugcuaaaaauggucuuaguugu cugaaaagccagcucuugaaccucuucacaacaguaucaacacugg cuucucccgguucauuuuaugcgugcgagaagucagugguaacugc ugcagggcuuaauacauuagu 54 9304 premiR_09304 ucacucgccaguaaccugucugcaugcaagacugggcagugacaag cacgaugugcucacugcccaagauuuugcuuugauuuuguuuuacu gcccaagaucugaacauuuuuugcaaacauagcagcuucucuaccu cugcugcauugacauauguuugaa 56 9148 premiR_09148 auuuaaaacugugucuuucugugucccugaaauucucacacauggu acguuuucaaugagcugauuuuguuucuccacucaaugcaguaauu gagcuucuuugguucagugcaugagugguucagugguucauugggc auccugguugagggaggggcu 58 9159 premiR_09159 uuuaugguugcuacuguagguuuauaauuuguuuauaauuuggccu aauuuccaucagccauacuaauauuggauuuuaaaaggaggcaacu uuuuuucuuuuugaaccaaaggaaugaguuagcuuugaaaacauaa uuugggauauuauaguaugga 60 9205 premiR_09205 ccugcugggguuggaguucuuaaugaacauacaagugaauacacug aggcaaaaaaauuaaagcucuccaacugugggguauucauucuguu cacuguggccaguguggugaucaguacuggccacaccaguggccaa agagaacugcauucaucaugug 62 9220 premiR_09220 ccucagccccuucagagagcgacuuucaaacucgcgcccgcgucgc ggcagcaccugggcagccccgcacgccgugcgcgucccgagcccgc ggggcagcuaccgcucggugaguguccccugauucuccucucuccc cucuuaucucccugcauuaggcug 64 9182 premiR_09182 cugaaaaguuccagcauauuuugcgaguacucaacaccaacaucga ugggcagcggaaaauagccuuugccaucacugccauuaagggugug ggccgaagauaugcucaugugguguugaggaaagcagacacugacc ucaccaagagggcgggagaacuc 66 9121 premiR_09121 caugcuuuugguuuguuaccaaaauauacaguguggugaagguuga cugaagaaguccaguguguccaguuaaaacagaaauaaauuaaacu cuucaucaacaaagaccuguuuuugugacugccuugaguuuuauca gaauuauuggccuaguaauccuu 68 9276 premiR_09276 augguuacuuauaugggaaggguggguaacaaggauuggacagggu uagauuagaccccucugaagguaccuuguuuuauaguuguaacuuu uuuuuuuuuugagauggagucuugcucugucacccaggcuggagug caguggugcgaucucagcucacug 70 9247 premiR_09247 cacacgauuaacccaagucaauagaagccggcguaaagaguguuuu agaucacccccuccccaauaaagcuaaaacucaccugaguuguaaa aaacuccaguugacacaaaauagacuacgaaaguggcuuuaacaua ucugaacacacaauagcuaagacccaa 72 9198 premiR_09198 ggcggcugccgaagauggcggaggugcaggucccaguccuccaugg ucgaggccaucuccugggccgccuggcggccaucguggcuaagcag guaauguugggcuggaaggugguggucguacgcugugagggcauca acauuucuggcaauuucuaca 74 9123 premiR_09123 gcccaggacuccagcucaugcgccgaauaguagguacaguguucca augucuuugugguuuguagagaacaaucaacggucggcgaacauca gugggauaagguaaaauggcugagugaagcauuggacuguaaaucu aaagacaggggcuaagccucuuuu 76 9146 premiR_09146 ugguguagaggcggagaggagccaagaaacuaaaggugaaaaauac acuggaacucuggggcaagacaugucuaugguagcugagccaaaca cguaggauuuccguuuuaagguucacauggaaaagguuauagcuuu gccuugagauugacucauuaaa 78 9137 premiR_09137 gacuaaaacuauuugaucuuuuaauauuuaauuaaugguuccccgu ggcguuuuuauagucuguguucuauugugagcaacgagauuuuaau aagcagguucaggacuuuccauuguguagcaagaugucauugcuuc caugacacuaauuuggcuuucaua 80 9186 premiR_09186 cacauacucaaggagcccuguuuuacagggcacuggagaacuaauu aauuugcaaugcagaaagaaugcagugacaucugaaauauuggccu cggguaucacaggucauuggaaauaguuugugacaaacuggggugg aggguggggguggggaaggcaacucu 82 9115 premiR_09115 gggggaggccugcgcggaggagcaccgcuuccucccgccgggaggg ggagucccgggcuccugcguccugucucccuccccggccgucugca ggagcacgaagggagugccuccucuucgucuccucgguccccguaa cuucuccccucacuuccuccugg 84 9203 premiR_09203 gucaaaaguccccagagucuucacacaagccgugguguaugaagcu gcauccucaggaccugggcuugggugguaggaggaauuggugcugg ucuuucauuuuggauuugacuccagccccacagccucagccacccc agccaauugucauaggagcugga 86 9241 premiR_09241 gcgcggcggagggggggguggggccuuggggccgcgagugggagcg ggagcgguucugcggccuccucgggcuucuuggcccugggcggagu gggauugggugucccggcuguucgcaguggccgcgagugcggccgg accuggaguaguaccugagccgcu 88 9156 premiR_09156 gagaacaugggucaccagcagggccugagaagagggagaaaauacg gaaaugugggauuggggucgcugagugcaggcauguaaguuaagug uuuggggaacagagcagugcuugacugaguguggcuggacgugagu acugagggggacaaaugagauugaucc 90 9281 premiR_09281 ucgcgggucuguggcgcggggccccgguggucgugucgcguggggg gcgggugguuggggcguccgguucgccgcgccccgccccggcccca ccggucccggccgccgcccccgcgcccgcucgcucccucccguccg cccguccgcggcccguccgucc 92 9124 premiR_09124 uuaggaagucugagaugauaaauauuucaaggucagugaagucuau caaucauucuccccuuccucaucagcaaugguagauagaaaugucc uaaacuuuucuaaauccuagugaugaggaugugcugauauucaaca uaguccuuaaagugaaaacuga 94 9171 premiR_09171 agcuacuuccuuucuucagccucuugcuuucuguucaaaucucagc uuuuaucacauucuuuucauggagagacaucucaaugucccuuuuc gccuaggagaagaauguuauugaguggggcucaggauuuaaaccca ggcagacuaauugguaugugag 96 9155 premiR_09155 cacauacauuggcgaaaagaccaacaagucaugauuguucugaagu ucccuuuaucauguuguccccuaaucucuacuaccaguaagccuuu guguuaucuuaggaugaggcaugggugguucaguguuuauaauaag acgagucuaaaauggacaau 98 9142 premiR_09142 uguuuaaugccugaaauccaagucuuccuccaugggaaaauacugu uauaccaaauaauucuagaugaguaacaaagaucuuuuuaggccuu cauuuuauguuuuuucuuaacuguuauauuaugauugugacauaga uuauacuacuacuaauuuuuggaug
100 9166 premiR_09166 cuuacggaaaaggaacagauuguuccuaaaccagaagaggagguug cccagaagaaaaagguaaauaaguaguugcucgguuuuguuuguga uaguagaaagauuugugguugcugugaugacuaucuuaggacaccu uuggaauaacuaugaaagaaaacuau 102 9149 premiR_09149 cuaggagugacucaugcagacucaagcagaaccuuggggcccaggg cagaagugugacuucaggucucacucagcacucaucagaacacuca cucaguaugcuuguaauuagaauugagugaucucauggaugaacug uacugggcuaacuugaagagcaca 104 9118 premiR_09118 uaaaagcugaaaaucucaguuuaaaaaucaaaauguuaacacaaag cuaagauucaucagagcccacccuauucuaaggaaccacaauaacu uacucuggccccaguguuaaaacgaucuuucagauuuagagugacu auguaagaauuuaggauuuccucuuu 106 9201 premiR_09201 ggccccgcggggcccguccgcuccuccagccgcugccucccgggcg gcgcucgccggcgcggcggcaaagacugagacagcuccgcugcccg cugaacuccauccucccggcggucgggcggcggcggcugcggucgg ucgcggcagcggcuccgcu 108 9267 premiR_09267 ugccuggucaaaggcuucuaccccagcgacaucgccguggaguggg agagcagcgggcagccggagaacaacuacaacaccacgccucccau gcuggacuccgacggcuccuucuuccucuacagcaagcucaccgug gacaagagcagguggcagcaggg 110 9200 premiR_09200 guggggaggucgaugaaugagugguuaauuaauuuuauuagggggu uaauuuugcguauuggggucauugguguucuuguaguugaaauaca acgaugguuuuucauaucauuggucgugguuguaguccgugcgaga auaaugauguaugcuuuguu 112 9193 premiR_09193 auucucaguauuggaucugcacauggaguguuuuucucucuagugg uuacagaggaugaaugcauauugagauaaagaagugauuuugguuc caaaaggauuuuaaggaugaugagagaacaguggguacuucauugc caggucaugucuuugcaagaagaaa 114 9292 premiR_09292 auucgugcugaaaaucucagacucauugaugauagcugccagugac aggaguaguguugccacuguaagauacgccaucuuuguuaguuacu cucaucuacucguuucuuguauucugccucuuggucaucuuugauu cucauuuaucugcaaauuuucuuggua 116 9283 premiR_09283 aucaaacacuuauccuauuaaacacagcauccaucggugaucccag ugacaaguaauugaauguuaguucuggagucuuuccuggggugaug gccuggagaagccucucuuuuaaggauuagauucagagguagaggu aaaugaguguugagcaccaggaagag 118 9271 premiR_09271 gugcccgggagguggacuggggccuggguugugcuggaggccaggc ugaggcccugccuugguuuggggaggagaucccugcacuccggaac uccucuguggcccacggaggaucgcucugaacugccucagcguggc ggccaguggggguagggguggagaga 120 9136 premiR_09136 cuaccugaaguuuuaagagucuuggaaagucaggagugacuucugc uaaacacggggcuuuccagagucagagaagcuagcaagccuguggu uuggaccagguacuaaauauuugacaagaguaugccagguguaaug agcuacugucuauuccccuuuaaagc 122 9284 premiR_09284 cucaccucgauuccucccaggccuggguccagcaccagccuaggaa gagggugccccaugcugucuagcucuucuucgggauggggggcucc agguuccuugguauuuugcuuuggccuuuggagccucagucaaaac ugaggaaaggugucauuuucacau 124 9185 premiR_09185 uaguaaauguaggcaguuucuuuaggguuaaucaucuuucaaaggg ccuuaggaauguccuucaaacagaauauaaaugucaaagagaauau cucuuucuguuugaaauuauuugggcagguugaaagaauuugauaa agggaaauucuauauuuaaucuuuc 126 9270 premiR_09270 uguuguaaacaaacaaguuaagagcaagauucuugccaagagaauu aaugugcguauugagcacauuaagcacucugagagcugggauagcu uccugaaauacaugaaggaaaaugaucagaaaaagaaagaagccaa agagaaagguaccuggguucaacugaa 128 9197 premiR_09197 ccugaagaggaagagaugacuguuggaaagcguuccccucccccau acggcagaacagcugcggcucccaggggaaagcccccgcaggacag uccucguggggugugacggcuguugguggagaagguuuggcgcccu auuuucuuaucugccuuucu 130 9225 premiR_09225 gagaggaaaaguccagaccuaggacuaguuauggcaguuggagaga aagaacaucgggauguuugaaaauaugccauugacuaucuuaacua cuguaauuuuaucauuuccaacgucaucuaacuggggacuagaaca aacugugaauucacuuucagcaac 132 9112 premiR_09112 ucuuaaaaguuuuauuaaaggggaggggcaaauauuggcaauuagu uggcaguggccuguuacgguugggauuggugggguggguuuaggua auuguuuaguuuaugauugcagauaaacucaugccagagaacuuaa agucuuagaauggaaaaaguaaagaaa 134 9307 premiR_09307 gaaggaugguuauucccgccuggagaucccacaguagggccuuugg agugauagacauccccaucucccuccacacccugcccuaccgcccc ccaacccccaaagcuucaacaaaggcuccuuuuuaaaguuuuccgg ugcccuuugcucuuuguuugccuu 136 9295 premiR_09295 cuucaaguaugccugggucuugcauaaacugaaagcugagcgugaa cgugguaucaccauugauaucuccuuguggaaauuugagaccagca aguacuaugugacuaucauugaugccccaggacucagagacuucau caaaaacaugauuacagggacauc 138 9120 premiR_09120 uggauuucgcccccgcucccucccggaaacuccuccuggugccugc gaccguucucacugagcaugugcagacggcggugcgcaugcucugu ugcgguccgcuucgguuucuguugcgggacccggggugucuccuag cgcaaccggaacuagccuucugg 140 9153 premiR_09153 cacuguagcauaagcaagggcuuaguuccugaacugaguuacagcu uuauuuuucuuuugauucagcauguuuuuaaugauccauaaguuaa aagcugcugguguuuuuauuaaagcugccauuuguuacuaaccagg cucugugugacuccuaaguggaa 142 9116 premiR_09116 agccacaccccagcagugugcaagggaucagacacaagguugaauc caucacaaaagcagaaucaccauggcaacugcauccuuugauucuu gagugugcccagcaaccugagcagaggcgauaguugaagugaacca aguucuccugagaaauggagggga 144 9312 premiR_09312 aguccgugcgagaauaaugauguaugcuuuguuucuguugagugug gguuuaguaaugggguuugugggguuuucuucuaagccuucuccua uuuauggggguuuaguacugauuguuagcgguguggucgggugugu uauuauucugaauuuugggggagguu 146 9221 premiR_09221 aggaaggggaaacucaaucagcaggacuucagaaagggccuugugu uuauagcuuugucaaguaaauuuggacgcagcuggagcacaggccc uguuuguuugcacauaauaaucuuguuuaucacuuuaaaaaauuca guaauaucucagcagucagg 148 9151 premiR_09151 acucccugacagauaucucccucuuccauuucaucaagacccagcu gagucacugucacugccuaccaaucucgaccggaccucgaccggcu cgucuguguugccaaucgacucggcguggcgucggucgugguagau aggcggucaugcauacgaauuuucag 150 9157 premiR_09157 agggacaaugccauauuuauccuucuagcccugacaccucacacaa ugcagagaacggaagggaguucaauaacugguagcaaagugccaac uccuugagaauagggccuguguuuagugaguauuuguuaagagaau gaauaaaugauguacaguugua 152 9305 premiR_09305 agcauuugagggugaugauggauucuguguguuugagagcaacgcc auugccuacuaugugagcaaugaggagcugcggggaaguacuccag aggcagcagcccagguggugcagugggugagcuuugcugauuccga uauagugcccccagccaguaccugg 154 9309 premiR_09309 acaaggauggaagaggcccucgggccugacaacacgcauacgguua aggcauugccaccuacuucguggcaucuaaccaucguuuuuuuuuu uuugguguuuuguuuuuuauuuuucuucagacggagucuuauucug ucgcccagacuggagugcaauggcgcg 156 9239 premiR_09239 uuuuauaaccauagaguggagacagucaguaugaccaccaaaccca ggagccauauauuaaaauacugauaaauuuaacuauauaaaaaaau uuuugccgggugcgguggcucacaccugugauucuagcagaaaauc agaucaggagaucacagaagguc 158 9177 premiR_09177 guccucccacuggccgcacucugugccccauggcccuccugcgccc cgcccggcguccucucacggccucugucugugcugagcuuggguaa cucuuguucuuaccuccacagagucuguagaagaggcgacaccagg gcuuccaaaugaacaaccgaaa 162 9122 premiR_09122 ucauuucugccacagucuuuuuuguugaagcaaguuagcaagcacu aagcacaucuacaaucaaggagaggggcaggcuuuaccuuuugaag gaagaaguaugaaaguguaucacugacugaucaaguagagguaagc aguggaggacacucagaauaccuuuu 164 9275 premiR_09275 acuaauaagcuacaaaacauuuaaaugacuagugucugugugugcu ugcuaguauuauuauaccaucagaaaguaaaaauggacauacaugu uaugcauuaaacccacaagagagaaaacuugaggacugauuaauuu aaguaguaaaugaauccaagaa 166 9259 premiR_09259 ccuaaaauucucaauuaggcuauaaaugcaagaugagcugaaggga aauaggugauuuccauucuguaguguguauauaugagguuuuauuc ucaugacaagaaacagacuaugcaaaucucuuuaauuucuggcauu ucagcuuucuagaauua 168 9248 premiR_09248 gggucaauaguacuugccgcaguacucuuaaaacuaggcggcuaug guauaauacgccucacacucauucucaacccccugacaaaacacau agccuaccccuuccuuguacuaucccuaugaggcauaauuauaaca agcuccaucugccuacgacaaa 170 9191 premiR_09191 aaccagaacgugguuugccugaggcuguaacugagagaaagauucu ggggcuguguuaugaaaauauagacauucucacauaagcccaguuc aucaccauuuccuccuuuaccuuucagugcaguuucuuuucacauu aggcuguugguucaaacuuuuggg 172 9172 premiR_09172 guguguguauauauguauacauauauguauguguauguguauauag agagagagcugagaguuauucuauuuauuccuuuucucuccuaauc ugaaaauggguguucuguauuuuggguggaagaggcauagaagggg auguguguugucucuuaagauu 174 9199 premiR_09199 agacagaaaucaggacuaaguccucugcuucaguuucauuguuaac gggccuuauucugaucucaccugucgcguagcucuaauauucacau aaacugaaauaaagaaguggaaugaggagcuuugacauucaaauua ugugauguaauuuaucuucc 176 9160 premiR_09160 uauguguaagauagaaugaauauugagcaggaugcuuuaaaaguga ccaagcagauuugaaaaacauuaaaaauguuggccuucucguccca guucuucccaaaguugagaaaagcuggguugagaggaugaaaagaa aaaaaaagaaaaauuuagugga 178 9272 premiR_09272 gaaaauaaaggcaccugaaaagaaacuacuacuuuaacacugcugu ggaaggccuuugcuuuauaagaaaaauauuauuagcuaugggaaag uaauguucuuuauguaaagacuuaaaaauagacuaauaguuuacag aguuauuauauaaaauacgauguga 180 9279 premiR_09279 aaucccuguuugcuucagggcgagaugugugacagagguggcauca agcucuuacagucccaacccuccaacggaaaugggcgaagaucuca ggaauggcaucggucacaggaaaucgauaguggcuggcugcuagca uggccacuuggggcuuaggcag 182 9236 premiR_09236 ggaaguuugggauaguaaaguuuguugccuuugugucuugugucuu uuuuccuuuucuuccuuucuugggggagauagauagauagacagac agacagacagacagacacagagagagagagagagagagagagacag auaguguucauggauccugu 184 9143 premiR_09143 guaaaaugaaaucacagugguaugggccucaugggguuaucgaaag aaugggcugaggucaugugggccaugggcuugguacagugccugag acauaaugaauacucaguucccugguggucuagugguuagaaaaau aauaauaauaauaauaau 186 9298 premiR_09298 uuuagaaguuucagucgcacacuccuacccgggucggaguuagcuc aagcgguuaccuccucaugccggacuuucuaucuguccaucucugu gcugggguucgagacccgcgggugcuuacugacccuuuuaugcaau aaauucgguauaaucugucacucuga 188 9260 premiR_09260 gggcagccguggggcguggaagccgcgcagaggccaaggcugcggg guucuucgucgucuacaggcuuucgcggcucaguguggaaaacccg ccguuuccucgcgccccacguccgacccaggccuccugggcacccu ucggggaggccgcgaucucgg 190 9228 premiR_09228 guggcgucgcgugugaggcgcgugcagggugagugugaguggacgc gugagugugugagugugcgcgcuuggagcguguuaggcgagugcgu gcgcccaccccugcgccccuccucccgcuuacacuuugaucuuauu ugaucggaucgugaccccagccccgc 192 9219 premiR_09219 gggcuaguguguuuguguuuccauucuaagauugagucuggcaguc ccuguuuuuuugcauugggguaacugcucuuugauuuuuuuuaauu gcaguauuugugugauugcaauaauaaaguuugguuugguuuuuac agucaugcgcagggacgauccuug 194 9244 premiR_09244 agcccagaaccccucucaccccagaaccuuccuugacuucugccag aguugagcagccggcccucugguaggcgcaugugaguggauguggg cacauguggcccacuggaucugguggauguggucgcgucuggcccc cuggaucuggugggugugggc 196 9180 premiR_09180 gugguauuugugauuugguuaaucuguauaaaaauuguaaguagaa agguuuauauuucaucuuaauucuuuugauguuguaaacguacuuu uuaaaagauggauuauuugaauguuuauggcaccugacuuguaaaa aaaaaaaacuacaaaaaaaucc 198 9288 premiR_09288 ugguaagaaacuggaagauggcccuaaauucuugaagucuggugau gcugccauuguugauacgguuccuggcaagcccuuguguguugaga gcuucucagacuauccaccugugggucgcuuugcuguucaugaucu gagacagacaguugucgugggugucau 200 9306 premiR_09306 ccccgcucaccuccucuauccccacaguguacugcugcugcugcuu ggccaacguuucacugccuggcaucgggggcaccauuccugagucc aaaccuuucuucuacgugaacguggcugacaucgagagccuggagg uagagguguccuauguggccug
202 9287 premiR_09287 aguugcgacaagacagaguuggagaauagaggagguucagaguugg aagaaaugggaguaggugauggcaacaccgaguugucagagugagc ugaggcaacauccucuacuucuagcucacugaugaaaauauccagg auagcgggucugggguccagu 204 9258 premiR_09258 cagagugggaccggcagcucccagacuugaggcggaggggccgcgg gccggagcucccugcagccgcuagccugggaagacuggagugcgcu gcccaccgagggucugcgccgcgccggccgccccgggccgcuuugu gcgcgcccgcgcggucuguac 206 9299 premiR_09299 cagaacccaccaaccagaacgugguuugccugaggcuguaacugag agaaagauucuggggcuguguuaugaaaauauagacauucucacau aagcccaguucaucaccauuuccuccuuuaccuuucagugcaguuu cuuuucacauuaggcuguugguucaaa 208 9285 premiR_09285 gcucuuucucuucccucucguuuaguuugccugggagcuugaaagg agaaagcacggggucgccccaaaccccuucugcuucugcccaucac aagugccacuaccgccaugggccucacuaucuccucccucuucucc cgacuauuuggcaagaagca 212 9187 premiR_09187 acuuguucccuaaauagggacuuguacgaauugcuacacgaggguu cagcugucucuuacuuuuaaucagugaaauugaccuaucugugaag agguggauauaaaaaaauaagacgagaagacccuauggagcuuuaa uucauuaauacaaauaaaaacucaaac 214 9194 premiR_09194 uggacacagaagaaacgagggagcccgggucuccuccgagugugca acaagcuggccuggggccccccgaaaggacgcuggagagaagccca ggaucacccagucuuugcagcagggugcaggcuuggagucccccca agggcggcuagaaucagguccagg 216 9204 premiR_09204 ugugucuuuuaaacuggaaaaucuucuagcauguuggguuguuaca gaguauauuuuugucugcagcuguuuguugccccauuccuaagagg aguuuauccauccugacuuguagcugugugacuucuugcagugccc ccaccccauccccccgggagag 218 9212 premiR_09212 cagaagugacuuuacuuucucaaguuugauacugaguugacuguuc ccuuaucccucacccuuccccuucccuuuccuaaggcaauagugca caacuuagguuauuuuugcuuccgaauuugaaugaaaaacuuaaug ccauggauuuuuuucuuuugca 220 9303 premiR_09303 cguucuccgcacuccugcuccgcgagggccccuucgaggcggcuga gacccgagugccggacucccgccgcuggagcggggcucggguucgg cagccggaaggaggugugcccccggggcgcuugggggcgccugagg ucccgaggggaggcaagauggga 222 9218 premiR_09218 agaagaaaacaaguuaauuugaagagagucagaaagcgugaguguc cagagccuacugagcccuggaagucacggauaaaaacaagaaguga agucaacacucucggugagaaagggagcgguacugacaaacuucua ccaucccagugugcccgguugcuccc 224 9144 premiR_09144 cccucccggcgcgguuggguggcgccucagcgggugggcagcaugg ggcggggaggguguccccuccgcgccguuaaaaugaaacucuagug gcuggaguccgggcagagcuugagggcaguuggugcggucggguug guucuuacaccccggcgggagc 226 9262 premiR_09262 aagauucaugaguagcagugacaaaccuaccgagccuggugauagc ugguuguccaagauagaaucuuagacaacucccuauaccagauccu cuaauuaauuuuaauaaaggccuucuauuuauacuagccacaucaa gccuagccgucuacguacccacagaau 228 9211 premiR_09211 gccuguugagaaagaccucuggggcccuguuggagauggcuggcag aaugguucucuugaugagcuucaugauaaagcagacuugccaauaa uaccaagagagaagacuggcucuacucuccaaaggaguccagggac agagagucagacagaugacaucagaag 230 9301 premiR_09301 cggcccuguccugcggggguccggucgcggaggcggcggaggggcg cggggacacuccccaccuccacuguccgcccgucggccccgguggc cuuuucucgccucgcgcacagcucccccgccgcagggcugagagag agaguggccgucuggugc 232 9231 premiR_09231 agaaauaauaaugcaggguuucuucaaaauaugguucuggacagug gauuauaguuaccuggagagcuuguguuaaaauaucugaggaugau uccaaguaccagggcuuauacacaggaauacuugagaaccacugca cucaagcauuuaaaauuuuccu 234 9240 premiR_09240 uccuagggcuuugacaccaaaaucuacuaugaugagucaggcuagg cuauaaacuugcaaggacuuagagcccagaaagugacaagcccaac uagccugccucuuggaggaaaaaagaagaauagcucaaaacacuua agaagguaaggaguccaagc 236 9190 premiR_09190 gggaggguggacaguccuuaacugcucugcagguccaggauguuag aaaggggcagggacaacaaaugggugaccccaaccucaaccugcug cuucucucuccaguccccaugugagagcagcagaggcggucuucaa cauccugccagccccacacagcua 238 9145 premiR_09145 uaggucuguuauuuucacauacacuugguaacucagacuggucuga auauaaaguagaaauagcuaagaaccauuuguaaugaaugcaacuc uuauuuguuuuuaaugguguuuuaaggacuuaaggguauuagaacu gacaacaguuuauucaguuaagc 240 9255 premiR_09255 acccccaaagcucuccugccugcuucugugugauauguuugauauu ggguuguuuaauuaggaaccaacuaaaugucaaacauauucuuaca gcagcaggugauucagcaccacccucuuucauacuucaaucucugg ggcuccugucucuuuuacugaaccuc 242 9131 premiR_09131 auccguuuuggaaccugcgucuggggcuccagucgcugcucuugcu ggcguccaucgccgccucggacggccgugcauuuucucgucucacg caguucgaggaggacccuagaaagccaggagcugugauugacagua gcuguagguuaccagacggcaac 244 9129 premiR_09129 uacauuuuagggugguagagcuacuccuuacuuuaaaugcuaccua cucacugugacacuguuuaauaaaugguuauugacuagagaaguag ggaucucugucaccuagcauucuaagucagucagucaucaguuuuu guagguuaucucagaagcaauag 246 9208 premiR_09208 uucuucuucagcaaacauuaggagaguaucuucucuguuuuggcca uguguguacucacagccccucacacauggccgaaacagagaaguua cuuuccuaauauuugccuccuuggagugucucaaguccuggaagca agagauaauaagcaauuaauauaca 248 9232 premiR_09232 cccgacagaucgacuauguugaucuaacuuuucuaagccaguuucu gucugauaugccagcuugagcagcuccuuugucccagcuccccugg gcaucuagcugaugggagcucauuuuucuguuuuuucauuucaggu uuauuguuggccaaaaccaggcuuu 250 9109 premiR_09109 gggucauggaccagcgccucagugcauuagucauucgcuuuuccuu acagacaaaucagauaacucuuccccagugauugucaaauguauga auguaucucuguaaaugugguuuugacaugucacuguuacugaagg agaguauggaauccccacagga 252 9179 premiR_09179 ggugaggccccgcgcgugugucccggcugcggucggccgcgcucga gggguccccguggcguccccuuccccgccggccgccuuucucgcgc cuuccccgucgccccggccucgcccguggucucucgucuucucccg gcccgcucuuccgaaccgggucgg 254 9308 premiR_09308 gcccagcacccucugucucuuuaugcaaucagugccagguggggag ggaugcauucuguccaaugacaugcaggcacuuuagagggcuugca uucauucccaaguccagcggcacacuuuauacauccuuggcugguc auugaggggaacaccggag 256 9249 premiR_09249 accgcaacucccuuucccccacuuuccccaaacgggaggcgcuagc cauggaacauggcacauccagggcuaccuccucccaaguuacccag aggucauguguacaagcagcaauucuaacaacagucccucaggcgu gagcggcauuuuacaguuugcaa 258 9246 premiR_09246 cuuaccuccucaaagcaauacacugaaaauguuuagacgggcucac aucaccccauaaacaaauagguuugguccuagccuuucuauuagcu cuuaguaagauuacacaugcaagcauccccguuccagugaguucac ccucuaaaucaccacgauca 260 9226 premiR_09226 cagagcaacuggcuccuggcagcugugcuuguccguuuccugucag agugaucccagguuuccuccuggcccgucccauggucccuccacag gagugugagaggaugggggaagcacugugggaagaccaccaaagau ggcuggacagugggagagagcacguu 262 9282 premiR_09282 caggacggccgccaucuugcgcgcagcuggagucggugccugaggu ugcagccgagagugugcgccagcccgcggcccagccgaagcucuuu cccgccgccucuccgcgccucgcccagguucagcuccgccugaccc uccgcuuggcacgguccccug 264 9184 premiR_09184 guuggcuuuuccagggccagcgugaguggugaggccagcucucuca gugaccaucagagacaaggccuuggccaguccaggggucuuggggc uccacuuuucugaauuaugaaauguugaguguuuacccugucaaua uauauaucauuuauauauuuuuugu 266 9264 premiR_09264 agauucaugaguagcagugacaaaccuaccgagccuggugauagcu gguuguccaagauagaaucuuagacaacucccuauaccagauccuc uaauuaauuuuaauaaaggccuucuauuuauacuagccacaucaag ccuagccgucuacguaccca 268 9162 premiR_09162 gaagcccaaguuugaauugggaaggcucauggagcuucauggugaa ggcaguaguucuggaaaagccacuggggaugagacaggugcuaaag uuggacgagcugauggauaugaaccaccaguccaagaaucuguuua aaguucagacuucaaauaguggcaa 270 9227 premiR_09227 cucucagcucugcagcugucugcgguggggggaagguuggggggug ucuggaggcauguuccccucaccaccccccgugggucucagggagg ccgggugugaccucaucuuucucauggugcuauccuggugcuauug ggguggggagcucccuccc 272 9206 premiR_09206 auccuuuagcacguuuggauaaaguuggccuucuagguuguggcau uucaacugguuaugguccugcugugaacacugccaagcuggagccu ggcucuguuugugccaucuuuggccugggaggauuuggaucggggg uuaccaugggcuguaaagug 274 9254 premiR_09254 ucucuaauuagcuuucccaguauacuucuuagaaaguccaaguguu caggacuuuuauaccuguuauacuuuggcuugguuuccaugauucu uacuuuauuagccuaguuuaucaccaauaauacuugacggaaggcu caguaauuaguuaugaauaugg 276 9134 premiR_09134 cauuaauuagguaauauuuuccucauuucuuuacugcugccauuuu ccucaccaguauuccagagauggucauagcucauuacucuaccacc aagaaccuaaaaggaauuagaauacagcagaauuggccucagugaa gagcuuaaaauuguucuccucgua 278 9289 premiR_09289 ugauauuacucaccauugauaccucuguuuggaaauuugagaccag caagugacuaucgcuguugccuuaggccacagagacuuuaucaaaa acgugauuacagggacauaucaggugggcuguguuguccugauuau ugcugcugguguuggcaacuuug 280 9152 premiR_09152 acucccugacagauaucucccucuuccauuucaucaagacccagcu gagucacugucacugccuaccaaucucgaccggaccucgaccggcu cgucuguguugccaaucgacucggcguggcgucggucgugguagau aggcggucaugcauacgaauuuuc 282 9238 premiR_09238 auauaaaaacauuaggucaagguacagccuaugagguggcaagaaa ugggcuacauuuucuauauccggcaaaucucacaacaaccuuuaug aaaucuaagggcucaaggaggauuuaguaguaaaccaagcgcagag ugcuugguugaauaaggccaugaa 284 9158 premiR_09158 uuucauuuucugugauuauuuuuaaauuagcuucuguguaaacuca cuaacuuguucccacaugacaauuuauagcaguccaaagauuuuuu uauagccaugguuguuauaauuuugacagaugcucaaggcuguugu uugcauuguucuucagaauuucaucuu 286 9168 premiR_09168 cauuacacuccagccugggcaacaagagcaaaacucugucucaaaa aaaugaaaagaaaagaaaauaccuccauggggccuucucuucccag uucuuccuggagucggggaaaagcuggguugagaaggugaaaagaa aaaacaaaccuugacugggc 288 9175 premiR_09175 ggaguagcuguaacauuauguggaaagcaagugggagaaucaugaa aaaaaauaaucccauagauggagaagaauagaaagaaggaaaggag cauugccuaguguugguuauugaugguuaagcucagcuuuuauuua uucaauaggccugcagauguagacu 290 9216 premiR_09216 uguaggauuuuuuguuuuuguagcuaacuuauggauugagauguga ucaaaggcuuuauuaaauuuguacuucagcauaugauggcugcguu cugcauuucauuccgccauaugccuggaccguucacacuuggguau cugggcuuagggagcauguaggcuuc 292 9117 premiR_09117 ucuagcucuguuauaaagaaaacauuuaggaaauucucucuuucuc ucuuucaccuauccuacuuuuuguguguccuuuguaguuuugcacc aucauuccuaacgaauuuauuuggcauuuggaagauagguuagcaa aaauuuuacuauauuugaaaggcua 294 9167 premiR_09167 ggucaccaggcugagaaagcaggagaugcuacugcugaggaacugu cacuugucauuucaagguccacuccuccacccucuggcagcaugag ucgcucugaaagauuuugaagcugggacaggagagggugagugagg ugaggccuccgcaugccagguuuuc 296 9126 premiR_09126 auucaucucugguuuucuugccacccucugggaguccccaucccau uuucauccugagcccaaccaggcccugccauuggccucuugucccu uggcacacuuguacccacaggugaggggcaggaccugaagguauug gccuguucaacaaucagucaucaugg 298 9274 premiR_09274 uuuuacauaaguagacacaggugggaaacuguuuagacgggcucac aucaccccauaaacaaauagguuugguccuagccuuucuauuagcu cuuaguaagauuacacaugcaagcauccccauuccagugaguucac ccucuaaaucaccacgauga 300 9140 premiR_09140 acuguuuauaagucgguguuguaaaucugaugugaauuuuuguuuc uuuuuucuuagauuuuugccuuuaugacgacagcuuguuaugguug caguuugggucuggcuuuacgaagauggcgaccguaacacuccuua gaaacuggcagucguauguuag 302 9135 premiR_09135 aguaggcaacugaggacugauuucucagggugauuagaaaggaaag gguggcggccuccuuucauacuucggaaagucuuguucccaucagc cuuuccucauggugccauaacuggaauggcggcaagguccucuuuc cugugccugugucuuaaguuucugg 304 9176 premiR_09176 gcgcccccaaaguguccccuccugcugugacuucuagccaagaaga
cauuucucccauggccaagugaucucugauagauccuguaggacca cugaagucagacaggacaaguugagucagggccuguguguccagug cgcagcaugcuuggggagugaca 306 9178 premiR_09178 uaacgcaugcgcggggagggcggagcugggcguugccguggcuacu gggaacgcauuucacgggggcggggcgugguuccggggcggggcgc ggccgccggaagugcguggccgcccggggccauggcgacacucagc uucgucuuccugcugcugggg 308 9207 premiR_09207 ucgauggguguucuuuuaaaauacgguucuaagucuaagucuaaca uucgguguaucuaaccgaauguuaauugauggagacaaggugauac ggguucagaaaauagaauucagaaaagaaaaggaagaauuggcaaa auucagaaaucaauuuuaagaaaaau 310 9163 premiR_09163 cccacggauucgccccgccgcgccucuccgcgcguagauuggccgg agcgaggcgaacgggcccggccuugguagccgccgaccgagcgcug gcuguccuggaaccuaggcggcgggagcccggggcgccucgcggca cggaagagcggcgagaug 312 9161 premiR_09161 ccuguuccccccaaaacccaaggacacucucaugaucucccggacc ccugaggucacgugcguggugguggacgugagccaggaagaccccg agguccaguucaacugguacguggauggcguggaggugcauaaugc caagacaaagccgcgggaggagc 314 9273 premiR_09273 cuccgugcuaccuaucacaccacguccuaaaguaaggucagcuaaa uaagcugucaggcccauaccccaaaaauguugguuacauccuuccu guacuaauuaaccuauuagcucagcuuaucaucuacuuuacuauuu cuacagguacccuuaucacaaugc 316 9133 premiR_09133 uggaaaucacagcaacccauugaaaacugcccuccccaccagaacg ugcuacguucuuucuucaugccuaugugugcuccauuccucauuuc uacuuggcucaagaaaacauuucugcagucaggugagacuuuuaca aaagaggagaaaaucaaugccuc 318 9210 premiR_09210 cugaucauaguauucugucagauaaugccuaagaaugaccgcugaa gaacguugacccauuugaguacccggucucagucgucauuuuuaag uccagugagcauugugguaguuguucuuagauugcaguuucuuaug uuuugaguuugaaguugauuuuca 320 9113 premiR_09113 aaagucuuagaauggaaaaaguaaagaaauaucaacuuccaaguug gcaaguaacucccaaugauuuaguuuuuuuccccccaguuugaauu gggaagcugggggaaguuaaauaugagccacuggguguaccagugc auuaauuugggcaaggaaagug 322 9268 premiR_09268 cuccaggucaucaucagugugguauuaucuaugagaacuugagcga cagaguauuucuugaugaauuuauagaucauuugagauguugaguu acuuuuguuuuguuuucaaauagguagagacuauuaauguaaaaaa acaagaaaggaaaaugaaaugugc 324 9114 premiR_09114 caccccgugccuuuugaucuagcacagacccuucaccccucaccuc gaugcagccaguagcuuggauccuugugggcaugauccauaaucgg uuucaagguaacgauggugucgaggucuuugguggguugaacuaug uuagaaaaggccauuaauuugcc 326 9189 premiR_09189 cccucuggcaugguucauuagggccaauuaauguggcuggguuauu ugcaacuuaaacugggggauaaugucgcuugagggagcguuuucgu uuuaggaaauauuguuuugguuucggguuugaaggcagcugucaaa aaagcggcauggaaauucauugg 328 9181 premiR_09181 gagcuaguaccuucuccccuuagcaacuuccucauucuaaaauggg gguggcagaaccauuguuuggcuccaguuguccucagaaagguggc uuccagaugccagugacugcuggugagugcaggcugcuucaguauu uccuggccagcugacaagguguua 330 9278 premiR_09278 acauaaaaucuuaucuaugugcagcaugacucucuccaggugacag aaagggcucuagacagcugagaggaccugaucauguagggagggac ggggaggggagccaggacccaggagcugcauggcuguaagaggaag guccuuggaggguaucagcagucuca 332 9188 premiR_09188 ggaaccugcuuggacaagucuucuggcucgaccucgacaugcucca ucggaugaauuguugguguuagcccugcggccccacgcaccagggu aagagagacucucgcuuccugcccuggcccgagggaccgacuggcu gggccugccuucugcccagcucacc 334 9280 premiR_09280 cuucaggaguuggugguguugacugggagugaauugacggaaggga ccaugggaauuuauauaucauuuugaaacuuaugaaaccuuuuguc aaaguuucacuuucugacucaggcucaguccaggacauuguucaau uccccugguguaggcauca 336 9233 premiR_09233 ggucaacaaggugagucuggaugaggggcagggaugccaggcaagu gagcaggucugggagucaggccuugcucaggcccuguucuucuccc uugcagcuucugucuggccccaaagagaccccugcugcccagagcc ccaccagaggccccucugacaccaaga 338 9224 premiR_09224 cuguguuguguccugacaccuccaaguucuagggccgucaggacac gggaggguuuggggacagaguguccuuccucuguccucucauccca guccugauggccgcuuggugagugucuggugcccugguggccugcc ccagcucucuucuggcuuucugagcag 340 9130 premiR_09130 uuacaaugguucuaugaggacguggccccacaguaaguugaggagc acuggguauguaugaauaaaauggcaugacaggccuucucuuucca guucuucccagaauugggaaaagcuggguugagaggguaagaaaag aaaaacaaauaaauuuuuuaaa 342 9195 premiR_09195 gcgagacucuuuuuuucuccaggaccugcggagcagccaggcuuca ugaguuaaaugcagaucugaaccauacccaguugggauugggguac acacucuacuccucugaaaacuagcuagggguucgaacuuggugag agggagagugggacagagc 344 9213 premiR_09213 aaguucugagaguccaggaggcagaggcugggguuugggggauguc agagggcaaaucuggggcuuggggggcccaggaagcagagaugaag guuuuagagucuccagagaacaaaucugguacuuuuaaggcccagg aagcggaggcuggggucuugggaaa 346 9173 premiR_09173 aauuugaaaauccauauaaagguacguccacauuuauguuauuaug agugagucauauuggugaagucaggacaauggccugucauuagauc uuugauucuuguuugcagugaagggagaugugaagaagccauguuc ucugaacgugcugcuuggaggacu 348 9253 premiR_09253 cgguguuuccggccgccgucgcuguccagggaggcugaggcgagag guagcuguccggguggggagcccgcacuaccuucuuccucuuccuc cuccuccuccgggugaggggagcgaagguuggggguccccgagccc auggaccaggaggaggcgga 350 9214 premiR_09214 uuuuuuuuuuaacaccuauauaucacccauugaacggguauuuuac ugaacacaguacaguagacuguuuaaaacucacauccugguaacuu ucacuacuugaaauuacaaagugcuuuuguuaauugcauauuuuug cucagccaucuuagaauugu 352 9223 premiR_09223 aagcuggcccuggcuggagauggcuagccccugagacaugcacuuc ugguuuugaaaugacucugucuguggggcagcagaaacuagagaag gcaaguggcugccccaccccaaggcgugaccaggaggaacagccug cagcucacuccaugccacacggg 354 9217 premiR_09217 uuggugguguguauaagaauguuucuugcuaauugaggauguguga gguuuaaggcugugagcugaucuuugaaaaauaguuuccuguuucu aaagugacauuacccaguauuugcuuacugcuuugugccuuaucuc ccgcuuucuuuuuaguauuucug 356 9265 premiR_09265 gaaagagaaagccaagauccacuaccggaagaagaaacagcucaug aggcuacggaaacaggccgagaagaacguggagaagaaaauugaca aauacacagagguccucaagacccacggacuccuggucugagccca auaaagacuguuaauuccucaaa 358 9235 premiR_09235 ugggcgucuacaacggcaagaccuucaaccagguggagaucaagcc cgagaugaucgaccacuaccugggcgaguucuccaucaccuacaag cccauaaagcacggcgggcccggcaucggggccagccacuccuccc gcuucaucccucucaagcaguggcuca 360 9174 premiR_09174 guagcccacauggauagcacaguugucagacaagauuccuucagau uccgaguugccuaccgguuguuuucguuguuguuguuguuguuuuu cuuuuucuuuuuuuuuuugaagacagcaauaaccacaguacauauu acuguaguucucuauaguuuuac 362 9311 premiR_09311 ggcggcgggagaaguagauugaagccaguugauuagggugcuuagc uguuaacuaaguguuuguggguuuaagucccauuggucuaguaagg gcuuagcuuaauuaaaguggcugauuugcguucaguugaugcagag ugggguuuugcaguccuuagcuguug 364 9266 premiR_09266 ucauucugaggucacauaacacauaaaauuaguuucuaugagugua uaccauuuaaagaauuuuuuuuucaguaaaagggaauauuacaaug uuggaggagagauaaguuauagggagcuggauuucaaaacgugguc caagauucaaaaauccuauugauagu 366 9132 premiR_09132 guaagaugguuaucgauaguaguuaaugauggaugaagugcacuga ggcucuuaaaagauacuuaggauuuuugacuuuacucuguagguuc uaaaguaaacauauaugagguuuuuaauuucucagauacuauaccu gcagcucuuuuugcugacucaagau 368 9293 premiR_09293 agcacaaguacacacauaaaaacauuaggucaagguguagcccaug agguggcacgaaaugggcuacauuuucuauguccagaaaaucucac aacauccuuuaggaaaucuaagggcucaaggaggauuuagcaguaa accaagagcagagugcuugguugaa 370 9138 premiR_09138 gucacucaggacagacuucuugaaguagguggcccuucaacugagc ugaagggaagagaagggcauugcaggcugagggaugaucccagggu gccccccagaucuaaaguguggagucugucaucgaggugcguagcc ucuccagaggugucacuguguuccau 372 9169 premiR_09169 cugcaaacagccuuuccacugacgcagugccuugggggcucugcca agcgaccccuagaauggggauuguggggggucgcucuaggcaccgc agcacugugcuggggauguugcagcugccugggagugacuucacac aguccucucugccuccagggucaccc 374 9165 premiR_09165 guggauaugagugaagacggggcaggcaggccacaucucuuagaag aggaaggugauugccacgucuccuuccuccaugcugauggcaaggc gugcgggcuguguucucuugcagccagcgucccaugcucgguggcc ccagaaaagucaguguguaggccu 376 9196 premiR_09196 aggaaacacaagaagaaacgccuggugcagagccccaauuccuacu ucauggaugugaaaugcccaagaugcuauaaaaucaccacggucuu uagccaugcacaaacgguaguuuuguguguuggcugcuccacuguc cucugccagccuauaggag 378 9209 premiR_09209 cauagauauguauucagcuugucuucaaauacggccaagcagaaaa uguuuuauauuuuauaaaucaucuuuugacucuguauuuaaauucu augauacugaaaauaaaggcauucuggaaaaauacugacugauuuu ggugcagaaguuuugaguaucaag 380 9310 premiR_09310 aauuaaaguggcugauuugcguucaguugaugcagagugggguuuu gcaguccuuagcuguugcagaaauuaaguauugcaacuuacugagg gcuuugaaggcucuuggucuguauuuaaccuaaauuucuauaagau uauuaguauaaaaggggagauagguag 382 9302 premiR_09302 ccaggagaggaaaaggaaaugggaccucagaaguagaagccucagg gaaggaguaaaguagaaaucagaagaaaagaagcuucacuugauag uaauaagguuuuuaacuucaaguaccuucagaaaaugugauuuuga uaagaggaaagggcaaauuuag 384 9222 premiR_09222 agccugugaccccucgggacugccuggugcaggugguggcagcugg agggacccaugcagcacccaggucagagcagacccuccccugccgg ccugcgccagcuggaccugauggcccccuguggcgccuugaccugc ugggccaggcugcccugggacucuc 386 9150 premiR_09150 ggccccgcauccgcguucgucuaggcgcucuugucaccucgccaug ccggagccaucgcgggcggcuccggcuucuaaaaagggcuccaaga aggccauuaccaaggcgcagaagaaggacggcaagaagcgcaagcg cggccgcaaggagagcuauucuauc 388 9119 premiR_09119 gaaacaucuuaaugcacagccacaaguuacaaugcaacagccugcu gcucauguacaaggucaggaaccuuugacugcuuccauguugguau cugcccaugcucaagagcaaaagcaaauguugggugaacggcuguu uccucuuauucaagccaugcaccuu 390 9257 premiR_09257 ugaaacuaacuagauuuauuggauaucaguacuuugagaguuagaa augguuacugauugucaucuuuucagugaaggguucuauaguugag uaaaaaauuugucuaacuuuguaaguauaguuuauauuguagaaau ugcuuccaauuuuguugguaacuucau 392 9170 premiR_09170 cugcaaacagccuuuccacugacgcagugccuugggggcucugcca agcgaccccuagaauggggauuguggggggucgcucuaggcaccgc agcacugugcuggggauguugcagcugccugggagugacuucacac aguccucucugccuccagggu 394 9277 premiR_09277 cccaggguggcauaggagaaaaaggugcugaaggcacagcuggaaa ugauggugcaagaguaagugaaaguauuccuuuucuagcugggcua ggaaccaacauuacaguaucauaugaguuucccugaaccuuccaaa auaaagucagucauguuuccuuggua 396 9250 premiR_09250 acaugcagggugaaauccucacuauuuuuaugaaacagcaucugau cuugaacuuuuaugacucaccucagucacuucaccuguauuuuggc ccugucagaucaugucuuuauuuaaacuuuugauauuuuauucuuu auauguuuuugcauuaguuuuuauuuu 398 9202 premiR_09202 aaacaauaaaaaacuggcugcuaucgaagcccuaaaugauggugaa cuccagaaagccauugacuuauucacagaugccaucaagcugaauc cucacuuggcccuuuuguaugccaagagggccagugucuucgucaa auuacagaagccaaauacugccau 400 9230 premiR_09230 cugguuauaucaggauaaauucauaaaggguuuuguguguguguuu guuuuuguuguuguuguuuaggguuuuuuuuuuuuaaacagggucu ugcuuuguugcccaggaugaaaugcaaucacacacaaucauggcuc auugcaucacuaucuauguauuca 402 9215 premiR_09215 ucaguuaagccaauacauuuaaaguuuugcaugaggaacacugacu uuauuaagcauuuucagauguggugguuguauuuuugccccaagaa guguuuggauaaccacacaaaagcaugaugaaaaggcuucuuguag ucccauaauuucuugugaacuaauguu 404 9297 premiR_09297 uucugaaggguauauugcauguucauuauuaaucugagugagaggu uaguugcuauaaaguuacaagauuuuccugaucacuuaaaauuuuc
uuguagucagagauuugacucugaaucgucacuucaaaaauuuguc uuuucagguacuauguaaagagaacu 406 9286 premiR_09286 cacuacggccucuggccaugcaccaguuguaguuuuguguguuggc ugcuccacuguugucugccagcccacaggagggaaagugaggcucc uggaaggacgcuccuucagauggaagcagcacuggaagagccccaa guugaggugcaugggacacaaacu 408 9110 premiR_09110 auaaugaguaaaaauguucaucuuuaauaaagcaaaaauagagcaa cccaccaaauaguuaacacuugccuggagagauuuaggaacaccag uauuccacugagauugcugagagucucaggaaagaaaggucuaacu uaaauuguauuuuaccauuucugag 412 9313 premiR_09313 gcaaagaaagaagaaucugaggagucugaugaugacaugggcuuug gucuuuuugacuaaaccucuuuuauaauguguucaauaaaaagcug aacuuuaaaaaaaagauugggguuuaucauguaauuguuucauuuu guuguauucuguguuaagauuucuaa 414 9314 premiR_09314 ccggccgcugggcgcacccgucccguucguccccggacguugcucu cuaccccgggaacgucgagacuggagcgcccgaacugagccaccuu cgcg 415 9315 premiR_09315 ucucggaagcuaagcagggucgggccugguuaguacuuggacggga gaccgccugggaauaccgggugcuguaggcuuuuucuuuggcuuuu ug 417 9316 premiR_09316 ucuuggaagcuaagcagggucgggccugguuaguacuuggauggga gaccaccugggaauaccgggugcuguaggcuuuggccgggcguggu gg 419 9317 premiR_09317 ggcguaggggggccggccugcugugaugacauuccaauuaaagcac guguuagacugcugacgcgggugaugcgaacuggagucugagccug cccgagcggagc 419 9318 premiR_09318 cacugucacugccuaccaaucucgaccggaccucgaccggcucguc uguguugccaaucgacucggcguggcgucggucgugguagauaggc ggu 419 9319 premiR_09319 cacugucacugccuaccaaucucgaccggaccucgaccggcucguc uguguugccaaucgacucggcguggcgucggucgugguagauaggc ggu 423 9320 premiR_09320 cacugucacugccuaccaaucucgaccggaccucgaccggcucguc uguguugccaaucgacucggcguggcgucggucgugguagauaggc ggu 425 9321 premiR_09321 ugcugcagguguuggagagcaguguguguugccuggggacugugug gacugguaucacccagacagcuugcacugacuccagacccugccgu caug 427 9322 premiR_09322 cgccccgggccgcggcuccugauuguccaaacgcaauucucgaguc uauggcuccggccgagaguugagucuggacgucccgagccgccgcc cccaa 427 9323 premiR_09323 aguaccaagaaguuaucauuuccauaugacugucauugcuuaaaac uagcuaguaugagcaggacgguggccauggaagucgaaauucgcua ag 433 9324 premiR_09324 aguaccaagaaguuaucauuuccauaugacugucauugcuuaaaac uagcuaguaugagcaggacgguggccauggaagucgaaauucgcua ag 433 9325 premiR_09325 gggauugacagauugacagcucuuucucgauucugugggugguggu gcauggccauucuuaguugguggagugauuugucugguuaauucug auaa 433 9326 premiR_09326 gggauugacagauugacagcucuuucucgauucugugggugguggu gcauggccauucuuaguugguggagugauuugucugguuaauucug auaa 433 9327 premiR_09327 gggauugacagauugacagcucuuucucgauucugugggugguggu gcauggccauucuuaguugguggagugauuugucugguuaauucug auaa 435 9328 premiR_09328 gggauugacagauugacagcucuuucucgauucugugggugguggu gcauggccauucuuaguugguggagugauuugucugguuaauucug auaa 437 9329 premiR_09329 ugcaacugccgucagccauugaugaucguucuucucuccguauugg ggagugagagggagagaacgcggucugagugguuuuuccuucuuga ug 439 9330 premiR_09330 auacguguaauugugaugaggauggauagcaaggaagccgcuccca ccugacccucacggccuccguguuaccuguccucuaggugggacgc uc 441 9331 premiR_09331 gggugugagaagccggauccuguggugacccaguggccuaauggau aaggcaucagccuccggagcuggggauuguggguucgagucccauc ugg 443 9332 premiR_09332 ccgggagcggggaggcggcggcuccagggaccuggcggccgccgau cggggcugcgaggccccauggcgccgcccccagccccgcuccuggc gccga 445 9333 premiR_09333 gggccgggaaugccgcggcggggacggcgauugguccguaugugug gugccaccggccgccggcuccgccccggcccccgccccacacgccg cau 446 9334 premiR_09334 ugguggggggagccgcggggaucgccgagggccggucggccgcccc gggugccgcgcggugccgccggcggcggugaggccccgcgcgugug ucccggcugcgg 448 9335 premiR_09335 ggggaggagacgguuccgggggaccggccgcgacugcggcggcggu gguggggggagccgcggggaucgccgagggccggucggccgccccg ggugccgcgcgg 450 9336 premiR_09336 acugucacugccuaccaaucucgaccggaccucgaccggcucgucu guguugccaaucgacucggcguggcgucggucgugguagauaggcg gucaug 453 9338 premiR_09338 aaugcagugugauuucugcccagugcucugaaugucaaagugaaga aauucagagaagccuggguagccgggcgugguggcucacaccugua aucccagcac 455 9339 premiR_09339 augaauuguugguguuagcccugcggccccacgcaccaggguaaga gagacucucgcuuccugcccuggcccgagggaccgacuggcugggc cugccuu 457 9340 premiR_09340 cuucuccccagccagagguggagccaagugguccagcgucacucca gugcucagcuguggcuggaggagcuggccuguggcacagcccugag u 459 9341 premiR_09341 gcacccagaucagugcuuggcaccuagcaagcacucaguaaauauu uguugagugccugcuaugugccaggcauugugcugagggcuuugug ggga 461 9342 premiR_09342 aguugguagagggcagagggaugagggggaaaguucuauaguccug agaucuaauuacaggacuauagaacuuucccccucaucccucuacc cuua 463 9343 premiR_09343 gugcugcagguguuggagagcaguguguguugccuggggacugugu ggacugguaucacccagacagcuugcacugacuccagacccugccg ucaug 465 9344 premiR_09344 gagggcgggagacaaaaucucgcaauucugaccugccuuuggacau aauugaggcuuuaugaggaagguggggaugcgggaguggcgauccc 465 9345 premiR_09345 ggcguugcuuggcugcaacugccgucagccauugaugaucguucuu cucuccguauuggggagugagagggagagaacgcggucugaguggu uuuuccuucuuga 465 9346 premiR_09346 ggcguugcuuggcugcaacugccgucagccauugaugaucguucuu cucuccguauuggggagugagagggagagaacgcggucugaguggu uuuuccuucuuga 465 9347 premiR_09347 ggcguugcuuggcugcaacugccgucagccauugaugaucguucuu cucuccguauuggggagugagagggagagaacgcggucugaguggu uuuuccuucuuga 465 9348 premiR_09348 ggcguugcuuggcugcaacugccgucagccauugaugaucguucuu cucuccguauuggggagugagagggagagaacgcggucugaguggu uuuuccuucuuga 467 9349 premiR_09349 ggcguugcuuggcugcaacugccgucagccauugaugaucguucuu cucuccguauuggggagugagagggagagaacgcggucugaguggu uuuuccuucuuga 467 9350 premiR_09350 ugugagacgaauuuuugagcggguaaaggucgcccucaaggugacc cgccuacuuugcgggaugccugggaguugcgaucugcccgaccuua uuca 470 9351 premiR_09351 ugugagacgaauuuuugagcggguaaaggucgcccucaaggugacc cgccuacuuugcgggaugccugggaguugcgaucugcccgaccuua uuca 470 9352 premiR_09352 gugaacggcggcugguggcgaguuccgcugugccagcuuccguugg cguuugccaucggugcaugggugguucagugguagaauucucgccu g 470 9353 premiR_09353 gugaacggcggcugguggcgaguuccgcugugccagcuuccguugg cguuugccaucggugcaugggugguucagugguagaauucucgccu g 470 9354 premiR_09354 gugaacggcggcugguggcgaguuccgcugugccagcuuccguugg cguuugccaucggugcaugggugguucagugguagaauucucgccu g 474 9363 premiR_09363 gugaacggcggcugguggcgaguuccgcugugccagcuuccguugg cguuugccaucggugcaugggugguucagugguagaauucucgccu gccacgcgggaggc 476 9364 premiR_09364 ccaucaccacugugaaucagagcaacaaaacagcuggaggcagaac agcacucagcuggagcauuggugguucagugguagaauucucgccu gc 476 9365 premiR_09365 cgaggaaguagugaccugccacuggccaccugcggaaccagaguuc cccacuggagggccgcguuggugguauaguggugagcauagcugcc uu 479 9367 premiR_09367 cgaggaaguagugaccugccacuggccaccugcggaaccagaguuc cccacuggagggccgcguuggugguauaguggugagcauagcugcc uuccag 481 9368 premiR_09368 ccgacccgggccugggcuguggcugugacuggcgcugccgugggcg ccgcagcccucgcgggagccggacgcgguaaugccccagcggcgca gc 483 9369 premiR_09369 guaccaagaaguuaucauuuccauaugacugucauugcuuaaaacu agcuaguaugagcaggacgguggccauggaagucgaaauucgcuaa gg 483 9370 premiR_09370 cugcugagaguagguggggauguagcucagugguagagcgcaugcu uugcauguaugaggccccggguucgauccccggcaucuccagugua gu 485 9373 premiR_09373 cugcugagaguagguggggauguagcucagugguagagcgcaugcu uugcauguaugaggccccggguucgauccccggcaucuccagugua gu 487 9374 premiR_09374 cugcugagaguagguggggauguagcucagugguagagcgcaugcu uugcauguaugaggccccggguucgauccccggcaucuccagugua gu 489 9375 premiR_09375 cugcugagaguagguggggauguagcucagugguagagcgcaugcu uugcauguaugaggccccggguucgauccccggcaucuccagugua gu 491 9376 premiR_09376 gccgacagccagcuggaucuccugucccgagcccuggguacugggg gugccccugaguuggguucccucagaccuggugaucgggcccugga g 491 9377 premiR_09377 cucccucuccucccccgggguucggugcgcggccggggccggaguu cgcugcaagucggcggaaaguuuggcugcgcggguucccccgaagu ucaggugcg 491 9378 premiR_09378 gucugaucucagaagcuaagcaaggucgggucuaguuaguacuugg augggagacugccuggaauaccgggugcuguaggcuuuuggccuau cguucccu 491 9379 premiR_09379 agagagccccggggugcagauccuugggagcccuguuagacucugg auuuuacacuuggagugaacgggcgccaucccgaggcuuugcacag gggcaa 496 9380 premiR_09380 agagagccccggggugcagauccuugggagcccuguuagacucugg auuuuacacuuggagugaacgggcgccaucccgaggcuuugcacag gggcaa 496 9381 premiR_09381 agagagccccggggugcagauccuugggagcccuguuagacucugg auuuuacacuuggagugaacgggcgccaucccgaggcuuugcacag gggcaa 496 9382 premiR_09382 agagagccccggggugcagauccuugggagcccuguuagacucugg auuuuacacuuggagugaacgggcgccaucccgaggcuuugcacag gggcaa 500 9383 premiR_09383 ggauugacagauugauagcucuuucucgauuccgugggugguggug cauggccguucuuaguugguggagcgauuugucugguuaauuccga uaac 500 9384 premiR_09384 ggauugacagauugauagcucuuucucgauuccgugggugguggug cauggccguucuuaguugguggagcgauuugucugguuaauuccga
uaac 503 9385 premiR_09385 ggauugacagauugauagcucuuucucgauuccgugggugguggug cauggccguucuuaguugguggagcgauuugucugguuaauuccga uaac 503 9386 premiR_09386 ggauugacagauugacagcucuuucucgauucugugggugguggug cauggccauucuuaguugguggagugauuugucugguuaauucuga uaa 503 9387 premiR_09387 ggauugacagauugacagcucuuucucgauucugugggugguggug cauggccauucuuaguugguggagugauuugucugguuaauucuga uaa 503 9388 premiR_09388 gcaacugccgucagccauugaugaucguucuucucuccguauuggg gagugagagggagagaacgcggucugagugguuuuuccuucuugau g 503 9389 premiR_09389 gcaacugccgucagccauugaugaucguucuucucuccguauuggg gagugagagggagagaacgcggucugagugguuuuuccuucuugau g 505 9390 premiR_09390 gcaacugccgucagccauugaugaucguucuucucuccguauuggg gagugagagggagagaacgcggucugagugguuuuuccuucuugau g 506 9391 premiR_09391 gcaacugccgucagccauugaugaucguucuucucuccguauuggg gagugagagggagagaacgcggucugagugguuuuuccuucuugau g 508 9392 premiR_09392 gcaacugccgucagccauugaugaucguucuucucuccguauuggg gagugagagggagagaacgcggucugagugguuuuuccuucuugau g 510 9393 premiR_09393 aucuuggaagcuaagcagggucgggccugguuaguacuuggauggg agaccaccugggaauaccgggugcuguaggcuuuggccgggcgugg ugg 512 9394 premiR_09394 aucucggaagcuaagcagggucgggccugguuaguacuuggacggg agaccgccugggaauaccgggugcuguaggcuuuuucuuuggcuuu uug 514 9395 premiR_09395 auccucccuggggcauccuguacugagcugccccgaggcccuucau gcugcccagcucggggcagcucaguacaggauacucggggugggag uca 516 9396 premiR_09396 acaucaagugacugugcuuggcuguggggcuaccaagaugaagaag gaaugcuccugcccucgaggagcucacagucuagugggagggaaca augc 516 9397 premiR_09397 ggggcucgcggacccggcccagagggcggcgguggcggcagcuacu uuucuggucagggcucggacaccggcgcgucucucaagcucgccuc uuc 519 9398 premiR_09398 uaaugcagugugauuucugcccagugcucugaaugucaaagugaag aaauucagagaagccuggguagccgggcgugguggcucacaccugu aa 521 9399 premiR_09399 guuccuuguguucuuccaguccgcccucugucaccuugcagacggc uuucucuccgaaugucugcaagugucagaggcgaggaguggcagcu gcau 523 9400 premiR_09400 guuccuuguguucuuccaguccgcccucugucaccuugcagacggc uuucucuccgaaugucugcaagugucagaggcgaggaguggcagcu gcau 523 9401 premiR_09401 aacauuaggagaguaucuucucuguuuuggccauguguguacucac agccccucacacauggccgaaacagagaaguuacuuuccuaauauu ugccu 525 9402 premiR_09402 cugccugcuucugugugauauguuugauauuggguuguuuaauuag gaaccaacuaaaugucaaacauauucuuacagcagcaggugauuca gcacc 527 9403 premiR_09403 ccgggccgcggcuccugauuguccaaacgcaauucucgagucuaug gcuccggccgagaguugagucuggacgucccgagccgccgccccca aaccuc 529 9404 premiR_09404 ccgggccgcggcuccugauuguccaaacgcaauucucgagucuaug gcuccggccgagaguugagucuggacgucccgagccgccgccccca aaccuc 531 9405 premiR_09405 guugugcuguccaggugcuggaucagugguucgagucugagccuuu aaaagccacucuagccacagaugcagugauuggagccaugacaagu cccca 533 9406 premiR_09406 accuaccuaacuggguuagggcccuggcuccaucuccuuuaggaaa accuucuguggggaguggggcuucgacccuaacccaggugggcugu aac 535 9407 premiR_09407 cauuaggagaguaucuucucuguuuuggccauguguguacucacag ccccucacacauggccgaaacagagaaguuacuuuccuaauauuug ccucc 537 9408 premiR_09408 uaccucccagcuguguucugcccagugcucugcugacuggacgccu cuguguccuuagaccaugugcagggccugaugcaggaaagagcuga uuaaugcagugugauuucugcccagugcucugaaugucaaagugaa 537 9409 premiR_09409 gaaauucagagaagccuggguagccgggcgugguggcucacaccug uaa 539 9410 premiR_09410 accccuagaauggggauuguggggggucgcucuaggcaccgcagca cugugcuggggauguugcagcugccugggagugacuucacacaguc cucucug 539 9411 premiR_09411 ucguccagcgagggcgcgcuggcccugggcagcguguggcugaagg ucaccauguucuccuuggccauggggcugcgcggggccagcagguc cacg 542 9412 premiR_09412 ucguccagcgagggcgcgcuggcccugggcagcguguggcugaagg ucaccauguucuccuuggccauggggcugcgcggggccagcagguc cacg 545 9414 premiR_09414 cagcuccgcagggguuuggggaaacggccgcugagugaggcgucgg cuguguuucucaccgcggucuuuuccucccacucuuggcugguugg acc 547 9415 premiR_09415 gauugacagauugauagcucuuucucgauuccgugggugguggugc auggccguucuuaguugguggagcgauuugucugguuaauuccgau aa 551 9416 premiR_09416 gauugacagauugauagcucuuucucgauuccgugggugguggugc auggccguucuuaguugguggagcgauuugucugguuaauuccgau aac 552 9417 premiR_09417 ccggcggggcgaagcccgcggcugcuggacccacccggccgggaau agugcuccugguuguuuccggcucgcgugggugugucggcggcggg gcc 553 9418 premiR_09418 ccugagcaaggucacaaagcugggugagaggggcugggauucacau ucaagcacuguguuccuaggccccuugaccccuggcaucugugggg 554 9419 premiR_09419 cugaaaugucuucaaauguaucaauaagccuucucuucccaguucu ucuuggagucaggaaaagcuggguugagaggagcagaaaagaaaaa 556 9423 premiR_09423 ucuucuaccuaagaauucugucucuuaggcuuucucuucccagauu ucccaaaguugggaaaagcuggguugagagggcaaaaggaaaaaaa a
TABLE-US-00005 TABLE 5 miRNA Sequences Seq ID MiR name mature_sequence 1 miR_1966 CGAGCCUGGUGAUAGCUGGUUGUCCAAG 3 miR_1967 GAGGCUGAGGCGAGAGGU 5 miR_1968 AUUUGUGGCCGAGUGUAACAACC 7 miR_1969 UCCCUUCGUGGUCGCC 9 miR_1970 GCAGGGGAAGAAGCCUUCCGU 11 miR_1971 ACUUUGAGAGUUAGAAAUGGUUACU 13 miR_1972 AACCAAUGAUGUAAUGAUUCUGCC 15 miR_1973 AUGAUUCUGUGACGCCAGCU 17 miR_1974 GAAAGCUGAGCGUGAACGUGGU 19 miR_1975 UAGCAGCACAUAAUGGUUUGAAU 21 miR_1976 UGUUUAGACGGGCUCACAU 23 miR_1977 GGAAAUUUGAGACCAGCAAGUACU 25 miR_1978 AUUGUAUAUCAGCAUGGGGAUUAUU 27 miR_1979 UUGGAGGCGUGGGUU 29 miR_1980 AACGUGCAGCGGCUGAAGGAGU 31 miR_1981 AAUUGUGAGGCUUGAGUGU 33 miR_1982 UGAUAGGAUUGACAUGGAGCAC 35 miR_1983 AACGGCCGCGGUACCCUAAC 37 miR_1984 UCUUGCCAAGAGAAUUAAUGUGCGU 39 miR_1985 AAUCUGAGUGAGAGGUUAGUUGCU 41 miR_1986 AUUAAAAAUUUCGGUUGGG 43 miR_1987 GAUAGCUGCCAGUGACAGGAGUAGU 45 miR_1988 GAGCCUGGUGAUAGCUGG 47 miR_1989 UGGCGCGGAGCGGAGCGG 49 miR_1990 AGGCGGCGGAGGGGCG 51 miR_1991 AUGCGUGCGAGAAGUCAGUGG 53 miR_1992 UGUGUUUGAGAGCAACGCCAUUGCCU 55 miR_1993 GCAUGAGUGGUUCAGUGGU 57 miR_1994 AAGGAAUGAGUUAGCUUUG 59 miR_1995 ACAAGUGAAUACACUGAGGC 61 miR_1996 CUCGCGCCCGCGUCGCGGCAGC 63 miR_1997 GUGGUGUUGAGGAAAGCAGAC 65 miR_1998 GUUUUUGUGACUGCCUUGAGU 67 miR_1999 AAGGCACAGCUGGAAAUGAUGGUG 69 miR_2000 AAACUAGGCGGCUAUGGUAU 71 miR_2001 GUGGUGGUCGUACGCUGUG 73 miR_2002 GCUGAGUGAAGCAUUGGACUGU 75 miR_2003 AGGUUCACAUGGAAAAGGUU 77 miR_2004 CCAUUGUGUAGCAAGAUGUCAU 79 miR_2005 GGAAAUAGUUUGUGACAAACUGGG 81 miR_2006 CUCCUCUUCGUCUCCUCGGUC 83 miR_2007 ACUCCAGCCCCACAGCCUCAG 85 miR_2008 GCCGCGAGUGGGAGCGGGAGCG 87 miR_2009 GCUUGACUGAGUGUGGCUGGACGUG 89 miR_2010 AGUCGGUGCCUGAGGUUGC 91 miR_2011 AGUGAUGAGGAUGUGCUGAU 93 miR_2012 AUUGAGUGGGGCUCAGGAUU 95 miR_2013 GCAUGGGUGGUUCAGUGU 97 miR_2014 AACUGUUAUAUUAUGAUUGUGAC 99 miR_2015 UUGCUGUGAUGACUAUCUUAGGAC 101 miR_2016 AGAAUUGAGUGAUCUCAUGGAU 103 miR_2017 AAAACGAUCUUUCAGAUUUAGAGU 105 miR_2018 GCGGUCGGGCGGCGGCG 107 miR_2019 AUGAGAACUUGAGCGACAGAGU 109 miR_2020 AUUGGUCGUGGUUGUAGU 111 miR_2021 GAUGAGAGAACAGUGGGUACUUC 113 miR_2022 CAAGGUGUAGCCCAUGAGGUGGC 115 miR_2023 AGCACCAGCCUAGGAAGAGGGU 117 miR_2024 ACUUUAACACUGCUGUGGAAGGC 119 miR_2025 AUUUGACAAGAGUAUGCCAGGUGU 121 miR_2026 CUGGGAGCUUGAAAGGAG 123 miR_2027 AUUUGGGCAGGUUGAAAGAAUUU 125 miR_2028 GUGCUGGAGGCCAGGCUGAGGCCC 127 miR_2029 GCUGUUGGUGGAGAAGGU 129 miR_2030 AUGGCAGUUGGAGAGAAAGAAC 131 miR_2031 GCAGAUAAACUCAUGCCAGAGAACU 133 miR_2032 AGUGCCAGGUGGGGAGG 135 miR_2033 GACUCUUAGCGGUGGAUC 137 miR_2034 CUGUUGCGGGACCCGGGGUGU 139 miR_2035 UUAAAGCUGCCAUUUGUUACU 141 miR_2036 GAGCAGAGGCGAUAGUUGAAGU 143 miR_2037 GAUGACAUGGGCUUUGGUCUUUUU 145 miR_2038 AGAAAGGGCCUUGUGUUU 147 miR_2039 ACUCGGCGUGGCGUCGGUCGUGGUAG 149 miR_2040 GUGUUUAGUGAGUAUUUGUU 151 miR_2041 ACUGCUGCUGCUGCUUGGCC 153 miR_2042 UGCAGAGUGGGGUUUUGCAGUCCUU 155 miR_2043 AUGACCACCAAACCCAGGAGC 157 miR_2044 CAGAGUCUGUAGAAGAGGCG 159 miR_2045 CCUUGACUUCUGCCAGAGU 161 miR_2046 AUCACUGACUGAUCAAGUAGAGGU 163 miR_2047 AAGGAUUGGACAGGGUUAGAUU 165 miR_2048 AGGCCAAGGCUGCGGGGUU 167 miR_2049 AACGGGAGGCGCUAGCCAUGG 169 miR_2050 ACCUUUCAGUGCAGUUUCUUUU 171 miR_2051 AUUUUGGGUGGAAGAGGCAU 173 miR_2052 GGAAUGAGGAGCUUUGAC 175 miR_2053 AAAAGCUGGGUUGAGAGGAU 177 miR_2054 AGUAAGGUCAGCUAAAUAAGCU 179 miR_2055 GAAUUGACGGAAGGGAC 181 miR_2056 UUGUGUCUUGUGUCUUUU 183 miR_2057 UCCCUGGUGGUCUAGU 185 miR_2058 UGAGGCUGUAACUGAGAGAAAGAUU 187 miR_2059 UUAGGGCCCUGGCUCCAUCUCCU 189 miR_2060 GAGUGUGAGUGGACGCGUGAGUGU 191 miR_2061 AUUGAGUCUGGCAGUCCCUGUU 193 miR_2062 AAAAUGUUUAGACGGGCUCAC 195 miR_2063 GAAUGUUUAUGGCACCUGAC 197 miR_2064 GGAAAUUUGAGACCAGCAAGU 199 miR_2065 ACAGUAGGGCCUUUGGAGUGAU 201 miR_2066 CUUGAAGUCUGGUGAUGCUGCCAUU 203 miR_2067 AGAUGAGCUGAAGGG 205 miR_2068 AAAAAGGGAGCCAAGAAG 207 miR_2069 AGUUUUGUGUGUUGGCUGCUCC 209 miR_2070 GGUUUAGUGAGCAGAGUU 211 miR_2071 AAGACGAGAAGACCCUAUGGAGCUU 213 miR_2072 AGCAGGGUGCAGGCUUGGAGUC 215 miR_2073 AUGUUGGGUUGUUACAGAGU 217 miR_2074 ACUGAGUUGACUGUUCCCUU 219 miR_2075 ACUGGGCAGUGACAAGCACGAU 221 miR_2076 AGAAAGCGUGAGUGUCCAGAGCCU 223 miR_2077 GCUUGAGGGCAGUUGGUGCGG 225 miR_2078 CCGAGCCUGGUGAUAGCUGGUUGUC 227 miR_2079 UGGAGAUGGCUGGCAGAAUGGUUCU 229 miR_2080 AAGUAGAAGCCUCAGGGAAG 231 miR_2081 AUGGUUCUGGACAGUGGAUU 233 miR_2082 GAUGAGUCAGGCUAGGCU 235 miR_2083 AUGUGAGAGCAGCAGAGGCGGU 237 miR_2084 GUUUUAAGGACUUAAGGGUAU 239 miR_2085 UGAUAUGUUUGAUAUUGGGU 241 miR_2086 AGAAAGCCAGGAGCUGUGAUU 243 miR_2087 AUUCUAAGUCAGUCAGUCAUC 245 miR_2088 UUCUCUGUUUUGGCCAUGUGUGU
247 miR_2090 UUCUAAGCCAGUUUCUGUCUGAU 249 miR_2091 GGUUUUGACAUGUCACUGUU 251 miR_2092 CUCGCCCGUGGUCUCUCGUCUU 253 miR_2093 AACACGCAUACGGUUAAGGCAUUGC 255 miR_2094 UGAAACAGCAUCUGAUCUUGAACUU 257 miR_2095 GCGUAAAGAGUGUUUUAGAUCACCC 259 miR_2096 GUCCGUUUCCUGUCAGAGUGAUCC 261 miR_2097 CCAUCGGUGAUCCCAGUGACAAGU 263 miR_2098 GAAAUGUUGAGUGUUUACCCUGU 265 miR_2099 GAAGAAACAGCUCAUGAGGCU 267 miR_2100 AUGAACCACCAGUCCAAGAAUCU 269 miR_2101 GGAAGGUUGGGGGGUGU 271 miR_2102 UUCUAGGUUGUGGCAUUU 273 miR_2103 UGAUAUGUUUGAUAUUGGGUUGUU 275 miR_2104 AGAAUACAGCAGAAUUGGCCUC 277 miR_2105 CUGAUGGAGAGAAGAAGGCAU 279 miR_2106 ACUCGGCGUGGCGUCGGUCGUG 281 miR_2107 AUGAGGUGGCAAGAAAUGGGCU 283 miR_2108 AAUUUUGACAGAUGCUCAAGGCUGU 285 miR_2109 AAAAGCUGGGUUGAGAAG 287 miR_2110 AUUGAUGGUUAAGCUCAGCUUUU 289 miR_2111 AUGGAUUGAGAUGUGAUCAAAGGC 291 miR_2113 AUUUGGCAUUUGGAAGAUAGGUU 293 miR_2114 ACUGCUGAGGAACUGUCACUUGU 295 miR_2115 AGGUGAGGGGCAGGACCUGAAGGU 297 miR_2116 AGUGUCUGUGUGUGCUUGCU 299 miR_2117 ACGAAGAUGGCGACCGUAAC 301 miR_2118 AACUGGAAUGGCGGCAAGGUCCU 303 miR_2119 AGUUGAGUCAGGGCCUGUGUG 305 miR_2120 GCCGCCCGGGGCCAUGGCG 307 miR_2121 AAGUCUAAGUCUAACAUUCGGUGU 309 miR_2122 CGGCGGGAGCCCGGGG 311 miR_2123 ACGUGGAUGGCGUGGAGGUGC 313 miR_2124 GUUUAGACGGGCUCACAU 315 miR_2125 AUUUCUGCAGUCAGGUGAGAC 317 miR_2126 AAGAAUGACCGCUGAAGAACGU 319 miR_2127 AAAUAUGAGCCACUGGGUGU 321 miR_2128 AAGGUCCUCUGAGGCAGCAGGCU 323 miR_2129 GUCGAGGUCUUUGGUGGGUUG 325 miR_2130 GGUUUCGGGUUUGAAGGCAGC 327 miR_2131 GCUGGUGAGUGCAGGCUGCUUC 329 miR_2132 GACAGAGGUGGCAUCAAGCU 331 miR_2133 CUGCCCUGGCCCGAGGGACCGAC 333 miR_2134 UCGUGUCGCGUGGGGGGCGG 335 miR_2135 GGGAUGCCAGGCAAGUGAGCAGGUC 337 miR_2136 AGGGCCGUCAGGACACGGGAGGGUU 339 miR_2137 GAAAAGCUGGGUUGAGAGGGU 341 miR_2138 AACUAGCUAGGGGUUCG 343 miR_2139 GGGUUUGGGGGAUGUCAGAGGGC 345 miR_2140 UGAAGGGAGAUGUGAAGAAGCC 347 miR_2141 AGAAAGUCCAAGUGUUCAGG 349 miR_2142 UGAACGGGUAUUUUACUG 351 miR_2143 CUGAGACAUGCACUUCUGGUU 353 miR_2144 AAUUGAGGAUGUGUGAGGUUU 355 miR_2145 AGUUUCUAUGAGUGUAUACCAUUU 357 miR_2146 AGGUGGAGAUCAAGCCCGAGAUGAU 359 miR_2147 GAAGACAGCAAUAACCACAGU 361 miR_2148 GUUUCUGUUGAGUGUGGGUUUAGU 363 miR_2149 AUCGCCGUGGAGUGGGAGAGC 365 miR_2150 GGAUGAAGUGCACUGAGGCUCUU 367 miR_2151 UCCUGUUGGCCGAGUGGAGACUGGUGU 369 miR_2152 GUGGAGUCUGUCAUCGAGGUGCGU 371 miR_2153 UUGCAGCUGCCUGGGAGUGACUUC 373 miR_2154 UGCAGCCAGCGUCCCAUGCUCG 375 miR_2155 AGUUUUGUGUGUUGGCU 377 miR_2156 ACGGCCAAGCAGAAAAUGUUUU 379 miR_2157 GAUUAGGGUGCUUAGCUGUUAACU 381 miR_2158 CCUUCGAGGCGGCUGAGACCC 383 miR_2159 AGGUGGUGGCAGCUGGAGGGACC 385 miR_2160 AGAAGAAGGACGGCAAGAAGCGC 387 miR_2161 AAAAGCAAAUGUUGGGUGAACGG 389 miR_2162 GGCGGAGGGGCCGCGGGCC 391 miR_2163 UUGCAGCUGCCUGGGAGUG 393 miR_2164 UCUCUCCAGGUGACAGAAAGGGCU 395 miR_2165 CGUUCUUGCUCUGCCUCGGUC 397 miR_2166 AUGCCAAGAGGGCCAGUGUCUU 399 miR_2167 UUUUGUGUGUGUGUUUGUUUUU 401 miR_2168 AUGAGGAACACUGACUUUAUUAAGC 403 miR_2169 GGGUCGGAGUUAGCUCAAGCGGUU 405 miR_2170 GGAGGUUCAGAGUUGGAAG 407 miR_2171 GAGAGUCUCAGGAAAGAAAGGUC 411 miR_2364 ACCCGUCCCGUUCGUCCCCGG 413 miR_2365 ACCGGGUGCUGUAGGCUUU 416 miR_2366 ACGCGGGUGAUGCGAACUGGAGUCUGAGC 418 miR_2367 ACUCGGCGUGGCGUCGGUCG 420 miR_2368 ACUCGGCGUGGCGUCGGUCGU 421 miR_2369 ACUCGGCGUGGCGUCGGUCGUGGU 422 miR_2370 AGAGCAGUGUGUGUUGCCUGG 424 miR_2371 AGAGUUGAGUCUGGACGUCCCG 426 miR_2372 AGGACGGUGGCCAUGGAAG 428 miR_2373 AGGACGGUGGCCAUGGAAGU 429 miR_2374 AGUUGGUGGAGUGAUUUGUCU 430 miR_2375 AGUUGGUGGAGUGAUUUGUCUG 431 miR_2376 AGUUGGUGGAGUGAUUUGUCUGG 432 miR_2377 AGUUGGUGGAGUGAUUUGUCUGGU 434 miR_2378 AGAACGCGGUCUGAGUGGU 436 miR_2379 AUGAGGAUGGAUAGCAAGG 438 miR_2380 CGGAGCUGGGGAUUGUGGGU 440 miR_2381 CGGCGGCUCCAGGGACCUGGCG 442 miR_2382 CGGCGGGGACGGCGAUUGGU 444 miR_2383 CGGGGAUCGCCGAGGGCCGGUCGGCCGCC 447 miR_2384 CUCGGCGUGGCGUCGGUCGUGGU 449 miR_2385 CUGCCCAGUGCUCUGAAUG 451 miR_2386 CUGCCCAGUGCUCUGAAUGUCAAAGUG 452 miR_2387 CUGCCCUGGCCCGAGGGACCGACU 454 miR_2388 CUGGAGGAGCUGGCCUGU 456 miR_2389 CUUGGCACCUAGCAAGCACUC 458 miR_2390 GACUAUAGAACUUUCCCCCUC 460 miR_2391 GAGAGCAGUGUGUGUUGCCUGG 462 miR_2392 GAGGAAGGUGGGGAUGC 464 miR_2393 GAGUGAGAGGGAGAGAACGCGGUCUGAGUG 466 miR_2394 GAUGCCUGGGAGUUGCGAUCU 468 miR_2395 GAUGCCUGGGAGUUGCGAUCUGC 469 miR_2396 GCAUGGGUGGUUCAGUGG 471 miR_2397 GCAUGGGUGGUUCAGUGGU 472 miR_2398 GCAUGGGUGGUUCAGUGGUAGAAUUCUCGCC 473 miR_2399 GCAUUGGUGGUUCAGUGGU 475 miR_2400 GCGUUGGUGGUAUAGUGGU 477 miR_2402 GCGUUGGUGGUAUAGUGGUGAGC 478 miR_2403 GCUGUGGCUGUGACUGGCG 480 miR_2404 GGACGGUGGCCAUGGAAGU 482 miR_2405 GGGGAUGUAGCUCAGUGGU 484 miR_2406 GGUUCCCUCAGACCUGGU 486 miR_2407 GGAAAGUUUGGCUGCGCGGGUUCCCC 488 miR_2408 GGAAUACCGGGUGCUGUAGGCUUUU
490 miR_2409 GUGAACGGGCGCCAUCCCGAGGC 492 miR_2410 GUGAACGGGCGCCAUCCCGAGGCU 493 miR_2411 GUGAACGGGCGCCAUCCCGAGGCUU 494 miR_2412 GUGAACGGGCGCCAUCCCGAGGCUUU 495 miR_2413 GUUGGUGGAGCGAUUUGUCUG 497 miR_2414 GUUGGUGGAGCGAUUUGUCUGG 498 miR_2415 GUUGGUGGAGCGAUUUGUCUGGU 499 miR_2416 GUUGGUGGAGUGAUUUGUCU 501 miR_2417 GUUGGUGGAGUGAUUUGUCUG 502 miR_2418 GAACGCGGUCUGAGUGGU 504 miR_2419 UACCGGGUGCUGUAGGCUUU 507 miR_2420 UCCUGUACUGAGCUGCCCCG 509 miR_1120 UCGACGAGCUCACAGUCUAGU 511 miR_2422 UCGGACACCGGCGCGUCUCU 513 miR_2423 UCUGCCCAGUGCUCUGAAU 515 miR_2424 UCUGCAAGUGUCAGAGGCGAG 517 miR_2425 UCUGCAAGUGUCAGAGGCGAGG 518 miR_2426 UCUUCUCUGUUUUGGCCAUGUG 520 miR_2427 UGAUAUGUUUGAUAUUGGGUUG 522 miR_2428 UGAUUGUCCAAACGCAAUUCUCG 524 miR_2429 UGCUGGAUCAGUGGUUCGAGUC 526 miR_2430 UUAGGGCCCUGGCUCCAUCU 528 miR_2431 UUCUCUGUUUUGGCCAUGUGUG 530 miR_2432 UUCUGCCCAGUGCUCUG 532 miR_2433 UUCUGCCCAGUGCUCUGAAU 534 miR_2435 UUGGCCAUGGGGCUGCGCGGG 536 miR_2436 UUGGCCAUGGGGCUGCGCGGGG 538 miR_2437 UUGGGGAAACGGCCGCUGAG 540 miR_2438 UUGGGGAAACGGCCGCUGAGU 541 miR_2439 UUGGUGGAGCGAUUUGUCU 543 miR_2440 UUGGUGGAGCGAUUUGUCUG 544 miR_2441 UUUCCGGCUCGCGUGGGUGU 546 miR_2442 AAAGCUGGGUGAGAGGG 548 miR_2443 AAAGCUGGGUUGAGAGG 549 miR_2444 AAAGCUGGGUUGAGAGGG 550 miR_2445 AAAGCUGGGUUGAGAGGGC 555 miR_2446 AACCUUGGAGAGCUGAGC 557 miR_2447 AAGCUGGGUUGAGAGGGC
Example 5
Expression Data
Array Design
[0617] The array contains LNA spiked capture probes for detection of the microRNAs listed herein
Sample Collection
[0618] Samples were collected and frozen to -80° C., before treatment with RNAlater ICE (Cat#7030, Ambion) according to manual.
RNA Extraction
[0619] Samples from RNAlater® ICE (Ambion) were disrupted and homogenized using the TissueRuptor (Qiagen) in Trizol reagent (Invitrogen). Total RNA was extracted from the samples using the protocol provided with the Trizol reagent.
[0620] Quality Control (QC) of the total RNA samples were performed with the Agilent 2100 BioAnalyzer using the Agilent RNA6000 Nano kit. RNA concentrations were measured in a NanoDrop ND-1000 spectrophotometer.
RNA Labelling and Hybridization
[0621] Essentially, the instructions detailed in the "miRCURY® LNA microRNA, Hy3®/Hy5® Power labeling kit" were followed.
[0622] All kit reagents were thawed on ice for 15 min, vortexed and spun down for 10 min.
[0623] For hybridization, the 12-chamber TECAN HS4800Pro hybridization station was used. 25 μL 2× hybridization buffer was added to each sample, vortexed and spun.
[0624] Samples were incubated at 95° C. for 3 min before injection into the hybridization chamber. The hybridization chambers were primed with 100 ul of 1× Hybridization buffer. 50 μl of the target preparation was injected into the Hybridization station and incubated at 56° C. for 16 hours (overnight).
[0625] The slides were washed at 60° C. for 1 min with Buffer A twice, at 23° C. for 1 min with Buffer B twice, at 23° C. for 1 min with Buffer C twice, at 23° C. for 30 sec with Buffer C once. The slides were dried for 5 min.
[0626] Slides were scanned using the DNA Microarray Scanner (Agilent) at 100% PMT setting.
Image Analysis and Data Processing
[0627] Image analysis and spot identification was done using Imagene 7.0.0 software (Biodiscovery). Tumor and normal adjacent tissue were paired and normalized with Lowess smooth fitting using Genesight 4.1.6 Lite edition software (Biodiscovery).
[0628] Ratios of tumor/normal were calculated and log 2 transformed from the Lowess normalized data sets. Raw values (Lowess normalized values) were further treated and median scaled for comparison between samples. To illustrate the tissue specificity of the individually microRNAs, an index was calculated as a ratio between the median scaled signal and an average of signal across tissues. This ratio was log 2 transformed and stated as the tissue specificity index.
Results
[0629] Differential expression of microRNAs between tumor and normal adjacent tissue can be identified using the log 2 ratios in Table 6 (ratios--454miRs) and in Table 7 (ratios--454premiRs). E.g. seq ID 113 are downregulated in tumor samples compared to normal adjacent tissue by 2 (-1.61)≈3 fold. This could indicate a function of this microRNA in the regulation of normal tissue, which is impaired in the tumor cells. This observation could lead to the development of a cancer biomarker useful for identification of special phenotypes important for treatment of for instance adrenal cancers.
[0630] Table 6 is provided in Parent U.S. application Ser. No. 11/975,644, which is hereby incorporated by reference. table ratios--454miRs: Contains ratio data generated on tumor versus normal adjacent tissues from a variety of tissues.
[0631] Table 7 is provided in Parent U.S. application Ser. No. 11/975,644, which is hereby incorporated by reference. ratios--454premiRs: Contains ratio data generated on tumor versus normal adjacent tissues from a variety of tissues.
[0632] Tissue specific expression of a microRNA can be identified with Table 8 (tissuespecificity_index--454miRs) and Table 9 (tissuespecificity_index--454premiRs). A positive tissue specificity index value indicates a higher prevalence of this microRNA in a sample compared to the average, whereas a negative value indicates lower levels of the specific microRNA. E.g. Seq ID 113 gives negative values for e.g. uterus, stomach, prostate and colon indicating lower or no expression of this microRNA in these tissues. This indicates that the expression of this microRNA is limited to a number of tissues.
[0633] Table 8 is provided in Parent U.S. application Ser. No. 11/975,644, which is hereby incorporated by reference. Tissue Specificity Index--454miRs: Contains a tissue specificity index calculated as the log 2 ratio between the lowess normalized expression value for a sample and the average
[0634] Table 9 is provided in Parent U.S. application Ser. No. 11/975,644, which is hereby incorporated by reference. Tissue Specificity Index--454premiRs of all samples for the corresponding microRNA: Contains a tissue specificity index calculated as the log 2 ratio between the lowess normalized expression value for a sample and the average of all samples for the corresponding pre-microRNA.
[0635] TABLE 10 LISTS THE DIFFERENT TISSUE SAMPLES USED FOR THE MICRORNA PROFILING.
TABLE-US-00006 Tissue Sample names Diagnosis Stage Adrenal gland T/N-30 Phaeochromocytom T/N-30 Technical Phaeochromocytom replicate Bladder T/N-34 urothel cell carcinoma T/N-46 carcinoma T/N-74 urothel papilloma grade 2 T/N-ambion transitional cel T3aN1MX, G2 carcinoma Colon T/N-47 ND T/N-47 Technical ND replicate Cervix T/N-ambion Sqaumous cell carcinoma Duodenum T/N-79 Technical adenocarcinoma replicate T/N-79 Technical adenocarcinoma replicate Esophagus T/N-ambion infiltrating moderately T2bNXMX, G2 differentiated adenocarcinoma Kidney T/N-48 renal cell carcinoma T/N-55 renal cell carcinoma T/N-55 Technical renal cell carcinoma replicate T/N-57 renal cell carcinoma T/N-57 Technical renal cell carcinoma replicate T/N-60 renal cell carcinoma T/N-61 renal cell carcinoma T/N-66 oncocytom T/N-73 ND T/N-76 clear cell carcinoma T/N-81 urothel papilloma grade 2 Liver T/N-ambion hepatoblastoma Lung T/N-ambion Squamous cell T1N1M0, stage2 carcinoma poorly differentiated Mammary T/N-32 lobular carcinoma T/N-41 ND T/N-43 ND T/N-44 ND T/N-45 ND T/N-52 Ductal carcinoma T/N-53 Ductal carcinoma T/N-ambion invasive ductal T3N1aMX carcinoma Ovary T/N-ambion papillary cystadenocarcinoma Prostate T/N-ambion Adenocarcinoma T2bN0M0, gleason score 6 (3 + 3) Rectal T/N-31 ND T/N-50 adenocarcinoma T/N-62 adenocarcinoma T/N-68 adenocarcinoma T/N-69 ND T/N-71 adenocarcinoma T/N-85 ND Stomach T/N-ambion Adenocarcinoma Uterus T/N-38 endometrial adenocarcinoma T/N-ambion endometrial T1bNXMXG2 adenocarcinoma
TABLE-US-00007 TABLE 11 SEQ ID NO 538 mRNA comprising miR2437 target region C17orf76 APC2 CUL3 LOC648570 SCRT2 ZFP36L1 HMGB1 SPRY4 C6orf190 ARHGEF12 DLGAP2 LPPR4 SEMA4G ZNF644 HNRPD SRGAP2 CNIH3 AZIN1 DNAJB5 MAPK6 SETD7 ADCY6 HOXA6 TPSD1 CROP BAZ2A DST MAT2A SFRS1 AP4E1 IGFBP5 TSC22D3 DNAJB12 BNC2 FLJ10154 MBD6 SMARCD1 APH1A KIAA1305 UBTF ELK1 C18orf34 FUBP1 MKLN1 SNURF BRSK1 LHX6 WNK3 JOSD1 C5orf16 G3BP1 MMP2 SRCAP BTRC LOXL3 XKRX MBD2 CALN1 G3BP2 MSI1 STRN4 C12orf48 MBNL3 ZNF207 MYST3 CAMTA1 GABRE NFIB TCF7 C1QL3 NKX2-2 ZNF219 ROBO2 CASKIN1 GDI1 PCDH17 TGFBR1 C1orf108 PLCH1 ZNF618 SLC4A10 CD24 GJA5 PRDM12 THRA CYFIP2 PSD3 USP12 CENTD2 HCCS PUM1 TSGA14 DBN1 PSMD2 YES1 CHD3 IGF2BP1 RBM14 UBE2R2 DCHS1 PVRL2 ZFHX4 CPEB4 IGSF21 RHOC VTI1A ELAVL3 RAB6B PHC2 CRSP2 IL1RAPL1 RSBN1 WDR68 FBS1 RBM25 AKAP11 CTF8 KIAA0174 SCRT1 XPO7 FHL5 SLC35A2 SEQ ID NO 540 mRNA comprising miR2438 target region C17orf76 APC2 CUL3 LOC648570 SCRT2 ZFP36L1 HMGB1 SPRY4 C6orf190 ARHGEF12 DLGAP2 LPPR4 SEMA4G ZNF644 HNRPD SRGAP2 CNIH3 AZIN1 DNAJB5 MAPK6 SETD7 ADCY6 HOXA6 TPSD1 CROP BAZ2A DST MAT2A SFRS1 AP4E1 IGFBP5 TSC22D3 DNAJB12 BNC2 FLJ10154 MBD6 SMARCD1 APH1A KIAA1305 UBTF ELK1 C18orf34 FUBP1 MKLN1 SNURF BRSK1 LHX6 WNK3 JOSD1 C5orf16 G3BP1 MMP2 SRCAP BTRC LOXL3 XKRX MBD2 CALN1 G3BP2 MSI1 STRN4 C12orf48 MBNL3 ZNF207 MYST3 CAMTA1 GABRE NFIB TCF7 C1QL3 NKX2-2 ZNF219 ROBO2 CASKIN1 GDI1 PCDH17 TGFBR1 C1orf108 PLCH1 ZNF618 SLC4A10 CD24 GJA5 PRDM12 THRA CYFIP2 PSD3 USP12 CENTD2 HCCS PUM1 TSGA14 DBN1 PSMD2 YES1 CHD3 IGF2BP1 RBM14 UBE2R2 DCHS1 PVRL2 ZFHX4 CPEB4 IGSF21 RHOC VTI1A ELAVL3 RAB6B PHC2 CRSP2 IL1RAPL1 RSBN1 WDR68 FBS1 RBM25 AKAP11 CTF8 KIAA0174 SCRT1 XPO7 FHL5 SLC35A2
[0636] The remainder of Table 11 is provided is provided in Parent U.S. application Ser. No. 11/975,644, which is hereby incorporated by reference
[0637] TABLE 12--A SUMMARY OF EXPRESSION ANALYSIS IS PROVIDED IN PARENT U.S. application Ser. No. 11/975,644, WHICH IS HEREBY INCORPORATED BY REFERENCE (T=Tumor, N=Normal, ratio T/N of values for each tissue type is provided.).
TABLE-US-00008 TABLE 13 Seq ID MiR name BC NAT T7826 T7732 538 miR_2437 0 2 0 0 540 miR_2438 1 1 0 1 The table represents the microRNA cloning frequency from four separate samples - methodology as described above. BC = Breast cancer tissue from 5 BC patients (described under "Example 1) E: NAT, normal adjacent breast tissue from the same patients F: T7826, an ovarian teratoma cell line, Hs 38.T (ATCC No. CRL-7826) G: T7732, a sacrococcygeal teratoma cell line, TE76.T (ATCC No. CRL-7732) The cloning frequencies were not normalized The total counts from each of the four samples were: BC: 93.078 NAT: 119.148 T7826: 66.970 T7732: 66.585
[0638] The remainder of Table 13 is provided in Parent U.S. application Ser. No. 11/975,644, which is hereby incorporated by reference
Sequence CWU
1
558128RNAHomo sapiens 1cgagccuggu gauagcuggu uguccaag
282165RNAHomo sapiens 2aagauucaug aguagcagug acaaaccuac
cgagccuggu gauagcuggu uguccaagau 60agaaucuuag acaacucccu auaccagauc
cucuaauuaa uuuuaauaaa ggccuucuau 120uuauacuagc cacaucaagc cuagccgucu
acguacccac agaau 165318RNAHomo sapiens 3gaggcugagg
cgagaggu 184158RNAHomo
sapiens 4cgguguuucc ggccgccguc gcuguccagg gaggcugagg cgagagguag
cuguccgggu 60ggggagcccg cacuaccuuc uuccucuucc uccuccuccu ccgggugagg
ggagcgaagg 120uugggggucc ccgagcccau ggaccaggag gaggcgga
158523RNAHomo sapiens 5auuuguggcc gaguguaaca acc
236163RNAHomo sapiens 6aucacccucu
gaucgccgau caccucugag acccaacuug cucauaaaca aaacugccca 60ugucgguccu
cugcccugga ccugugacac ucuggacuau uucuguguuu auuuguggcc 120gaguguaaca
accauauaau aaaucaccuc uuccgcuguu uua 163716RNAHomo
sapiens 7ucccuucgug gucgcc
168156RNAHomo sapiens 8auccugccuu ggcuggaaaa gccagccuuc cacccagcgc
cccuaaaaug aucggguuga 60cuccaguuuu guuacgaaag gaggccgggc ugcugagagg
cucccugagu ucccuucgug 120gucgcccguc acauugcccu gcuguauacu uaauaa
156921RNAHomo sapiens 9gcaggggaag aagccuuccg u
2110161RNAHomo sapiens
10cagacaaaga ggggcgugag ggagcugccu gcaggggaag aagccuuccg uaucgagcug
60ggcggucauu acacaggugc gcacagauau ggaugaggag gggcgugagg gagccacgug
120cagggcagca aguccucuau aucuugagcu ggguggucau u
1611125RNAHomo sapiens 11acuuugagag uuagaaaugg uuacu
2512165RNAHomo sapiens 12ugaaacuaac uagauuuauu
ggauaucagu acuuugagag uuagaaaugg uuacugauug 60ucaucuuuuc agugaagggu
ucuauaguug aguaaaaaau uugucuaacu uuguaaguau 120aguuuauauu guagaaauug
cuuccaauuu uguugguaac uucau 1651324RNAHomo sapiens
13aaccaaugau guaaugauuc ugcc
2414164RNAHomo sapiens 14auugaguagg gcaaauuuua aauggguauu auuuuucauc
uucaaacagg cagaccuguu 60auccuaaacu aggugaguca gcuuuuggua caugugauga
uuuucagugu aaccaaugau 120guaaugauuc ugccaaauga aauauaauga uaucacugua
aaac 1641520RNAHomo sapiens 15augauucugu gacgccagcu
2016160RNAHomo sapiens
16uuggcaggaa guuuccaugg ccaugcagcc gcagggucac ccugagugcu uuucagggug
60gcagggccuu gccucagaug gccacaaggg caccucuccu uggauacuuu augauucugu
120gacgccagcu acuugguuug cuuuuuguau uuuuaugcau
1601722RNAHomo sapiens 17gaaagcugag cgugaacgug gu
2218162RNAHomo sapiens 18cuucaaguau gccugggucu
ugcauaaacu gaaagcugag cgugaacgug guaucaccau 60ugauaucucc uuguggaaau
uugagaccag caaguacuau gugacuauca uugaugcccc 120aggacucaga gacuucauca
aaaacaugau uacagggaca uc 1621923RNAHomo sapiens
19uagcagcaca uaaugguuug aau
2320163RNAHomo sapiens 20auagaaucau cuaaguauuc agacacugcu uuccuaggaa
auguuaaacu ccuugaggca 60ggcuggcuuc cucaccaccu ugugcacugc ugcucccaca
ccacagugac uagcagcaca 120uaaugguuug aauuaaagcu gaaguaaaaa auauccaggu
cca 1632119RNAHomo sapiens 21uguuuagacg ggcucacau
1922158RNAHomo sapiens
22cuuaccuccu caaagcaaua cacugaaaau guuuagacgg gcucacauca ccccauaaac
60aaauagguuu gguccuagcc uuucuauuag cucuuaguaa gauuacacau gcaagcaucc
120ccguuccagu gaguucaccc ucuaaaucac cacgauca
1582324RNAHomo sapiens 23ggaaauuuga gaccagcaag uacu
2424164RNAHomo sapiens 24auuugagaag gaggcugcug
agaugggaaa gugcuccuuc aaguaugccu gggucuugga 60uaaacugaaa gcugagcgug
aacaugguau caccauugau aucucuuugu ggaaauuuga 120gaccagcaag uacuauguga
cuaucauuga ugccccagga caca 1642525RNAHomo sapiens
25auuguauauc agcaugggga uuauu
2526165RNAHomo sapiens 26ugccuaauac ugacucagau gcacaaucca guuaacccag
augugugaga ucuuccgguu 60ugaaagaacu guauuggcaa ggcaaaauca accuauugua
gaauauauuu auuguauauc 120agcaugggga uuauuaauau ugcuaauaaa accauuauuu
guaaa 1652715RNAHomo sapiens 27uuggaggcgu ggguu
1528155RNAHomo sapiens
28gggaaggaua aagggauggc augguggggg uuggaggcgu ggguuuuaga accuaucccu
60uucuagcccu gagcaaugcu ugccccagaa ggaguugggg cuaggcccau uccaauccuu
120ccagccuaag auccagacuc caaggcaugc cccag
1552922RNAHomo sapiens 29aacgugcagc ggcugaagga gu
2230162RNAHomo sapiens 30ucaaucugga ggagcucagg
guggccggca uucacaagaa gguggcccgg accaucggca 60uuucugugga uccgaggagg
cggaacaagu ccacggaguc ccugcaggcg aacgugcagc 120ggcugaagga guaccgcucc
aaacucaucc ucuuccccag ga 1623119RNAHomo sapiens
31aauugugagg cuugagugu
1932159RNAHomo sapiens 32accccaucca auuuaaucgg guguuauuua auuauacuac
uauaauuguu guauuugcag 60guuugacugu ucucagggaa cgcugaaggu ucauaacagu
agugauuugu aauugugagg 120cuugagugug gaauugaauu acuucauuag agaguaacc
1593322RNAHomo sapiens 33ugauaggauu gacauggagc ac
2234162RNAHomo sapiens
34cuuauuuacg uuacuggcug aaagccuguc ugauaggauu gacauggagc acuaauuaau
60caccuagggu cuccucauuu acuaaucaua uugcacaaaa cuucccugcu gacugaggcu
120caagggcaaa cugugggcuu ccagccagcu uauuuuucau aa
1623520RNAHomo sapiens 35aacggccgcg guacccuaac
2036160RNAHomo sapiens 36guuaaaaaaa guaaaaggaa
cucggcaaau cuuaccccgc cuguuuacca aaaacaucac 60cucuagcauu cucaguauua
gaggcaccgc cugcccagug acaugcguuu aacggccgcg 120guacccuaac ugugcaaagg
uagcauaauc acuuguuccu 1603725RNAHomo sapiens
37ucuugccaag agaauuaaug ugcgu
2538165RNAHomo sapiens 38uguuguaaac aaacaaguua agagcaagau ucuugccaag
agaauuaaug ugcguauuga 60gcacauuaag cacucugaga gcugggauag cuuccugaaa
uacaugaagg aaaaugauca 120gaaaaagaaa gaagccaaag agaaagguac cuggguucaa
cugaa 1653924RNAHomo sapiens 39aaucugagug agagguuagu
ugcu 2440164RNAHomo sapiens
40uucugaaggg uauauugcau guucauuauu aaucugagug agagguuagu ugcuauaaag
60uuacaagauu uuccugauca cuuaaaauuu ucuuguaguc agagauuuga cucugaaucg
120ucacuucaaa aauuugucuu uucagguacu auguaaagag aacu
1644119RNAHomo sapiens 41auuaaaaauu ucgguuggg
1942159RNAHomo sapiens 42ccgugaagag gcgggcauga
cacagcaaga cgagaagacc cuauggagcu uuaauuuauu 60aaugcaaaca guaccuaaca
aacccacagg uccuaaacua ccaaaccugc auuaaaaauu 120ucgguugggg cgaccucgga
gcagaaccca accuccgag 1594325RNAHomo sapiens
43gauagcugcc agugacagga guagu
2544165RNAHomo sapiens 44auucgugcug aaaaucucag acucauugau gauagcugcc
agugacagga guaguguugc 60cacuguaaga uacgccaucu uuguuaguua cucucaucua
cucguuucuu guauucugcc 120ucuuggucau cuuugauucu cauuuaucug caaauuuucu
uggua 1654518RNAHomo sapiens 45gagccuggug auagcugg
1846158RNAHomo sapiens
46agauucauga guagcaguga caaaccuacc gagccuggug auagcugguu guccaagaua
60gaaucuuaga caacucccua uaccagaucc ucuaauuaau uuuaauaaag gccuucuauu
120uauacuagcc acaucaagcc uagccgucua cguaccca
1584718RNAHomo sapiens 47uggcgcggag cggagcgg
1848158RNAHomo sapiens 48aggcagcucg gcgggcggcg
ggcggcauuc uggcgcggag cggagcggcg gcgggcgcag 60cuagcggguc ggccgcggag
cggaggugca gcucggcuuc ccccggcacc ccucccccuc 120gggcgccagc cccaccccuc
cgccggccgg gccgaccc 1584916RNAHomo sapiens
49aggcggcgga ggggcg
1650156RNAHomo sapiens 50cggcccuguc cugcgggggu ccggucgcgg aggcggcgga
ggggcgcggg gacacucccc 60accuccacug uccgcccguc ggccccggug gccuuuucuc
gccucgcgca cagcuccccc 120gccgcagggc ugagagagag aguggccguc uggugc
1565121RNAHomo sapiens 51augcgugcga gaagucagug g
2152159RNAHomo sapiens
52caggccuuuc ugaaggaguu auucugcuaa aaauggucuu aguugucuga aaagccagcu
60cuugaaccuc uucacaacag uaucaacacu ggcuucuccc gguucauuuu augcgugcga
120gaagucagug guaacugcug cagggcuuaa uacauuagu
1595326RNAHomo sapiens 53uguguuugag agcaacgcca uugccu
2654163RNAHomo sapiens 54agcauuugag ggugaugaug
gauucugugu guuugagagc aacgccauug ccuacuaugu 60gagcaaugag gagcugcggg
gaaguacucc agaggcagca gcccaggugg ugcagugggu 120gagcuuugcu gauuccgaua
uagugccccc agccaguacc ugg 1635519RNAHomo sapiens
55gcaugagugg uucaguggu
1956159RNAHomo sapiens 56auuuaaaacu gugucuuucu gugucccuga aauucucaca
caugguacgu uuucaaugag 60cugauuuugu uucuccacuc aaugcaguaa uugagcuucu
uugguucagu gcaugagugg 120uucagugguu cauugggcau ccugguugag ggaggggcu
1595719RNAHomo sapiens 57aaggaaugag uuagcuuug
1958159RNAHomo sapiens
58uuuaugguug cuacuguagg uuuauaauuu guuuauaauu uggccuaauu uccaucagcc
60auacuaauau uggauuuuaa aaggaggcaa cuuuuuuucu uuuugaacca aaggaaugag
120uuagcuuuga aaacauaauu ugggauauua uaguaugga
1595920RNAHomo sapiens 59acaagugaau acacugaggc
2060160RNAHomo sapiens 60ccugcugggg uuggaguucu
uaaugaacau acaagugaau acacugaggc aaaaaaauua 60aagcucucca acuguggggu
auucauucug uucacugugg ccaguguggu gaucaguacu 120ggccacacca guggccaaag
agaacugcau ucaucaugug 1606122RNAHomo sapiens
61cucgcgcccg cgucgcggca gc
2262162RNAHomo sapiens 62ccucagcccc uucagagagc gacuuucaaa cucgcgcccg
cgucgcggca gcaccugggc 60agccccgcac gccgugcgcg ucccgagccc gcggggcagc
uaccgcucgg ugaguguccc 120cugauucucc ucucuccccu cuuaucuccc ugcauuaggc
ug 1626321RNAHomo sapiens 63gugguguuga ggaaagcaga c
2164161RNAHomo sapiens
64cugaaaaguu ccagcauauu uugcgaguac ucaacaccaa caucgauggg cagcggaaaa
60uagccuuugc caucacugcc auuaagggug ugggccgaag auaugcucau gugguguuga
120ggaaagcaga cacugaccuc accaagaggg cgggagaacu c
1616521RNAHomo sapiens 65guuuuuguga cugccuugag u
2166161RNAHomo sapiens 66caugcuuuug guuuguuacc
aaaauauaca guguggugaa gguugacuga agaaguccag 60uguguccagu uaaaacagaa
auaaauuaaa cucuucauca acaaagaccu guuuuuguga 120cugccuugag uuuuaucaga
auuauuggcc uaguaauccu u 1616724RNAHomo sapiens
67aaggcacagc uggaaaugau ggug
2468164RNAHomo sapiens 68cccagggugg cauaggagaa aaaggugcug aaggcacagc
uggaaaugau ggugcaagag 60uaagugaaag uauuccuuuu cuagcugggc uaggaaccaa
cauuacagua ucauaugagu 120uucccugaac cuuccaaaau aaagucaguc auguuuccuu
ggua 1646920RNAHomo sapiens 69aaacuaggcg gcuaugguau
2070160RNAHomo sapiens
70gggucaauag uacuugccgc aguacucuua aaacuaggcg gcuaugguau aauacgccuc
60acacucauuc ucaacccccu gacaaaacac auagccuacc ccuuccuugu acuaucccua
120ugaggcauaa uuauaacaag cuccaucugc cuacgacaaa
1607119RNAHomo sapiens 71gugguggucg uacgcugug
1972159RNAHomo sapiens 72ggcggcugcc gaagauggcg
gaggugcagg ucccaguccu ccauggucga ggccaucucc 60ugggccgccu ggcggccauc
guggcuaagc agguaauguu gggcuggaag gugguggucg 120uacgcuguga gggcaucaac
auuucuggca auuucuaca 1597322RNAHomo sapiens
73gcugagugaa gcauuggacu gu
2274162RNAHomo sapiens 74gcccaggacu ccagcucaug cgccgaauag uagguacagu
guuccaaugu cuuugugguu 60uguagagaac aaucaacggu cggcgaacau cagugggaua
agguaaaaug gcugagugaa 120gcauuggacu guaaaucuaa agacaggggc uaagccucuu
uu 1627520RNAHomo sapiens 75agguucacau ggaaaagguu
2076160RNAHomo sapiens
76ugguguagag gcggagagga gccaagaaac uaaaggugaa aaauacacug gaacucuggg
60gcaagacaug ucuaugguag cugagccaaa cacguaggau uuccguuuua agguucacau
120ggaaaagguu auagcuuugc cuugagauug acucauuaaa
1607722RNAHomo sapiens 77ccauugugua gcaagauguc au
2278162RNAHomo sapiens 78gacuaaaacu auuugaucuu
uuaauauuua auuaaugguu ccccguggcg uuuuuauagu 60cuguguucua uugugagcaa
cgagauuuua auaagcaggu ucaggacuuu ccauugugua 120gcaagauguc auugcuucca
ugacacuaau uuggcuuuca ua 1627924RNAHomo sapiens
79ggaaauaguu ugugacaaac uggg
2480164RNAHomo sapiens 80cacauacuca aggagcccug uuuuacaggg cacuggagaa
cuaauuaauu ugcaaugcag 60aaagaaugca gugacaucug aaauauuggc cucggguauc
acaggucauu ggaaauaguu 120ugugacaaac ugggguggag ggugggggug gggaaggcaa
cucu 1648121RNAHomo sapiens 81cuccucuucg ucuccucggu c
2182161RNAHomo sapiens
82gggggaggcc ugcgcggagg agcaccgcuu ccucccgccg ggagggggag ucccgggcuc
60cugcguccug ucucccuccc cggccgucug caggagcacg aagggagugc cuccucuucg
120ucuccucggu ccccguaacu ucuccccuca cuuccuccug g
1618321RNAHomo sapiens 83acuccagccc cacagccuca g
2184161RNAHomo sapiens 84gucaaaaguc cccagagucu
ucacacaagc cgugguguau gaagcugcau ccucaggacc 60ugggcuuggg ugguaggagg
aauuggugcu ggucuuucau uuuggauuug acuccagccc 120cacagccuca gccaccccag
ccaauuguca uaggagcugg a 1618522RNAHomo sapiens
85gccgcgagug ggagcgggag cg
2286162RNAHomo sapiens 86gcgcggcgga ggggggggug gggccuuggg gccgcgagug
ggagcgggag cgguucugcg 60gccuccucgg gcuucuuggc ccugggcgga gugggauugg
gugucccggc uguucgcagu 120ggccgcgagu gcggccggac cuggaguagu accugagccg
cu 1628725RNAHomo sapiens 87gcuugacuga guguggcugg
acgug 2588165RNAHomo sapiens
88gagaacaugg gucaccagca gggccugaga agagggagaa aauacggaaa ugugggauug
60gggucgcuga gugcaggcau guaaguuaag uguuugggga acagagcagu gcuugacuga
120guguggcugg acgugaguac ugagggggac aaaugagauu gaucc
1658919RNAHomo sapiens 89agucggugcc ugagguugc
1990159RNAHomo sapiens 90caggacggcc gccaucuugc
gcgcagcugg agucggugcc ugagguugca gccgagagug 60ugcgccagcc cgcggcccag
ccgaagcucu uucccgccgc cucuccgcgc cucgcccagg 120uucagcuccg ccugacccuc
cgcuuggcac gguccccug 1599120RNAHomo sapiens
91agugaugagg augugcugau
2092160RNAHomo sapiens 92uuaggaaguc ugagaugaua aauauuucaa ggucagugaa
gucuaucaau cauucucccc 60uuccucauca gcaaugguag auagaaaugu ccuaaacuuu
ucuaaauccu agugaugagg 120augugcugau auucaacaua guccuuaaag ugaaaacuga
1609320RNAHomo sapiens 93auugaguggg gcucaggauu
2094160RNAHomo sapiens
94agcuacuucc uuucuucagc cucuugcuuu cuguucaaau cucagcuuuu aucacauucu
60uuucauggag agacaucuca augucccuuu ucgccuagga gaagaauguu auugaguggg
120gcucaggauu uaaacccagg cagacuaauu gguaugugag
1609518RNAHomo sapiens 95gcaugggugg uucagugu
1896158RNAHomo sapiens 96cacauacauu ggcgaaaaga
ccaacaaguc augauuguuc ugaaguuccc uuuaucaugu 60uguccccuaa ucucuacuac
caguaagccu uuguguuauc uuaggaugag gcaugggugg 120uucaguguuu auaauaagac
gagucuaaaa uggacaau 1589723RNAHomo sapiens
97aacuguuaua uuaugauugu gac
2398163RNAHomo sapiens 98uguuuaaugc cugaaaucca agucuuccuc caugggaaaa
uacuguuaua ccaaauaauu 60cuagaugagu aacaaagauc uuuuuaggcc uucauuuuau
guuuuuucuu aacuguuaua 120uuaugauugu gacauagauu auacuacuac uaauuuuugg
aug 1639924RNAHomo sapiens 99uugcugugau gacuaucuua
ggac 24100164RNAHomo sapiens
100cuuacggaaa aggaacagau uguuccuaaa ccagaagagg agguugccca gaagaaaaag
60guaaauaagu aguugcucgg uuuuguuugu gauaguagaa agauuugugg uugcugugau
120gacuaucuua ggacaccuuu ggaauaacua ugaaagaaaa cuau
16410122RNAHomo sapiens 101agaauugagu gaucucaugg au
22102162RNAHomo sapiens 102cuaggaguga cucaugcaga
cucaagcaga accuuggggc ccagggcaga agugugacuu 60caggucucac ucagcacuca
ucagaacacu cacucaguau gcuuguaauu agaauugagu 120gaucucaugg augaacugua
cugggcuaac uugaagagca ca 16210324RNAHomo sapiens
103aaaacgaucu uucagauuua gagu
24104164RNAHomo sapiens 104uaaaagcuga aaaucucagu uuaaaaauca aaauguuaac
acaaagcuaa gauucaucag 60agcccacccu auucuaagga accacaauaa cuuacucugg
ccccaguguu aaaacgaucu 120uucagauuua gagugacuau guaagaauuu aggauuuccu
cuuu 16410517RNAHomo sapiens 105gcggucgggc ggcggcg
17106157RNAHomo sapiens
106ggccccgcgg ggcccguccg cuccuccagc cgcugccucc cgggcggcgc ucgccggcgc
60ggcggcaaag acugagacag cuccgcugcc cgcugaacuc cauccucccg gcggucgggc
120ggcggcggcu gcggucgguc gcggcagcgg cuccgcu
15710722RNAHomo sapiens 107augagaacuu gagcgacaga gu
22108162RNAHomo sapiens 108cuccagguca ucaucagugu
gguauuaucu augagaacuu gagcgacaga guauuucuug 60augaauuuau agaucauuug
agauguugag uuacuuuugu uuuguuuuca aauagguaga 120gacuauuaau guaaaaaaac
aagaaaggaa aaugaaaugu gc 16210918RNAHomo sapiens
109auuggucgug guuguagu
18110158RNAHomo sapiens 110guggggaggu cgaugaauga gugguuaauu aauuuuauua
ggggguuaau uuugcguauu 60ggggucauug guguucuugu aguugaaaua caacgauggu
uuuucauauc auuggucgug 120guuguagucc gugcgagaau aaugauguau gcuuuguu
15811123RNAHomo sapiens 111gaugagagaa caguggguac
uuc 23112163RNAHomo sapiens
112auucucagua uuggaucugc acauggagug uuuuucucuc uagugguuac agaggaugaa
60ugcauauuga gauaaagaag ugauuuuggu uccaaaagga uuuuaaggau gaugagagaa
120caguggguac uucauugcca ggucaugucu uugcaagaag aaa
16311323RNAHomo sapiens 113caagguguag cccaugaggu ggc
23114163RNAHomo sapiens 114agcacaagua cacacauaaa
aacauuaggu caagguguag cccaugaggu ggcacgaaau 60gggcuacauu uucuaugucc
agaaaaucuc acaacauccu uuaggaaauc uaagggcuca 120aggaggauuu agcaguaaac
caagagcaga gugcuugguu gaa 16311522RNAHomo sapiens
115agcaccagcc uaggaagagg gu
22116162RNAHomo sapiens 116cucaccucga uuccucccag gccugggucc agcaccagcc
uaggaagagg gugccccaug 60cugucuagcu cuucuucggg auggggggcu ccagguuccu
ugguauuuug cuuuggccuu 120uggagccuca gucaaaacug aggaaaggug ucauuuucac
au 16211723RNAHomo sapiens 117acuuuaacac ugcuguggaa
ggc 23118163RNAHomo sapiens
118gaaaauaaag gcaccugaaa agaaacuacu acuuuaacac ugcuguggaa ggccuuugcu
60uuauaagaaa aauauuauua gcuaugggaa aguaauguuc uuuauguaaa gacuuaaaaa
120uagacuaaua guuuacagag uuauuauaua aaauacgaug uga
16311924RNAHomo sapiens 119auuugacaag aguaugccag gugu
24120164RNAHomo sapiens 120cuaccugaag uuuuaagagu
cuuggaaagu caggagugac uucugcuaaa cacggggcuu 60uccagaguca gagaagcuag
caagccugug guuuggacca gguacuaaau auuugacaag 120aguaugccag guguaaugag
cuacugucua uuccccuuua aagc 16412118RNAHomo sapiens
121cugggagcuu gaaaggag
18122158RNAHomo sapiens 122gcucuuucuc uucccucucg uuuaguuugc cugggagcuu
gaaaggagaa agcacggggu 60cgccccaaac cccuucugcu ucugcccauc acaagugcca
cuaccgccau gggccucacu 120aucuccuccc ucuucucccg acuauuuggc aagaagca
15812323RNAHomo sapiens 123auuugggcag guugaaagaa
uuu 23124163RNAHomo sapiens
124uaguaaaugu aggcaguuuc uuuaggguua aucaucuuuc aaagggccuu aggaaugucc
60uucaaacaga auauaaaugu caaagagaau aucucuuucu guuugaaauu auuugggcag
120guugaaagaa uuugauaaag ggaaauucua uauuuaaucu uuc
16312524RNAHomo sapiens 125gugcuggagg ccaggcugag gccc
24126164RNAHomo sapiens 126gugcccggga gguggacugg
ggccuggguu gugcuggagg ccaggcugag gcccugccuu 60gguuugggga ggagaucccu
gcacuccgga acuccucugu ggcccacgga ggaucgcucu 120gaacugccuc agcguggcgg
ccaguggggg uaggggugga gaga 16412718RNAHomo sapiens
127gcuguuggug gagaaggu
18128158RNAHomo sapiens 128ccugaagagg aagagaugac uguuggaaag cguuccccuc
ccccauacgg cagaacagcu 60gcggcuccca ggggaaagcc cccgcaggac aguccucgug
gggugugacg gcuguuggug 120gagaagguuu ggcgcccuau uuucuuaucu gccuuucu
15812922RNAHomo sapiens 129auggcaguug gagagaaaga
ac 22130162RNAHomo sapiens
130gagaggaaaa guccagaccu aggacuaguu auggcaguug gagagaaaga acaucgggau
60guuugaaaau augccauuga cuaucuuaac uacuguaauu uuaucauuuc caacgucauc
120uaacugggga cuagaacaaa cugugaauuc acuuucagca ac
16213125RNAHomo sapiens 131gcagauaaac ucaugccaga gaacu
25132165RNAHomo sapiens 132ucuuaaaagu uuuauuaaag
gggaggggca aauauuggca auuaguuggc aguggccugu 60uacgguuggg auuggugggg
uggguuuagg uaauuguuua guuuaugauu gcagauaaac 120ucaugccaga gaacuuaaag
ucuuagaaug gaaaaaguaa agaaa 16513317RNAHomo sapiens
133agugccaggu ggggagg
17134157RNAHomo sapiens 134gcccagcacc cucugucucu uuaugcaauc agugccaggu
ggggagggau gcauucuguc 60caaugacaug caggcacuuu agagggcuug cauucauucc
caaguccagc ggcacacuuu 120auacauccuu ggcuggucau ugaggggaac accggag
15713518RNAHomo sapiens 135gacucuuagc gguggauc
18136158RNAHomo sapiens
136cacgcuugug gugaaaucag gaauuuuuag gacucuuagc gguggaucaa aaagaaaaaa
60gaaaacagga cagaguaaaa ucuugcucca aagcuugugu ucuggcaaau accgucugug
120ucucgaaugu gaaguuguuu ccacuccuca gagcccac
15813721RNAHomo sapiens 137cuguugcggg acccggggug u
21138161RNAHomo sapiens 138uggauuucgc ccccgcuccc
ucccggaaac uccuccuggu gccugcgacc guucucacug 60agcaugugca gacggcggug
cgcaugcucu guugcggucc gcuucgguuu cuguugcggg 120acccggggug ucuccuagcg
caaccggaac uagccuucug g 16113921RNAHomo sapiens
139uuaaagcugc cauuuguuac u
21140161RNAHomo sapiens 140cacuguagca uaagcaaggg cuuaguuccu gaacugaguu
acagcuuuau uuuucuuuug 60auucagcaug uuuuuaauga uccauaaguu aaaagcugcu
gguguuuuua uuaaagcugc 120cauuuguuac uaaccaggcu cugugugacu ccuaagugga a
16114122RNAHomo sapiens 141gagcagaggc gauaguugaa
gu 22142162RNAHomo sapiens
142agccacaccc cagcagugug caagggauca gacacaaggu ugaauccauc acaaaagcag
60aaucaccaug gcaacugcau ccuuugauuc uugagugugc ccagcaaccu gagcagaggc
120gauaguugaa gugaaccaag uucuccugag aaauggaggg ga
16214324RNAHomo sapiens 143gaugacaugg gcuuuggucu uuuu
24144164RNAHomo sapiens 144gcaaagaaag aagaaucuga
ggagucugau gaugacaugg gcuuuggucu uuuugacuaa 60accucuuuua uaauguguuc
aauaaaaagc ugaacuuuaa aaaaaagauu gggguuuauc 120auguaauugu uucauuuugu
uguauucugu guuaagauuu cuaa 16414518RNAHomo sapiens
145agaaagggcc uuguguuu
18146158RNAHomo sapiens 146aggaagggga aacucaauca gcaggacuuc agaaagggcc
uuguguuuau agcuuuguca 60aguaaauuug gacgcagcug gagcacaggc ccuguuuguu
ugcacauaau aaucuuguuu 120aucacuuuaa aaaauucagu aauaucucag cagucagg
15814726RNAHomo sapiens 147acucggcgug gcgucggucg
ugguag 26148164RNAHomo sapiens
148acucccugac agauaucucc cucuuccauu ucaucaagac ccagcugagu cacugucacu
60gccuaccaau cucgaccgga ccucgaccgg cucgucugug uugccaaucg acucggcgug
120gcgucggucg ugguagauag gcggucaugc auacgaauuu ucag
16414920RNAHomo sapiens 149guguuuagug aguauuuguu
20150160RNAHomo sapiens 150agggacaaug ccauauuuau
ccuucuagcc cugacaccuc acacaaugca gagaacggaa 60gggaguucaa uaacugguag
caaagugcca acuccuugag aauagggccu guguuuagug 120aguauuuguu aagagaauga
auaaaugaug uacaguugua 16015120RNAHomo sapiens
151acugcugcug cugcuuggcc
20152160RNAHomo sapiens 152ccccgcucac cuccucuauc cccacagugu acugcugcug
cugcuuggcc aacguuucac 60ugccuggcau cgggggcacc auuccugagu ccaaaccuuu
cuucuacgug aacguggcug 120acaucgagag ccuggaggua gagguguccu auguggccug
16015325RNAHomo sapiens 153ugcagagugg gguuuugcag
uccuu 25154165RNAHomo sapiens
154aauuaaagug gcugauuugc guucaguuga ugcagagugg gguuuugcag uccuuagcug
60uugcagaaau uaaguauugc aacuuacuga gggcuuugaa ggcucuuggu cuguauuuaa
120ccuaaauuuc uauaagauua uuaguauaaa aggggagaua gguag
16515521RNAHomo sapiens 155augaccacca aacccaggag c
21156161RNAHomo sapiens 156uuuuauaacc auagagugga
gacagucagu augaccacca aacccaggag ccauauauua 60aaauacugau aaauuuaacu
auauaaaaaa auuuuugccg ggugcggugg cucacaccug 120ugauucuagc agaaaaucag
aucaggagau cacagaaggu c 16115720RNAHomo sapiens
157cagagucugu agaagaggcg
20158160RNAHomo sapiens 158guccucccac uggccgcacu cugugcccca uggcccuccu
gcgccccgcc cggcguccuc 60ucacggccuc ugucugugcu gagcuugggu aacucuuguu
cuuaccucca cagagucugu 120agaagaggcg acaccagggc uuccaaauga acaaccgaaa
16015919RNAHomo sapiens 159ccuugacuuc ugccagagu
19160159RNAHomo sapiens
160agcccagaac cccucucacc ccagaaccuu ccuugacuuc ugccagaguu gagcagccgg
60cccucuggua ggcgcaugug aguggaugug ggcacaugug gcccacugga ucugguggau
120guggucgcgu cuggcccccu ggaucuggug ggugugggc
15916124RNAHomo sapiens 161aucacugacu gaucaaguag aggu
24162164RNAHomo sapiens 162ucauuucugc cacagucuuu
uuuguugaag caaguuagca agcacuaagc acaucuacaa 60ucaaggagag gggcaggcuu
uaccuuuuga aggaagaagu augaaagugu aucacugacu 120gaucaaguag agguaagcag
uggaggacac ucagaauacc uuuu 16416322RNAHomo sapiens
163aaggauugga caggguuaga uu
22164162RNAHomo sapiens 164augguuacuu auaugggaag gguggguaac aaggauugga
caggguuaga uuagaccccu 60cugaagguac cuuguuuuau aguuguaacu uuuuuuuuuu
uugagaugga gucuugcucu 120gucacccagg cuggagugca guggugcgau cucagcucac
ug 16216519RNAHomo sapiens 165aggccaaggc ugcgggguu
19166159RNAHomo sapiens
166gggcagccgu ggggcgugga agccgcgcag aggccaaggc ugcgggguuc uucgucgucu
60acaggcuuuc gcggcucagu guggaaaacc cgccguuucc ucgcgcccca cguccgaccc
120aggccuccug ggcacccuuc ggggaggccg cgaucucgg
15916721RNAHomo sapiens 167aacgggaggc gcuagccaug g
21168161RNAHomo sapiens 168accgcaacuc ccuuuccccc
acuuucccca aacgggaggc gcuagccaug gaacauggca 60cauccagggc uaccuccucc
caaguuaccc agaggucaug uguacaagca gcaauucuaa 120caacaguccc ucaggcguga
gcggcauuuu acaguuugca a 16116922RNAHomo sapiens
169accuuucagu gcaguuucuu uu
22170162RNAHomo sapiens 170aaccagaacg ugguuugccu gaggcuguaa cugagagaaa
gauucugggg cuguguuaug 60aaaauauaga cauucucaca uaagcccagu ucaucaccau
uuccuccuuu accuuucagu 120gcaguuucuu uucacauuag gcuguugguu caaacuuuug
gg 16217120RNAHomo sapiens 171auuuugggug gaagaggcau
20172160RNAHomo sapiens
172guguguguau auauguauac auauauguau guguaugugu auauagagag agagcugaga
60guuauucuau uuauuccuuu ucucuccuaa ucugaaaaug gguguucugu auuuugggug
120gaagaggcau agaaggggau guguguuguc ucuuaagauu
16017318RNAHomo sapiens 173ggaaugagga gcuuugac
18174158RNAHomo sapiens 174agacagaaau caggacuaag
uccucugcuu caguuucauu guuaacgggc cuuauucuga 60ucucaccugu cgcguagcuc
uaauauucac auaaacugaa auaaagaagu ggaaugagga 120gcuuugacau ucaaauuaug
ugauguaauu uaucuucc 15817520RNAHomo sapiens
175aaaagcuggg uugagaggau
20176160RNAHomo sapiens 176uauguguaag auagaaugaa uauugagcag gaugcuuuaa
aagugaccaa gcagauuuga 60aaaacauuaa aaauguuggc cuucucgucc caguucuucc
caaaguugag aaaagcuggg 120uugagaggau gaaaagaaaa aaaaagaaaa auuuagugga
16017722RNAHomo sapiens 177aguaagguca gcuaaauaag
cu 22178162RNAHomo sapiens
178cuccgugcua ccuaucacac cacguccuaa aguaagguca gcuaaauaag cugucaggcc
60cauaccccaa aaauguuggu uacauccuuc cuguacuaau uaaccuauua gcucagcuua
120ucaucuacuu uacuauuucu acagguaccc uuaucacaau gc
16217917RNAHomo sapiens 179gaauugacgg aagggac
17180157RNAHomo sapiens 180cuucaggagu uggugguguu
gacugggagu gaauugacgg aagggaccau gggaauuuau 60auaucauuuu gaaacuuaug
aaaccuuuug ucaaaguuuc acuuucugac ucaggcucag 120uccaggacau uguucaauuc
cccuggugua ggcauca 15718118RNAHomo sapiens
181uugugucuug ugucuuuu
18182158RNAHomo sapiens 182ggaaguuugg gauaguaaag uuuguugccu uugugucuug
ugucuuuuuu ccuuuucuuc 60cuuucuuggg ggagauagau agauagacag acagacagac
agacagacac agagagagag 120agagagagag agagacagau aguguucaug gauccugu
15818316RNAHomo sapiens 183ucccuggugg ucuagu
16184156RNAHomo sapiens
184guaaaaugaa aucacagugg uaugggccuc augggguuau cgaaagaaug ggcugagguc
60augugggcca ugggcuuggu acagugccug agacauaaug aauacucagu ucccuggugg
120ucuagugguu agaaaaauaa uaauaauaau aauaau
15618525RNAHomo sapiens 185ugaggcugua acugagagaa agauu
25186165RNAHomo sapiens 186cagaacccac caaccagaac
gugguuugcc ugaggcugua acugagagaa agauucuggg 60gcuguguuau gaaaauauag
acauucucac auaagcccag uucaucacca uuuccuccuu 120uaccuuucag ugcaguuucu
uuucacauua ggcuguuggu ucaaa 16518723RNAHomo sapiens
187uuagggcccu ggcuccaucu ccu
23188163RNAHomo sapiens 188ugaaaucaac gaaucaccua ccuaacuggg uuagggcccu
ggcuccaucu ccuuuaggaa 60aaccuucugu ggggaguggg gcuucgaccc uaacccaggu
gggcuguaac acugcugugu 120uuucuaaggg gcagaguuuu cuacuacuuu uccgcuggcc
cag 16318924RNAHomo sapiens 189gagugugagu ggacgcguga
gugu 24190164RNAHomo sapiens
190guggcgucgc gugugaggcg cgugcagggu gagugugagu ggacgcguga gugugugagu
60gugcgcgcuu ggagcguguu aggcgagugc gugcgcccac cccugcgccc cuccucccgc
120uuacacuuug aucuuauuug aucggaucgu gaccccagcc ccgc
16419122RNAHomo sapiens 191auugagucug gcagucccug uu
22192162RNAHomo sapiens 192gggcuagugu guuuguguuu
ccauucuaag auugagucug gcagucccug uuuuuuugca 60uugggguaac ugcucuuuga
uuuuuuuuaa uugcaguauu ugugugauug caauaauaaa 120guuugguuug guuuuuacag
ucaugcgcag ggacgauccu ug 16219321RNAHomo sapiens
193aaaauguuua gacgggcuca c
21194161RNAHomo sapiens 194uguagcuuac cuccucaaag caauacacug aaaauguuua
gacgggcuca caucacccca 60uaaacaaaua gguuuggucc uagccuuucu auuagcucuu
aguaagauua cacaugcaag 120cauccccguu ccagugaguu cacccucuaa aucaccacga u
16119520RNAHomo sapiens 195gaauguuuau ggcaccugac
20196160RNAHomo sapiens
196gugguauuug ugauuugguu aaucuguaua aaaauuguaa guagaaaggu uuauauuuca
60ucuuaauucu uuugauguug uaaacguacu uuuuaaaaga uggauuauuu gaauguuuau
120ggcaccugac uuguaaaaaa aaaaaacuac aaaaaaaucc
16019721RNAHomo sapiens 197ggaaauuuga gaccagcaag u
21198161RNAHomo sapiens 198ugauauuacu caccauugau
accucuguuu ggaaauuuga gaccagcaag ugacuaucgc 60uguugccuua ggccacagag
acuuuaucaa aaacgugauu acagggacau aucagguggg 120cuguguuguc cugauuauug
cugcuggugu uggcaacuuu g 16119922RNAHomo sapiens
199acaguagggc cuuuggagug au
22200162RNAHomo sapiens 200gaaggauggu uauucccgcc uggagauccc acaguagggc
cuuuggagug auagacaucc 60ccaucucccu ccacacccug cccuaccgcc ccccaacccc
caaagcuuca acaaaggcuc 120cuuuuuaaag uuuuccggug cccuuugcuc uuuguuugcc
uu 16220125RNAHomo sapiens 201cuugaagucu ggugaugcug
ccauu 25202165RNAHomo sapiens
202ugguaagaaa cuggaagaug gcccuaaauu cuugaagucu ggugaugcug ccauuguuga
60uacgguuccu ggcaagcccu uguguguuga gagcuucuca gacuauccac cugugggucg
120cuuugcuguu caugaucuga gacagacagu ugucgugggu gucau
16520315RNAHomo sapiens 203agaugagcug aaggg
15204155RNAHomo sapiens 204ccuaaaauuc ucaauuaggc
uauaaaugca agaugagcug aagggaaaua ggugauuucc 60auucuguagu guguauauau
gagguuuuau ucucaugaca agaaacagac uaugcaaauc 120ucuuuaauuu cuggcauuuc
agcuuucuag aauua 15520518RNAHomo sapiens
205aaaaagggag ccaagaag
18206158RNAHomo sapiens 206ggcaagaaca aguaccuuac gaaagacagc aaaaagggag
ccaagaagug gcugauccau 60uuucuuuuuu ucuuuuuucu uuuuuuugag acagucuugc
ucuauccccc uggcuggaau 120acaauggugu gaucucagcu cacugcaacc uccgccuc
15820722RNAHomo sapiens 207aguuuugugu guuggcugcu
cc 22208162RNAHomo sapiens
208cacuacggcc ucuggccaug caccaguugu aguuuugugu guuggcugcu ccacuguugu
60cugccagccc acaggaggga aagugaggcu ccuggaagga cgcuccuuca gauggaagca
120gcacuggaag agccccaagu ugaggugcau gggacacaaa cu
16220918RNAHomo sapiens 209gguuuaguga gcagaguu
18210158RNAHomo sapiens 210gaaugaauga uuuuauagau
ugacuauagu gguuuaguga gcagaguuac aauuaugagc 60auuaauuccc agaccaguuc
cccuaacuca ccuugugcuc aaauaugaaa aaggauacca 120cagaaaaugu caguuacucu
cagauuaagu aaaaaugg 15821125RNAHomo sapiens
211aagacgagaa gacccuaugg agcuu
25212165RNAHomo sapiens 212acuuguuccc uaaauaggga cuuguacgaa uugcuacacg
aggguucagc ugucucuuac 60uuuuaaucag ugaaauugac cuaucuguga agagguggau
auaaaaaaau aagacgagaa 120gacccuaugg agcuuuaauu cauuaauaca aauaaaaacu
caaac 16521322RNAHomo sapiens 213agcagggugc aggcuuggag
uc 22214162RNAHomo sapiens
214uggacacaga agaaacgagg gagcccgggu cuccuccgag ugugcaacaa gcuggccugg
60ggccccccga aaggacgcug gagagaagcc caggaucacc cagucuuugc agcagggugc
120aggcuuggag uccccccaag ggcggcuaga aucaggucca gg
16221520RNAHomo sapiens 215auguuggguu guuacagagu
20216160RNAHomo sapiens 216ugugucuuuu aaacuggaaa
aucuucuagc auguuggguu guuacagagu auauuuuugu 60cugcagcugu uuguugcccc
auuccuaaga ggaguuuauc cauccugacu uguagcugug 120ugacuucuug cagugccccc
accccauccc cccgggagag 16021720RNAHomo sapiens
217acugaguuga cuguucccuu
20218160RNAHomo sapiens 218cagaagugac uuuacuuucu caaguuugau acugaguuga
cuguucccuu aucccucacc 60cuuccccuuc ccuuuccuaa ggcaauagug cacaacuuag
guuauuuuug cuuccgaauu 120ugaaugaaaa acuuaaugcc auggauuuuu uucuuuugca
16021922RNAHomo sapiens 219acugggcagu gacaagcacg
au 22220162RNAHomo sapiens
220ucacucgcca guaaccuguc ugcaugcaag acugggcagu gacaagcacg augugcucac
60ugcccaagau uuugcuuuga uuuuguuuua cugcccaaga ucugaacauu uuuugcaaac
120auagcagcuu cucuaccucu gcugcauuga cauauguuug aa
16222124RNAHomo sapiens 221agaaagcgug aguguccaga gccu
24222164RNAHomo sapiens 222agaagaaaac aaguuaauuu
gaagagaguc agaaagcgug aguguccaga gccuacugag 60cccuggaagu cacggauaaa
aacaagaagu gaagucaaca cucucgguga gaaagggagc 120gguacugaca aacuucuacc
aucccagugu gcccgguugc uccc 16422321RNAHomo sapiens
223gcuugagggc aguuggugcg g
21224160RNAHomo sapiens 224cccucccggc gcgguugggu ggcgccucag cgggugggca
gcauggggcg gggagggugu 60ccccuccgcg ccguuaaaau gaaacucuag uggcuggagu
ccgggcagag cuugagggca 120guuggugcgg ucggguuggu ucuuacaccc cggcgggagc
16022525RNAHomo sapiens 225ccgagccugg ugauagcugg
uuguc 25226162RNAHomo sapiens
226gauucaugag uagcagugac aaaccuaccg agccugguga uagcugguug uccaagauag
60aaucuuagac aacucccuau accagauccu cuaauuaauu uuaauaaagg ccuucuauuu
120auacuagcca caucaagccu agccgucuac guacccacag aa
16222725RNAHomo sapiens 227uggagauggc uggcagaaug guucu
25228165RNAHomo sapiens 228gccuguugag aaagaccucu
ggggcccugu uggagauggc uggcagaaug guucucuuga 60ugagcuucau gauaaagcag
acuugccaau aauaccaaga gagaagacug gcucuacucu 120ccaaaggagu ccagggacag
agagucagac agaugacauc agaag 16522920RNAHomo sapiens
229aaguagaagc cucagggaag
20230160RNAHomo sapiens 230ccaggagagg aaaaggaaau gggaccucag aaguagaagc
cucagggaag gaguaaagua 60gaaaucagaa gaaaagaagc uucacuugau aguaauaagg
uuuuuaacuu caaguaccuu 120cagaaaaugu gauuuugaua agaggaaagg gcaaauuuag
16023120RNAHomo sapiens 231augguucugg acaguggauu
20232160RNAHomo sapiens
232agaaauaaua augcaggguu ucuucaaaau augguucugg acaguggauu auaguuaccu
60ggagagcuug uguuaaaaua ucugaggaug auuccaagua ccagggcuua uacacaggaa
120uacuugagaa ccacugcacu caagcauuua aaauuuuccu
16023318RNAHomo sapiens 233gaugagucag gcuaggcu
18234158RNAHomo sapiens 234uccuagggcu uugacaccaa
aaucuacuau gaugagucag gcuaggcuau aaacuugcaa 60ggacuuagag cccagaaagu
gacaagccca acuagccugc cucuuggagg aaaaaagaag 120aauagcucaa aacacuuaag
aagguaagga guccaagc 15823522RNAHomo sapiens
235augugagagc agcagaggcg gu
22236162RNAHomo sapiens 236gggagggugg acaguccuua acugcucugc agguccagga
uguuagaaag gggcagggac 60aacaaauggg ugaccccaac cucaaccugc ugcuucucuc
uccagucccc augugagagc 120agcagaggcg gucuucaaca uccugccagc cccacacagc
ua 16223721RNAHomo sapiens 237guuuuaagga cuuaagggua
u 21238161RNAHomo sapiens
238uaggucuguu auuuucacau acacuuggua acucagacug gucugaauau aaaguagaaa
60uagcuaagaa ccauuuguaa ugaaugcaac ucuuauuugu uuuuaauggu guuuuaagga
120cuuaagggua uuagaacuga caacaguuua uucaguuaag c
16123920RNAHomo sapiens 239ugauauguuu gauauugggu
20240160RNAHomo sapiens 240acccccaaag cucuccugcc
ugcuucugug ugauauguuu gauauugggu uguuuaauua 60ggaaccaacu aaaugucaaa
cauauucuua cagcagcagg ugauucagca ccacccucuu 120ucauacuuca aucucugggg
cuccugucuc uuuuacugaa 16024121RNAHomo sapiens
241agaaagccag gagcugugau u
21242161RNAHomo sapiens 242auccguuuug gaaccugcgu cuggggcucc agucgcugcu
cuugcuggcg uccaucgccg 60ccucggacgg ccgugcauuu ucucgucuca cgcaguucga
ggaggacccu agaaagccag 120gagcugugau ugacaguagc uguagguuac cagacggcaa c
16124321RNAHomo sapiens 243auucuaaguc agucagucau c
21244161RNAHomo sapiens
244uacauuuuag ggugguagag cuacuccuua cuuuaaaugc uaccuacuca cugugacacu
60guuuaauaaa ugguuauuga cuagagaagu agggaucucu gucaccuagc auucuaaguc
120agucagucau caguuuuugu agguuaucuc agaagcaaua g
16124523RNAHomo sapiens 245uucucuguuu uggccaugug ugu
23246163RNAHomo sapiens 246uucuucuuca gcaaacauua
ggagaguauc uucucuguuu uggccaugug uguacucaca 60gccccucaca cauggccgaa
acagagaagu uacuuuccua auauuugccu ccuuggagug 120ucucaagucc uggaagcaag
agauaauaag caauuaauau aca 16324723RNAHomo sapiens
247uucuaagcca guuucugucu gau
23248163RNAHomo sapiens 248cccgacagau cgacuauguu gaucuaacuu uucuaagcca
guuucugucu gauaugccag 60cuugagcagc uccuuugucc cagcuccccu gggcaucuag
cugaugggag cucauuuuuc 120uguuuuuuca uuucagguuu auuguuggcc aaaaccaggc
uuu 16324920RNAHomo sapiens 249gguuuugaca ugucacuguu
20250160RNAHomo sapiens
250gggucaugga ccagcgccuc agugcauuag ucauucgcuu uuccuuacag acaaaucaga
60uaacucuucc ccagugauug ucaaauguau gaauguaucu cuguaaaugu gguuuugaca
120ugucacuguu acugaaggag aguauggaau ccccacagga
16025122RNAHomo sapiens 251cucgcccgug gucucucguc uu
22252162RNAHomo sapiens 252ggugaggccc cgcgcgugug
ucccggcugc ggucggccgc gcucgagggg uccccguggc 60guccccuucc ccgccggccg
ccuuucucgc gccuuccccg ucgccccggc cucgcccgug 120gucucucguc uucucccggc
ccgcucuucc gaaccggguc gg 16225325RNAHomo sapiens
253aacacgcaua cgguuaaggc auugc
25254165RNAHomo sapiens 254acaaggaugg aagaggcccu cgggccugac aacacgcaua
cgguuaaggc auugccaccu 60acuucguggc aucuaaccau cguuuuuuuu uuuuuggugu
uuuguuuuuu auuuuucuuc 120agacggaguc uuauucuguc gcccagacug gagugcaaug
gcgcg 16525525RNAHomo sapiens 255ugaaacagca ucugaucuug
aacuu 25256165RNAHomo sapiens
256acaugcaggg ugaaauccuc acuauuuuua ugaaacagca ucugaucuug aacuuuuaug
60acucaccuca gucacuucac cuguauuuug gcccugucag aucaugucuu uauuuaaacu
120uuugauauuu uauucuuuau auguuuuugc auuaguuuuu auuuu
16525725RNAHomo sapiens 257gcguaaagag uguuuuagau caccc
25258165RNAHomo sapiens 258cacacgauua acccaaguca
auagaagccg gcguaaagag uguuuuagau cacccccucc 60ccaauaaagc uaaaacucac
cugaguugua aaaaacucca guugacacaa aauagacuac 120gaaaguggcu uuaacauauc
ugaacacaca auagcuaaga cccaa 16525924RNAHomo sapiens
259guccguuucc ugucagagug aucc
24260164RNAHomo sapiens 260cagagcaacu ggcuccuggc agcugugcuu guccguuucc
ugucagagug aucccagguu 60uccuccuggc ccgucccaug gucccuccac aggaguguga
gaggaugggg gaagcacugu 120gggaagacca ccaaagaugg cuggacagug ggagagagca
cguu 16426124RNAHomo sapiens 261ccaucgguga ucccagugac
aagu 24262164RNAHomo sapiens
262aucaaacacu uauccuauua aacacagcau ccaucgguga ucccagugac aaguaauuga
60auguuaguuc uggagucuuu ccugggguga uggccuggag aagccucucu uuuaaggauu
120agauucagag guagagguaa augaguguug agcaccagga agag
16426323RNAHomo sapiens 263gaaauguuga guguuuaccc ugu
23264163RNAHomo sapiens 264guuggcuuuu ccagggccag
cgugaguggu gaggccagcu cucucaguga ccaucagaga 60caaggccuug gccaguccag
gggucuuggg gcuccacuuu ucugaauuau gaaauguuga 120guguuuaccc ugucaauaua
uauaucauuu auauauuuuu ugu 16326521RNAHomo sapiens
265gaagaaacag cucaugaggc u
21266161RNAHomo sapiens 266gaaagagaaa gccaagaucc acuaccggaa gaagaaacag
cucaugaggc uacggaaaca 60ggccgagaag aacguggaga agaaaauuga caaauacaca
gagguccuca agacccacgg 120acuccugguc ugagcccaau aaagacuguu aauuccucaa a
16126723RNAHomo sapiens 267augaaccacc aguccaagaa
ucu 23268163RNAHomo sapiens
268gaagcccaag uuugaauugg gaaggcucau ggagcuucau ggugaaggca guaguucugg
60aaaagccacu ggggaugaga caggugcuaa aguuggacga gcugauggau augaaccacc
120aguccaagaa ucuguuuaaa guucagacuu caaauagugg caa
16326917RNAHomo sapiens 269ggaagguugg ggggugu
17270157RNAHomo sapiens 270cucucagcuc ugcagcuguc
ugcggugggg ggaagguugg ggggugucug gaggcauguu 60ccccucacca ccccccgugg
gucucaggga ggccgggugu gaccucaucu uucucauggu 120gcuauccugg ugcuauuggg
guggggagcu cccuccc 15727118RNAHomo sapiens
271uucuagguug uggcauuu
18272158RNAHomo sapiens 272auccuuuagc acguuuggau aaaguuggcc uucuagguug
uggcauuuca acugguuaug 60guccugcugu gaacacugcc aagcuggagc cuggcucugu
uugugccauc uuuggccugg 120gaggauuugg aucggggguu accaugggcu guaaagug
15827324RNAHomo sapiens 273ugauauguuu gauauugggu
uguu 24274164RNAHomo sapiens
274acccccaaag cucuccugcc ugcuucugug ugauauguuu gauauugggu uguuuaauua
60ggaaccaacu aaaugucaaa cauauucuua cagcagcagg ugauucagca ccacccucuu
120ucauacuuca aucucugggg cuccugucuc uuuuacugaa ccuc
16427522RNAHomo sapiens 275agaauacagc agaauuggcc uc
22276162RNAHomo sapiens 276cauuaauuag guaauauuuu
ccucauuucu uuacugcugc cauuuuccuc accaguauuc 60cagagauggu cauagcucau
uacucuacca ccaagaaccu aaaaggaauu agaauacagc 120agaauuggcc ucagugaaga
gcuuaaaauu guucuccucg ua 16227721RNAHomo sapiens
277cugauggaga gaagaaggca u
21278161RNAHomo sapiens 278ugguguggcc aaggccaaca cugagucgac cugauggaga
gaagaaggca uguguccacu 60ggcuccugau gaccaugcuu uggauguugc caacaaaauu
gggaucaucu aaucugaguc 120cagcuugcua auucuaaagg uauauaugua ucuuuucacc a
16127922RNAHomo sapiens 279acucggcgug gcgucggucg
ug 22280162RNAHomo sapiens
280acucccugac agauaucucc cucuuccauu ucaucaagac ccagcugagu cacugucacu
60gccuaccaau cucgaccgga ccucgaccgg cucgucugug uugccaaucg acucggcgug
120gcgucggucg ugguagauag gcggucaugc auacgaauuu uc
16228122RNAHomo sapiens 281augagguggc aagaaauggg cu
22282162RNAHomo sapiens 282auauaaaaac auuaggucaa
gguacagccu augagguggc aagaaauggg cuacauuuuc 60uauauccggc aaaucucaca
acaaccuuua ugaaaucuaa gggcucaagg aggauuuagu 120aguaaaccaa gcgcagagug
cuugguugaa uaaggccaug aa 16228325RNAHomo sapiens
283aauuuugaca gaugcucaag gcugu
25284165RNAHomo sapiens 284uuucauuuuc ugugauuauu uuuaaauuag cuucugugua
aacucacuaa cuuguuccca 60caugacaauu uauagcaguc caaagauuuu uuuauagcca
ugguuguuau aauuuugaca 120gaugcucaag gcuguuguuu gcauuguucu ucagaauuuc
aucuu 16528518RNAHomo sapiens 285aaaagcuggg uugagaag
18286158RNAHomo sapiens
286cauuacacuc cagccugggc aacaagagca aaacucuguc ucaaaaaaau gaaaagaaaa
60gaaaauaccu ccauggggcc uucucuuccc aguucuuccu ggagucgggg aaaagcuggg
120uugagaaggu gaaaagaaaa aacaaaccuu gacugggc
15828723RNAHomo sapiens 287auugaugguu aagcucagcu uuu
23288163RNAHomo sapiens 288ggaguagcug uaacauuaug
uggaaagcaa gugggagaau caugaaaaaa aauaauccca 60uagauggaga agaauagaaa
gaaggaaagg agcauugccu aguguugguu auugaugguu 120aagcucagcu uuuauuuauu
caauaggccu gcagauguag acu 16328924RNAHomo sapiens
289auggauugag augugaucaa aggc
24290164RNAHomo sapiens 290uguaggauuu uuuguuuuug uagcuaacuu auggauugag
augugaucaa aggcuuuauu 60aaauuuguac uucagcauau gauggcugcg uucugcauuu
cauuccgcca uaugccugga 120ccguucacac uuggguaucu gggcuuaggg agcauguagg
cuuc 16429123RNAHomo sapiens 291auuuggcauu uggaagauag
guu 23292163RNAHomo sapiens
292ucuagcucug uuauaaagaa aacauuuagg aaauucucuc uuucucucuu ucaccuaucc
60uacuuuuugu guguccuuug uaguuuugca ccaucauucc uaacgaauuu auuuggcauu
120uggaagauag guuagcaaaa auuuuacuau auuugaaagg cua
16329323RNAHomo sapiens 293acugcugagg aacugucacu ugu
23294163RNAHomo sapiens 294ggucaccagg cugagaaagc
aggagaugcu acugcugagg aacugucacu ugucauuuca 60agguccacuc cuccacccuc
uggcagcaug agucgcucug aaagauuuug aagcugggac 120aggagagggu gagugaggug
aggccuccgc augccagguu uuc 16329524RNAHomo sapiens
295aggugagggg caggaccuga aggu
24296164RNAHomo sapiens 296auucaucucu gguuuucuug ccacccucug ggagucccca
ucccauuuuc auccugagcc 60caaccaggcc cugccauugg ccucuugucc cuuggcacac
uuguacccac aggugagggg 120caggaccuga agguauuggc cuguucaaca aucagucauc
augg 16429720RNAHomo sapiens 297agugucugug ugugcuugcu
20298160RNAHomo sapiens
298acuaauaagc uacaaaacau uuaaaugacu agugucugug ugugcuugcu aguauuauua
60uaccaucaga aaguaaaaau ggacauacau guuaugcauu aaacccacaa gagagaaaac
120uugaggacug auuaauuuaa guaguaaaug aauccaagaa
16029920RNAHomo sapiens 299acgaagaugg cgaccguaac
20300160RNAHomo sapiens 300acuguuuaua agucgguguu
guaaaucuga ugugaauuuu uguuucuuuu uucuuagauu 60uuugccuuua ugacgacagc
uuguuauggu ugcaguuugg gucuggcuuu acgaagaugg 120cgaccguaac acuccuuaga
aacuggcagu cguauguuag 16030123RNAHomo sapiens
301aacuggaaug gcggcaaggu ccu
23302163RNAHomo sapiens 302aguaggcaac ugaggacuga uuucucaggg ugauuagaaa
ggaaagggug gcggccuccu 60uucauacuuc ggaaagucuu guucccauca gccuuuccuc
auggugccau aacuggaaug 120gcggcaaggu ccucuuuccu gugccugugu cuuaaguuuc
ugg 16330321RNAHomo sapiens 303aguugaguca gggccugugu
g 21304161RNAHomo sapiens
304gcgcccccaa aguguccccu ccugcuguga cuucuagcca agaagacauu ucucccaugg
60ccaagugauc ucugauagau ccuguaggac cacugaaguc agacaggaca aguugaguca
120gggccugugu guccagugcg cagcaugcuu ggggagugac a
16130519RNAHomo sapiens 305gccgcccggg gccauggcg
19306159RNAHomo sapiens 306uaacgcaugc gcggggaggg
cggagcuggg cguugccgug gcuacuggga acgcauuuca 60cgggggcggg gcgugguucc
ggggcggggc gcggccgccg gaagugcgug gccgcccggg 120gccauggcga cacucagcuu
cgucuuccug cugcugggg 15930724RNAHomo sapiens
307aagucuaagu cuaacauucg gugu
24308164RNAHomo sapiens 308ucgaugggug uucuuuuaaa auacgguucu aagucuaagu
cuaacauucg guguaucuaa 60ccgaauguua auugauggag acaaggugau acggguucag
aaaauagaau ucagaaaaga 120aaaggaagaa uuggcaaaau ucagaaauca auuuuaagaa
aaau 16430916RNAHomo sapiens 309cggcgggagc ccgggg
16310156RNAHomo sapiens
310cccacggauu cgccccgccg cgccucuccg cgcguagauu ggccggagcg aggcgaacgg
60gcccggccuu gguagccgcc gaccgagcgc uggcuguccu ggaaccuagg cggcgggagc
120ccggggcgcc ucgcggcacg gaagagcggc gagaug
15631121RNAHomo sapiens 311acguggaugg cguggaggug c
21312161RNAHomo sapiens 312ccuguucccc ccaaaaccca
aggacacucu caugaucucc cggaccccug aggucacgug 60cgugguggug gacgugagcc
aggaagaccc cgagguccag uucaacuggu acguggaugg 120cguggaggug cauaaugcca
agacaaagcc gcgggaggag c 16131318RNAHomo sapiens
313guuuagacgg gcucacau
18314158RNAHomo sapiens 314uuuuacauaa guagacacag gugggaaacu guuuagacgg
gcucacauca ccccauaaac 60aaauagguuu gguccuagcc uuucuauuag cucuuaguaa
gauuacacau gcaagcaucc 120ccauuccagu gaguucaccc ucuaaaucac cacgauga
15831521RNAHomo sapiens 315auuucugcag ucaggugaga c
21316161RNAHomo sapiens
316uggaaaucac agcaacccau ugaaaacugc ccuccccacc agaacgugcu acguucuuuc
60uucaugccua ugugugcucc auuccucauu ucuacuuggc ucaagaaaac auuucugcag
120ucaggugaga cuuuuacaaa agaggagaaa aucaaugccu c
16131722RNAHomo sapiens 317aagaaugacc gcugaagaac gu
22318162RNAHomo sapiens 318cugaucauag uauucuguca
gauaaugccu aagaaugacc gcugaagaac guugacccau 60uugaguaccc ggucucaguc
gucauuuuua aguccaguga gcauuguggu aguuguucuu 120agauugcagu uucuuauguu
uugaguuuga aguugauuuu ca 16231920RNAHomo sapiens
319aaauaugagc cacugggugu
20320160RNAHomo sapiens 320aaagucuuag aauggaaaaa guaaagaaau aucaacuucc
aaguuggcaa guaacuccca 60augauuuagu uuuuuucccc ccaguuugaa uugggaagcu
gggggaaguu aaauaugagc 120cacugggugu accagugcau uaauuugggc aaggaaagug
16032123RNAHomo sapiens 321aagguccucu gaggcagcag
gcu 23322163RNAHomo sapiens
322gaagaucacu acaacaauuu gucugccucc aagguccucu gaggcagcag gcucuggggc
60uucugcuguc cuuuggaggg ugucuucugg guagagggau gggaaggaag ggacccuuac
120ccccggcucu ucuccugacc ugccaauaaa aauuuauggu cca
16332321RNAHomo sapiens 323gucgaggucu uugguggguu g
21324161RNAHomo sapiens 324caccccgugc cuuuugaucu
agcacagacc cuucaccccu caccucgaug cagccaguag 60cuuggauccu ugugggcaug
auccauaauc gguuucaagg uaacgauggu gucgaggucu 120uugguggguu gaacuauguu
agaaaaggcc auuaauuugc c 16132521RNAHomo sapiens
325gguuucgggu uugaaggcag c
21326161RNAHomo sapiens 326cccucuggca ugguucauua gggccaauua auguggcugg
guuauuugca acuuaaacug 60ggggauaaug ucgcuugagg gagcguuuuc guuuuaggaa
auauuguuuu gguuucgggu 120uugaaggcag cugucaaaaa agcggcaugg aaauucauug g
16132722RNAHomo sapiens 327gcuggugagu gcaggcugcu
uc 22328162RNAHomo sapiens
328gagcuaguac cuucuccccu uagcaacuuc cucauucuaa aaugggggug gcagaaccau
60uguuuggcuc caguuguccu cagaaaggug gcuuccagau gccagugacu gcuggugagu
120gcaggcugcu ucaguauuuc cuggccagcu gacaaggugu ua
16232920RNAHomo sapiens 329gacagaggug gcaucaagcu
20330160RNAHomo sapiens 330aaucccuguu ugcuucaggg
cgagaugugu gacagaggug gcaucaagcu cuuacagucc 60caacccucca acggaaaugg
gcgaagaucu caggaauggc aucggucaca ggaaaucgau 120aguggcuggc ugcuagcaug
gccacuuggg gcuuaggcag 16033123RNAHomo sapiens
331cugcccuggc ccgagggacc gac
23332163RNAHomo sapiens 332ggaaccugcu uggacaaguc uucuggcucg accucgacau
gcuccaucgg augaauuguu 60gguguuagcc cugcggcccc acgcaccagg guaagagaga
cucucgcuuc cugcccuggc 120ccgagggacc gacuggcugg gccugccuuc ugcccagcuc
acc 16333320RNAHomo sapiens 333ucgugucgcg uggggggcgg
20334160RNAHomo sapiens
334ucgcgggucu guggcgcggg gccccggugg ucgugucgcg uggggggcgg gugguugggg
60cguccgguuc gccgcgcccc gccccggccc caccgguccc ggccgccgcc cccgcgcccg
120cucgcucccu cccguccgcc cguccgcggc ccguccgucc
16033525RNAHomo sapiens 335gggaugccag gcaagugagc agguc
25336165RNAHomo sapiens 336ggucaacaag gugagucugg
augaggggca gggaugccag gcaagugagc aggucuggga 60gucaggccuu gcucaggccc
uguucuucuc ccuugcagcu ucugucuggc cccaaagaga 120ccccugcugc ccagagcccc
accagaggcc ccucugacac caaga 16533725RNAHomo sapiens
337agggccguca ggacacggga ggguu
25338165RNAHomo sapiens 338cuguguugug uccugacacc uccaaguucu agggccguca
ggacacggga ggguuugggg 60acagaguguc cuuccucugu ccucucaucc caguccugau
ggccgcuugg ugagugucug 120gugcccuggu ggccugcccc agcucucuuc uggcuuucug
agcag 16533921RNAHomo sapiens 339gaaaagcugg guugagaggg
u 21340160RNAHomo sapiens
340uuacaauggu ucuaugagga cguggcccca caguaaguug aggagcacug gguauguaug
60aauaaaaugg caugacaggc cuucucuuuc caguucuucc cagaauuggg aaaagcuggg
120uugagagggu aagaaaagaa aaacaaauaa auuuuuuaaa
16034117RNAHomo sapiens 341aacuagcuag ggguucg
17342157RNAHomo sapiens 342gcgagacucu uuuuuucucc
aggaccugcg gagcagccag gcuucaugag uuaaaugcag 60aucugaacca uacccaguug
ggauuggggu acacacucua cuccucugaa aacuagcuag 120ggguucgaac uuggugagag
ggagaguggg acagagc 15734323RNAHomo sapiens
343ggguuugggg gaugucagag ggc
23344163RNAHomo sapiens 344aaguucugag aguccaggag gcagaggcug ggguuugggg
gaugucagag ggcaaaucug 60gggcuugggg ggcccaggaa gcagagauga agguuuuaga
gucuccagag aacaaaucug 120guacuuuuaa ggcccaggaa gcggaggcug gggucuuggg
aaa 16334522RNAHomo sapiens 345ugaagggaga ugugaagaag
cc 22346162RNAHomo sapiens
346aauuugaaaa uccauauaaa gguacgucca cauuuauguu auuaugagug agucauauug
60gugaagucag gacaauggcc ugucauuaga ucuuugauuc uuguuugcag ugaagggaga
120ugugaagaag ccauguucuc ugaacgugcu gcuuggagga cu
16234720RNAHomo sapiens 347agaaagucca aguguucagg
20348160RNAHomo sapiens 348ucucuaauua gcuuucccag
uauacuucuu agaaagucca aguguucagg acuuuuauac 60cuguuauacu uuggcuuggu
uuccaugauu cuuacuuuau uagccuaguu uaucaccaau 120aauacuugac ggaaggcuca
guaauuaguu augaauaugg 16034918RNAHomo sapiens
349ugaacgggua uuuuacug
18350158RNAHomo sapiens 350uuuuuuuuuu aacaccuaua uaucacccau ugaacgggua
uuuuacugaa cacaguacag 60uagacuguuu aaaacucaca uccugguaac uuucacuacu
ugaaauuaca aagugcuuuu 120guuaauugca uauuuuugcu cagccaucuu agaauugu
15835121RNAHomo sapiens 351cugagacaug cacuucuggu u
21352161RNAHomo sapiens
352aagcuggccc uggcuggaga uggcuagccc cugagacaug cacuucuggu uuugaaauga
60cucugucugu ggggcagcag aaacuagaga aggcaagugg cugccccacc ccaaggcgug
120accaggagga acagccugca gcucacucca ugccacacgg g
16135321RNAHomo sapiens 353aauugaggau gugugagguu u
21354161RNAHomo sapiens 354uugguggugu guauaagaau
guuucuugcu aauugaggau gugugagguu uaaggcugug 60agcugaucuu ugaaaaauag
uuuccuguuu cuaaagugac auuacccagu auuugcuuac 120ugcuuugugc cuuaucuccc
gcuuucuuuu uaguauuucu g 16135524RNAHomo sapiens
355aguuucuaug aguguauacc auuu
24356164RNAHomo sapiens 356ucauucugag gucacauaac acauaaaauu aguuucuaug
aguguauacc auuuaaagaa 60uuuuuuuuuc aguaaaaggg aauauuacaa uguuggagga
gagauaaguu auagggagcu 120ggauuucaaa acguggucca agauucaaaa auccuauuga
uagu 16435725RNAHomo sapiens 357agguggagau caagcccgag
augau 25358165RNAHomo sapiens
358ugggcgucua caacggcaag accuucaacc agguggagau caagcccgag augaucgacc
60acuaccuggg cgaguucucc aucaccuaca agcccauaaa gcacggcggg cccggcaucg
120gggccagcca cuccucccgc uucaucccuc ucaagcagug gcuca
16535921RNAHomo sapiens 359gaagacagca auaaccacag u
21360161RNAHomo sapiens 360guagcccaca uggauagcac
aguugucaga caagauuccu ucagauuccg aguugccuac 60cgguuguuuu cguuguuguu
guuguuguuu uucuuuuucu uuuuuuuuuu gaagacagca 120auaaccacag uacauauuac
uguaguucuc uauaguuuua c 16136124RNAHomo sapiens
361guuucuguug aguguggguu uagu
24362164RNAHomo sapiens 362aguccgugcg agaauaauga uguaugcuuu guuucuguug
aguguggguu uaguaauggg 60guuugugggg uuuucuucua agccuucucc uauuuauggg
gguuuaguac ugauuguuag 120cggugugguc ggguguguua uuauucugaa uuuuggggga
gguu 16436321RNAHomo sapiens 363aucgccgugg agugggagag
c 21364161RNAHomo sapiens
364ugccugguca aaggcuucua ccccagcgac aucgccgugg agugggagag cagcgggcag
60ccggagaaca acuacaacac cacgccuccc augcuggacu ccgacggcuc cuucuuccuc
120uacagcaagc ucaccgugga caagagcagg uggcagcagg g
16136523RNAHomo sapiens 365ggaugaagug cacugaggcu cuu
23366163RNAHomo sapiens 366guaagauggu uaucgauagu
aguuaaugau ggaugaagug cacugaggcu cuuaaaagau 60acuuaggauu uuugacuuua
cucuguaggu ucuaaaguaa acauauauga gguuuuuaau 120uucucagaua cuauaccugc
agcucuuuuu gcugacucaa gau 16336727RNAHomo sapiens
367uccuguuggc cgaguggaga cuggugu
27368165RNAHomo sapiens 368ucuacaaaau uggugguauu gguacuguuc cuguuggccg
aguggagacu gguguucuca 60aaccuggugu gguggucacc uuugcuccag ucaacauuac
aacagaagua aaaucugucg 120aaaugcacca ugaagcuuug agugaagcuc uuccugggga
caaug 16536924RNAHomo sapiens 369guggagucug ucaucgaggu
gcgu 24370164RNAHomo sapiens
370gucacucagg acagacuucu ugaaguaggu ggcccuucaa cugagcugaa gggaagagaa
60gggcauugca ggcugaggga ugaucccagg gugcccccca gaucuaaagu guggagucug
120ucaucgaggu gcguagccuc uccagaggug ucacuguguu ccau
16437124RNAHomo sapiens 371uugcagcugc cugggaguga cuuc
24372164RNAHomo sapiens 372cugcaaacag ccuuuccacu
gacgcagugc cuugggggcu cugccaagcg accccuagaa 60uggggauugu ggggggucgc
ucuaggcacc gcagcacugu gcuggggaug uugcagcugc 120cugggaguga cuucacacag
uccucucugc cuccaggguc accc 16437322RNAHomo sapiens
373ugcagccagc gucccaugcu cg
22374162RNAHomo sapiens 374guggauauga gugaagacgg ggcaggcagg ccacaucucu
uagaagagga aggugauugc 60cacgucuccu uccuccaugc ugauggcaag gcgugcgggc
uguguucucu ugcagccagc 120gucccaugcu cgguggcccc agaaaaguca guguguaggc
cu 16237517RNAHomo sapiens 375aguuuugugu guuggcu
17376157RNAHomo sapiens
376aggaaacaca agaagaaacg ccuggugcag agccccaauu ccuacuucau ggaugugaaa
60ugcccaagau gcuauaaaau caccacgguc uuuagccaug cacaaacggu aguuuugugu
120guuggcugcu ccacuguccu cugccagccu auaggag
15737722RNAHomo sapiens 377acggccaagc agaaaauguu uu
22378162RNAHomo sapiens 378cauagauaug uauucagcuu
gucuucaaau acggccaagc agaaaauguu uuauauuuua 60uaaaucaucu uuugacucug
uauuuaaauu cuaugauacu gaaaauaaag gcauucugga 120aaaauacuga cugauuuugg
ugcagaaguu uugaguauca ag 16237924RNAHomo sapiens
379gauuagggug cuuagcuguu aacu
24380164RNAHomo sapiens 380ggcggcggga gaaguagauu gaagccaguu gauuagggug
cuuagcuguu aacuaagugu 60uuguggguuu aagucccauu ggucuaguaa gggcuuagcu
uaauuaaagu ggcugauuug 120cguucaguug augcagagug ggguuuugca guccuuagcu
guug 16438121RNAHomo sapiens 381ccuucgaggc ggcugagacc
c 21382161RNAHomo sapiens
382cguucuccgc acuccugcuc cgcgagggcc ccuucgaggc ggcugagacc cgagugccgg
60acucccgccg cuggagcggg gcucggguuc ggcagccgga aggaggugug cccccggggc
120gcuugggggc gccugagguc ccgaggggag gcaagauggg a
16138323RNAHomo sapiens 383aggugguggc agcuggaggg acc
23384163RNAHomo sapiens 384agccugugac cccucgggac
ugccuggugc aggugguggc agcuggaggg acccaugcag 60cacccagguc agagcagacc
cuccccugcc ggccugcgcc agcuggaccu gauggccccc 120uguggcgccu ugaccugcug
ggccaggcug cccugggacu cuc 16338523RNAHomo sapiens
385agaagaagga cggcaagaag cgc
23386163RNAHomo sapiens 386ggccccgcau ccgcguucgu cuaggcgcuc uugucaccuc
gccaugccgg agccaucgcg 60ggcggcuccg gcuucuaaaa agggcuccaa gaaggccauu
accaaggcgc agaagaagga 120cggcaagaag cgcaagcgcg gccgcaagga gagcuauucu
auc 16338723RNAHomo sapiens 387aaaagcaaau guugggugaa
cgg 23388163RNAHomo sapiens
388gaaacaucuu aaugcacagc cacaaguuac aaugcaacag ccugcugcuc auguacaagg
60ucaggaaccu uugacugcuu ccauguuggu aucugcccau gcucaagagc aaaagcaaau
120guugggugaa cggcuguuuc cucuuauuca agccaugcac cuu
16338919RNAHomo sapiens 389ggcggagggg ccgcgggcc
19390159RNAHomo sapiens 390cagaguggga ccggcagcuc
ccagacuuga ggcggagggg ccgcgggccg gagcucccug 60cagccgcuag ccugggaaga
cuggagugcg cugcccaccg agggucugcg ccgcgccggc 120cgccccgggc cgcuuugugc
gcgcccgcgc ggucuguac 15939119RNAHomo sapiens
391uugcagcugc cugggagug
19392159RNAHomo sapiens 392cugcaaacag ccuuuccacu gacgcagugc cuugggggcu
cugccaagcg accccuagaa 60uggggauugu ggggggucgc ucuaggcacc gcagcacugu
gcuggggaug uugcagcugc 120cugggaguga cuucacacag uccucucugc cuccagggu
15939324RNAHomo sapiens 393ucucuccagg ugacagaaag
ggcu 24394164RNAHomo sapiens
394acauaaaauc uuaucuaugu gcagcaugac ucucuccagg ugacagaaag ggcucuagac
60agcugagagg accugaucau guagggaggg acggggaggg gagccaggac ccaggagcug
120cauggcugua agaggaaggu ccuuggaggg uaucagcagu cuca
16439521RNAHomo sapiens 395cguucuugcu cugccucggu c
21396161RNAHomo sapiens 396gggcagaagu cugagccagu
guuucaucau cguucuugcu cugccucggu cuguacaucu 60gugaaauggg acucccucuc
uguuguggag gcccugggga cagcugggag gacuggaggg 120guggugggga gguugugguc
cuuauuagac auucagauac c 16139722RNAHomo sapiens
397augccaagag ggccaguguc uu
22398162RNAHomo sapiens 398aaacaauaaa aaacuggcug cuaucgaagc ccuaaaugau
ggugaacucc agaaagccau 60ugacuuauuc acagaugcca ucaagcugaa uccucacuug
gcccuuuugu augccaagag 120ggccaguguc uucgucaaau uacagaagcc aaauacugcc
au 16239922RNAHomo sapiens 399uuuugugugu guguuuguuu
uu 22400162RNAHomo sapiens
400cugguuauau caggauaaau ucauaaaggg uuuugugugu guguuuguuu uuguuguugu
60uguuuagggu uuuuuuuuuu uaaacagggu cuugcuuugu ugcccaggau gaaaugcaau
120cacacacaau cauggcucau ugcaucacua ucuauguauu ca
16240125RNAHomo sapiens 401augaggaaca cugacuuuau uaagc
25402165RNAHomo sapiens 402ucaguuaagc caauacauuu
aaaguuuugc augaggaaca cugacuuuau uaagcauuuu 60cagauguggu gguuguauuu
uugccccaag aaguguuugg auaaccacac aaaagcauga 120ugaaaaggcu ucuuguaguc
ccauaauuuc uugugaacua auguu 16540324RNAHomo sapiens
403gggucggagu uagcucaagc gguu
24404164RNAHomo sapiens 404uuuagaaguu ucagucgcac acuccuaccc gggucggagu
uagcucaagc gguuaccucc 60ucaugccgga cuuucuaucu guccaucucu gugcuggggu
ucgagacccg cgggugcuua 120cugacccuuu uaugcaauaa auucgguaua aucugucacu
cuga 16440519RNAHomo sapiens 405ggagguucag aguuggaag
19406159RNAHomo sapiens
406aguugcgaca agacagaguu ggagaauaga ggagguucag aguuggaaga aaugggagua
60ggugauggca acaccgaguu gucagaguga gcugaggcaa cauccucuac uucuagcuca
120cugaugaaaa uauccaggau agcgggucug ggguccagu
15940723RNAHomo sapiens 407gagagucuca ggaaagaaag guc
23408163RNAHomo sapiens 408auaaugagua aaaauguuca
ucuuuaauaa agcaaaaaua gagcaaccca ccaaauaguu 60aacacuugcc uggagagauu
uaggaacacc aguauuccac ugagauugcu gagagucuca 120ggaaagaaag gucuaacuua
aauuguauuu uaccauuucu gag 16340943DNAartificialPCR
primer 409gcctccctcg cgccatcagc tnnnngacct tggctgtcac tca
4341061DNAartificialPCR primer 410gccttgccag cccgctcaga cgagacatcg
ccccgctttt tttttttttt tttttttttt 60t
6141121RNAHomo sapiens 411acccgucccg
uucguccccg g 2141296RNAHomo
sapiens 412ccggccgcug ggcgcacccg ucccguucgu ccccggacgu ugcucucuac
cccgggaacg 60ucgagacugg agcgcccgaa cugagccacc uucgcg
9641319RNAHomo sapiens 413accgggugcu guaggcuuu
1941494RNAHomo sapiens 414ucucggaagc
uaagcagggu cgggccuggu uaguacuugg acgggagacc gccugggaau 60accgggugcu
guaggcuuuu ucuuuggcuu uuug 9441594RNAHomo
sapiens 415ucuuggaagc uaagcagggu cgggccuggu uaguacuugg augggagacc
accugggaau 60accgggugcu guaggcuuug gccgggcgug gugg
9441629RNAHomo sapiens 416acgcggguga ugcgaacugg agucugagc
29417104RNAHomo sapiens 417ggcguagggg
ggccggccug cugugaugac auuccaauua aagcacgugu uagacugcug 60acgcggguga
ugcgaacugg agucugagcc ugcccgagcg gagc 10441820RNAHomo
sapiens 418acucggcgug gcgucggucg
2041995RNAHomo sapiens 419cacugucacu gccuaccaau cucgaccgga
ccucgaccgg cucgucugug uugccaaucg 60acucggcgug gcgucggucg ugguagauag
gcggu 9542021RNAHomo sapiens 420acucggcgug
gcgucggucg u 2142124RNAHomo
sapiens 421acucggcgug gcgucggucg uggu
2442221RNAHomo sapiens 422agagcagugu guguugccug g
2142396RNAHomo sapiens 423ugcugcaggu
guuggagagc aguguguguu gccuggggac uguguggacu gguaucaccc 60agacagcuug
cacugacucc agacccugcc gucaug 9642422RNAHomo
sapiens 424agaguugagu cuggacgucc cg
2242597RNAHomo sapiens 425cgccccgggc cgcggcuccu gauuguccaa
acgcaauucu cgagucuaug gcuccggccg 60agaguugagu cuggacgucc cgagccgccg
cccccaa 9742619RNAHomo sapiens 426aggacggugg
ccauggaag 1942794RNAHomo
sapiens 427aguaccaaga aguuaucauu uccauaugac ugucauugcu uaaaacuagc
uaguaugagc 60aggacggugg ccauggaagu cgaaauucgc uaag
9442820RNAHomo sapiens 428aggacggugg ccauggaagu
2042921RNAHomo sapiens 429aguuggugga
gugauuuguc u 2143022RNAHomo
sapiens 430aguuggugga gugauuuguc ug
2243123RNAHomo sapiens 431aguuggugga gugauuuguc ugg
2343224RNAHomo sapiens 432aguuggugga
gugauuuguc uggu 2443396RNAHomo
sapiens 433gggauugaca gauugacagc ucuuucucga uucugugggu gguggugcau
ggccauucuu 60aguuggugga gugauuuguc ugguuaauuc ugauaa
9643419RNAHomo sapiens 434agaacgcggu cugaguggu
1943594RNAHomo sapiens 435ugcaacugcc
gucagccauu gaugaucguu cuucucuccg uauuggggag ugagagggag 60agaacgcggu
cugagugguu uuuccuucuu gaug 9443619RNAHomo
sapiens 436augaggaugg auagcaagg
1943794RNAHomo sapiens 437auacguguaa uugugaugag gauggauagc
aaggaagccg cucccaccug acccucacgg 60ccuccguguu accuguccuc uaggugggac
gcuc 9443820RNAHomo sapiens 438cggagcuggg
gauugugggu 2043995RNAHomo
sapiens 439gggugugaga agccggaucc uguggugacc caguggccua auggauaagg
caucagccuc 60cggagcuggg gauugugggu ucgaguccca ucugg
9544022RNAHomo sapiens 440cggcggcucc agggaccugg cg
2244197RNAHomo sapiens 441ccgggagcgg
ggaggcggcg gcuccaggga ccuggcggcc gccgaucggg gcugcgaggc 60cccauggcgc
cgcccccagc cccgcuccug gcgccga 9744220RNAHomo
sapiens 442cggcggggac ggcgauuggu
2044395RNAHomo sapiens 443gggccgggaa ugccgcggcg gggacggcga
uugguccgua uguguggugc caccggccgc 60cggcuccgcc ccggcccccg ccccacacgc
cgcau 9544429RNAHomo sapiens 444cggggaucgc
cgagggccgg ucggccgcc
29445104RNAHomo sapiens 445uggugggggg agccgcgggg aucgccgagg gccggucggc
cgccccgggu gccgcgcggu 60gccgccggcg gcggugaggc cccgcgcgug ugucccggcu
gcgg 104446104RNAHomo sapiens 446ggggaggaga
cgguuccggg ggaccggccg cgacugcggc ggcgguggug gggggagccg 60cggggaucgc
cgagggccgg ucggccgccc cgggugccgc gcgg 10444723RNAHomo
sapiens 447cucggcgugg cgucggucgu ggu
2344898RNAHomo sapiens 448acugucacug ccuaccaauc ucgaccggac
cucgaccggc ucgucugugu ugccaaucga 60cucggcgugg cgucggucgu gguagauagg
cggucaug 9844919RNAHomo sapiens 449cugcccagug
cucugaaug 1945094RNAHomo
sapiens 450aaugcagugu gauuucugcc cagugcucug aaugucaaag ugaagaaauu
cagagaagcc 60uggguagccg ggcguggugg cucacaccug uaau
9445127RNAHomo sapiens 451cugcccagug cucugaaugu caaagug
2745224RNAHomo sapiens 452cugcccuggc
ccgagggacc gacu 2445399RNAHomo
sapiens 453augaauuguu gguguuagcc cugcggcccc acgcaccagg guaagagaga
cucucgcuuc 60cugcccuggc ccgagggacc gacuggcugg gccugccuu
9945418RNAHomo sapiens 454cuggaggagc uggccugu
1845593RNAHomo sapiens 455cuucucccca
gccagaggug gagccaagug guccagcguc acuccagugc ucagcugugg 60cuggaggagc
uggccugugg cacagcccug agu 9345621RNAHomo
sapiens 456cuuggcaccu agcaagcacu c
2145796RNAHomo sapiens 457gcacccagau cagugcuugg caccuagcaa
gcacucagua aauauuuguu gagugccugc 60uaugugccag gcauugugcu gagggcuuug
ugggga 9645821RNAHomo sapiens 458gacuauagaa
cuuucccccu c 2145996RNAHomo
sapiens 459aguugguaga gggcagaggg augaggggga aaguucuaua guccugagau
cuaauuacag 60gacuauagaa cuuucccccu caucccucua cccuua
9646022RNAHomo sapiens 460gagagcagug uguguugccu gg
2246197RNAHomo sapiens 461gugcugcagg
uguuggagag cagugugugu ugccugggga cuguguggac ugguaucacc 60cagacagcuu
gcacugacuc cagacccugc cgucaug 9746217RNAHomo
sapiens 462gaggaaggug gggaugc
1746392RNAHomo sapiens 463gagggcggga gacaaaaucu cgcaauucug
accugccuuu ggacauaauu gaggcuuuau 60gaggaaggug gggaugcggg aguggcgauc
cc 9246430RNAHomo sapiens 464gagugagagg
gagagaacgc ggucugagug
30465105RNAHomo sapiens 465ggcguugcuu ggcugcaacu gccgucagcc auugaugauc
guucuucucu ccguauuggg 60gagugagagg gagagaacgc ggucugagug guuuuuccuu
cuuga 10546621RNAHomo sapiens 466gaugccuggg aguugcgauc
u 2146796RNAHomo sapiens
467ugugagacga auuuuugagc ggguaaaggu cgcccucaag gugacccgcc uacuuugcgg
60gaugccuggg aguugcgauc ugcccgaccu uauuca
9646823RNAHomo sapiens 468gaugccuggg aguugcgauc ugc
2346918RNAHomo sapiens 469gcaugggugg uucagugg
1847093RNAHomo sapiens
470gugaacggcg gcugguggcg aguuccgcug ugccagcuuc cguuggcguu ugccaucggu
60gcaugggugg uucaguggua gaauucucgc cug
9347119RNAHomo sapiens 471gcaugggugg uucaguggu
1947231RNAHomo sapiens 472gcaugggugg uucaguggua
gaauucucgc c 3147319RNAHomo sapiens
473gcauuggugg uucaguggu
1947494RNAHomo sapiens 474ccaucaccac ugugaaucag agcaacaaaa cagcuggagg
cagaacagca cucagcugga 60gcauuggugg uucaguggua gaauucucgc cugc
9447519RNAHomo sapiens 475gcguuggugg uauaguggu
1947694RNAHomo sapiens
476cgaggaagua gugaccugcc acuggccacc ugcggaacca gaguucccca cuggagggcc
60gcguuggugg uauaguggug agcauagcug ccuu
9447723RNAHomo sapiens 477gcguuggugg uauaguggug agc
2347819RNAHomo sapiens 478gcuguggcug ugacuggcg
1947994RNAHomo sapiens
479ccgacccggg ccugggcugu ggcugugacu ggcgcugccg ugggcgccgc agcccucgcg
60ggagccggac gcgguaaugc cccagcggcg cagc
9448019RNAHomo sapiens 480ggacgguggc cauggaagu
1948194RNAHomo sapiens 481guaccaagaa guuaucauuu
ccauaugacu gucauugcuu aaaacuagcu aguaugagca 60ggacgguggc cauggaaguc
gaaauucgcu aagg 9448219RNAHomo sapiens
482ggggauguag cucaguggu
1948394RNAHomo sapiens 483cugcugagag uaggugggga uguagcucag ugguagagcg
caugcuuugc auguaugagg 60ccccggguuc gauccccggc aucuccagug uagu
9448418RNAHomo sapiens 484gguucccuca gaccuggu
1848593RNAHomo sapiens
485gccgacagcc agcuggaucu ccugucccga gcccugggua cugggggugc cccugaguug
60gguucccuca gaccugguga ucgggcccug gag
9348626RNAHomo sapiens 486ggaaaguuug gcugcgcggg uucccc
26487101RNAHomo sapiens 487cucccucucc ucccccgggg
uucggugcgc ggccggggcc ggaguucgcu gcaagucggc 60ggaaaguuug gcugcgcggg
uucccccgaa guucaggugc g 10148825RNAHomo sapiens
488ggaauaccgg gugcuguagg cuuuu
25489100RNAHomo sapiens 489gucugaucuc agaagcuaag caaggucggg ucuaguuagu
acuuggaugg gagacugccu 60ggaauaccgg gugcuguagg cuuuuggccu aucguucccu
10049023RNAHomo sapiens 490gugaacgggc gccaucccga
ggc 2349198RNAHomo sapiens
491agagagcccc ggggugcaga uccuugggag cccuguuaga cucuggauuu uacacuugga
60gugaacgggc gccaucccga ggcuuugcac aggggcaa
9849224RNAHomo sapiens 492gugaacgggc gccaucccga ggcu
2449325RNAHomo sapiens 493gugaacgggc gccaucccga
ggcuu 2549426RNAHomo sapiens
494gugaacgggc gccaucccga ggcuuu
2649521RNAHomo sapiens 495guugguggag cgauuugucu g
2149696RNAHomo sapiens 496ggauugacag auugauagcu
cuuucucgau uccgugggug guggugcaug gccguucuua 60guugguggag cgauuugucu
gguuaauucc gauaac 9649722RNAHomo sapiens
497guugguggag cgauuugucu gg
2249823RNAHomo sapiens 498guugguggag cgauuugucu ggu
2349920RNAHomo sapiens 499guugguggag ugauuugucu
2050095RNAHomo sapiens
500ggauugacag auugacagcu cuuucucgau ucugugggug guggugcaug gccauucuua
60guugguggag ugauuugucu gguuaauucu gauaa
9550121RNAHomo sapiens 501guugguggag ugauuugucu g
2150218RNAHomo sapiens 502gaacgcgguc ugaguggu
1850393RNAHomo sapiens
503gcaacugccg ucagccauug augaucguuc uucucuccgu auuggggagu gagagggaga
60gaacgcgguc ugagugguuu uuccuucuug aug
9350420RNAHomo sapiens 504uaccgggugc uguaggcuuu
2050595RNAHomo sapiens 505aucuuggaag cuaagcaggg
ucgggccugg uuaguacuug gaugggagac caccugggaa 60uaccgggugc uguaggcuuu
ggccgggcgu ggugg 9550695RNAHomo sapiens
506aucucggaag cuaagcaggg ucgggccugg uuaguacuug gacgggagac cgccugggaa
60uaccgggugc uguaggcuuu uucuuuggcu uuuug
9550720RNAHomo sapiens 507uccuguacug agcugccccg
2050895RNAHomo sapiens 508auccucccug gggcauccug
uacugagcug ccccgaggcc cuucaugcug cccagcucgg 60ggcagcucag uacaggauac
ucgggguggg aguca 9550921RNAHomo sapiens
509ucgaggagcu cacagucuag u
2151096RNAHomo sapiens 510acaucaagug acugugcuug gcuguggggc uaccaagaug
aagaaggaau gcuccugccc 60ucgaggagcu cacagucuag ugggagggaa caaugc
9651120RNAHomo sapiens 511ucggacaccg gcgcgucucu
2051295RNAHomo sapiens
512ggggcucgcg gacccggccc agagggcggc gguggcggca gcuacuuuuc uggucagggc
60ucggacaccg gcgcgucucu caagcucgcc ucuuc
9551319RNAHomo sapiens 513ucugcccagu gcucugaau
1951494RNAHomo sapiens 514uaaugcagug ugauuucugc
ccagugcucu gaaugucaaa gugaagaaau ucagagaagc 60cuggguagcc gggcguggug
gcucacaccu guaa 9451521RNAHomo sapiens
515ucugcaagug ucagaggcga g
2151696RNAHomo sapiens 516guuccuugug uucuuccagu ccgcccucug ucaccuugca
gacggcuuuc ucuccgaaug 60ucugcaagug ucagaggcga ggaguggcag cugcau
9651722RNAHomo sapiens 517ucugcaagug ucagaggcga
gg 2251822RNAHomo sapiens
518ucuucucugu uuuggccaug ug
2251997RNAHomo sapiens 519aacauuagga gaguaucuuc ucuguuuugg ccaugugugu
acucacagcc ccucacacau 60ggccgaaaca gagaaguuac uuuccuaaua uuugccu
9752022RNAHomo sapiens 520ugauauguuu gauauugggu
ug 2252197RNAHomo sapiens
521cugccugcuu cugugugaua uguuugauau uggguuguuu aauuaggaac caacuaaaug
60ucaaacauau ucuuacagca gcaggugauu cagcacc
9752223RNAHomo sapiens 522ugauugucca aacgcaauuc ucg
2352398RNAHomo sapiens 523ccgggccgcg gcuccugauu
guccaaacgc aauucucgag ucuauggcuc cggccgagag 60uugagucugg acgucccgag
ccgccgcccc caaaccuc 9852422RNAHomo sapiens
524ugcuggauca gugguucgag uc
2252597RNAHomo sapiens 525guugugcugu ccaggugcug gaucaguggu ucgagucuga
gccuuuaaaa gccacucuag 60ccacagaugc agugauugga gccaugacaa gucccca
9752620RNAHomo sapiens 526uuagggcccu ggcuccaucu
2052795RNAHomo sapiens
527accuaccuaa cuggguuagg gcccuggcuc caucuccuuu aggaaaaccu ucugugggga
60guggggcuuc gacccuaacc caggugggcu guaac
9552822RNAHomo sapiens 528uucucuguuu uggccaugug ug
2252997RNAHomo sapiens 529cauuaggaga guaucuucuc
uguuuuggcc auguguguac ucacagcccc ucacacaugg 60ccgaaacaga gaaguuacuu
uccuaauauu ugccucc 9753017RNAHomo sapiens
530uucugcccag ugcucug
1753192RNAHomo sapiens 531uaccucccag cuguguucug cccagugcuc ugcugacugg
acgccucugu guccuuagac 60caugugcagg gccugaugca ggaaagagcu ga
9253220RNAHomo sapiens 532uucugcccag ugcucugaau
2053395RNAHomo sapiens
533uuaaugcagu gugauuucug cccagugcuc ugaaugucaa agugaagaaa uucagagaag
60ccuggguagc cgggcguggu ggcucacacc uguaa
9553424RNAHomo sapiens 534uugcagcugc cugggaguga cuuc
2453599RNAHomo sapiens 535accccuagaa uggggauugu
ggggggucgc ucuaggcacc gcagcacugu gcuggggaug 60uugcagcugc cugggaguga
cuucacacag uccucucug 9953621RNAHomo sapiens
536uuggccaugg ggcugcgcgg g
2153796RNAHomo sapiens 537ucguccagcg agggcgcgcu ggcccugggc agcguguggc
ugaaggucac cauguucucc 60uuggccaugg ggcugcgcgg ggccagcagg uccacg
9653820RNAHomo sapiens 538uuggggaaac ggccgcugag
2053995RNAHomo sapiens
539cagcuccgca gggguuuggg gaaacggccg cugagugagg cgucggcugu guuucucacc
60gcggucuuuu ccucccacuc uuggcugguu ggacc
9554021RNAHomo sapiens 540uuggggaaac ggccgcugag u
2154119RNAHomo sapiens 541uugguggagc gauuugucu
1954294RNAHomo sapiens
542gauugacaga uugauagcuc uuucucgauu ccgugggugg uggugcaugg ccguucuuag
60uugguggagc gauuugucug guuaauuccg auaa
9454320RNAHomo sapiens 543uugguggagc gauuugucug
2054420RNAHomo sapiens 544uuuccggcuc gcgugggugu
2054595RNAHomo sapiens
545ccggcggggc gaagcccgcg gcugcuggac ccacccggcc gggaauagug cuccugguug
60uuuccggcuc gcgugggugu gucggcggcg gggcc
9554617RNAHomo sapiens 546aaagcugggu gagaggg
1754792RNAHomo sapiens 547ccugagcaag gucacaaagc
ugggugagag gggcugggau ucacauucaa gcacuguguu 60ccuaggcccc uugaccccug
gcaucugugg gg 9254817RNAHomo sapiens
548aaagcugggu ugagagg
1754918RNAHomo sapiens 549aaagcugggu ugagaggg
1855019RNAHomo sapiens 550aaagcugggu ugagagggc
1955192RNAHomo sapiens
551cugaaauguc uucaaaugua ucaauaagcc uucucuuccc aguucuucuu ggagucagga
60aaagcugggu ugagaggagc agaaaagaaa aa
9255292RNAHomo sapiens 552guauguauga auaaaauggc augacaggcc uucucuuucc
aguucuuccc agaauuggga 60aaagcugggu ugagagggua agaaaagaaa aa
9255392RNAHomo sapiens 553ucuucuaccu aagaauucug
ucucuuaggc uuucucuucc cagauuuccc aaaguuggga 60aaagcugggu ugagagggca
aaaggaaaaa aa 9255492RNAHomo sapiens
554gaaacuagug uuucaaaaau aaauuaaucc cucucuuucu aguucuuccu agagugagga
60aaagcugggu ugagagggca aacaaauuaa cu
9255518RNAHomo sapiens 555aaccuuggag agcugagc
1855693RNAHomo sapiens 556cgcggugggg aagccaaccu
uggagagcug agcgugcgac cggcccggcg cgggggucuc 60cgggagcugg cgagucgcua
gcaccgaguc aca 9355718RNAHomo sapiens
557aagcuggguu gagagggc
1855893RNAHomo sapiens 558cuucuaccua agaauucugu cucuuaggcu uucucuuccc
agauuuccca aaguugggaa 60aagcuggguu gagagggcaa aaggaaaaaa aaa
93
User Contributions:
Comment about this patent or add new information about this topic: