Patent application title: ABSCISIC ACID CARRIER GENE AND TRANSGENIC PLANT EXPRESSING THE SAME
Inventors:
Young-Sook Lee (Gyeongsangbuk-Do, KR)
Mi-Young Lee (Gyeongsangbuk-Do, KR)
Enrico Martionia (Zurich, CH)
Joo-Hyun Kang (Gyeongsangbuk-Do, KR)
Assignees:
POSTECH ACADEMY - INDUSTRY FOUNDATION
IPC8 Class: AC12N1582FI
USPC Class:
800278
Class name: Multicellular living organisms and unmodified parts thereof and related processes method of introducing a polynucleotide molecule into or rearrangement of genetic material within a plant or plant part
Publication date: 2012-02-16
Patent application number: 20120042410
Abstract:
The present invention relates to carrier genes of abscisic acid and the
transgenic plant prepared using such genes, and more specifically to
genes that enhance resistance to salt or dryness in relation to abscisic
acid transport and the recombinant vectors including the genes, the
transgenic plant prepared using the recombinant vector, a transgenic
plant that is superior in terms of resistance to base and dryness, a
method for environmental purification in arid regions based on the
plants, and the development of crops having enhanced yields.Claims:
1. An abscisic acid (ABA) carrier, comprising an AtPDR12 protein having
an amino acid sequence of SEQ ID NO: 2 or a protein having an amino acid
sequence with a homology of at least 60% with SEQ ID NO: 2.
2. The abscisic acid carrier according to claim 1, wherein the protein having an amino acid sequence with a homology of at least 60% with SEQ ID NO: 2 is selected from the group consisting of: AtPDR3 having an amino acid sequence of SEQ ID NO: 4, AtPDR4 having an amino acid sequence of SEQ ID NO: 6, AtPDR6 having an amino acid sequence of SEQ ID NO: 8, AtPDR10 having an amino acid sequence of SEQ ID NO: 10, and AtPDR13 having an amino acid sequence of SEQ ID NO: 12.
3. A composition for the transportation of abscisic acid, comprising the abscisic acid carrier according to claim 1, or a nucleotide sequence encoding the abscisic acid carrier.
4. The composition according to claim 3, wherein the nucleotide sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, and SEQ ID NO: 11.
5. A composition for improving resistance of plants to salinity or drought, comprising the abscisic acid carrier according to claim 1, or a nucleotide sequence encoding the abscisic acid carrier.
6. The composition according to claim 5, wherein the nucleotide sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, and SEQ ID NO: 11.
7. A recombinant vector, comprising: a promoter which can be expressed in plant cells; and a nucleotide sequence, operably linked to the promoter, coding for an AtPDR12 protein having an amino acid sequence of SEQ ID NO: 2 or a protein having an amino acid sequence with a homology of at least 60% with SEQ ID NO: 2.
8. The recombinant vector according to claim 7, wherein the protein having an amino acid sequence with a homology of at least 60% with SEQ ID NO: 2 is selected from the group consisting of AtPDR3 having an amino acid sequence of SEQ ID NO: 4, AtPDR4 having an amino acid sequence of SEQ ID NO: 6, AtPDR6 having an amino acid sequence of SEQ ID NO: 8, AtPDR10 having an amino acid sequence of SEQ ID NO: 10, and AtPDR13 having an amino acid sequence of SEQ ID NO: 12.
9. The recombinant vector according to claim 7, wherein the nucleotide sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, and SEQ ID NO: 11.
10. A transgenic plant, plant cell, or part of a plant that is transformed with the recombinant vector according to any one of claims 7.
11. A method for generating a transgenic plant, comprising: constructing the recombinant vector according to claim 7; and introducing the recombinant vector into a plant cell or a plant tissue.
12. A method for generating a plant improved in ABA transport or resistance to salinity or drought, comprising: constructing a recombinant vector comprising a promoter, which can be expressed in plant cells and a nucleotide sequence, operably linked to the promoter, coding for an AtPDR12 protein having an amino acid sequence of SEQ ID NO: 2 or a protein having an amino acid sequence with an homology of at least 60% with SEQ ID NO: 2.; and introducing the recombinant vector into a plant cell or a plant tissue.
13. (canceled)
14. The method according to claim 12, wherein the protein having an amino acid sequence with a homology of at least 60% with SEQ ID NO: 2 is selected from the group consisting of AtPDR3 having an amino acid sequence of SEQ ID NO: 4, AtPDR4 having an amino acid sequence of SEQ ID NO: 6, AtPDR6 having an amino acid sequence of SEQ ID NO: 8, AtPDR10 having an amino acid sequence of SEQ ID NO: 10, and AtPDR13 having an amino acid sequence of SEQ ID NO: 12.
15. The method according to claim 12, wherein the nucleotide sequence is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, SEQ ID NO: 7, SEQ ID NO: 9, and SEQ ID NO: 11.
16. The method according to claim 12, wherein when the nucleotide sequence is a coding sequence for a protein selected from the group consisting of AtPD12 of SEQ ID NO: 2, AtPDR3 of SEQ ID NO: 4, AtPDR4 of SEQ ID NO: 6, AtPDR10 of SEQ ID NO: 10, or is selected from the group consisting of SEQ ID NO: 1, SEQ ID NO: 3, SEQ ID NO: 5, and SEQ ID NO: 9, the recombinant vector contains a strong promoter or an enhancer to induce overexpression of the nucleotide sequence.
17. The method according to claim 16, wherein the strong promoter or enhancer is selected from the group consisting of a CMV35S promoter, an actin promoter, a ubiquitin promoter, a rubisco promoter, an RD29A promoter, a 35s promoter enhancer, an AtADH 5'-UTR enhancer, and an OsADH 5'-UTR enhancer.
18. The method according to claim 12, wherein when the nucleotide sequence codes for AtPDR6 of SEQ ID NO: 8 or AtPDR13 of SEQ ID NO: 12, or is selected from the group consisting of SEQ ID NO: 7 and SEQ ID NO: 11, the recombinant vector contains siRNA which binds complementary to the nucleotide sequence or an antisense RNA, T-DNA or an endogenous transposon is inserted into the nucleotide sequence, or a modification occurs on the full length or a part of the nucleotide sequence, whereby the expression of nucleotide sequence is induced to lose its function and thus to be down-regulated.
19. The transgenic plant, plant cell, or part of plant according to claim 10, wherein the plant is selected from the group consisting of onion, carrot, cucumber, olive, sweet potato, potato, Chinese cabbage, radish, lettuce, broccoli, tobacco, petunia, sunflower, Brassica napus, leaf-mustard, Arabidopsis thaliana, Brassica campestris, Brassica juncea, nicotiana tabacum, Betula platyphylla, poplar, cross-bred poplar, and Betula schmidtii.
Description:
TECHNICAL FIELD
[0001] The present invention relates to an abscisic acid (ABA) carrier gene and a transgenic plant using the same. More particularly, the present invention relates to a gene which is involved in ABA carrier and which improves resistance to salinity and drought; a recombinant vector carrying the gene; a transgenic plant prepared using the recombinant vector; a transgenic plant modified to be improved in resistance to salinity and/or drought; and a method for environmental remediation in highly salty and/or arid regions and for increasing crop productivity in highly salty and/or arid regions using this transgenic plants.
BACKGROUND ART
[0002] Over the world, water stressed countries have been proliferating, with the concomitant desertification of some arid regions, which has been incurring very severe agricultural and environmental problems. Problems may be found even in regions with sufficient amounts of water because of salts. When agricultural plants are cultivated using water for irrigation, salts which have a negative influence on the growth of crops accumulate in the land because salts contained in the water used for irrigation are left behind upon the evaporation of water. There is thus an urgent need for the development of plants that can grow even in arid regions or under high salt concentrations. Such techniques would make a great contribution to agricultural productivity. Plants that are resistant to both contaminants and drought are ideal for the economical environmental remediation of arid regions. For example, plants which can lower transpirational water loss are advantageous in terms of survival under arid conditions, thus contributing to improvements in agricultural productivity as well as the environmental remediation of arid regions.
[0003] ABA is a ubiquitous plant hormone that is accumulated in response to various stress caused by environment including drought, salinity, cold, heat, and infection by pathogens and is involved in a large number of physiological processes including the impartment of plants with stress resistance. When pretreated with ABA, plants can resist stress better, compared to a control. Mutant plants which cannot synthesize or respond to ABA are vulnerable to environmental stress (Taiz and Zeiger, Plant Physiology, 3rd edition: 543˜555, 591˜621). Therefore, the use of the proteins which are involved directly or indirectly in the synthesis, transportation, and responses involving ABA may lead to the development of plants that are improved in their resistance to stresses such as including drought, salinity, cold, heat and infection by pathogens. For example, a plant which rapidly synthesizes ABA in response to stress might be very effective in improving the yield of a crop. In many cases, various types of stress may coexist in the regions which need environmental remediation, thus, the genes implicated in the synthesis, transportation and responses of ABA which is responsible for the protection of plants from various environmental stress are very useful for the development of plants.
[0004] The genes implicated in resistance to salinity and drought may also be used to rehabilitate the environment. Environmental rehabilitation is to rehabilitate an ecological system which has been naturally or artificially destroyed, thereby constructing a clean environment, preserving natural resources and setting up a base where human beings can live together with other biological species. Typically, rehabilitation may be achieved by removing pollutants, planting resistant plants, and reintroducing extinct or endangered animals. Salt-resistant genes may be used to rehabilitate agriculture and the environment of reclaimed land because these areas are high in salinity.
[0005] Therefore, there is a need for plants resistant to salinity and/or drought.
DISCLOSURE
Technical Problem
[0006] Accordingly, the present invention has been made keeping in mind the above problems occurring in the prior art, and an object of the present invention is to provide a gene which is involved in ABA transport or which allows the resistance to salinity and/or drought of plants to be improved.
[0007] It is another object of the present invention to provide a recombinant vector carrying a gene which is involved in ABA transport or which allows the resistance to salinity and/or drought of plants to be improved.
[0008] It is a further object of the present invention to provide a transgenic plant which is involved in ABA transport or which allows the resistance to salinity and/or drought to be improved.
[0009] It is still a further object of the present invention to provide a method for generating a transgenic plant which is involved in ABA transport or which allows resistance to salinity and/or drought to be improved.
[0010] It is still another object of the present invention to provide a technique for making salty regions and/or arid regions environmentally friendly.
Technical Solution
[0011] Leading to the present invention, the present inventors found that a sequence encoding an ATP-binding cassette (ABC) carriers consisting of two repeats of [six transmembrane domains and one ATP-binding domain] is able to transport ABA whereby resistance to salinity and/or drought can be conferred on the plant expressing the protein.
[0012] Therefore, the present invention is characterized in that a sequence encoding an ABC carriers consisting of two repeats of six transmembrane domains and one ATP-binding domain is expressed, overexpressed or down-regulated in plants, thereby improving the ABA transportation and/or resistance to salinity and/or drought of plants.
[0013] In accordance with an aspect thereof, the present invention provides the use of an ABC carrier consisting of two repeats of six transmembrane domains and one ATP-binding domain and/or a nucleotide sequence encoding the same in improving ABA transportation and/or resistance to salinity and/or drought. In another aspect thereof, the present invention provides a composition for improving ABA transportation and/or resistance to salinity and/or drought, comprising an ABC carrier consisting of two repeats of six transmembrane domains and one ATP-binding domain and/or a nucleotide sequence encoding the same.
[0014] In accordance with a further aspect thereof, the present invention provides a recombinant vector comprising a nucleotide sequence encoding an ABC carrier consisting of two repeats of six transmembrane domains and one ATP-binding domain or a nucleotide sequence sharing a homology therewith; and
[0015] a promoter, which can be expressed in plant cells, operably linked to the nucleotide sequence.
[0016] In accordance with still a further aspect thereof, the present invention provides a transgenic plant which is transformed with the recombinant vector.
[0017] In accordance with still another aspect thereof, the present invention provides a transgenic plant, plant cell, and/or part of a plant, transformed with the recombinant vector.
[0018] In accordance with yet another aspect thereof, the present invention provides a method for generating a plant whose capability of transporting ABA is improved, comprising:
[0019] (a) constructing a recombinant vector in which a nucleotide sequence coding for an ABA carrier consisting of two repeats of six transmembrane domains and one ATP-binding domain, and a nucleotide sequence having a homology therewith is operably linked to a promoter; and
[0020] (b) introducing the recombinant vector into a plant cell or a plant tissue.
[0021] The plant improved in ability to transport ABA enjoys the advantage of being further resistant to drought, salinity, cold, heat and infection by pathogens.
[0022] In accordance with yet a further aspect thereof, the present invention provides a method for generating a salt-and/or drought-resistant plant, comprising:
[0023] (a) constructing a recombinant vector in which a nucleotide sequence coding for an ABA carrier composed of two repeats of six transmembrane domains and one ATP-binding domain, and a nucleotide sequence having a homology therewith is operably linked to a promoter; and
[0024] (b) introducing the recombinant vector into a plant cell or a plant tissue (see Examples 6 and 7 and FIGS. 2 to 5).
[0025] In the above methods for producing the transgenic plant, the recombinant vector-constructing step (a) may be carried out by constructing an expression cassette containing the nucleotide sequence operably linked to the promoter, and inserting the expression cassette into a suitable vector.
[0026] According to an embodiment, the nucleotide sequence encoding an ABC carrier composed of two repeats of six transmembrane domains and one ATP-binding domain, and the nucleotide sequence having a homology therewith may be manipulated to be overexpressed or down-regulated in the expression vector and the transgenic plant.
[0027] As used herein, the term "ABC (ATP-binding cassette) carrier" refers to a protein that utilizes the energy of ATP hydrolysis to perform the transportation of various substrates across membranes such as the uptake of nutrients into cells and the exportation of, for example, toxic materials out of cells.
[0028] The term "homology", as used herein, refers to the similarity between nucleic acid (DNA) sequences or between amino acid sequences.
[0029] The term "RNA interference (RNAi)", as used herein, is intended to refer to the suppression of the expression of a gene of interest by DNA constructs which are homologous to a part of the DNA and are designed to produce short hairpins interfering with the RNAs.
[0030] RNA interference (RNAi) has an important role in defending cells against viruses and results in the cleavage of viral dsRNA. The mechanism is as follows: 1) Dicer cleaves hairpin dsRNA molecules into small-interfering RNA (siRNA) with 21˜23 nucleotide; 2) Dicer aids to integrate the siRNA into the RNA-induced silencing complex (RISC); 3) The siRNA-integrated RISC recognizes antisense mRNA complementary to the siRNA and induces the cleavage of the mRNA. Thus, antisense mRNA complementary to the siRNA is degraded.
[0031] This mechanism is applied in this invention. For example, a DNA construct which is designed on the basis a partial sequence of a target gene, e. g. AtPDR12 (SEQ ID NO: 1) to produce dsRNA, is inserted into a vector (refer to Example 4) which is then transformed into a plant to give an RNAi transgenic plant in which AtPDR12, and its highly homologous sequences AtPDR4 and AtPDR10 are down-regulated.
[0032] The partial sequence of AtPDR12 gene (SEQ ID NO: 1) may be the following sequence:
TABLE-US-00001 (SEQ ID NO: 13) GCAAATCCTTCCATCATATTCATGGATGAACCTACTTCAGGATTGGA TGCACGAGCTGCTGCCATCGTTATGAGGACTGTAAGGAACACAGTTGACA CTGGTAGAACAGTCGTCTGCACCATTCACCAGCCTAGCATCGACATCTTT GAAGCCTTTGATGAGTTGTTCCTACTTAAGCGTGGAGGTGAGGAGATATA CGTTGGACCTCTTGGCCACGAATCAACCCATTTGATCAACTATTTTGAGA GTATTCAAGGAATCAACAAGATCACAGAAGGATACAACCCAGCAACCTGG ATGCTTGA
[0033] In other words, RNAi is a gene silencing process in which siRNA recognizes and binds to a specific sequence of mRNA and the target mRNA is degraded. Also, the siRNA binds to mRNAs which have sequences not only identical, but also similar (in this case, other genes with homology to AtPDR12) to those of the siRNA, and thus induces cleavage of the mRNA.
[0034] As used herein, the term "transgenic plant" is a plant which has foreign DNA sequence therein and whose DNA is modified using genetic engineering techniques in such a manner as to express, overexpress, or down-regulate the foreign DNA sequence.
[0035] As used herein, the term "ABA" refers to a plant hormone that is a weak acid containing 15 carbons and that regulates the growth and development of plants, such as embryo maturation, seed dormancy and germination, lateral root formation, cell division and extension and is involved in the responses to environmental stress factors such as drought, salinity, coldness, infection by pathogens, and UV light (reviewed in Leung and Giraudat, 1998; Rock, 2000).
[0036] The term "ABA carrier", as used herein, refers to a transmembrane protein spanning the lipid-bilayer membrane that is involved directly or indirectly in the uptake and exclusion of the plant hormone ABA.
[0037] The term "salt- and/or drought-resistant protein", as used herein, refers to a protein that mediates a process so as not to inhibit the growth of plants in the presence of a high concentration of salts or in arid regions. The term "salt" means all compounds in which the anion of an acid is combined with the cation of a base, as well as sodium chloride (NaCl), present in culture environments such as soil, water and air. Examples of the salt include:
[0038] Sodium salts: NaNO3, NaCl, Na2S, Na2SO4, Na2CO3, etc.
[0039] Potassium salts: KNO3, KCl, K2S, K2SO4, K2CO3, etc.
[0040] Ammonium salts: NH4NO3, NH4Cl, (NH4)2S, (NH4)2SO4, (NH4)2CO3, etc.
[0041] Magnesium salts: Mg(NO3)2, MgCl2, MgS, MgSO4, MgCO3, etc.
[0042] Barium salts: Ba(NO3)2, BaCl2, BaS, BaSO4, BaCO3, etc.
[0043] Calcium salts: Ca(NO3)2, CaCl2, CaS, CaSO4, CaCO3, etc.
[0044] Others: Pb(NO3)2, PbCl2, PbS, PbSO4, PbCO3, AgNO3, AgCl, Ag2S, Ag2SO4, Ag2CO3, etc.
[0045] Each of the ABA carrier, the composition for the transportation of ABA and the composition for improving plants in resistance to salinity and drought, comprises an ABC carrier consisting of two repeats of six transmembrane domains and one ATP-binding domain or a nucleotide sequence coding for the ABC carrier.
[0046] In a preferred embodiment, the ABC carrier is derived from Arabidopsis thaliana and may be an AtPDR12 protein having an amino acid sequence of SEQ ID NO: 2 and may be a protein whose amino acid sequence shares a homology of at least 60%, e.g., 70%, preferably at least 80%, more preferably 90% to 95%, and most preferably 95% to 99% with that of SEQ ID NO: 2. For example, the homologue of AtPDR12 may be selected from the group consisting of AtPDR3 of SEQ ID NO: 4, AtPDR4 of SEQ ID NO: 6, AtPDR6 of SEQ ID NO: 8, AtPDR10 of SEQ ID NO: 10, and AtPDR13 of SEQ ID NO: 12.
[0047] The nucleotide sequence encoding the ABC carrier may be a sequence coding for the AtPDR12 of SEQ ID NO: 2 or for a protein whose amino acid sequence shares a homology of at least 60%, e.g., 70%, preferably at least 80%, more preferably 90% to 95%, and most preferably 95% to 99% with that of SEQ ID NO: 2. For example, the nucleotide sequence encoding the ABC carrier is a nucleotide sequence of SEQ ID NO: 1 or a nucleotide sequence sharing a homology of at least 60%, e.g., 70%, preferably at least 80%, more preferably 90% to 95%, and most preferably 95% to 99% with that of SEQ ID NO: 1. In one embodiment, the homologous nucleotide sequence may be selected from the group consisting of nucleotide sequences coding for the AtPD3 protein having an amino acid sequence of SEQ ID NO: (e.g. SEQ ID NO: 3), for the AtPD4 protein having an amino acid sequence of SEQ ID NO: 6 (e.g. SEQ ID NO: 5), for the AtPD6 protein having an amino acid sequence of SEQ ID NO: 8 (e.g. SEQ ID NO: 7), for the AtPD10 protein having an amino acid sequence of SEQ ID NO: 10 (e.g. SEQ ID NO: 9), and for the AtPD13 protein having an amino acid sequence of SEQ ID NO: 12 (e.g. SEQ ID NO: 11).
[0048] The homologous sequences are summarized in the following table.
TABLE-US-00002 Homology to AtPDR12 Accession (gene/ AGI No. No. SEQ ID NO: protein) (gene) (protein) (protein/gene) AtPDR3 60%/62% At2g29940 NP_180555 SEQ ID NO: 3/4 AtPDR4 61%/62% At2g26910 NP_180259 SEQ ID NO: 5/6 AtPDR6 62%/66% At2g36380 NP_181179 SEQ ID NO: 7/8 AtPDR10 61%/60% At3g30842 NP_683617 SEQ ID NO: 9/10 AtPDR13 61%/70% At1g15215 NP_680694 SEQ ID NO: 11/12
[0049] In accordance with still yet another aspect thereof, the present invention provides an expression cassette in which an ABC carrier gene or a nucleotide sequence sharing homology therewith is operably linked to a promoter, and a recombinant vector carrying the same.
[0050] In an embodiment, the expression cassette or the recombinant vector may comprises a promoter, a gene encoding the ABC carrier, e.g., a gene encoding AtPDR12, or a homologue thereof, and a transcription terminator. Any promoter which is expressed in a plant may be used. For example, the promoter may be selected from the group consisting of an AtPDR12 promoter, a CMV (Cauliflower Mosaic Virus) 35S promoter, an nos (nopaline synthase) promoter of Agrobacterium tumefaciens Ti plasmid, an ocs (octopine synthase) promoter, an mas (mannopine synthase) promoter, a ubiquitin promoter, an actin promoter, a rubisco promoter, an RD29A promoter, and any other known plant expression promoter. Preferable for overexpression is a CMV 35s promoter, a ubiquitin promoter, an actin promoter or a rubisco promoter. A stress-inducible promoter, (e.g. RD29A promoter), may be also used. However, the present invention is not limited to the examples. So long as it allows overexpression in plant cells, any promoter or enhancer may be used. For example, a 35s promoter enhancer for enhancing transcription, or an AtADH 5' UTR (sequence in the 5'-untranslated region of the Arabidopsis ADH gene) enhancer, or an OsADH 5'-UTR (sequence in the 5'-untranslated region of the rice ADH gene) enhancer for promoting translation may be used. As for the transcription terminator, it may be any of those which are typically used in plant cells. An illustrative, non-limiting example is a nopaline synthase (nos) transcription terminator.
[0051] The expression cassette or recombinant vector of the present invention may further comprise a marker which is indicative of the expression of an AtPDR12 gene or allows the selection of a transgenic plant expressing the gene. Examples of the marker gene useful in the present invention include, but are not limited to, genes resistant to antibiotics such as kanamycin, spectinomycin, basta, hygromycin, gentamicin and bleomycin, or genes coding for GUS (β-glucuronidase), CAT (chloramphenicol acetyltransferase), luciferase and GFP (green fluorescent protein).
[0052] When introduced along with the expression cassette into plants, the marker allows the selection of transgenic plants appearing during the growth in a medium containing a specific antibiotic or showing a blue color (GUS), luminescence (luciferase), as a result of reaction with a substrate or fluorescene.
[0053] The recombinant vector may be constructed by inserting the expression cassette into the backbone of a known vector and comprises a sequence encoding an ABC carrier able to transport ABA. In the recombinant vector, the sequence is operably linked to transcription and translation factors and designed to be expressed in plants, plant tissues or plant cells and optionally overexpressed or down-regulated. In an embodiment, the recombinant vector may be designed to allow the ABC carrier to be expressed, overexpressed or down-regulated.
[0054] Examples of the known vector include pBI121, pHellsgate8, pROKII, pBI76, pET21, pSK(+), pLSAGPT, pUC, and pGEM. In addition, the vector expressed in plants comprising a CMV35s promoter such as pCAMBIA series (pCAMBIA1200, 1201, 1281, 1291, 1300, 1301, 1302, 1303, 1304, 1380, 1381, 2200, 2201, 2300, 2301, 3200, 3201, 3300), pMDC32, and pC-TAPa-pYL436, may be used.
[0055] In an embodiment, the transgenic plant may be designed to allow the ABC carrier to be expressed, overexpressed or down-regulated. For example, the overexpression of the ABC carrier may be achieved by a recombinant vector constructed to use a strong promoter such as a CMV 35S promoter, an actin promoter, a ubiquitin promoter, a rubisco promoter, or an RD29A promoter, or an enhancer such as a 35s promoter enhancer for enhancing transcription, ATADH 5'UTR (a sequence in the 5'-untranslated region of the Arabidopsis thaliana ADH gene) enhancer, or an OsADH 5'-UTR (a sequence in the 5'-untranslated region of the rice ADH gene) enhancer for promoting translation. The suppression of expression may be carried out by RNAi, that is, by adding siRNA or antisense RNA complimentary to a partial or full sequence of the ABC carrier gene, inserting T-DNA or endogenous transposon, or mutating the gene at a transcription level or a translation level through modification or deletion of a partial or full nucleotide or one amino acid sequence of the gene to induce the loss of the function.
[0056] Also, the present invention provides a transgenic plant which is transformed with the recombinant vector. The transgenic plant comprises an ABC carrier-encoding sequence which is designed to be operably linked to and controlled by transcription and translation factors. The transgenic plant is of plants, preferably a plant, a plant cell or a plant tissue. The plant tissue includes a plant seed. The plant may be a herbaceous or woody plant, examples of which include, but are not limited to, flowering plants, garden plants, onion, carrot, cucumber, olive, sweet potato, potato, Chinese cabbage, radish, lettuce, broccoli, tobacco, petunia, sunflower, Brassica napus, leaf-mustard, Arabidopsis thaliana, Brassica campestris, Brassica juncea, Nicotiana tabacum, Betula platyphylla, poplar, cross-bred poplar (e.g., Populus alba X P. tremula var. glandulosa: a natural crossbred Populus alba and P. tremula var. glandulosa), and Betula schmidtii. The plant may be asexually propagated using a method selected from the group consisting of somatic embryogenesis, tissue culture and cell line culture.
[0057] The transgenic plant may be prepared using any well-known technique. A typical, non-limiting example is Agrobacterium tumefaciens-mediated DNA transfer. More preferably, recombinant agrobacterium prepared by electroporation, microparticle injection or gene gun is induced to infect a host plant cell by soaking method.
[0058] As described, the ABC carriers according to the present invention may transport ABA or inhibit the transportation of ABA. The control of their expression may result in an improvement in resistance to salinity and/or drought.
[0059] For example, the overexpression of at least one of the ABC carrier group consisting of AtPDR12 (SEQ ID NO: 2), AtPDR3 (SEQ ID NO: 4), AtPDR4 (SEQ ID NO: 6), AtPDR10 (SEQ ID NO: 10), and homologues thereof with a homology of at least 60%, preferably at least 80%, more preferably at least 90% to 95%, and most preferably at least 95% to 99% may allow the preparation of a transgenic plant which is improved in resistance to stress including salinity and/or drought and in ability to transport ABA. A transgenic plant in which at least one gene selected from the group consisting of an AtPDR12 gene (SEQ ID NO: 1), an AtPDR3 gene (SEQ ID NO: 3), an AtPDR4 gene (SEQ ID NO: 5) and an AtPDR10 gene (SEQ ID NO: 9) is overexpressed exhibits an improvement in resistance to stress including salinity and drought and in ability to transport ABA. The overexpression may be performed as mentioned above.
[0060] A transgenic plant in which neucleotide sequences coding AtPDR6 (SEQ ID NO: 8), AtPDR13 (SEQ ID NO: 12), and homologues thereof with a homology of at least 60%, preferably at least 80%, and more preferable at least 90% to 99% are down-regulated or inactivated closes its stomatal pores rapidly under arid conditions, showing improved drought tolerance. For example, the down-regulation of the AtPDR6 gene (SEQ ID NO: 7) and/or the AtPDR13 gene (SEQ ID NO: 11) may allow the preparation of a transgenic plant which has improved resistance to salinity and drought and improved ability to transport ABA.
[0061] Therefore, the transgenic plant is transformed by a modified form of the target gene or regulated the expression level of the target genes. Target genes mean the genes which regulate stomata movement through the change of ABA transportation activity. The transgenic plant can either readily translocate pollutants such as heavy metals from roots to shoots along with water upon activated transpiration or can have improved drought tolerance.
[0062] Therefore, in accordance with another aspect thereof, the present invention provides a method for environmental remediation in highly salty and/or arid regions, comprising planting the transgenic plant in the soil. In accordance with another aspect thereof, the present invention provides a method for increasing crop productivity in highly salty and/or arid regions, comprising planting the transgenic plant.
DESCRIPTION OF DRAWINGS
[0063] FIG. 1 shows the tissue-specific expression of AtPDR12 in the Arabidopsis thaliana plant transformed with AtPDR12 promoter: uidA as analyzed by GUS labels. The GUS activity driven AtPDR12 promoter is observed in both roots and leaves, particularly strongly in lateral roots and guard cells (A; 2-week-old Arabidopsis seedling, B; mature leaves, C; guard cells, D; flowers, E; anther and pollen, F; an embryo germinated from a seed, G; root tissue, H; silique, I; seeds within siliques, J; an end of a main root, K; developing lateral root, L; lateral root.)
[0064] FIG. 2 shows AtPDR12 contributes to increase of the salt tolerance of the plant. (A) is the expression level of AtPDR12 gene in the AtPDR12-overexpressing Arabidopsis by RT-PCR. (B) to (D) showed the growth extent (B), fresh weight (C) and root length (D) of the AtPDR12-overexpressing Arabidopsis thaliana was cultured in media containing 120, 130 and 140 mM NaCl, respectively.
[0065] FIG. 3 is a graph of germination rates when seeds of the AtPDR12-overexpressing Arabidopsis thaliana transgenic plant were induced to germinate in a medium containing 200 mM NaCl, showing an improved resistance of the plant to salinity.
[0066] FIG. 4 is of photographs of leaves of the AtPDR12-knockout mutant plant(atpdr12) after they were cultured in arid regions, showing the involvement of AtPDR12 in drought tolerance.
[0067] FIG. 5 shows the deletion of AtPDR12 gene induced decrease in sensitivity to ABA in graphs where the inhibition of ABA against light-induced opening of stomata is measured (A), the ABA-induced stomata closure is measured (B), germination rates are measured upon the induction of germination in an ABA-containing medium (C) and the number of lateral roots formed in an ABA-containing medium is counted (D).
[0068] FIG. 6 is a graph in which the time dependent content of radiolabeled ABA taken up into protoplasts isolated from the AtPDR12-knockout mutant plant(atpdr12-1) and the wild-type are incubated in a betain solution containing radiolabeled ABA, showing that AtPDR12 mediates the uptake of ABA into the plant cell.
[0069] FIG. 7 shows the gene expression of the plants down-regulated in the expression of the AtPDR12 gene and its homologues AtPDR4 and AtPDR10 genes (RNAi), in which the homology among the three genes is given (A) (AtPDR4: 61% homology, AtPDR10: 61% homology) and the expression levels of the three genes in the down-regulated plant are measured by RT-PCR.
[0070] FIG. 8 is graphs of the germination rates of AtPDR3/AtPDR4-knockout mutant plant (pdr3-1, pdr3-2, and pdr4), both having a homology of 62% with the AtPDR12 amino acid sequence, upon the induction of germination in an ABA-containing medium, showing that the mutant plant (pdr3-1, pdr3-2 and pdr4) decrease in sensitivity to the ABA.
[0071] FIG. 9 is of graphs of the germination rates of AtPDR6-or AtPDR13-knockout mutant plant(pdr6-1, pdr6-2, and pdr13), both having respective homologies of 65 and 70% with the AtPDR12 nucleotide sequence, upon the induction of germination in an ABA-containing plant, showing that the mutant plants(pdr6-1, pdr6-2, and pdr13) increase in sensitivity to the ABA.
[0072] FIG. 10 is of graphs in which the number of siliques and the weight of seeds are measured in mutant plants when they are cultured for 14 days without being watered after completion of nutritional growth (5 weeks), showing that the AtPDR12-overexpressing transgenic Arabisopsis thaliana is resistant to drought in terms of seed productivity.
[0073] FIG. 11 is of graphs in which stomata of the AtPDR3-knockout mutant plant exhibit hypersensitive movement in response to ABA compared to that of the wild-type (A) whereas stomata of the AtPDR2- or AtPDR4-knockout mutant plant is hyposensitive to ABA, compared to that of the wild-type (B), showing that sensitivity to ABA is changed by the knockout of PDR genes homologous to AtPDR12.
BEST MODE
[0074] In the following, the present invention is described in detail through experiments. The experiments are not intended to limit the technical spirit of the present invention, but are intended to describe the invention
EXAMPLE 1
Plant Culture Conditions
[0075] Seeds of wild type of Arabidopsis thaliana (dry seeds within one year after harvest), and seeds of the transgenic Arabidopsis thaliana species, species prepared in the following Examples 3 and 4, which overexpressed(e.g., AtPDR12), or down-regulated a certain gene, or seeds of knockout mutant Arabidopsis thaliana species (atpdr12-1 (SALK--013945), atpdr12-2 (SALK--005635), purchased from SALK, dry seeds within one year after harvest) were surface sterilized with 70% (v/v) ethanol (Samchun) and 25% (v/v) Chlororox (Yuhan Clorox) and stored at 4° C. for two days in a dark place before sawing on 1/2 MS-agar medium (Murashige and Skoog Duchefa). And then the media culture on a vertically or horizontally for two to three weeks (culture condition (day/night): 22/18° C., 16/8 h, light condition: 40 μmol m-2 s-1).
EXAMPLE 2
Determination of Gene Expression Tissue Using Promoter-GUS Fusion Protein
[0076] PCR was performed on a genomic DNA extracted from wild-type Arabidopsis thaliana, in the presence of a pair of primers containing a HindIII restriction enzyme site (5'-AAGCTTACGCCGGCCGCCGCCGCGGCAG-3', SEQ ID NO: 14) and a BamHI restriction enzyme site (5'-GGATCCTTTGTATCCAAGAAATCAAAGT-3', SEQ ID NO. 15), respectively, to amplify an AtPDR12 promoter which was then inserted into a pBII01.2 vector (Clontech) using the restriction enzymes HindIII (Roche) and BamHI (Roche) to construct a recombinant vector for transformation. This was introduced into Agrobacterium using electroporation. The transformed Agrobacterium thus obtained was transformed into Arabidopsis thaliana using the floral dipping method (Clough and Bent, 1988). The seeds of transgenic Arabidopsis thaliana were selected on a 1/2 MS-agar medium containing 30 μg/L of kanamycin (Duchefa), and the seeds were harvested from the plants that survived. T2 Seeds from the T1 generation Arabidopsis thaliana were used for GUS analysis.
[0077] The transgenic Arabidopsis thaliana grown for two weeks on the 1/2 MS-agar medium was incubated for 24 hours in 100 mM phosphate buffer containing 0.5 mM K4Fe(CN)6 (Sigma), 0.5 mM K3Fe(CN)6 (Sigma), 10 mM EDTA (USB), 0.1% (v/v) Triton X-100 (Sigma) and 500 mg/mL X-Gluc. (Duchefa), followed by removal of chlorophyll with 100% (v/v) ethanol. The plant was observed using an optical microscope and the images are shown in FIG. 1. As shown in FIG. 1, the AtPDR12 promoter-GUS was observed to be expressed throughout the plant, such as in the leaves, flowers, lateral roots, seeds, and guard cells.
EXAMPLE 3
Generation of Transgenic Arabidopsis Thaliana
[0078] cDNA was synthesized from total RNA extracted from wild-type Arabidopsis thaliana using a reverse transcriptase (Clontech) (see Example 5, below). With the cDNA serving as a template, PCR was performed in the presence of an AtPDR12-TFF primer (5'-CCCGGGGGGGATCCATGGAGGGAACTAGITTICACCAAGCGAGTA-3', SEQ ID NO: 16) and an AtPDR12-TFR primer (5'-GGATCCGCGGCCGCCIATCGTITTIGGAAATTGAAACTCTIGATTC-3', SEQ ID NO: 17) to amplify AtPDR12 DNA (SEQ ID NO: 1) which was then inserted into a T-vector (Promega). Again, the AtPCR12 DNA was cloned into a pBI121 vector (Clontech) to construct a recombinant vector Using BamHI restriction enzyme. This pBI121 vector was used as a plant expression vector for use in the generation of transgenic Arabidopsis thaliana and has a CaMV35S Promoter, multiple cloning sites and a nopaline synthetase terminator.
[0079] The recombinant vector was introduced into Agrobacterium by electroporation with which Arabidopsis thaliana was then transformed using the floral dipping method (Clough and Bent, 1988). The Seeds of transgenic Arabidopsis thaliana was selected on a 1/2 MS-agar medium containing 30 μg/L of kanamycin (Duchefa), and seeds were harvested from the plants that survived.
[0080] Seeds of the T3 generation homozygote were used for phenotype analysis.
EXAMPLE 4
Generation of RNAi Transgenic Plant
[0081] To generate an RNAi (RNA interference) transgenic plant in which the expression of AtPDR12 and its homologues AtPDR4 (SEQ ID NO: 5) and AtPDR10 (SEQ ID NO: 9) was suppressed, first, PCR was performed in the presence of an Ri-F primer (5'-GGGGACAAGITIGTACAAAAAAGCAGGCTICATGGCAAACCCTICTATAGTATICATGGATG-3') and an Ri-R primer (5'-GGGGACCACTTIGTACAAGAAAGCTGGGICITAATCAAGCATCCATGCTGCCGGATTATTG-3'). The PCR product thus obtained was inserted into a pDONR221 vector (Invitrogen) using gateway BP clonase and then cloned into the binary vector pHellsgate8 (Invitrogen) using gateway LR clonase (Invitrogen) to give a recombinant vector (pHellsgate8-AtPDR12Ri). The pHellsgate8-AtPDR12Ri vector was transformed into Arabidopsis thaliana through the mediation of Agrobacterium to afford an AtPDR12 RNAi-transgenic plant according to example 3. The Seeds of transgenic Arabidopsis thaliana was selected on a 1/2 MS-medium containing 30 μg/L kanamycin (Duchefa) and seeds were harvested from the plants that survived.
EXAMPLE 5
RNA Isolation and RT-PCR
[0082] Total RNA was extracted from two- to three-week-old wild-type Arabidopsis thaliana using Trizol. In detail, the plant was cultured on a 1/2 MS-agar medium (culture condition (day/night): 22/18° C., 16/8 h, light condition: 40 μmol m-2 s-1), and evenly ground using liquid nitrogen, followed by isolating total RNA with the Trizol (Phenol in saturated buffer (pH 4.3, USB), guanidine thiocyanate (Sigma), Ammonium thiocyanate (Sigma), sodium acetate (3 M, pH 5.0, Aldrich), Glycerol (USB), and 8-hydroxyquinoline (Sigma)). It was used for RT-PCR as template.
[0083] cDNA was synthesized from 5 μg of the RNA (using a Powerscript RT (reverse transcription) kit (Clontech) and an oligo-dT primer 5'-TTTTTTTTTTTTTTTTTT-3', SEQ ID NO: 20). With 2 μL of the cDNA serving as a template, PCR was preformed in the presence of primers specific for AtPDR4, AtPDR10, and AtPDR12, respectively. β-tubulin and ubiquitine were used as loading controls.
[0084] In greater detail, to examine the expression of the AtPDR12 gene in the AtPDR12-transformed plant, cDNA was synthesized from each of wild-type, and the overexpressed transgenic plants prepared in Example 3 (four plants were randomly selected and named P12-1, P12-2, P12-3 and P12-4) (see Example 5) and used as a template for PCR using a pair of primers P123rd-F (5'-CTGCTTTTGGGTCCTCCAAGTTCT-3', SEQ ID NO: 21) and P123rd-R (5'-GAGATTGAATGTCTCTGGCGCAG-3', SEQ ID NO: 22). The PCR result is given in FIG. 2A. As shown in FIG. 2A, a high expression level of AtPDR12 was detected in the AtPDR12 transgenic plant. As a loading control, β-tubulin was not significantly different in expression level between the wild-type and the transgenic plants (primers: Tub-F (5'-GCTGACGTTTTCTGTATTCC-3', SEQ ID NO: 23), Tub-R (5'-AGGCTCTGTATTGCTGTGAT-3', SEQ ID NO: 24).
[0085] The expression level of AtPDR12 and its homologues AtPDR4 and AtPDR10 in the AtPDR12 RNAi plant prepared in Example 4 was examined. In this regard, first, cDNA was synthesized from the wild-type plant and the transgenic plants.
[0086] (1-9: AtPDR12-down-regulated plants (AtPDR12 RNAi) surviving 30 μg/L kanamycin (Duchefa) on a 1/2 MS-agar medium was randomly selected and numbered 1 to 9) and used as templates for PCR using respective primer sets specific for AtPDR4 (F-GCATTAGTGGGAGTAAGTGGTGCC (SEQ ID NO: 25), R-TTGAGTGTCCCTTTTGGAGCCAA (SEQ ID NO: 26)), AtPDR10 (F-GAATGGATTAAGCGGTGCTTTTAG (SEQ ID NO: 27), R-TTGACATCGCGCCTACACTATTGA (SEQ ID NO: 28)), and AtPDR12 (F-CTGCTTTTGGGTCCTCCAAGTTCT (SEQ ID NO: 29), R-GAGATTGAATGICTCTGGCGCAG-3' (SEQ ID NO: 30)). PCR results are shown in FIG. 7B. As shown in FIG. 7B, the AtPDR12-down-regulated plants (1, 5, 7, 8) were lower in the expression level of the gene than was the wild-type. As a loading control, ubiquitin was amplified (primers: LP-GCCAAGATCCAAGACAAAGA (SEQ ID NO: 31), RP-TTACGAGCAAGCATCATCAA (SEQ ID NO: 32)) and there were no significance differences in the expression level of ubiquitin between the wild-type and the transgenic plants.
EXAMPLE 6
Assay for Resistance to Salinity and Drought
[0087] The AtPDR12 transgenic plants were assayed for resistance to salinity and drought. In this regard, first, the wild-type and the overexpressed plants prepared in Example 3 were cultured for three weeks on 1/2 MS-medium containing 120 mM, 130 mM and 140 mM NaCl, respectively (culture condition (day/night): 22/18° C., 16/8 h, light condition: 40 μmol m-2 s-1). In FIG. 2, the culture results are shown for growth extent (B), fresh weight (C) and root length (D). As is apparent from the data of FIG. 2, the overexpressed plants were superior to the wild-type plant in terms of growth extent, fresh weight and root length and thus more resistant to salinity than the wild-type plant.
[0088] In addition, seeds of the wild-type and the AtPDR12-overexpressed plants prepared in Example 3 were induced to germinate on a 1/2 MS-agar medium containing 200 mM NaCl. The results are presented in FIG. 3. As shown in FIG. 3, the higher germination rates detected in the overexpressed plants demonstrated that the overexpressed plants became more resistant to salinity than the corresponding wild-type.
[0089] As for assay for resistance to drought stress, its results are shown in FIG. 4 after an AtPDR12-knockout mutant plant (atpdr12), a plant which does not express AtPDR12 due to the insertion of "T-DNA" into the AtPDR12 gene sequence, which was purchased from SALK. Mutants (plants different in the sites at which T-DNA was inserted into the AtPDR12 gene sequence were randomly named atpdr12-1 and atpdr12-2. Respective SALK numbers are as follows: atpdr12-1 (SALK--013945) and atpdr12-2 (SALK--005635)) and the wild-type were grown for four weeks in soli and additionally for two weeks withdraw watering. A control was cultured and watered every two or three days. As shown in FIG. 4, leaves of the AtPDR12-knockout mutant plant (atpdr12) wilted faster than those of the wild-type. Hence, the AtPDR12-knockout mutant plant became weak in drought tolerance and was more sensitive to drought stress, compared to the wild-type. From this data, it is expected that AtPDR12-overexpressed transgenic plants shows a higher resistance to drought than does the wild-type.
EXAMPLE 7
Assay for Response to ABA, an Indicator of Drought Tolerance
[0090] Leaves of five-week-old Arabidopsis thaliana were floated on an ABA-containing buffer (1 μM ABA (Sigma), 10 mM MES (Duchefa), 10 mM KCl (Sigma) pH 6.05 buffer). After exposure to light (170 μmol m-2 sec-1 white light at 23° C.) for predetermined times, epidermal strips were peeled from leaves and observed on slide glass using a microscope to measure the degree of stomatal opening. The results are shown in FIG. 5A. Leaves that had been floated on a buffer in the absence of ABA under light (170 μmol m-2 sec-1 white light at 23° C.) for 3 hours were transferred onto a 50 μM ABA-containing buffer. The stomatal closures of the leaves were measured with time dependency. The results are shown in FIG. 5B. Stomata opening movement by light of AtPDR12-knockout mutant plants (atpdr12) were not inhibited as much as the wild type (FIG. 5A). Furthermore, stomata of atpdr12 plants closed more slowly in response to ABA(FIG. 5B).
[0091] Under the same condition with the exception the ABC concentration as 3 μM, AtPDR12-knockout mutant plants and its homologues were monitored ABA induced stomata closing and the results are given in FIG. 11. Stomata of the AtPDR3-knockout mutant plant (purchased from SALK) exhibited hypersensitive movement in response to ABA compared to that of the wild-type (FIG. 11A) whereas stomata of the AtPDR2- or AtPDR4-knockout mutant plants (purchased from SALK) was hyposensitive to ABA, compared to that of the wild-type (FIG. 11B).
[0092] When seeds were induced to germinate in a 1/2 MS-agar medium in the presence of 1 μM ABA, which is inhibitory of seed germination, higher germination rates were observed in the AtPDR12-knockout mutant plant (atpdr12) than in the wild-type (FIG. 5C). In addition, seedlings were grown on 1/2 MS-agar medium for four days in the absence of ABA and then transferred to the same medium supplemented with ABA (2 μM or 5 μM). 7 days after the transfer of the plants, 5˜8 more lateral roots were observed in atpdr12 than in the wild-type. These results indicate that atpdr12 is hyposensitive to ABA in comparison to the wild-type (FIG. 5D).
[0093] Therefore, tissues of the AtPDR12-knockout mutant plant(adtpdr12), such as seeds, lateral roots and guard cells, are understood to significantly decrease in response to ABA. That is, the overexpression or activation of the gene coding for AtPDR12 or its homologues makes the plant close stomata faster and to a greater extent and thus makes it more resistant to drought than the wild-type.
[0094] Further, after seeds were induced to germinate in a 1/2 MS-agar medium in the presence of 1 μM ABA, which is inhibitory of seed germination, the germination rates of the wild-type and the AtPDR3 (SEQ ID NO: 3)- or AtPDR4 (SEQ ID NO: 4)-knockout mutant plants(pdr3-1, pdr3-2, pdr-4, purchased from SALK) were measured and the results are shown in FIG. 8. As shown in FIG. 8, the mutant plants (pdr3-1, pdr3-2, pdr4) are higher in germination rate than is the wild-type.
[0095] In the same medium as described above, seeds of the AtPDR6 (SEQ ID NO: 7)- or AtPDR13 (SEQ ID NO: 11)-knockout mutant plants (pdr6-1, pdr6-2, pdr13, purchased from SALK) lacking the expression of AtPDR6 (SEQ ID NO: 7) or AtPDR13 (SEQ ID NO: 11) were analyzed for germination rate and the results are showed in FIG. 9. As shown in FIG. 9, lower germination rates were observed in the AtPDR6- or AtPDR13-knockout mutant plant than in the wild-type.
[0096] In summary, seeds of the mutant plants were observed to have a decreased response to ABA if they lacked the expression of AtPDR3 or AtPDR4 (pdr3-1, pdr3-2, pdr-4) and to have an increased response to ABA if they lacked the expression of AtPDR6 or AtPDR13 (pdr6-21 pdr6-2, pdr13). As is apparent from the results, these genes are understood to be involved in ABA transport directly or indirectly. Therefore, the overexpression (AtPDR3, AtPDR4) or down-regulation (AtPDR6, AtPDR13) of the genes may lead to the development of the mutant plants which can close stomata faster and to a greater extent and thus are more resistant to drought than the wild-type.
EXAMPLE 8
ABA Transport Activity Assay
[0097] The AtPDR12 gene was assayed for ABA transport activity. In this regard, protoplasts of the wild-type and the AtPDR12-knockout mutant plant (adpdr12) were incubated for a predetermined period of time in a betaine solution (500 mM glycine betaine monohydrate (Sigma), 10 mM CaCl2 (Sigma), 10 mM MES (Duchefa)) containing an isotope (3H)-labeled ABA (3H-ABA, Amersham Biosciences).
[0098] 3H-ABA uptakes into the protoplasts were measured using a liquid scintillation counter (LS6500, Beckman) and the results are shown in FIG. 6. The protoplasts were harvested from the media containing the isotope-labeled ABA and analyzed for ABA content into the cells. As shown in FIG. 6, lower ABA levels had accumulated in the AtPDR12-knockout mutant plant(atpdr12) than in the wild-type, indicating that AtPDR12 mediates the uptake of ABA into cells.
[0099] Hence, the AtPDR12-overexpressing transgenic plants can rapidly take up ABA, which plays a crucial role in drought resistance, into the cells, and can be utilized to generate a plant which is improved in resistance to drought, salinity, cold, heat, infection by pathogens, etc.
EXAMPLE 9
Assay for Seed Productivity under Drought Stress
[0100] To assay seed productivity under drought stress, the AtPDR12-overexpressing transgenic Arabidopsis plants prepared in example 3 (randomly selected, named P12-20 and 25, respectively) and the AtPDR12-knockout mutant plant (atpdr12-1, 2) were cultured, together with the wild-type, in soil for 5 weeks and then for an additional 2 weeks without watering. The number of siliques(A) and the weight of seeds(B) in the plants were measured and the results are showed in FIG. 10. As is apparent from the data of FIG. 10, the AtPDR12-overexpressing transgenic Arabidopsis plants (P12-20, 25) showed higher seed productivity in terms of the number of siliques and the weight of seeds than did the AtPDR12-knockout mutant plant (atpdr12-1, 2) and the wild-type.
[0101] As described above, the AtPDR12 protein according to the present invention is involved in the transportation of the ABA hormone, which plays a crucial role in drought tolerance. The overexpression of AtPDR12 gene leads to the development of a novel plant which is improved in resistance to various stresses including drought, salinity, cold, heat, and infection by pathogens. In this context, when the AtPDR12 gene or homologues thereof are overexpressed (AtPDR3, AtPDR4, AtPDR10) or down-regulated (AtPDR6, AtPDR13) therein, the mutant plants are anticipated to have improved salt- or drought-resistance, thus greatly contributing to the agriculture and environment of reclaimed lands and arid regions.
Sequence CWU
1
3214272DNAArtificial Sequencenucleotide sequence encoding AtPDR12 protein
1atggagggaa ctagttttca ccaagcgagt aatagtatga gaagaaactc atcggtgtgg 60
aagaaagatt caggaaggga gattttctcg aggtcatcta gagaagaaga cgatgaagaa 120
gctttgagat gggctgctct tgagaagctt cccacttttg atcgtctcag gaaaggaatc 180
ctaactgcct cacatgccgg aggacccatc aacgagatcg atattcagaa gcttgggttt 240
caagatacta agaaactgct agagaggctc atcaaagtcg gtgacgatga gcatgagaaa 300
ctcctctgga aactcaagaa acgtatcgat agagttggaa tcgatcttcc gacaatagaa 360
gttcggtttg atcatctaaa agttgaagca gaggttcatg ttggaggcag agctttacct 420
acgttcgtca atttcatctc caattttgct gataagttcc tgaatactct gcatcttgtt 480
ccgaaccgaa agaagaagtt cactatactc aacgacgtca gcggaatcgt caagcctggc 540
aggatggctc tgcttttggg tcctccaagt tctgggaaaa cgaccctctt gcttgccttg 600
gcgggaaagc ttgatcaaga actaaagcaa actggaagag tgacatacaa tggtcatgga 660
atgaacgagt ttgtgccaca aagaacagct gcatatatcg gccaaaacga tgttcatatc 720
ggtgagatga ctgttcgtga gacttttgct tacgcagctc gcttccaagg tgttggttcg 780
cgttatgaca tgttgacaga gttggcaaga agagagaaag aagcaaacat caaacctgac 840
cctgatattg atatattcat gaaggcgatg tcaacagcag gtgaaaaaac aaatgtgatg 900
acagattata tcctcaagat cttaggactt gaggtctgtg cagacactat ggtcggcgat 960
gatatgttga gaggcatctc cggaggacaa aagaagcgtg tcactactgg tgaaatgctg
1020gttggaccgt ctagggctct gttcatggat gagatatcga ctggtttaga tagttcaacg
1080acttaccaga tagtgaactc cctcagaaac tatgttcata tcttcaatgg gacagctctg
1140atctctctcc ttcagcctgc gccagagaca ttcaatctct tcgatgatat cattctcatt
1200gcagaaggcg agatcatcta cgagggccct cgtgatcacg ttgtggagtt ctttgagacc
1260atgggattca aatgtcctcc aagaaaaggc gttgctgatt tccttcaaga agtgacatca
1320aagaaagacc aaatgcagta ctgggcacga cgtgatgagc cttacaggtt cattagagtg
1380agagagtttg cagaggcgtt tcaatcattc cacgttggcc ggagaatcgg agatgagctt
1440gctttgccct ttgacaagac aaagagccat ccggctgctc taaccaccaa gaaatacgga
1500gttgggatta aagaacttgt caagaccagc ttctcaagag aatacttact catgaaaaga
1560aactcctttg tttactactt caagtttgga caactgctgg taatggcatt tttgacaatg
1620acgttgttct ttcggacgga gatgcaaaag aagactgagg ttgatgggag tctctacact
1680ggagccttgt tcttcatcct tatgatgctc atgttcaatg gaatgtctga actttcaatg
1740accatagcaa aacttcctgt gttttacaaa caaagagatc tcctcttcta ccctgcatgg
1800gtgtactctc tgcctccttg gctcctcaag atacctataa gcttcatgga agccgctctc
1860acaacattca tcacttacta tgtcatcggc tttgatccca acgttggaag gctgtttaag
1920cagtatattc tcctcgtgct catgaaccaa atggcttcag cattgtttaa gatggtggca
1980gcattgggaa gaaacatgat cgttgcaaat acatttggtg catttgcgat gctcgtcttc
2040tttgccttgg gtggtgtggt actttcacga gacgacatta agaagtggtg gatatggggt
2100tactggatct ccccaataat gtatggacag aacgcgatcc tagccaatga gttctttgga
2160cacagctgga gtcgagctgt cgaaaactcg agcgaaacac ttggagttac tttccttaag
2220tctcgtgggt tcttacccca tgcatactgg tactggattg gaactggagc cttacttggg
2280ttcgtcgtgt tattcaattt tggtttcacg ctggctctga cgtttctgaa ctccttggga
2340aagcctcaag ctgttattgc agaagagcct gcgagtgatg agacagaact tcagtctgct
2400aggtcagaag gtgtagttga agctggtgcc aataagaaaa gagggatggt gcttccattt
2460gagccacatt caattacctt cgacaatgtt gtatactcag ttgacatgcc ccaggaaatg
2520atagagcaag gcacacaaga agacagactt gtcctgttga aaggtgtgaa tggtgcattc
2580aggccaggcg tgctcacggc tctcatgggt gtctctggag ctggcaaaac cactctgatg
2640gatgttcttg ccggaaggaa aaccggtggt tatattgatg gcaacatcac catttccggt
2700taccctaaga atcaacaaac atttgcccgt atctcaggat actgtgaaca aactgatatc
2760cattccccac atgtcactgt ttacgagtcc ttggtttact cagcctggct ccgattacct
2820aaagaagttg ataaaaacaa gagaaagata ttcatagagg aagtgatgga gctggtggag
2880ttaacgccgc tgaggcaagc actggttgga ctacctggtg agagcggttt gtcaacagag
2940caaagaaaga gactgaccat tgcggtggag ctggttgcaa atccttccat catattcatg
3000gatgaaccta cttcaggatt ggatgcacga gctgctgcca tcgttatgag gactgtaagg
3060aacacagttg acactggtag aacagtcgtc tgcaccattc accagcctag catcgacatc
3120tttgaagcct ttgatgagtt gttcctactt aagcgtggag gtgaggagat atacgttgga
3180cctcttggcc acgaatcaac ccatttgatc aactattttg agagtattca aggaatcaac
3240aagatcacag aaggatacaa cccagcaacc tggatgcttg aagtctcaac cacatctcaa
3300gaagcggctt taggagtcga tttcgcccaa gtctacaaaa attcagaact ttacaagaga
3360aacaaggagc taatcaagga gctaagccag ccagctccag gatcaaaaga tttatatttc
3420ccaacacaat actctcaatc gttcttgaca caatgtatgg cttctctatg gaaacaacac
3480tggtcctact ggagaaatcc tccttacaca gccgtgagat tcctcttcac aatcggcatt
3540gctcttatgt tcggcacaat gttctgggac cttggaggca aaacgaaaac gagacaggat
3600ttatcgaatg caatgggttc aatgtacaca gctgttctct tcctcggatt acaaaacgca
3660gcttcagtgc aaccagtcgt caacgtcgaa agaactgtct tttaccgaga acaagccgcc
3720ggaatgtact ccgccatgcc ttatgctttc gctcaggttt tcatcgagat cccatacgtt
3780ctcgtgcaag cgatagtgta cggtctcata gtgtacgcta tgataggatt cgagtggacg
3840gcggtgaagt tcttctggta cctcttcttt atgtacggat cattcttaac tttcaccttc
3900tacggaatga tggctgtagc tatgacgcct aaccaccaca tcgcctccgt cgtctcctcc
3960gctttctacg gcatctggaa tctcttctcc ggcttcctca tccctcgtcc cagtatgcct
4020gtgtggtggg aatggtacta ctggctttgc ccagttgcat ggacattgta tggattaatc
4080gcatcacagt tcggtgatat tacagaacct atggcagata gtaatatgag tgtgaagcaa
4140ttcattagag aattctatgg atatagagaa ggtttcttgg gtgtggttgc cgccatgaac
4200gtcatctttc ctttgctctt tgccgttatc tttgctatcg gaatcaagag tttcaatttc
4260caaaaacgat ag
427221423PRTArtificial Sequenceamino acid sequence of AtPDR12 protein
2Met Glu Gly Thr Ser Phe His Gln Ala Ser Asn Ser Met Arg Arg Asn1
5 10 15Ser Ser Val Trp Lys Lys
Asp Ser Gly Arg Glu Ile Phe Ser Arg Ser 20 25
30Ser Arg Glu Glu Asp Asp Glu Glu Ala Leu Arg Trp Ala
Ala Leu Glu 35 40 45Lys Leu Pro
Thr Phe Asp Arg Leu Arg Lys Gly Ile Leu Thr Ala Ser 50
55 60His Ala Gly Gly Pro Ile Asn Glu Ile Asp Ile Gln
Lys Leu Gly Phe65 70 75
80Gln Asp Thr Lys Lys Leu Leu Glu Arg Leu Ile Lys Val Gly Asp Asp
85 90 95Glu His Glu Lys Leu Leu
Trp Lys Leu Lys Lys Arg Ile Asp Arg Val 100
105 110Gly Ile Asp Leu Pro Thr Ile Glu Val Arg Phe Asp
His Leu Lys Val 115 120 125Glu Ala
Glu Val His Val Gly Gly Arg Ala Leu Pro Thr Phe Val Asn 130
135 140Phe Ile Ser Asn Phe Ala Asp Lys Phe Leu Asn
Thr Leu His Leu Val145 150 155
160Pro Asn Arg Lys Lys Lys Phe Thr Ile Leu Asn Asp Val Ser Gly Ile
165 170 175Val Lys Pro Gly
Arg Met Ala Leu Leu Leu Gly Pro Pro Ser Ser Gly 180
185 190Lys Thr Thr Leu Leu Leu Ala Leu Ala Gly Lys
Leu Asp Gln Glu Leu 195 200 205Lys
Gln Thr Gly Arg Val Thr Tyr Asn Gly His Gly Met Asn Glu Phe 210
215 220Val Pro Gln Arg Thr Ala Ala Tyr Ile Gly
Gln Asn Asp Val His Ile225 230 235
240Gly Glu Met Thr Val Arg Glu Thr Phe Ala Tyr Ala Ala Arg Phe
Gln 245 250 255Gly Val Gly
Ser Arg Tyr Asp Met Leu Thr Glu Leu Ala Arg Arg Glu 260
265 270Lys Glu Ala Asn Ile Lys Pro Asp Pro Asp
Ile Asp Ile Phe Met Lys 275 280
285Ala Met Ser Thr Ala Gly Glu Lys Thr Asn Val Met Thr Asp Tyr Ile 290
295 300Leu Lys Ile Leu Gly Leu Glu Val
Cys Ala Asp Thr Met Val Gly Asp305 310
315 320Asp Met Leu Arg Gly Ile Ser Gly Gly Gln Lys Lys
Arg Val Thr Thr 325 330
335Gly Glu Met Leu Val Gly Pro Ser Arg Ala Leu Phe Met Asp Glu Ile
340 345 350Ser Thr Gly Leu Asp Ser
Ser Thr Thr Tyr Gln Ile Val Asn Ser Leu 355 360
365Arg Asn Tyr Val His Ile Phe Asn Gly Thr Ala Leu Ile Ser
Leu Leu 370 375 380Gln Pro Ala Pro Glu
Thr Phe Asn Leu Phe Asp Asp Ile Ile Leu Ile385 390
395 400Ala Glu Gly Glu Ile Ile Tyr Glu Gly Pro
Arg Asp His Val Val Glu 405 410
415Phe Phe Glu Thr Met Gly Phe Lys Cys Pro Pro Arg Lys Gly Val Ala
420 425 430Asp Phe Leu Gln Glu
Val Thr Ser Lys Lys Asp Gln Met Gln Tyr Trp 435
440 445Ala Arg Arg Asp Glu Pro Tyr Arg Phe Ile Arg Val
Arg Glu Phe Ala 450 455 460Glu Ala Phe
Gln Ser Phe His Val Gly Arg Arg Ile Gly Asp Glu Leu465
470 475 480Ala Leu Pro Phe Asp Lys Thr
Lys Ser His Pro Ala Ala Leu Thr Thr 485
490 495Lys Lys Tyr Gly Val Gly Ile Lys Glu Leu Val Lys
Thr Ser Phe Ser 500 505 510Arg
Glu Tyr Leu Leu Met Lys Arg Asn Ser Phe Val Tyr Tyr Phe Lys 515
520 525Phe Gly Gln Leu Leu Val Met Ala Phe
Leu Thr Met Thr Leu Phe Phe 530 535
540Arg Thr Glu Met Gln Lys Lys Thr Glu Val Asp Gly Ser Leu Tyr Thr545
550 555 560Gly Ala Leu Phe
Phe Ile Leu Met Met Leu Met Phe Asn Gly Met Ser 565
570 575Glu Leu Ser Met Thr Ile Ala Lys Leu Pro
Val Phe Tyr Lys Gln Arg 580 585
590Asp Leu Leu Phe Tyr Pro Ala Trp Val Tyr Ser Leu Pro Pro Trp Leu
595 600 605Leu Lys Ile Pro Ile Ser Phe
Met Glu Ala Ala Leu Thr Thr Phe Ile 610 615
620Thr Tyr Tyr Val Ile Gly Phe Asp Pro Asn Val Gly Arg Leu Phe
Lys625 630 635 640Gln Tyr
Ile Leu Leu Val Leu Met Asn Gln Met Ala Ser Ala Leu Phe
645 650 655Lys Met Val Ala Ala Leu Gly
Arg Asn Met Ile Val Ala Asn Thr Phe 660 665
670Gly Ala Phe Ala Met Leu Val Phe Phe Ala Leu Gly Gly Val
Val Leu 675 680 685Ser Arg Asp Asp
Ile Lys Lys Trp Trp Ile Trp Gly Tyr Trp Ile Ser 690
695 700Pro Ile Met Tyr Gly Gln Asn Ala Ile Leu Ala Asn
Glu Phe Phe Gly705 710 715
720His Ser Trp Ser Arg Ala Val Glu Asn Ser Ser Glu Thr Leu Gly Val
725 730 735Thr Phe Leu Lys Ser
Arg Gly Phe Leu Pro His Ala Tyr Trp Tyr Trp 740
745 750Ile Gly Thr Gly Ala Leu Leu Gly Phe Val Val Leu
Phe Asn Phe Gly 755 760 765Phe Thr
Leu Ala Leu Thr Phe Leu Asn Ser Leu Gly Lys Pro Gln Ala 770
775 780Val Ile Ala Glu Glu Pro Ala Ser Asp Glu Thr
Glu Leu Gln Ser Ala785 790 795
800Arg Ser Glu Gly Val Val Glu Ala Gly Ala Asn Lys Lys Arg Gly Met
805 810 815Val Leu Pro Phe
Glu Pro His Ser Ile Thr Phe Asp Asn Val Val Tyr 820
825 830Ser Val Asp Met Pro Gln Glu Met Ile Glu Gln
Gly Thr Gln Glu Asp 835 840 845Arg
Leu Val Leu Leu Lys Gly Val Asn Gly Ala Phe Arg Pro Gly Val 850
855 860Leu Thr Ala Leu Met Gly Val Ser Gly Ala
Gly Lys Thr Thr Leu Met865 870 875
880Asp Val Leu Ala Gly Arg Lys Thr Gly Gly Tyr Ile Asp Gly Asn
Ile 885 890 895Thr Ile Ser
Gly Tyr Pro Lys Asn Gln Gln Thr Phe Ala Arg Ile Ser 900
905 910Gly Tyr Cys Glu Gln Thr Asp Ile His Ser
Pro His Val Thr Val Tyr 915 920
925Glu Ser Leu Val Tyr Ser Ala Trp Leu Arg Leu Pro Lys Glu Val Asp 930
935 940Lys Asn Lys Arg Lys Ile Phe Ile
Glu Glu Val Met Glu Leu Val Glu945 950
955 960Leu Thr Pro Leu Arg Gln Ala Leu Val Gly Leu Pro
Gly Glu Ser Gly 965 970
975Leu Ser Thr Glu Gln Arg Lys Arg Leu Thr Ile Ala Val Glu Leu Val
980 985 990Ala Asn Pro Ser Ile Ile
Phe Met Asp Glu Pro Thr Ser Gly Leu Asp 995 1000
1005Ala Arg Ala Ala Ala Ile Val Met Arg Thr Val Arg Asn Thr
Val Asp 1010 1015 1020Thr Gly Arg Thr
Val Val Cys Thr Ile His Gln Pro Ser Ile Asp Ile1025 1030
1035 1040Phe Glu Ala Phe Asp Glu Leu Phe Leu
Leu Lys Arg Gly Gly Glu Glu 1045 1050
1055Ile Tyr Val Gly Pro Leu Gly His Glu Ser Thr His Leu Ile Asn
Tyr 1060 1065 1070Phe Glu Ser
Ile Gln Gly Ile Asn Lys Ile Thr Glu Gly Tyr Asn Pro 1075
1080 1085Ala Thr Trp Met Leu Glu Val Ser Thr Thr Ser
Gln Glu Ala Ala Leu 1090 1095 1100Gly
Val Asp Phe Ala Gln Val Tyr Lys Asn Ser Glu Leu Tyr Lys Arg1105
1110 1115 1120Asn Lys Glu Leu Ile Lys
Glu Leu Ser Gln Pro Ala Pro Gly Ser Lys 1125
1130 1135Asp Leu Tyr Phe Pro Thr Gln Tyr Ser Gln Ser Phe
Leu Thr Gln Cys 1140 1145
1150Met Ala Ser Leu Trp Lys Gln His Trp Ser Tyr Trp Arg Asn Pro Pro
1155 1160 1165Tyr Thr Ala Val Arg Phe Leu
Phe Thr Ile Gly Ile Ala Leu Met Phe 1170 1175
1180Gly Thr Met Phe Trp Asp Leu Gly Gly Lys Thr Lys Thr Arg Gln
Asp1185 1190 1195 1200Leu
Ser Asn Ala Met Gly Ser Met Tyr Thr Ala Val Leu Phe Leu Gly
1205 1210 1215Leu Gln Asn Ala Ala Ser Val
Gln Pro Val Val Asn Val Glu Arg Thr 1220 1225
1230Val Phe Tyr Arg Glu Gln Ala Ala Gly Met Tyr Ser Ala Met
Pro Tyr 1235 1240 1245Ala Phe Ala
Gln Val Phe Ile Glu Ile Pro Tyr Val Leu Val Gln Ala 1250
1255 1260Ile Val Tyr Gly Leu Ile Val Tyr Ala Met Ile Gly
Phe Glu Trp Thr1265 1270 1275
1280Ala Val Lys Phe Phe Trp Tyr Leu Phe Phe Met Tyr Gly Ser Phe Leu
1285 1290 1295Thr Phe Thr Phe Tyr
Gly Met Met Ala Val Ala Met Thr Pro Asn His 1300
1305 1310His Ile Ala Ser Val Val Ser Ser Ala Phe Tyr Gly
Ile Trp Asn Leu 1315 1320 1325Phe
Ser Gly Phe Leu Ile Pro Arg Pro Ser Met Pro Val Trp Trp Glu 1330
1335 1340Trp Tyr Tyr Trp Leu Cys Pro Val Ala Trp
Thr Leu Tyr Gly Leu Ile1345 1350 1355
1360Ala Ser Gln Phe Gly Asp Ile Thr Glu Pro Met Ala Asp Ser Asn
Met 1365 1370 1375Ser Val
Lys Gln Phe Ile Arg Glu Phe Tyr Gly Tyr Arg Glu Gly Phe 1380
1385 1390Leu Gly Val Val Ala Ala Met Asn Val
Ile Phe Pro Leu Leu Phe Ala 1395 1400
1405Val Ile Phe Ala Ile Gly Ile Lys Ser Phe Asn Phe Gln Lys Arg 1410
1415 142034281DNAArtificial
Sequencenucleotide sequence encoding AtPDR3 protein 3atggcggcgg
cttcgaatgg gagtgagtat ttcgaattcg atgtagaaac aggaagagaa 60 tcgttcgcgc
ggccgtctaa cgccgagaca gtggagcaag atgaggaaga tctacggtgg 120 gcggcgatcg
gaagattacc gtcgcagaga caagggactc ataatgcgat tctgcgtcgg 180 tcgcaaacgc
aaacgcagac ttctggttac gctgatggaa acgtggttca aacgattgat 240 gtgaagaaat
tggatcgtgc ggatcgtgag atgttggttc gtcaagctct tgctactagt 300 gatcaagata
atttcaagct tctctctgct attaaagaac gtcttgatcg agttggtatg 360 gaggttccga
aaatcgaagt gcggttcgag aatttgaata ttgaagctga tgttcaagct 420 ggtacaagag
ctttgcctac tttggttaat gtctctcgtg atttctttga gcgttgctta 480 agcagcttga
ggataatcaa gcctaggaaa cacaagctta atattttgaa agatattagt 540 gggattatca
aaccaggaag gatgactttg ttgttaggac caccgggttc cggaaaatcg 600 acgttgcttc
ttgctcttgc agggaagctt gataagagtt taaagaaaac gggtaacatt 660 acctataatg
gagagaatct taacaagttt catgttaaaa gaacttcagc atatataagt 720 caaacagata
atcacattgc tgaactcact gttcgtgaaa ctcttgattt cgctgcgaga 780 tgtcaaggcg
caagcgaagg atttgcaggt tacatgaaag atctaacccg attagagaaa 840 gagaggggta
tacgtccttc ttctgagatt gatgcgttta tgaaggctgc ttctgtcaaa 900 ggcgaaaagc
atagtgtttc gacagattat gtgcttaaag tacttggtct tgatgtatgt 960 tctgatacaa
tggttggtaa tgatatgatg agaggtgttt caggaggtca aaggaaaaga 1020gttacaacag
gagaaatgac tgttgggcca agaaaaacgt tgtttatgga tgaaatatct 1080actggtcttg
atagttcaac aactttccag attgtcaaat gtatcagaaa cttcgttcat 1140ctaatggatg
caactgttct tatggcactt cttcagcctg caccagaaac atttgacttg 1200tttgatgact
taattcttct atcagaaggt tacatggtat atcaaggtcc tcgagaagat 1260gtgatagcct
tttttgagtc tctaggattc cgtctcccac cgcgtaaagg tgtggcagat 1320tttctccaag
aggtgacctc taaaaaggat caagctcaat actgggcaga tccttcgaag 1380ccatatcagt
tcattcctgt ctcagacata gcggctgcat tccgtaactc gaaatacggg 1440catgctgcgg
attccaagct ggctgcacca tttgacaaga aatctgcgga tccttcagct 1500ttatgcagaa
caaaatttgc catttcagga tgggaaaacc ttaaagtttg ctttgtacga 1560gaattattat
tgatcaaacg gcacaaattt ctttacactt ttaggacatg ccaggttgga 1620tttgtgggac
ttgtcacagc gacagtgttc ttgaaaacta gattacaccc aacaagcgaa 1680caatttggca
atgagtatct atcttgcctt ttcttcgggc tagtccacat gatgttcaac 1740ggtttctctg
aactacctct catgatatcg cgtctcccgg ttttttacaa gcaaagggat 1800aactcctttc
atcctgcttg gtcatggtct attgccagct ggctcttgcg tgtgccttac 1860tctgtccttg
aagctgttgt ctggagtggt gtagtatact tcactgtggg acttgctccc 1920tcagcaggca
gatttttccg atacatgtta cttctcttct cggtgcatca aatggctctc 1980ggtttatttc
gtatgatggc ttctctagca agggacatgg tcattgccaa tacattcgga 2040tctgcagcaa
tcttaatagt gttcttgctt ggtggattcg ttattccaaa agctgatatt 2100aaaccttggt
gggtttgggg tttttgggtg tcgccgttat cctatggaca acgtgccatt 2160gcggtcaatg
aattcacagc cacacggtgg atgacgccat cagctatatc tgatactaca 2220attggactca
accttctaaa gctacgtagc tttccaacga atgactattg gtattggatt 2280ggaatcgcgg
ttctcattgg ttatgcaatt ctattcaata acgtagtaac tctcgccttg 2340gcttatctta
accctctaag aaaagctcga gcagttgttt tagacgatcc caatgaagaa 2400actgctttag
tagcagatgc aaatcaagta ataagtgaga aaaagggaat gatccttcca 2460ttcaaaccat
taacaatgac tttccacaat gtcaactatt atgttgacat gccaaaggaa 2520atgcgttctc
aaggtgtacc agagacaaga ctacaactgt tatcaaacgt gagtggagtg 2580ttctcacctg
gagttcttac agctttagtt ggatcaagcg gtgcgggaaa aactacgttg 2640atggatgttc
ttgcgggtcg aaagacaggt ggatataccg agggagatat tagaatctct 2700ggtcacccaa
aagaacaaca aacgtttgct aggatctctg gatatgttga gcagaacgat 2760atacactctc
ctcaagtcac agttgaagag tccttatggt tttcggctag ccttcgtctt 2820cctaaggaga
tcaccaaaga acagaaaaag gaatttgtgg aacaagtcat gagacttgta 2880gagcttgaca
ctctgagata tgctttagta ggtttacctg gtaccacggg tctttctact 2940gagcagagga
aacgtctaac aattgcggtt gagttagtag caaatccatc aattattttc 3000atggatgaac
caacatctgg acttgatgca agagcagcag caattgtgat gagaactgtt 3060agaaacactg
ttgatactgg aagaacagtg gtttgcacca ttcatcaacc tagcattgac 3120atttttgagg
cctttgacga gctgcttcta atgaaacgag gaggacaggt tatatatggt 3180gggaaattgg
gtacacactc gcaggttctg gtagattact ttcaggggat taacggagta 3240cctccaatct
caagtggtta caatccagca acttggatgc ttgaagtaac tacacctgct 3300ttggaagaga
aatataacat ggagtttgca gatttataca agaaatctga ccagtttaga 3360gaagtagagg
caaacatcaa gcaactcagt gttccaccag aaggctcaga accaataagc 3420tttacatcaa
gatactcaca aaaccaacta tctcaatttc tactctgtct ctggaaacag 3480aaccttgtct
actggagaag tccagaatac aatctcgtga gattagtctt cacaacgatc 3540gctgcgttta
tactgggaac agttttctgg gacattggtt ccaagaggac ttcctcacag 3600gatttgatca
ccgtaatggg agctctctac tcggcttgtc tgtttcttgg agttagtaac 3660gcttcatcag
tacaaccaat cgtttcaatc gaaagaacag ttttctacag agagaaagcc 3720gctggtatgt
atgctccaat tccatatgca gcagctcagg gtcttgtgga gataccttac 3780attctgaccc
aaaccattct ctacggtgtc atcacatact tcaccattgg ctttgaaaga 3840acgttcagta
agtttgtact gtatttggtg ttcatgttcc tcacattcac ctacttcacc 3900ttctatggca
tgatggcggt tggtctcacc ccgaatcagc atttagccgc tgtgatctcc 3960tctgcgtttt
actctctctg gaatctccta tccggtttcc tcgtccaaaa gcctttgatt 4020ccagtgtggt
ggatatggtt ctattacata tgtccagtgg cgtggacact acaaggagta 4080atcctttcgc
agcttggtga cgtggaaagc atgatcaacg agccattgtt tcatggcacg 4140gtgaaggagt
ttattgaata ttacttcggc tacaagccaa acatgattgg tgtatctgct 4200gctgttcttg
tcggtttttg tgctctcttc ttctcagcat ttgcactttc agtcaaatac 4260ctcaacttcc
agagaagata a
428141426PRTArtificial Sequenceamino acid sequence of AtPDR3 protein 4Met
Ala Ala Ala Ser Asn Gly Ser Glu Tyr Phe Glu Phe Asp Val Glu1
5 10 15Thr Gly Arg Glu Ser Phe Ala
Arg Pro Ser Asn Ala Glu Thr Val Glu 20 25
30Gln Asp Glu Glu Asp Leu Arg Trp Ala Ala Ile Gly Arg Leu
Pro Ser 35 40 45Gln Arg Gln Gly
Thr His Asn Ala Ile Leu Arg Arg Ser Gln Thr Gln 50 55
60Thr Gln Thr Ser Gly Tyr Ala Asp Gly Asn Val Val Gln
Thr Ile Asp65 70 75
80Val Lys Lys Leu Asp Arg Ala Asp Arg Glu Met Leu Val Arg Gln Ala
85 90 95Leu Ala Thr Ser Asp Gln
Asp Asn Phe Lys Leu Leu Ser Ala Ile Lys 100
105 110Glu Arg Leu Asp Arg Val Gly Met Glu Val Pro Lys
Ile Glu Val Arg 115 120 125Phe Glu
Asn Leu Asn Ile Glu Ala Asp Val Gln Ala Gly Thr Arg Ala 130
135 140Leu Pro Thr Leu Val Asn Val Ser Arg Asp Phe
Phe Glu Arg Cys Leu145 150 155
160Ser Ser Leu Arg Ile Ile Lys Pro Arg Lys His Lys Leu Asn Ile Leu
165 170 175Lys Asp Ile Ser
Gly Ile Ile Lys Pro Gly Arg Met Thr Leu Leu Leu 180
185 190Gly Pro Pro Gly Ser Gly Lys Ser Thr Leu Leu
Leu Ala Leu Ala Gly 195 200 205Lys
Leu Asp Lys Ser Leu Lys Lys Thr Gly Asn Ile Thr Tyr Asn Gly 210
215 220Glu Asn Leu Asn Lys Phe His Val Lys Arg
Thr Ser Ala Tyr Ile Ser225 230 235
240Gln Thr Asp Asn His Ile Ala Glu Leu Thr Val Arg Glu Thr Leu
Asp 245 250 255Phe Ala Ala
Arg Cys Gln Gly Ala Ser Glu Gly Phe Ala Gly Tyr Met 260
265 270Lys Asp Leu Thr Arg Leu Glu Lys Glu Arg
Gly Ile Arg Pro Ser Ser 275 280
285Glu Ile Asp Ala Phe Met Lys Ala Ala Ser Val Lys Gly Glu Lys His 290
295 300Ser Val Ser Thr Asp Tyr Val Leu
Lys Val Leu Gly Leu Asp Val Cys305 310
315 320Ser Asp Thr Met Val Gly Asn Asp Met Met Arg Gly
Val Ser Gly Gly 325 330
335Gln Arg Lys Arg Val Thr Thr Gly Glu Met Thr Val Gly Pro Arg Lys
340 345 350Thr Leu Phe Met Asp Glu
Ile Ser Thr Gly Leu Asp Ser Ser Thr Thr 355 360
365Phe Gln Ile Val Lys Cys Ile Arg Asn Phe Val His Leu Met
Asp Ala 370 375 380Thr Val Leu Met Ala
Leu Leu Gln Pro Ala Pro Glu Thr Phe Asp Leu385 390
395 400Phe Asp Asp Leu Ile Leu Leu Ser Glu Gly
Tyr Met Val Tyr Gln Gly 405 410
415Pro Arg Glu Asp Val Ile Ala Phe Phe Glu Ser Leu Gly Phe Arg Leu
420 425 430Pro Pro Arg Lys Gly
Val Ala Asp Phe Leu Gln Glu Val Thr Ser Lys 435
440 445Lys Asp Gln Ala Gln Tyr Trp Ala Asp Pro Ser Lys
Pro Tyr Gln Phe 450 455 460Ile Pro Val
Ser Asp Ile Ala Ala Ala Phe Arg Asn Ser Lys Tyr Gly465
470 475 480His Ala Ala Asp Ser Lys Leu
Ala Ala Pro Phe Asp Lys Lys Ser Ala 485
490 495Asp Pro Ser Ala Leu Cys Arg Thr Lys Phe Ala Ile
Ser Gly Trp Glu 500 505 510Asn
Leu Lys Val Cys Phe Val Arg Glu Leu Leu Leu Ile Lys Arg His 515
520 525Lys Phe Leu Tyr Thr Phe Arg Thr Cys
Gln Val Gly Phe Val Gly Leu 530 535
540Val Thr Ala Thr Val Phe Leu Lys Thr Arg Leu His Pro Thr Ser Glu545
550 555 560Gln Phe Gly Asn
Glu Tyr Leu Ser Cys Leu Phe Phe Gly Leu Val His 565
570 575Met Met Phe Asn Gly Phe Ser Glu Leu Pro
Leu Met Ile Ser Arg Leu 580 585
590Pro Val Phe Tyr Lys Gln Arg Asp Asn Ser Phe His Pro Ala Trp Ser
595 600 605Trp Ser Ile Ala Ser Trp Leu
Leu Arg Val Pro Tyr Ser Val Leu Glu 610 615
620Ala Val Val Trp Ser Gly Val Val Tyr Phe Thr Val Gly Leu Ala
Pro625 630 635 640Ser Ala
Gly Arg Phe Phe Arg Tyr Met Leu Leu Leu Phe Ser Val His
645 650 655Gln Met Ala Leu Gly Leu Phe
Arg Met Met Ala Ser Leu Ala Arg Asp 660 665
670Met Val Ile Ala Asn Thr Phe Gly Ser Ala Ala Ile Leu Ile
Val Phe 675 680 685Leu Leu Gly Gly
Phe Val Ile Pro Lys Ala Asp Ile Lys Pro Trp Trp 690
695 700Val Trp Gly Phe Trp Val Ser Pro Leu Ser Tyr Gly
Gln Arg Ala Ile705 710 715
720Ala Val Asn Glu Phe Thr Ala Thr Arg Trp Met Thr Pro Ser Ala Ile
725 730 735Ser Asp Thr Thr Ile
Gly Leu Asn Leu Leu Lys Leu Arg Ser Phe Pro 740
745 750Thr Asn Asp Tyr Trp Tyr Trp Ile Gly Ile Ala Val
Leu Ile Gly Tyr 755 760 765Ala Ile
Leu Phe Asn Asn Val Val Thr Leu Ala Leu Ala Tyr Leu Asn 770
775 780Pro Leu Arg Lys Ala Arg Ala Val Val Leu Asp
Asp Pro Asn Glu Glu785 790 795
800Thr Ala Leu Val Ala Asp Ala Asn Gln Val Ile Ser Glu Lys Lys Gly
805 810 815Met Ile Leu Pro
Phe Lys Pro Leu Thr Met Thr Phe His Asn Val Asn 820
825 830Tyr Tyr Val Asp Met Pro Lys Glu Met Arg Ser
Gln Gly Val Pro Glu 835 840 845Thr
Arg Leu Gln Leu Leu Ser Asn Val Ser Gly Val Phe Ser Pro Gly 850
855 860Val Leu Thr Ala Leu Val Gly Ser Ser Gly
Ala Gly Lys Thr Thr Leu865 870 875
880Met Asp Val Leu Ala Gly Arg Lys Thr Gly Gly Tyr Thr Glu Gly
Asp 885 890 895Ile Arg Ile
Ser Gly His Pro Lys Glu Gln Gln Thr Phe Ala Arg Ile 900
905 910Ser Gly Tyr Val Glu Gln Asn Asp Ile His
Ser Pro Gln Val Thr Val 915 920
925Glu Glu Ser Leu Trp Phe Ser Ala Ser Leu Arg Leu Pro Lys Glu Ile 930
935 940Thr Lys Glu Gln Lys Lys Glu Phe
Val Glu Gln Val Met Arg Leu Val945 950
955 960Glu Leu Asp Thr Leu Arg Tyr Ala Leu Val Gly Leu
Pro Gly Thr Thr 965 970
975Gly Leu Ser Thr Glu Gln Arg Lys Arg Leu Thr Ile Ala Val Glu Leu
980 985 990Val Ala Asn Pro Ser Ile
Ile Phe Met Asp Glu Pro Thr Ser Gly Leu 995 1000
1005Asp Ala Arg Ala Ala Ala Ile Val Met Arg Thr Val Arg Asn
Thr Val 1010 1015 1020Asp Thr Gly Arg
Thr Val Val Cys Thr Ile His Gln Pro Ser Ile Asp1025 1030
1035 1040Ile Phe Glu Ala Phe Asp Glu Leu Leu
Leu Met Lys Arg Gly Gly Gln 1045 1050
1055Val Ile Tyr Gly Gly Lys Leu Gly Thr His Ser Gln Val Leu Val
Asp 1060 1065 1070Tyr Phe Gln
Gly Ile Asn Gly Val Pro Pro Ile Ser Ser Gly Tyr Asn 1075
1080 1085Pro Ala Thr Trp Met Leu Glu Val Thr Thr Pro
Ala Leu Glu Glu Lys 1090 1095 1100Tyr
Asn Met Glu Phe Ala Asp Leu Tyr Lys Lys Ser Asp Gln Phe Arg1105
1110 1115 1120Glu Val Glu Ala Asn Ile
Lys Gln Leu Ser Val Pro Pro Glu Gly Ser 1125
1130 1135Glu Pro Ile Ser Phe Thr Ser Arg Tyr Ser Gln Asn
Gln Leu Ser Gln 1140 1145
1150Phe Leu Leu Cys Leu Trp Lys Gln Asn Leu Val Tyr Trp Arg Ser Pro
1155 1160 1165Glu Tyr Asn Leu Val Arg Leu
Val Phe Thr Thr Ile Ala Ala Phe Ile 1170 1175
1180Leu Gly Thr Val Phe Trp Asp Ile Gly Ser Lys Arg Thr Ser Ser
Gln1185 1190 1195 1200Asp
Leu Ile Thr Val Met Gly Ala Leu Tyr Ser Ala Cys Leu Phe Leu
1205 1210 1215Gly Val Ser Asn Ala Ser Ser
Val Gln Pro Ile Val Ser Ile Glu Arg 1220 1225
1230Thr Val Phe Tyr Arg Glu Lys Ala Ala Gly Met Tyr Ala Pro
Ile Pro 1235 1240 1245Tyr Ala Ala
Ala Gln Gly Leu Val Glu Ile Pro Tyr Ile Leu Thr Gln 1250
1255 1260Thr Ile Leu Tyr Gly Val Ile Thr Tyr Phe Thr Ile
Gly Phe Glu Arg1265 1270 1275
1280Thr Phe Ser Lys Phe Val Leu Tyr Leu Val Phe Met Phe Leu Thr Phe
1285 1290 1295Thr Tyr Phe Thr Phe
Tyr Gly Met Met Ala Val Gly Leu Thr Pro Asn 1300
1305 1310Gln His Leu Ala Ala Val Ile Ser Ser Ala Phe Tyr
Ser Leu Trp Asn 1315 1320 1325Leu
Leu Ser Gly Phe Leu Val Gln Lys Pro Leu Ile Pro Val Trp Trp 1330
1335 1340Ile Trp Phe Tyr Tyr Ile Cys Pro Val Ala
Trp Thr Leu Gln Gly Val1345 1350 1355
1360Ile Leu Ser Gln Leu Gly Asp Val Glu Ser Met Ile Asn Glu Pro
Leu 1365 1370 1375Phe His
Gly Thr Val Lys Glu Phe Ile Glu Tyr Tyr Phe Gly Tyr Lys 1380
1385 1390Pro Asn Met Ile Gly Val Ser Ala Ala
Val Leu Val Gly Phe Cys Ala 1395 1400
1405Leu Phe Phe Ser Ala Phe Ala Leu Ser Val Lys Tyr Leu Asn Phe Gln
1410 1415 1420Arg Arg142554263DNAArtificial
Sequencenucleotide sequence encoding AtPDR4 protein 5atgtggaact
cggcggagaa cgcattctcg cgttcgacgt cgtttaaaga cgaaatcgaa 60 gacgaagaag
agcttcgttg ggcagcttta caacgtcttc caacttattc acgaatccgc 120 cgcgggattt
tcagagatat ggttggtgag cctaaagaga tccaaattgg taacctagaa 180 gctagcgaac
aacgtcttct tctcgaccgt cttgtgaatt ccgttgaaaa tgatcctgaa 240 cagttcttcg
ctcgtgttag gaagagattc gacgctgtgg atttgaaatt tccgaagatt 300 gaagttcgat
ttcagaatct gatggtagaa tcatttgttc atgttggaag cagagcatta 360 ccaacaattc
ccaatttcat cattaacatg gcagaaggtt tgttgaggaa cattcatgtg 420 attggtggaa
aaaggaacaa attaacgatt ttagatggta tcagtggtgt tattagacct 480 tcaagattga
cactactact aggtcctcca agttcaggga agacaacatt actcttagct 540 ttagctggac
gtcttggaac taatcttcag acatcaggga aaataacgta caatggctac 600 gatctcaaag
agataatcgc gccaaggacg tccgcatatg tgagccaaca ggattggcat 660 gtggcggaga
tgacagtgag gcagactctt gagtttgctg gtcgttgtca aggtgttgga 720 ttcaaatatg
atatgctttt ggagttagca agaagggaaa agcttgcagg aattgtacct 780 gatgaagatc
ttgatatatt tatgaagtct ttagctctcg ggggaatgga gacaagcctc 840 gtcgtggagt
atgttatgaa gattctagga ttggacacat gtgcggacac attggttgga 900 gatgagatga
ttaaaggaat ttcaggggga cagaagaaac ggctaacaac aggggaacta 960 ttagttggtc
cagcaagagt ccttttcatg gatgaaatat caaatggttt agatagttcg 1020acgactcatc
agattataat gtatatgagg cattctactc atgcgctcga aggaaccacc 1080gtcatttctt
tactccaacc gtctcccgag acttacgagt tgtttgatga tgttatcctt 1140atgtctgagg
gacagattat ataccaggga cctcgtgacg aggttcttga tttcttttct 1200tcgttgggat
ttacttgccc tgatagaaaa aatgttgcag atttcttgca agaggtcacc 1260tcaaagaaag
atcagcagca gtactggtca gtccctttcc ggccttatcg ctatgtacct 1320cctggaaaat
ttgctgaagc tttccgttca tatccaactg gtaagaagtt ggcaaaaaaa 1380cttgaggttc
catttgataa acggttcaat cattcagccg cgttatcgac atcccaatat 1440ggtgttaaga
agagtgaact tctcaagatc aactttgcct ggcagaagca actgatgaag 1500caaaatgcat
ttatttatgt gttcaagttt gttcagcttc ttttagttgc tttgatcacg 1560atgactgtct
tttgccgaac aacaatgcat cacaacacta ttgatgatgg caacatatat 1620cttgggtcac
tttacttttc catggtcatc attctcttta acggattcac cgaggttcca 1680atgctagtag
ccaaacttcc cgttctttat aagcacagag acttgcattt ttacccaagc 1740tgggcttata
cattaccttc ctggcttttg agtatcccta cttcaataat agaatctgcc 1800acatgggtgg
cagtaacata ttatacaatt ggatatgatc ctttgttctc aaggtttctt 1860cagcagttct
tgctgtattt ctctctgcat cagatgtcgt tgggtctttt ccgcgtaatg 1920ggttctttag
gccgacatat gatagttgcc aatacgtttg ggtcctttgc aatgcttgtg 1980gtcatgactc
ttggaggatt tataatttcc agagatagca taccaagctg gtggatatgg 2040ggttactgga
tttctccatt gatgtatgct caaaacgcag cttctgtgaa tgagttcctt 2100ggtcataatt
ggcaaaagac tgctgggaat cacactagcg actctcttgg tttggcattg 2160ctgaaagaaa
gaagtttgtt ctctgggaac tactggtatt ggatcggtgt cgctgccttg 2220cttggataca
cagttctttt taatatacta tttacgctgt ttttagctca cctcaaccca 2280tggggtaagt
ttcaagccgt tgtatccaga gaagagttag acgagagaga aaagaaaaga 2340aaaggcgatg
agtttgttgt ggaactaaga gagtacttgc agcattcagg ctcaatacat 2400ggaaaatatt
tcaagaatcg aggcatggtt ctcccatttc aaccactatc tctgtctttc 2460agcaatatca
actactatgt ggatgttcct ttgggactaa aagaacaagg gatactagaa 2520gataggttgc
agctacttgt gaatattact ggagctttta gacctggtgt gcttacagca 2580ttagtgggag
taagtggtgc cggtaaaaca acgctcatgg atgttttagc tggaagaaaa 2640accggaggaa
ctatagaagg cgatgtgtac atatctggtt ttcctaaaag acaggaaacg 2700tttgcaagaa
tttctggtta ttgtgagcag aatgatgttc actctccatg cctaactgtt 2760gttgaatctc
tacttttctc ggcgtgcctt cgtttaccag cagacattga ctcagagaca 2820caaagggcgt
ttgttcatga ggtgatggag ctagtggagc tgacctcttt aagcggggca 2880ttagtcggtc
ttcctggagt tgatggctta tcaactgaac agaggaaacg gttaacaatt 2940gctgtcgagc
tagttgcaaa cccttctata gtattcatgg atgagccaac ttcaggattg 3000gatgcacggg
cggccgccat tgtgatgagg actgtaagaa atattgttaa cacagggcga 3060accattgtct
gcacgattca tcagcctagc attgatattt ttgagtcatt tgacgagctt 3120ttgttcatga
aacgtggtgg agaactcata tatgccggtc cacttggcca gaagtcttgt 3180gagcttatca
agtatttcga gtcaattgaa ggggtgcaaa agatcaaacc tggccataat 3240ccggcagcat
ggatgcttga tgtcactgct tctaccgagg aacaccggct tggagttgat 3300tttgctgaaa
tttacaggaa ctcaaatctt tgtcaacgca acaaggagct gatcgaagta 3360ctcagcaagc
caagtaacat tgcaaaagaa atcgagtttc caaccagata ctctcagtca 3420ctgtatagtc
agtttgttgc ttgcctgtgg aaacaaaacc tatcatattg gcgaaaccca 3480caatacactg
cagttcgatt cttctacacc gtggttatct cgctgatgct tggaacaata 3540tgttggaaat
ttggctccaa aagggacact caacaacagt tatttaatgc aatgggatcg 3600atgtacgctg
cggttctctt cattggaatc accaatgcaa ccgctgcaca gcccgttgtt 3660tccatagaaa
gatttgtttc ataccgcgag agagcagcgg gaatgtactc ggcacttccc 3720tttgcatttg
cacaggtgtt tatagaattt ccatacgtgt tagcacaatc cacaatatac 3780agcaccatat
tctatgcaat ggccgcgttc gaatggtccg cggtgaagtt cttgtggtac 3840ttattcttca
tgtacttttc gataatgtac ttcaccttct acgggatgat gacgacagca 3900atcaccccaa
accacaatgt cgcctcgatt atagcagcac ctttctacat gctctggaat 3960cttttcagtg
gcttcatgat cccatacaag aggattcctc tgtggtggag atggtactac 4020tgggcaaacc
cggtggcttg gacactgtac ggtctattgg tgtctcagta cggtgatgat 4080gaaagatcgg
tgaagctatc ggacggtatc catcaggtga tggtgaaaca actgcttgag 4140gatgtgatgg
gatataaaca tgacttctta ggtgtctcag ctattatggt tgtcgccttt 4200tgcgtcttct
tctcccttgt gtttgcattc gccattaaag ctttcaattt ccagagaaga 4260tga
426361420PRTArtificial Sequenceamino acid sequence of AtPDR4 protein 6Met
Trp Asn Ser Ala Glu Asn Ala Phe Ser Arg Ser Thr Ser Phe Lys1
5 10 15Asp Glu Ile Glu Asp Glu Glu
Glu Leu Arg Trp Ala Ala Leu Gln Arg 20 25
30Leu Pro Thr Tyr Ser Arg Ile Arg Arg Gly Ile Phe Arg Asp
Met Val 35 40 45Gly Glu Pro Lys
Glu Ile Gln Ile Gly Asn Leu Glu Ala Ser Glu Gln 50 55
60Arg Leu Leu Leu Asp Arg Leu Val Asn Ser Val Glu Asn
Asp Pro Glu65 70 75
80Gln Phe Phe Ala Arg Val Arg Lys Arg Phe Asp Ala Val Asp Leu Lys
85 90 95Phe Pro Lys Ile Glu Val
Arg Phe Gln Asn Leu Met Val Glu Ser Phe 100
105 110Val His Val Gly Ser Arg Ala Leu Pro Thr Ile Pro
Asn Phe Ile Ile 115 120 125Asn Met
Ala Glu Gly Leu Leu Arg Asn Ile His Val Ile Gly Gly Lys 130
135 140Arg Asn Lys Leu Thr Ile Leu Asp Gly Ile Ser
Gly Val Ile Arg Pro145 150 155
160Ser Arg Leu Thr Leu Leu Leu Gly Pro Pro Ser Ser Gly Lys Thr Thr
165 170 175Leu Leu Leu Ala
Leu Ala Gly Arg Leu Gly Thr Asn Leu Gln Thr Ser 180
185 190Gly Lys Ile Thr Tyr Asn Gly Tyr Asp Leu Lys
Glu Ile Ile Ala Pro 195 200 205Arg
Thr Ser Ala Tyr Val Ser Gln Gln Asp Trp His Val Ala Glu Met 210
215 220Thr Val Arg Gln Thr Leu Glu Phe Ala Gly
Arg Cys Gln Gly Val Gly225 230 235
240Phe Lys Tyr Asp Met Leu Leu Glu Leu Ala Arg Arg Glu Lys Leu
Ala 245 250 255Gly Ile Val
Pro Asp Glu Asp Leu Asp Ile Phe Met Lys Ser Leu Ala 260
265 270Leu Gly Gly Met Glu Thr Ser Leu Val Val
Glu Tyr Val Met Lys Ile 275 280
285Leu Gly Leu Asp Thr Cys Ala Asp Thr Leu Val Gly Asp Glu Met Ile 290
295 300Lys Gly Ile Ser Gly Gly Gln Lys
Lys Arg Leu Thr Thr Gly Glu Leu305 310
315 320Leu Val Gly Pro Ala Arg Val Leu Phe Met Asp Glu
Ile Ser Asn Gly 325 330
335Leu Asp Ser Ser Thr Thr His Gln Ile Ile Met Tyr Met Arg His Ser
340 345 350Thr His Ala Leu Glu Gly
Thr Thr Val Ile Ser Leu Leu Gln Pro Ser 355 360
365Pro Glu Thr Tyr Glu Leu Phe Asp Asp Val Ile Leu Met Ser
Glu Gly 370 375 380Gln Ile Ile Tyr Gln
Gly Pro Arg Asp Glu Val Leu Asp Phe Phe Ser385 390
395 400Ser Leu Gly Phe Thr Cys Pro Asp Arg Lys
Asn Val Ala Asp Phe Leu 405 410
415Gln Glu Val Thr Ser Lys Lys Asp Gln Gln Gln Tyr Trp Ser Val Pro
420 425 430Phe Arg Pro Tyr Arg
Tyr Val Pro Pro Gly Lys Phe Ala Glu Ala Phe 435
440 445Arg Ser Tyr Pro Thr Gly Lys Lys Leu Ala Lys Lys
Leu Glu Val Pro 450 455 460Phe Asp Lys
Arg Phe Asn His Ser Ala Ala Leu Ser Thr Ser Gln Tyr465
470 475 480Gly Val Lys Lys Ser Glu Leu
Leu Lys Ile Asn Phe Ala Trp Gln Lys 485
490 495Gln Leu Met Lys Gln Asn Ala Phe Ile Tyr Val Phe
Lys Phe Val Gln 500 505 510Leu
Leu Leu Val Ala Leu Ile Thr Met Thr Val Phe Cys Arg Thr Thr 515
520 525Met His His Asn Thr Ile Asp Asp Gly
Asn Ile Tyr Leu Gly Ser Leu 530 535
540Tyr Phe Ser Met Val Ile Ile Leu Phe Asn Gly Phe Thr Glu Val Pro545
550 555 560Met Leu Val Ala
Lys Leu Pro Val Leu Tyr Lys His Arg Asp Leu His 565
570 575Phe Tyr Pro Ser Trp Ala Tyr Thr Leu Pro
Ser Trp Leu Leu Ser Ile 580 585
590Pro Thr Ser Ile Ile Glu Ser Ala Thr Trp Val Ala Val Thr Tyr Tyr
595 600 605Thr Ile Gly Tyr Asp Pro Leu
Phe Ser Arg Phe Leu Gln Gln Phe Leu 610 615
620Leu Tyr Phe Ser Leu His Gln Met Ser Leu Gly Leu Phe Arg Val
Met625 630 635 640Gly Ser
Leu Gly Arg His Met Ile Val Ala Asn Thr Phe Gly Ser Phe
645 650 655Ala Met Leu Val Val Met Thr
Leu Gly Gly Phe Ile Ile Ser Arg Asp 660 665
670Ser Ile Pro Ser Trp Trp Ile Trp Gly Tyr Trp Ile Ser Pro
Leu Met 675 680 685Tyr Ala Gln Asn
Ala Ala Ser Val Asn Glu Phe Leu Gly His Asn Trp 690
695 700Gln Lys Thr Ala Gly Asn His Thr Ser Asp Ser Leu
Gly Leu Ala Leu705 710 715
720Leu Lys Glu Arg Ser Leu Phe Ser Gly Asn Tyr Trp Tyr Trp Ile Gly
725 730 735Val Ala Ala Leu Leu
Gly Tyr Thr Val Leu Phe Asn Ile Leu Phe Thr 740
745 750Leu Phe Leu Ala His Leu Asn Pro Trp Gly Lys Phe
Gln Ala Val Val 755 760 765Ser Arg
Glu Glu Leu Asp Glu Arg Glu Lys Lys Arg Lys Gly Asp Glu 770
775 780Phe Val Val Glu Leu Arg Glu Tyr Leu Gln His
Ser Gly Ser Ile His785 790 795
800Gly Lys Tyr Phe Lys Asn Arg Gly Met Val Leu Pro Phe Gln Pro Leu
805 810 815Ser Leu Ser Phe
Ser Asn Ile Asn Tyr Tyr Val Asp Val Pro Leu Gly 820
825 830Leu Lys Glu Gln Gly Ile Leu Glu Asp Arg Leu
Gln Leu Leu Val Asn 835 840 845Ile
Thr Gly Ala Phe Arg Pro Gly Val Leu Thr Ala Leu Val Gly Val 850
855 860Ser Gly Ala Gly Lys Thr Thr Leu Met Asp
Val Leu Ala Gly Arg Lys865 870 875
880Thr Gly Gly Thr Ile Glu Gly Asp Val Tyr Ile Ser Gly Phe Pro
Lys 885 890 895Arg Gln Glu
Thr Phe Ala Arg Ile Ser Gly Tyr Cys Glu Gln Asn Asp 900
905 910Val His Ser Pro Cys Leu Thr Val Val Glu
Ser Leu Leu Phe Ser Ala 915 920
925Cys Leu Arg Leu Pro Ala Asp Ile Asp Ser Glu Thr Gln Arg Ala Phe 930
935 940Val His Glu Val Met Glu Leu Val
Glu Leu Thr Ser Leu Ser Gly Ala945 950
955 960Leu Val Gly Leu Pro Gly Val Asp Gly Leu Ser Thr
Glu Gln Arg Lys 965 970
975Arg Leu Thr Ile Ala Val Glu Leu Val Ala Asn Pro Ser Ile Val Phe
980 985 990Met Asp Glu Pro Thr Ser
Gly Leu Asp Ala Arg Ala Ala Ala Ile Val 995 1000
1005Met Arg Thr Val Arg Asn Ile Val Asn Thr Gly Arg Thr Ile
Val Cys 1010 1015 1020Thr Ile His Gln
Pro Ser Ile Asp Ile Phe Glu Ser Phe Asp Glu Leu1025 1030
1035 1040Leu Phe Met Lys Arg Gly Gly Glu Leu
Ile Tyr Ala Gly Pro Leu Gly 1045 1050
1055Gln Lys Ser Cys Glu Leu Ile Lys Tyr Phe Glu Ser Ile Glu Gly
Val 1060 1065 1070Gln Lys Ile
Lys Pro Gly His Asn Pro Ala Ala Trp Met Leu Asp Val 1075
1080 1085Thr Ala Ser Thr Glu Glu His Arg Leu Gly Val
Asp Phe Ala Glu Ile 1090 1095 1100Tyr
Arg Asn Ser Asn Leu Cys Gln Arg Asn Lys Glu Leu Ile Glu Val1105
1110 1115 1120Leu Ser Lys Pro Ser Asn
Ile Ala Lys Glu Ile Glu Phe Pro Thr Arg 1125
1130 1135Tyr Ser Gln Ser Leu Tyr Ser Gln Phe Val Ala Cys
Leu Trp Lys Gln 1140 1145
1150Asn Leu Ser Tyr Trp Arg Asn Pro Gln Tyr Thr Ala Val Arg Phe Phe
1155 1160 1165Tyr Thr Val Val Ile Ser Leu
Met Leu Gly Thr Ile Cys Trp Lys Phe 1170 1175
1180Gly Ser Lys Arg Asp Thr Gln Gln Gln Leu Phe Asn Ala Met Gly
Ser1185 1190 1195 1200Met
Tyr Ala Ala Val Leu Phe Ile Gly Ile Thr Asn Ala Thr Ala Ala
1205 1210 1215Gln Pro Val Val Ser Ile Glu
Arg Phe Val Ser Tyr Arg Glu Arg Ala 1220 1225
1230Ala Gly Met Tyr Ser Ala Leu Pro Phe Ala Phe Ala Gln Val
Phe Ile 1235 1240 1245Glu Phe Pro
Tyr Val Leu Ala Gln Ser Thr Ile Tyr Ser Thr Ile Phe 1250
1255 1260Tyr Ala Met Ala Ala Phe Glu Trp Ser Ala Val Lys
Phe Leu Trp Tyr1265 1270 1275
1280Leu Phe Phe Met Tyr Phe Ser Ile Met Tyr Phe Thr Phe Tyr Gly Met
1285 1290 1295Met Thr Thr Ala Ile
Thr Pro Asn His Asn Val Ala Ser Ile Ile Ala 1300
1305 1310Ala Pro Phe Tyr Met Leu Trp Asn Leu Phe Ser Gly
Phe Met Ile Pro 1315 1320 1325Tyr
Lys Arg Ile Pro Leu Trp Trp Arg Trp Tyr Tyr Trp Ala Asn Pro 1330
1335 1340Val Ala Trp Thr Leu Tyr Gly Leu Leu Val
Ser Gln Tyr Gly Asp Asp1345 1350 1355
1360Glu Arg Ser Val Lys Leu Ser Asp Gly Ile His Gln Val Met Val
Lys 1365 1370 1375Gln Leu
Leu Glu Asp Val Met Gly Tyr Lys His Asp Phe Leu Gly Val 1380
1385 1390Ser Ala Ile Met Val Val Ala Phe Cys
Val Phe Phe Ser Leu Val Phe 1395 1400
1405Ala Phe Ala Ile Lys Ala Phe Asn Phe Gln Arg Arg 1410
1415 142074362DNAArtificial Sequencenucleotide sequence
encoding AtPDR6 protein 7atgttaggac gagatgaaga tctggtccga acaatgagcg
ggagaggaag tttaggctcc 60 acaagtcacc ggagtttagc cggagctgct tcaaaaagct
tcagagatgt gtttgctccc 120 ccaacggacg acgtgtttgg tcggagcgat agacgagaag
aagatgacgt ggagctccga 180 tgggcggcgc ttgagagatt accgacttac gatcggttaa
gaaaaggtat gttgccgcaa 240 acgatggtca acggtaagat tggacttgaa gatgttgacg
tcacgaatct tgctcctaag 300 gagaagaaac atcttatgga aatgattctg aaattcgttg
aagaagataa cgaaaagttt 360 cttcggcgat tgagagaaag aactgacaga gtgggaatcg
aagttccgaa aattgaagta 420 aggtatgaga atctttcagt ggaaggagat gttcgtagtg
caagcagagc tcttcctact 480 ctcttcaacg tcactttgaa tacaatcgag agtattcttg
gattattcca cctgcttcca 540 tctaagaaga ggaagattga gattcttaaa gatataagtg
gcattatcaa accatcaagg 600 atgactttat tacttggtcc acctagttca gggaaaacaa
ctttgttaca agctttagct 660 gggaagcttg atgacactct ccagatgtct gggaggataa
cttactgcgg tcatgagttt 720 cgtgagtttg ttcctcagaa gacttgtgct tacattagtc
agcatgacct tcactttgga 780 gaaatgactg tgcgagagtc attggacttt tcgggacgat
gtttaggtgt tgggactcgg 840 taccagcttt tgactgagct ctcaaggagg gagagagaag
ctggaattaa gcctgaccct 900 gagattgatg catttatgaa atccattgct atatctggcc
aagaaactag tttggttaca 960 gactatgtac ttaagttact tggtctggac atttgtgctg
acacacttgt tggagatgtg 1020atgagacgag gtatttctgg tggacagcgg aaacgtctaa
caacaggaga gatgttggtt 1080ggaccagcaa cagctctttt catggatgaa atatcaacag
ggttagacag ttccacaaca 1140ttccaaattt gcaagttcat gaggcaacta gttcatatcg
cggatgtcac aatggtcatt 1200tcgcttctac aacctgcgcc agagacattt gagcttttcg
acgacattat cctactctca 1260gagggccaaa ttgtctacca ggggtcacga gacaacgttc
ttgagttctt tgagtacatg 1320ggtttcaaat gtcctgaaag gaaaggtatt gcagattttc
tgcaagaagt tacgtctaag 1380aaggaccaag aacagtattg gaacaggaga gaacatcctt
acagctatgt atcagtgcat 1440gacttctcaa gcggcttcaa ttcttttcac gcagggcaac
aacttgcttc agaattcagg 1500gttccttatg acaaagcaaa aactcatcct gcagcactag
tgacacaaaa gtatggtata 1560tcaaacaagg atctattcaa ggcatgcttt gatagagaat
ggcttcttat gaaacgtaac 1620tcctttgtgt acgtgttcaa gaccgtccag ataaccatca
tgtctttgat tgccatgacg 1680gtttattttc ggacagaaat gcatgtcggc actgtgcaag
atggtcaaaa gttttatggt 1740gctctctttt tcagcttgat caatctaatg tttaatggaa
tggctgaact agccttcaca 1800gtgatgaggc ttccggtttt cttcaagcag agggacttct
tgttctatcc tccatgggct 1860ttcgcattac ccggttttct tctcaagatt ccgttatctc
ttattgaatc agttatatgg 1920atcgctctta catactacac tattggtttt gctccttctg
ctgccaggtt cttccggcag 1980ttgctagcat acttctgtgt gaatcagatg gcactttctt
tatttagatt ccttggagcc 2040cttggaagaa cagaagtcat cgccaactct ggcgggacat
tagcattgct agtcgtattt 2100gttcttggag gctttattat ttctaaagat gacatcccgt
cgtggctgac ttggtgctat 2160tatacatcac ctatgatgta tggacagact gcattagtta
taaatgaatt tttggatgag 2220cgatggggca gcccaaacaa tgatacacgc atcaacgcga
aaacagttgg agaagtcttg 2280ctgaagagca gaggcttctt tacagaacca tattggtttt
ggatctgtat tggggcgcta 2340cttgggttta ctgtgttgtt caacttctgt tacataatag
ccttgatgta tttgaaccct 2400cttggtaact ccaaagctac tacagttgtg gaagaaggta
aagacaaaca caaagggagt 2460cacagtggaa caggaggttc tgtagtggaa ctcactagta
cttcaagtca tggaccaaag 2520aaaggaatgg ttttaccttt ccaaccactt tctctagcat
tcaacaatgt gaactactac 2580gtggatatgc ctgcagaaat gaaggctcaa ggagttgaag
gagatcgact tcagttacta 2640agagacgttg gtggagcttt caggcctggc gtattgacag
cattggtcgg tgttagtggt 2700gcgggtaaga ctaccttaat ggatgtcttg gccggtagga
aaacaggagg ctatgtagaa 2760gggagtatta acatatctgg ttacccaaag aaccaagcaa
catttgctag agtcagtggt 2820tactgtgagc aaaatgatat ccattctcca catgttaccg
tttatgaatc ccttatctat 2880tcagcatggc ttcgtctttc cgccgatata gataccaaaa
cacgagagat gtttgtggag 2940gaagtgatgg agttggtgga gcttaaacct cttagaaact
ctatagttgg tcttcctggt 3000gtagatggtc tttcaacaga acagaggaag aggcttacta
tagcagttga attggtagct 3060aatccatcaa taatcttcat ggacgagcca acatctggtc
ttgatgcaag agctgctgcc 3120attgttatgc gtactgttag gaatactgtt gatacaggaa
gaactgttgt ttgtacaatt 3180caccaaccta gcatcgacat tttcgaatcc ttcgatgagt
tgctgttgat gaaacgagga 3240ggacaagtta tatatgctgg aacactagga catcactcac
aaaaactcgt tgaatacttt 3300gaggctattg aaggggttcc aaagatcaag gacggataca
atcctgcgac gtggatgctt 3360gacgtcacta ctccttcaat ggagtcacaa atgagcgtgg
actttgctca aatattcgtt 3420aactcctctg ttaatcggag aaatcaggaa ctcatcaaag
agctgagtac tccaccaccg 3480ggatcgaatg atctctactt ccgaaccaag tacgcgcaac
cattttctac tcaaaccaaa 3540gcttgcttct ggaaaatgta ttggtcaaac tggagatatc
ctcagtacaa tgccattcgg 3600tttctcatga cagtagtcat tggtgtcttg tttggtctac
ttttctggca aacaggaact 3660aaaatagaga aagagcaaga cctgaataat ttctttggag
ccatgtatgc tgctgtattg 3720ttcctcggtg ccaccaacgc tgcaacagtt caacccgcag
ttgctattga gcgaacggtt 3780ttctaccgcg aaaaagccgc tggaatgtac tccgccattc
cctatgcaat ttctcaggta 3840gcagtagaaa tcatgtacaa cactatacaa accggagttt
acacacttat cctttactcg 3900atgatcggat acgactggac tgtggtcaaa ttcttctggt
tctactacta catgttaaca 3960tgcttcgtct acttcaccct atacggtatg atgcttgtcg
ccttgacacc aaactatcaa 4020atagctggaa tctgcttgtc cttcttcctc agtttctgga
atcttttctc cggtttcctc 4080atccctagac cgcaaatacc aatatggtgg agatggtact
attgggcatc acctgtggct 4140tggacattgt atggaatcat cacatctcaa gtaggagaca
gggattcgat tgtgcacatc 4200actggtgttg gagatatgag tcttaaaacg ttgctcaaaa
atggattcgg gttcgattat 4260gacttcttac cagttgtagc cgttgtccac atcgcctgga
tcttgatctt tctctttgcc 4320tttgcttatg gtatcaagtt cctcaacttc caaagaaggt
ga 436281453PRTArtificial Sequenceamio acid sequence
of AtPDR6 protein 8Met Leu Gly Arg Asp Glu Asp Leu Val Arg Thr Met Ser
Gly Arg Gly1 5 10 15Ser
Leu Gly Ser Thr Ser His Arg Ser Leu Ala Gly Ala Ala Ser Lys 20
25 30Ser Phe Arg Asp Val Phe Ala Pro
Pro Thr Asp Asp Val Phe Gly Arg 35 40
45Ser Asp Arg Arg Glu Glu Asp Asp Val Glu Leu Arg Trp Ala Ala Leu
50 55 60Glu Arg Leu Pro Thr Tyr Asp Arg
Leu Arg Lys Gly Met Leu Pro Gln65 70 75
80Thr Met Val Asn Gly Lys Ile Gly Leu Glu Asp Val Asp
Val Thr Asn 85 90 95Leu
Ala Pro Lys Glu Lys Lys His Leu Met Glu Met Ile Leu Lys Phe
100 105 110Val Glu Glu Asp Asn Glu Lys
Phe Leu Arg Arg Leu Arg Glu Arg Thr 115 120
125Asp Arg Val Gly Ile Glu Val Pro Lys Ile Glu Val Arg Tyr Glu
Asn 130 135 140Leu Ser Val Glu Gly Asp
Val Arg Ser Ala Ser Arg Ala Leu Pro Thr145 150
155 160Leu Phe Asn Val Thr Leu Asn Thr Ile Glu Ser
Ile Leu Gly Leu Phe 165 170
175His Leu Leu Pro Ser Lys Lys Arg Lys Ile Glu Ile Leu Lys Asp Ile
180 185 190Ser Gly Ile Ile Lys Pro
Ser Arg Met Thr Leu Leu Leu Gly Pro Pro 195 200
205Ser Ser Gly Lys Thr Thr Leu Leu Gln Ala Leu Ala Gly Lys
Leu Asp 210 215 220Asp Thr Leu Gln Met
Ser Gly Arg Ile Thr Tyr Cys Gly His Glu Phe225 230
235 240Arg Glu Phe Val Pro Gln Lys Thr Cys Ala
Tyr Ile Ser Gln His Asp 245 250
255Leu His Phe Gly Glu Met Thr Val Arg Glu Ser Leu Asp Phe Ser Gly
260 265 270Arg Cys Leu Gly Val
Gly Thr Arg Tyr Gln Leu Leu Thr Glu Leu Ser 275
280 285Arg Arg Glu Arg Glu Ala Gly Ile Lys Pro Asp Pro
Glu Ile Asp Ala 290 295 300Phe Met Lys
Ser Ile Ala Ile Ser Gly Gln Glu Thr Ser Leu Val Thr305
310 315 320Asp Tyr Val Leu Lys Leu Leu
Gly Leu Asp Ile Cys Ala Asp Thr Leu 325
330 335Val Gly Asp Val Met Arg Arg Gly Ile Ser Gly Gly
Gln Arg Lys Arg 340 345 350Leu
Thr Thr Gly Glu Met Leu Val Gly Pro Ala Thr Ala Leu Phe Met 355
360 365Asp Glu Ile Ser Thr Gly Leu Asp Ser
Ser Thr Thr Phe Gln Ile Cys 370 375
380Lys Phe Met Arg Gln Leu Val His Ile Ala Asp Val Thr Met Val Ile385
390 395 400Ser Leu Leu Gln
Pro Ala Pro Glu Thr Phe Glu Leu Phe Asp Asp Ile 405
410 415Ile Leu Leu Ser Glu Gly Gln Ile Val Tyr
Gln Gly Ser Arg Asp Asn 420 425
430Val Leu Glu Phe Phe Glu Tyr Met Gly Phe Lys Cys Pro Glu Arg Lys
435 440 445Gly Ile Ala Asp Phe Leu Gln
Glu Val Thr Ser Lys Lys Asp Gln Glu 450 455
460Gln Tyr Trp Asn Arg Arg Glu His Pro Tyr Ser Tyr Val Ser Val
His465 470 475 480Asp Phe
Ser Ser Gly Phe Asn Ser Phe His Ala Gly Gln Gln Leu Ala
485 490 495Ser Glu Phe Arg Val Pro Tyr
Asp Lys Ala Lys Thr His Pro Ala Ala 500 505
510Leu Val Thr Gln Lys Tyr Gly Ile Ser Asn Lys Asp Leu Phe
Lys Ala 515 520 525Cys Phe Asp Arg
Glu Trp Leu Leu Met Lys Arg Asn Ser Phe Val Tyr 530
535 540Val Phe Lys Thr Val Gln Ile Thr Ile Met Ser Leu
Ile Ala Met Thr545 550 555
560Val Tyr Phe Arg Thr Glu Met His Val Gly Thr Val Gln Asp Gly Gln
565 570 575Lys Phe Tyr Gly Ala
Leu Phe Phe Ser Leu Ile Asn Leu Met Phe Asn 580
585 590Gly Met Ala Glu Leu Ala Phe Thr Val Met Arg Leu
Pro Val Phe Phe 595 600 605Lys Gln
Arg Asp Phe Leu Phe Tyr Pro Pro Trp Ala Phe Ala Leu Pro 610
615 620Gly Phe Leu Leu Lys Ile Pro Leu Ser Leu Ile
Glu Ser Val Ile Trp625 630 635
640Ile Ala Leu Thr Tyr Tyr Thr Ile Gly Phe Ala Pro Ser Ala Ala Arg
645 650 655Phe Phe Arg Gln
Leu Leu Ala Tyr Phe Cys Val Asn Gln Met Ala Leu 660
665 670Ser Leu Phe Arg Phe Leu Gly Ala Leu Gly Arg
Thr Glu Val Ile Ala 675 680 685Asn
Ser Gly Gly Thr Leu Ala Leu Leu Val Val Phe Val Leu Gly Gly 690
695 700Phe Ile Ile Ser Lys Asp Asp Ile Pro Ser
Trp Leu Thr Trp Cys Tyr705 710 715
720Tyr Thr Ser Pro Met Met Tyr Gly Gln Thr Ala Leu Val Ile Asn
Glu 725 730 735Phe Leu Asp
Glu Arg Trp Gly Ser Pro Asn Asn Asp Thr Arg Ile Asn 740
745 750Ala Lys Thr Val Gly Glu Val Leu Leu Lys
Ser Arg Gly Phe Phe Thr 755 760
765Glu Pro Tyr Trp Phe Trp Ile Cys Ile Gly Ala Leu Leu Gly Phe Thr 770
775 780Val Leu Phe Asn Phe Cys Tyr Ile
Ile Ala Leu Met Tyr Leu Asn Pro785 790
795 800Leu Gly Asn Ser Lys Ala Thr Thr Val Val Glu Glu
Gly Lys Asp Lys 805 810
815His Lys Gly Ser His Ser Gly Thr Gly Gly Ser Val Val Glu Leu Thr
820 825 830Ser Thr Ser Ser His Gly
Pro Lys Lys Gly Met Val Leu Pro Phe Gln 835 840
845Pro Leu Ser Leu Ala Phe Asn Asn Val Asn Tyr Tyr Val Asp
Met Pro 850 855 860Ala Glu Met Lys Ala
Gln Gly Val Glu Gly Asp Arg Leu Gln Leu Leu865 870
875 880Arg Asp Val Gly Gly Ala Phe Arg Pro Gly
Val Leu Thr Ala Leu Val 885 890
895Gly Val Ser Gly Ala Gly Lys Thr Thr Leu Met Asp Val Leu Ala Gly
900 905 910Arg Lys Thr Gly Gly
Tyr Val Glu Gly Ser Ile Asn Ile Ser Gly Tyr 915
920 925Pro Lys Asn Gln Ala Thr Phe Ala Arg Val Ser Gly
Tyr Cys Glu Gln 930 935 940Asn Asp Ile
His Ser Pro His Val Thr Val Tyr Glu Ser Leu Ile Tyr945
950 955 960Ser Ala Trp Leu Arg Leu Ser
Ala Asp Ile Asp Thr Lys Thr Arg Glu 965
970 975Met Phe Val Glu Glu Val Met Glu Leu Val Glu Leu
Lys Pro Leu Arg 980 985 990Asn
Ser Ile Val Gly Leu Pro Gly Val Asp Gly Leu Ser Thr Glu Gln 995
1000 1005Arg Lys Arg Leu Thr Ile Ala Val Glu
Leu Val Ala Asn Pro Ser Ile 1010 1015
1020Ile Phe Met Asp Glu Pro Thr Ser Gly Leu Asp Ala Arg Ala Ala Ala1025
1030 1035 1040Ile Val Met Arg
Thr Val Arg Asn Thr Val Asp Thr Gly Arg Thr Val 1045
1050 1055Val Cys Thr Ile His Gln Pro Ser Ile Asp
Ile Phe Glu Ser Phe Asp 1060 1065
1070Glu Leu Leu Leu Met Lys Arg Gly Gly Gln Val Ile Tyr Ala Gly Thr
1075 1080 1085Leu Gly His His Ser Gln Lys
Leu Val Glu Tyr Phe Glu Ala Ile Glu 1090 1095
1100Gly Val Pro Lys Ile Lys Asp Gly Tyr Asn Pro Ala Thr Trp Met
Leu1105 1110 1115 1120Asp
Val Thr Thr Pro Ser Met Glu Ser Gln Met Ser Val Asp Phe Ala
1125 1130 1135Gln Ile Phe Val Asn Ser Ser
Val Asn Arg Arg Asn Gln Glu Leu Ile 1140 1145
1150Lys Glu Leu Ser Thr Pro Pro Pro Gly Ser Asn Asp Leu Tyr
Phe Arg 1155 1160 1165Thr Lys Tyr
Ala Gln Pro Phe Ser Thr Gln Thr Lys Ala Cys Phe Trp 1170
1175 1180Lys Met Tyr Trp Ser Asn Trp Arg Tyr Pro Gln Tyr
Asn Ala Ile Arg1185 1190 1195
1200Phe Leu Met Thr Val Val Ile Gly Val Leu Phe Gly Leu Leu Phe Trp
1205 1210 1215Gln Thr Gly Thr Lys
Ile Glu Lys Glu Gln Asp Leu Asn Asn Phe Phe 1220
1225 1230Gly Ala Met Tyr Ala Ala Val Leu Phe Leu Gly Ala
Thr Asn Ala Ala 1235 1240 1245Thr
Val Gln Pro Ala Val Ala Ile Glu Arg Thr Val Phe Tyr Arg Glu 1250
1255 1260Lys Ala Ala Gly Met Tyr Ser Ala Ile Pro
Tyr Ala Ile Ser Gln Val1265 1270 1275
1280Ala Val Glu Ile Met Tyr Asn Thr Ile Gln Thr Gly Val Tyr Thr
Leu 1285 1290 1295Ile Leu
Tyr Ser Met Ile Gly Tyr Asp Trp Thr Val Val Lys Phe Phe 1300
1305 1310Trp Phe Tyr Tyr Tyr Met Leu Thr Cys
Phe Val Tyr Phe Thr Leu Tyr 1315 1320
1325Gly Met Met Leu Val Ala Leu Thr Pro Asn Tyr Gln Ile Ala Gly Ile
1330 1335 1340Cys Leu Ser Phe Phe Leu Ser
Phe Trp Asn Leu Phe Ser Gly Phe Leu1345 1350
1355 1360Ile Pro Arg Pro Gln Ile Pro Ile Trp Trp Arg Trp
Tyr Tyr Trp Ala 1365 1370
1375Ser Pro Val Ala Trp Thr Leu Tyr Gly Ile Ile Thr Ser Gln Val Gly
1380 1385 1390Asp Arg Asp Ser Ile Val
His Ile Thr Gly Val Gly Asp Met Ser Leu 1395 1400
1405Lys Thr Leu Leu Lys Asn Gly Phe Gly Phe Asp Tyr Asp Phe
Leu Pro 1410 1415 1420Val Val Ala Val
Val His Ile Ala Trp Ile Leu Ile Phe Leu Phe Ala1425 1430
1435 1440Phe Ala Tyr Gly Ile Lys Phe Leu Asn
Phe Gln Arg Arg 1445 145094221DNAArtificial
Sequencenucleotide sequence encoding AtPDR10 protein 9atggcacatt
acagagtaag ctcagaggta gagaacataa tgaacagaga caggagtcac 60 cgaaaaaacg
aagaagaaga cgaagaggaa gctttgaaat tagcggctat ggagaagttg 120 cagcgtcttc
caacgtatga ccgggcgaga aaggccgtgt taaaagggat cacaggaggt 180 ttcaaggaga
ttgacatgaa agaccttggc ctcgcggaga gaagagagtt attcgataga 240 gttatgacga
tggatgatga agattggcat ggagagtatc taaggaggct aaagagtcgt 300 tttgatagag
tctctctgca tctgccgacg atagaagtcc gatttgaaga tttaaacgtg 360 actgccgaag
cttatgcggg aagcaaaacc gttcccacag tcctgaactc atacgtcaac 420 cttttaaaag
gtattggaac taaaatcaga gttcttccgg atcggaaaaa gagaatctcc 480 attcttaacg
atgttagtgg aatcatcaag cctggcagat tgactctact attgggacca 540 ccgggctctg
gaaaatcgac actactaaaa gcattgtctg gaaagacaga aactggacta 600 agatctacag
ggaaagtgac atacaatggt catgaactgc atgagtttgt gcctgaaaga 660 actgcgggat
acatcgacca atatgatgtt cacttgccgg acctaacagt tcgagaaaca 720 ttaaagtttt
ccgcaaaatg ccaaggagtt ggcacaggct acgatatgct tgctgagtta 780 ctgagacgag
agaaagactt gaatatcaag ccggatcctt acctcgatgc gttaatgaag 840 gcatcggtta
taaaaggaca caaggagtat gtggttacag attacgtttt aaaagtctta 900 ggacttgaga
tatgtgctga tacgatagtt gggaatcata tgaagagagg catctctggt 960 gggcaaaaga
aacgcgtaac gactggcgaa atgttggtcg gtccagttgg agctttcttc 1020atggacaaca
tatcagatgg tttagatagc tcgacgacgt ttcagattgt caagagcatc 1080aagcaaatga
tccatgtttt cgataaaacc gctcttattt ctcttctcca gcctcctcca 1140gagacatttg
agctcttcga tgatgtcatc attcttggag aaggccacat tgtttaccaa 1200ggccctcgag
aagacgtcct cgagtttttt gaatttatgg ggtttaagtg tcctgaaaga 1260aaagggattg
ctgattactt gcaagaaatt ttatccaaaa aagatcaaga acaatattgg 1320gctaatccag
agctgccata tcgttatgta accgcaaaaa aattcgagga aggcttcaaa 1380attcatcatt
tcgggagagc aatgcggtct cagcttgcaa cgccatttga tcgactaaag 1440aatcacagag
cagccctgac aaggacaaca tatggagcta gcaagttgga actactaaag 1500gcatgcttag
aacgagaaag cattctaatg aagaggaact tacgcacttt cgtcttgaag 1560tcacttcagc
taattatcaa tgccattcta atcggagttg tgttttggca acaaaagaac 1620tatcccagca
cggtcgagga tggaatcatc tacatgggag ctatctactt ggaagtgcaa 1680atgattgtgt
tctcggggtt tttcgaactt ccaatgacta tcgataagct tccagtgttc 1740tacaagcaac
gtcattttag cttttacccg tcatgggcat tctcgttacc aacgtcaatc 1800atcaccttcc
ctttatcctt cgttgaagtc ttcattgtgg tcttaataac ttatttcacc 1860attggatatg
atctaaccgt cccatcgttc ctgaaacatt acttagttct agcattgtgc 1920ggacaaatgt
cgtatgggct ttttcgatgt atcgctgcag tgactcgaaa tcatgtggtt 1980tcaaacacaa
tgggatgtct tgctgtgatg tggctgatga cattcagcgg atatgtgttg 2040tcccgaaatc
aagtgcataa atggttgaca tgggcgtact ggacatcacc aatgatgtat 2100atccaaacag
ctgtttcggt taacgaattc cgcagcgagt cttggaaaga tgtaatttct 2160aagaaacctt
tctttaagtt ttcaacgtca cattttaaag atatcaaact taaccgtgta 2220gtgtacgatt
tccagggtct aggagtagcg gtcttgaaat cgcgagaata tggaatatct 2280aagactgcgg
tgttaccgga tgaacgagaa gaagctgata gcaacaatac gaccggcaga 2340gactatacag
gaactacgat ggaacgattc tttgatagag ttgtaacaac aagaacttgc 2400aacgacaaaa
aactgcgtat acctttcaaa cctctatata tgacgttcga gaacatcaca 2460tattctgtag
acaccccaaa ggaaatgaaa gaaaaaggca taagagagaa taaactagta 2520ctattgaatg
gattaagcgg tgcttttagg cccggggttc ttacagcact tatgggcgtg 2580agtggtgcgg
gcaaaactac tttgatggat gtcttagccg gacgtaagaa cacaggatac 2640atccaagggg
aaatatatgt ctctggattt cctaaaaaac aggatagctt tgctcgtgtt 2700tcgggttatt
gcgaacaatc tgacatccat tcccctcttt taactgttta tgagtctctt 2760ctttattctg
catggttgag gttgcctcct gatatcgaca cacatactcg agaggtgatg 2820gaattgatag
agttaaaagc attgagggag atgttggtag gatatgtggg aattagtggg 2880ctttcgaccg
agcaaagaaa aagaatgaca atcgcagtag agcttgtagc caatccttct 2940attcttttca
tggatgagcc tacatccggc ttggatgcta gagctgccgc gattgtcatg 3000aggacagttc
gaaacactgt tgacactgga agaactgttg tatgcaccat tcaccagcca 3060agtattgata
tttttgaatc ctttgatgag cttttcttgt tgacaagagg aggcgaagag 3120atctatgttg
gtccaatagg ccaccattcc tctcaactaa tcgaatactt tgagggaata 3180agaggagtag
gaaaaataaa ggaaggttat aatccagcaa catgggccct tgaagtaaca 3240acaagggcac
aagaagatgt tcttggtgtc acatttgcgc aagtatacaa gaagtcaaac 3300ctctatagga
gaaacaaaga tctgattaag gaactgaaca atattcctcc tcatgcacaa 3360gacattcatt
tctcaacaaa atattcacaa tcctacctct ctcaattcca agcttgcttg 3420tggaagcaac
acaaatcata ttggagaaat gttccttata acgcggtgcg tttcagtttc 3480ggggctgctg
ttggaatcat gtatggaatc atcttttgga gcctcggaaa acgaaaagga 3540acaaggcaag
atatcttcaa tagtgtaggc gcgatgtcaa ccgttgttgg cttcttaagt 3600tcacaaagtg
cggctactgt acgtccagtt gtaatcgctg aacgtactgt tttttatcga 3660gaagccggtg
ctggaatgta ctccgctcta ccctatgcat tttcacaggt gataatcgag 3720atcccatata
caatggctca agcttgcatc tatggagtta ttgtctatgg gatgatagga 3780tacgaatgga
cagcttccaa gttttttttg aacatattct ttaccttcat cagcatcctc 3840tactctatat
acactggtat tatggtcatt tccgtaagcc ctaatcaaga aatcgcttcg 3900atactcaatg
gtgtcatatc cacatcgtgg aacgtctttt caggattcac tattcctcgt 3960cccagaatgc
atgtatggtt gagatggttc acctacgtgt gtcccgggtg gtgggggttg 4020tacggactga
cgatagctca atacggagat gtggagacaa ggctcgatac gggtgagacg 4080gttgttgagt
tcatgaagaa ttattatggt tatgaataca acttcttgtg ggttgtctca 4140cttaccctca
ttgctttctc tatgtttttt gtatttatct atgctttctc tgttaagatt 4200ctgaatttcc
aaaagaggtg a
4221101406PRTArtificial Sequenceamino acid sequence of AtPDR10 protein
10Met Ala His Tyr Arg Val Ser Ser Glu Val Glu Asn Ile Met Asn Arg1
5 10 15Asp Arg Ser His Arg Lys
Asn Glu Glu Glu Asp Glu Glu Glu Ala Leu 20 25
30Lys Leu Ala Ala Met Glu Lys Leu Gln Arg Leu Pro Thr
Tyr Asp Arg 35 40 45Ala Arg Lys
Ala Val Leu Lys Gly Ile Thr Gly Gly Phe Lys Glu Ile 50
55 60Asp Met Lys Asp Leu Gly Leu Ala Glu Arg Arg Glu
Leu Phe Asp Arg65 70 75
80Val Met Thr Met Asp Asp Glu Asp Trp His Gly Glu Tyr Leu Arg Arg
85 90 95Leu Lys Ser Arg Phe Asp
Arg Val Ser Leu His Leu Pro Thr Ile Glu 100
105 110Val Arg Phe Glu Asp Leu Asn Val Thr Ala Glu Ala
Tyr Ala Gly Ser 115 120 125Lys Thr
Val Pro Thr Val Leu Asn Ser Tyr Val Asn Leu Leu Lys Gly 130
135 140Ile Gly Thr Lys Ile Arg Val Leu Pro Asp Arg
Lys Lys Arg Ile Ser145 150 155
160Ile Leu Asn Asp Val Ser Gly Ile Ile Lys Pro Gly Arg Leu Thr Leu
165 170 175Leu Leu Gly Pro
Pro Gly Ser Gly Lys Ser Thr Leu Leu Lys Ala Leu 180
185 190Ser Gly Lys Thr Glu Thr Gly Leu Arg Ser Thr
Gly Lys Val Thr Tyr 195 200 205Asn
Gly His Glu Leu His Glu Phe Val Pro Glu Arg Thr Ala Gly Tyr 210
215 220Ile Asp Gln Tyr Asp Val His Leu Pro Asp
Leu Thr Val Arg Glu Thr225 230 235
240Leu Lys Phe Ser Ala Lys Cys Gln Gly Val Gly Thr Gly Tyr Asp
Met 245 250 255Leu Ala Glu
Leu Leu Arg Arg Glu Lys Asp Leu Asn Ile Lys Pro Asp 260
265 270Pro Tyr Leu Asp Ala Leu Met Lys Ala Ser
Val Ile Lys Gly His Lys 275 280
285Glu Tyr Val Val Thr Asp Tyr Val Leu Lys Val Leu Gly Leu Glu Ile 290
295 300Cys Ala Asp Thr Ile Val Gly Asn
His Met Lys Arg Gly Ile Ser Gly305 310
315 320Gly Gln Lys Lys Arg Val Thr Thr Gly Glu Met Leu
Val Gly Pro Val 325 330
335Gly Ala Phe Phe Met Asp Asn Ile Ser Asp Gly Leu Asp Ser Ser Thr
340 345 350Thr Phe Gln Ile Val Lys
Ser Ile Lys Gln Met Ile His Val Phe Asp 355 360
365Lys Thr Ala Leu Ile Ser Leu Leu Gln Pro Pro Pro Glu Thr
Phe Glu 370 375 380Leu Phe Asp Asp Val
Ile Ile Leu Gly Glu Gly His Ile Val Tyr Gln385 390
395 400Gly Pro Arg Glu Asp Val Leu Glu Phe Phe
Glu Phe Met Gly Phe Lys 405 410
415Cys Pro Glu Arg Lys Gly Ile Ala Asp Tyr Leu Gln Glu Ile Leu Ser
420 425 430Lys Lys Asp Gln Glu
Gln Tyr Trp Ala Asn Pro Glu Leu Pro Tyr Arg 435
440 445Tyr Val Thr Ala Lys Lys Phe Glu Glu Gly Phe Lys
Ile His His Phe 450 455 460Gly Arg Ala
Met Arg Ser Gln Leu Ala Thr Pro Phe Asp Arg Leu Lys465
470 475 480Asn His Arg Ala Ala Leu Thr
Arg Thr Thr Tyr Gly Ala Ser Lys Leu 485
490 495Glu Leu Leu Lys Ala Cys Leu Glu Arg Glu Ser Ile
Leu Met Lys Arg 500 505 510Asn
Leu Arg Thr Phe Val Leu Lys Ser Leu Gln Leu Ile Ile Asn Ala 515
520 525Ile Leu Ile Gly Val Val Phe Trp Gln
Gln Lys Asn Tyr Pro Ser Thr 530 535
540Val Glu Asp Gly Ile Ile Tyr Met Gly Ala Ile Tyr Leu Glu Val Gln545
550 555 560Met Ile Val Phe
Ser Gly Phe Phe Glu Leu Pro Met Thr Ile Asp Lys 565
570 575Leu Pro Val Phe Tyr Lys Gln Arg His Phe
Ser Phe Tyr Pro Ser Trp 580 585
590Ala Phe Ser Leu Pro Thr Ser Ile Ile Thr Phe Pro Leu Ser Phe Val
595 600 605Glu Val Phe Ile Val Val Leu
Ile Thr Tyr Phe Thr Ile Gly Tyr Asp 610 615
620Leu Thr Val Pro Ser Phe Leu Lys His Tyr Leu Val Leu Ala Leu
Cys625 630 635 640Gly Gln
Met Ser Tyr Gly Leu Phe Arg Cys Ile Ala Ala Val Thr Arg
645 650 655Asn His Val Val Ser Asn Thr
Met Gly Cys Leu Ala Val Met Trp Leu 660 665
670Met Thr Phe Ser Gly Tyr Val Leu Ser Arg Asn Gln Val His
Lys Trp 675 680 685Leu Thr Trp Ala
Tyr Trp Thr Ser Pro Met Met Tyr Ile Gln Thr Ala 690
695 700Val Ser Val Asn Glu Phe Arg Ser Glu Ser Trp Lys
Asp Val Ile Ser705 710 715
720Lys Lys Pro Phe Phe Lys Phe Ser Thr Ser His Phe Lys Asp Ile Lys
725 730 735Leu Asn Arg Val Val
Tyr Asp Phe Gln Gly Leu Gly Val Ala Val Leu 740
745 750Lys Ser Arg Glu Tyr Gly Ile Ser Lys Thr Ala Val
Leu Pro Asp Glu 755 760 765Arg Glu
Glu Ala Asp Ser Asn Asn Thr Thr Gly Arg Asp Tyr Thr Gly 770
775 780Thr Thr Met Glu Arg Phe Phe Asp Arg Val Val
Thr Thr Arg Thr Cys785 790 795
800Asn Asp Lys Lys Leu Arg Ile Pro Phe Lys Pro Leu Tyr Met Thr Phe
805 810 815Glu Asn Ile Thr
Tyr Ser Val Asp Thr Pro Lys Glu Met Lys Glu Lys 820
825 830Gly Ile Arg Glu Asn Lys Leu Val Leu Leu Asn
Gly Leu Ser Gly Ala 835 840 845Phe
Arg Pro Gly Val Leu Thr Ala Leu Met Gly Val Ser Gly Ala Gly 850
855 860Lys Thr Thr Leu Met Asp Val Leu Ala Gly
Arg Lys Asn Thr Gly Tyr865 870 875
880Ile Gln Gly Glu Ile Tyr Val Ser Gly Phe Pro Lys Lys Gln Asp
Ser 885 890 895Phe Ala Arg
Val Ser Gly Tyr Cys Glu Gln Ser Asp Ile His Ser Pro 900
905 910Leu Leu Thr Val Tyr Glu Ser Leu Leu Tyr
Ser Ala Trp Leu Arg Leu 915 920
925Pro Pro Asp Ile Asp Thr His Thr Arg Glu Val Met Glu Leu Ile Glu 930
935 940Leu Lys Ala Leu Arg Glu Met Leu
Val Gly Tyr Val Gly Ile Ser Gly945 950
955 960Leu Ser Thr Glu Gln Arg Lys Arg Met Thr Ile Ala
Val Glu Leu Val 965 970
975Ala Asn Pro Ser Ile Leu Phe Met Asp Glu Pro Thr Ser Gly Leu Asp
980 985 990Ala Arg Ala Ala Ala Ile
Val Met Arg Thr Val Arg Asn Thr Val Asp 995 1000
1005Thr Gly Arg Thr Val Val Cys Thr Ile His Gln Pro Ser Ile
Asp Ile 1010 1015 1020Phe Glu Ser Phe
Asp Glu Leu Phe Leu Leu Thr Arg Gly Gly Glu Glu1025 1030
1035 1040Ile Tyr Val Gly Pro Ile Gly His His
Ser Ser Gln Leu Ile Glu Tyr 1045 1050
1055Phe Glu Gly Ile Arg Gly Val Gly Lys Ile Lys Glu Gly Tyr Asn
Pro 1060 1065 1070Ala Thr Trp
Ala Leu Glu Val Thr Thr Arg Ala Gln Glu Asp Val Leu 1075
1080 1085Gly Val Thr Phe Ala Gln Val Tyr Lys Lys Ser
Asn Leu Tyr Arg Arg 1090 1095 1100Asn
Lys Asp Leu Ile Lys Glu Leu Asn Asn Ile Pro Pro His Ala Gln1105
1110 1115 1120Asp Ile His Phe Ser Thr
Lys Tyr Ser Gln Ser Tyr Leu Ser Gln Phe 1125
1130 1135Gln Ala Cys Leu Trp Lys Gln His Lys Ser Tyr Trp
Arg Asn Val Pro 1140 1145
1150Tyr Asn Ala Val Arg Phe Ser Phe Gly Ala Ala Val Gly Ile Met Tyr
1155 1160 1165Gly Ile Ile Phe Trp Ser Leu
Gly Lys Arg Lys Gly Thr Arg Gln Asp 1170 1175
1180Ile Phe Asn Ser Val Gly Ala Met Ser Thr Val Val Gly Phe Leu
Ser1185 1190 1195 1200Ser
Gln Ser Ala Ala Thr Val Arg Pro Val Val Ile Ala Glu Arg Thr
1205 1210 1215Val Phe Tyr Arg Glu Ala Gly
Ala Gly Met Tyr Ser Ala Leu Pro Tyr 1220 1225
1230Ala Phe Ser Gln Val Ile Ile Glu Ile Pro Tyr Thr Met Ala
Gln Ala 1235 1240 1245Cys Ile Tyr
Gly Val Ile Val Tyr Gly Met Ile Gly Tyr Glu Trp Thr 1250
1255 1260Ala Ser Lys Phe Phe Leu Asn Ile Phe Phe Thr Phe
Ile Ser Ile Leu1265 1270 1275
1280Tyr Ser Ile Tyr Thr Gly Ile Met Val Ile Ser Val Ser Pro Asn Gln
1285 1290 1295Glu Ile Ala Ser Ile
Leu Asn Gly Val Ile Ser Thr Ser Trp Asn Val 1300
1305 1310Phe Ser Gly Phe Thr Ile Pro Arg Pro Arg Met His
Val Trp Leu Arg 1315 1320 1325Trp
Phe Thr Tyr Val Cys Pro Gly Trp Trp Gly Leu Tyr Gly Leu Thr 1330
1335 1340Ile Ala Gln Tyr Gly Asp Val Glu Thr Arg
Leu Asp Thr Gly Glu Thr1345 1350 1355
1360Val Val Glu Phe Met Lys Asn Tyr Tyr Gly Tyr Glu Tyr Asn Phe
Leu 1365 1370 1375Trp Val
Val Ser Leu Thr Leu Ile Ala Phe Ser Met Phe Phe Val Phe 1380
1385 1390Ile Tyr Ala Phe Ser Val Lys Ile Leu
Asn Phe Gln Lys Arg 1395 1400
1405114173DNAArtificial Sequencenucleotide sequence encoding AtPDR13
protein 11atggctcaaa caggtgaaga tgttgacaag gcaaagtcct tccaagttga
gtttgcttgt 60 ggaaatggtg ttgatgatga ggagaagctt cggtcgcagt gggcaacagt
tgagagatta 120 ccaactttta aaagggttac tactgctttg ttacacacag gagatgactc
gtcagatatt 180 attgatgtta ctaaacttga ggatgctgag agacggttgt tgattgaaaa
gctcgtcaaa 240 caaatcgaag ctgataacct ccgtttactc aggaaaataa gaaagagaat
cgacgaagtt 300 ggtatagagt taccaacggt ggaagtgagg ttcaatgacc tctctgttga
agcggaatgc 360 caagtagttc atggaaagcc tatcccaact ctttggaata ctatcaaggg
ctcactatct 420 aagttcgttt gttcaaagaa agaaaccaag ataggcatct tgaaaggagt
gagtggaatt 480 gtaaggcctg gaagaatgac attgttgctt ggtcctcctg gttgtggtaa
aaccactctt 540 ctacaagcac tttctggaag actttcccat tctgtaaagg ttggaggaaa
agtaagttat 600 aatggttgct tactttcaga gtttattcca gaaaaaacgt caagttatat
cagtcaaaat 660 gatctacaca ttccagagct gagtgtgaga gagactctcg acttctctgc
gtgttgccaa 720 ggcataggaa gccgtatgga aattatgaaa gagatcagta gaagggagaa
actaaaagaa 780 attgttccag atcctgatat agatgcttac atgaaggcaa tatctgttga
aggtttgaaa 840 aacagtatgc aaactgacta tattctaaag atcctgggac tcgatatctg
tgcagataca 900 cgagcaggag atgccacaag acctggaata tctggtggcc aaaagaggag
gttgacaaca 960 gctactactc tgttaatgga tgaaatatcg aatggtttgg acagctcaac
tacgttccag 1020atagtgtcgt gcctccaaca gttggcacat atagctggag ccaccatact
gatttcactt 1080cttcagcctg caccagaaac atttgagctt tttgacgatg tgattctttt
gggggaagga 1140aagataattt accatgctcc aagagctgat atctgtaaat tctttgaagg
ttgtggattt 1200aaatgtccag agagaaaagg cgttgctgac ttcctccagg aggttatgtc
tagaaaagat 1260caagaacaat attggtgcca cagaagcaag ccctacagtt atatatctgt
tgattcattc 1320attaagaagt ttaacgaatc aaatcttggg tttttgctga aagaagaact
gtcaaagccg 1380tttgataaat cccagactcg caaggatagt ctatgtttta gaaaatactc
actcagtaaa 1440tgggagatgc ttaaagcttg ctcaaggaga gaaattcttt tgatgaaacg
gaattctttc 1500atttacttgt tcaaatctgg actgttagtg ttcaatgcgt tagtcacaat
gaccgttttt 1560ctacaagctg gagctacgag ggatgctcgt catgggaatt atcttatggg
ttctatgttc 1620actgctctct ttagacttct tgccgatggg cttccagaac tcactttgac
tatctccaga 1680ttgggagtgt tctgcaaaca gaaagattta tacttctatc ctgcttgggc
atatgcaatt 1740ccttcgatta tcttaaggat acctctttcg gttcttgatt catttatttg
gacagtactg 1800acatattatg tcattggtta cagtcccgaa gtcggaaggt tcttccggca
cttcattatc 1860ttacttacat tccacctttc atgtatatca atgtttcgcg ctatagcgtc
aatctgtcgc 1920acatttgttg cttgctcaat tactggagct atttcggtat tgcttctcgc
attgtttgga 1980ggctttgtga ttccaaaatc atccatgcct acttggctgg gttggggatt
ctggctttct 2040cccttgtcat atgctgagat tggtttaacc gcaaatgaat ttttctctcc
acggtggaga 2100aagttaacct ctggcaacat tacagccggg gaacaagtgt tagatgtccg
tggattgaat 2160tttggtaggc actcttactg gacagctttt ggtgctttag ttgggtttgt
cttgttcttc 2220aatgccctct acacgttggc cctgacatat cggaataatc cacaaagatc
ccgtgctatt 2280gtctcgcatg ggaagaactc tcagtgctca gaagaagatt ttaaaccctg
tcctgaaatc 2340acatcgcgag ctaaaacagg aaaagttatc ttgcctttta agccactcac
tgtcacattt 2400caaaacgtcc agtattatat tgagactcct caggggaaga cacggcaact
tctctttgat 2460attacaggcg cgttgaagcc cggtgttctc acatctctga tgggtgtcag
tggagcaggg 2520aaaacgactc ttcttgatgt cctttctgga aggaaaaccc gcggtatcat
caaaggagag 2580atcagagtag gcgggtatcc taaggttcaa gaaacatttg cacgagtatc
aggttactgt 2640gaacagtttg atattcattc ccctaatata actgtggaag agtctttgaa
atattctgct 2700tggcttcgac tcccctataa catcgatgca aagaccaaga acgaactcgt
caaagaagtc 2760ctcgagacag ttgagcttga ggatatcaaa gattccatgg tgggacttcc
tggaataagt 2820ggtttatcta cagaacaacg caaaaggctg acaatagccg tggaacttgt
ttctaaccct 2880tccatcatat ttctggatga acctacaaca gggctggatg caagagccgc
agccattgtt 2940atgagagctg tgaaaaatgt tgctgagact gggagaacag ttgtttgcac
gatccaccag 3000cctagcatag atatctttga gacatttgat gagctgatcc tgatgaaaga
tgggggacag 3060cttgtctact atggtcctct tggaaaacat tcaagtaagg ttatcaaata
ctttgagagc 3120atccctggag ttccaaaagt ccaaaagaat tgtaatccag ccacttggat
gttagatatt 3180acttgtaaat ctgcagagca cagacttgga atggattttg cacaagcata
caaggattca 3240actctgtaca aggagaacaa aatggtggtt gaacaactga gttctgcgtc
tctgggatca 3300gaagctctga gctttccttc acgttattca caaacaggtt gggggcaact
aaaggcttgc 3360ctttggaaac aacattgctc gtattggaga aacccttcac ataatctcac
tcgcatagtc 3420ttcatattac tcaattctct gttatgtagc cttctcttct ggcaaaaagc
taaggacata 3480aataatcagc aagatctttt tagcatattt ggctcaatgt acactatagt
aatcttctcg 3540ggaataaaca actgtgcgac agttatgaac ttcattgcaa ccgagcgcaa
tgttttctac 3600cgtgaaaggt ttgcgcggat gtactcctca tgggcgtatt cattttctca
ggtcctagtt 3660gaggttccat actcactact ccagtctcta ctatgtacga tcattgtata
tcctatgatc 3720ggctaccata tgtctgttta caagatgttt tggagcttgt acagcatctt
ctgctcgttg 3780cttatcttca actactgtgg gatgcttatg gttgctttga cgccaaacat
tcacatggca 3840ttgactttgc gctcaacttt tttctccatg gtgaatctgt ttgctggctt
tgtcatgcca 3900aaacagaaaa tcccaaaatg gtggatatgg atgtactacc tgagccctac
atcgtgggtg 3960ttggaaggat tactgagttc gcagtatgga gatgtcgaga aagagataac
agtatttgga 4020gagaagaaga gtgtttcagc tttcttggag gattacttcg gctacaaaca
tgactccttg 4080gctgttgtag cgtttgtcct cattgctttt cctatcatcg ttgcttctct
ttttgccttc 4140ttcatgagca aactcaattt tcaaaagaaa tag
4173121390PRTArtificial Sequenceamino acid sequence of AtPDR13
12Met Ala Gln Thr Gly Glu Asp Val Asp Lys Ala Lys Ser Phe Gln Val1
5 10 15Glu Phe Ala Cys Gly Asn
Gly Val Asp Asp Glu Glu Lys Leu Arg Ser 20 25
30Gln Trp Ala Thr Val Glu Arg Leu Pro Thr Phe Lys Arg
Val Thr Thr 35 40 45Ala Leu Leu
His Thr Gly Asp Asp Ser Ser Asp Ile Ile Asp Val Thr 50
55 60Lys Leu Glu Asp Ala Glu Arg Arg Leu Leu Ile Glu
Lys Leu Val Lys65 70 75
80Gln Ile Glu Ala Asp Asn Leu Arg Leu Leu Arg Lys Ile Arg Lys Arg
85 90 95Ile Asp Glu Val Gly Ile
Glu Leu Pro Thr Val Glu Val Arg Phe Asn 100
105 110Asp Leu Ser Val Glu Ala Glu Cys Gln Val Val His
Gly Lys Pro Ile 115 120 125Pro Thr
Leu Trp Asn Thr Ile Lys Gly Ser Leu Ser Lys Phe Val Cys 130
135 140Ser Lys Lys Glu Thr Lys Ile Gly Ile Leu Lys
Gly Val Ser Gly Ile145 150 155
160Val Arg Pro Gly Arg Met Thr Leu Leu Leu Gly Pro Pro Gly Cys Gly
165 170 175Lys Thr Thr Leu
Leu Gln Ala Leu Ser Gly Arg Leu Ser His Ser Val 180
185 190Lys Val Gly Gly Lys Val Ser Tyr Asn Gly Cys
Leu Leu Ser Glu Phe 195 200 205Ile
Pro Glu Lys Thr Ser Ser Tyr Ile Ser Gln Asn Asp Leu His Ile 210
215 220Pro Glu Leu Ser Val Arg Glu Thr Leu Asp
Phe Ser Ala Cys Cys Gln225 230 235
240Gly Ile Gly Ser Arg Met Glu Ile Met Lys Glu Ile Ser Arg Arg
Glu 245 250 255Lys Leu Lys
Glu Ile Val Pro Asp Pro Asp Ile Asp Ala Tyr Met Lys 260
265 270Ala Ile Ser Val Glu Gly Leu Lys Asn Ser
Met Gln Thr Asp Tyr Ile 275 280
285Leu Lys Ile Leu Gly Leu Asp Ile Cys Ala Asp Thr Arg Ala Gly Asp 290
295 300Ala Thr Arg Pro Gly Ile Ser Gly
Gly Gln Lys Arg Arg Leu Thr Thr305 310
315 320Ala Thr Thr Leu Leu Met Asp Glu Ile Ser Asn Gly
Leu Asp Ser Ser 325 330
335Thr Thr Phe Gln Ile Val Ser Cys Leu Gln Gln Leu Ala His Ile Ala
340 345 350Gly Ala Thr Ile Leu Ile
Ser Leu Leu Gln Pro Ala Pro Glu Thr Phe 355 360
365Glu Leu Phe Asp Asp Val Ile Leu Leu Gly Glu Gly Lys Ile
Ile Tyr 370 375 380His Ala Pro Arg Ala
Asp Ile Cys Lys Phe Phe Glu Gly Cys Gly Phe385 390
395 400Lys Cys Pro Glu Arg Lys Gly Val Ala Asp
Phe Leu Gln Glu Val Met 405 410
415Ser Arg Lys Asp Gln Glu Gln Tyr Trp Cys His Arg Ser Lys Pro Tyr
420 425 430Ser Tyr Ile Ser Val
Asp Ser Phe Ile Lys Lys Phe Asn Glu Ser Asn 435
440 445Leu Gly Phe Leu Leu Lys Glu Glu Leu Ser Lys Pro
Phe Asp Lys Ser 450 455 460Gln Thr Arg
Lys Asp Ser Leu Cys Phe Arg Lys Tyr Ser Leu Ser Lys465
470 475 480Trp Glu Met Leu Lys Ala Cys
Ser Arg Arg Glu Ile Leu Leu Met Lys 485
490 495Arg Asn Ser Phe Ile Tyr Leu Phe Lys Ser Gly Leu
Leu Val Phe Asn 500 505 510Ala
Leu Val Thr Met Thr Val Phe Leu Gln Ala Gly Ala Thr Arg Asp 515
520 525Ala Arg His Gly Asn Tyr Leu Met Gly
Ser Met Phe Thr Ala Leu Phe 530 535
540Arg Leu Leu Ala Asp Gly Leu Pro Glu Leu Thr Leu Thr Ile Ser Arg545
550 555 560Leu Gly Val Phe
Cys Lys Gln Lys Asp Leu Tyr Phe Tyr Pro Ala Trp 565
570 575Ala Tyr Ala Ile Pro Ser Ile Ile Leu Arg
Ile Pro Leu Ser Val Leu 580 585
590Asp Ser Phe Ile Trp Thr Val Leu Thr Tyr Tyr Val Ile Gly Tyr Ser
595 600 605Pro Glu Val Gly Arg Phe Phe
Arg His Phe Ile Ile Leu Leu Thr Phe 610 615
620His Leu Ser Cys Ile Ser Met Phe Arg Ala Ile Ala Ser Ile Cys
Arg625 630 635 640Thr Phe
Val Ala Cys Ser Ile Thr Gly Ala Ile Ser Val Leu Leu Leu
645 650 655Ala Leu Phe Gly Gly Phe Val
Ile Pro Lys Ser Ser Met Pro Thr Trp 660 665
670Leu Gly Trp Gly Phe Trp Leu Ser Pro Leu Ser Tyr Ala Glu
Ile Gly 675 680 685Leu Thr Ala Asn
Glu Phe Phe Ser Pro Arg Trp Arg Lys Leu Thr Ser 690
695 700Gly Asn Ile Thr Ala Gly Glu Gln Val Leu Asp Val
Arg Gly Leu Asn705 710 715
720Phe Gly Arg His Ser Tyr Trp Thr Ala Phe Gly Ala Leu Val Gly Phe
725 730 735Val Leu Phe Phe Asn
Ala Leu Tyr Thr Leu Ala Leu Thr Tyr Arg Asn 740
745 750Asn Pro Gln Arg Ser Arg Ala Ile Val Ser His Gly
Lys Asn Ser Gln 755 760 765Cys Ser
Glu Glu Asp Phe Lys Pro Cys Pro Glu Ile Thr Ser Arg Ala 770
775 780Lys Thr Gly Lys Val Ile Leu Pro Phe Lys Pro
Leu Thr Val Thr Phe785 790 795
800Gln Asn Val Gln Tyr Tyr Ile Glu Thr Pro Gln Gly Lys Thr Arg Gln
805 810 815Leu Leu Phe Asp
Ile Thr Gly Ala Leu Lys Pro Gly Val Leu Thr Ser 820
825 830Leu Met Gly Val Ser Gly Ala Gly Lys Thr Thr
Leu Leu Asp Val Leu 835 840 845Ser
Gly Arg Lys Thr Arg Gly Ile Ile Lys Gly Glu Ile Arg Val Gly 850
855 860Gly Tyr Pro Lys Val Gln Glu Thr Phe Ala
Arg Val Ser Gly Tyr Cys865 870 875
880Glu Gln Phe Asp Ile His Ser Pro Asn Ile Thr Val Glu Glu Ser
Leu 885 890 895Lys Tyr Ser
Ala Trp Leu Arg Leu Pro Tyr Asn Ile Asp Ala Lys Thr 900
905 910Lys Asn Glu Leu Val Lys Glu Val Leu Glu
Thr Val Glu Leu Glu Asp 915 920
925Ile Lys Asp Ser Met Val Gly Leu Pro Gly Ile Ser Gly Leu Ser Thr 930
935 940Glu Gln Arg Lys Arg Leu Thr Ile
Ala Val Glu Leu Val Ser Asn Pro945 950
955 960Ser Ile Ile Phe Leu Asp Glu Pro Thr Thr Gly Leu
Asp Ala Arg Ala 965 970
975Ala Ala Ile Val Met Arg Ala Val Lys Asn Val Ala Glu Thr Gly Arg
980 985 990Thr Val Val Cys Thr Ile
His Gln Pro Ser Ile Asp Ile Phe Glu Thr 995 1000
1005Phe Asp Glu Leu Ile Leu Met Lys Asp Gly Gly Gln Leu Val
Tyr Tyr 1010 1015 1020Gly Pro Leu Gly
Lys His Ser Ser Lys Val Ile Lys Tyr Phe Glu Ser1025 1030
1035 1040Ile Pro Gly Val Pro Lys Val Gln Lys
Asn Cys Asn Pro Ala Thr Trp 1045 1050
1055Met Leu Asp Ile Thr Cys Lys Ser Ala Glu His Arg Leu Gly Met
Asp 1060 1065 1070Phe Ala Gln
Ala Tyr Lys Asp Ser Thr Leu Tyr Lys Glu Asn Lys Met 1075
1080 1085Val Val Glu Gln Leu Ser Ser Ala Ser Leu Gly
Ser Glu Ala Leu Ser 1090 1095 1100Phe
Pro Ser Arg Tyr Ser Gln Thr Gly Trp Gly Gln Leu Lys Ala Cys1105
1110 1115 1120Leu Trp Lys Gln His Cys
Ser Tyr Trp Arg Asn Pro Ser His Asn Leu 1125
1130 1135Thr Arg Ile Val Phe Ile Leu Leu Asn Ser Leu Leu
Cys Ser Leu Leu 1140 1145
1150Phe Trp Gln Lys Ala Lys Asp Ile Asn Asn Gln Gln Asp Leu Phe Ser
1155 1160 1165Ile Phe Gly Ser Met Tyr Thr
Ile Val Ile Phe Ser Gly Ile Asn Asn 1170 1175
1180Cys Ala Thr Val Met Asn Phe Ile Ala Thr Glu Arg Asn Val Phe
Tyr1185 1190 1195 1200Arg
Glu Arg Phe Ala Arg Met Tyr Ser Ser Trp Ala Tyr Ser Phe Ser
1205 1210 1215Gln Val Leu Val Glu Val Pro
Tyr Ser Leu Leu Gln Ser Leu Leu Cys 1220 1225
1230Thr Ile Ile Val Tyr Pro Met Ile Gly Tyr His Met Ser Val
Tyr Lys 1235 1240 1245Met Phe Trp
Ser Leu Tyr Ser Ile Phe Cys Ser Leu Leu Ile Phe Asn 1250
1255 1260Tyr Cys Gly Met Leu Met Val Ala Leu Thr Pro Asn
Ile His Met Ala1265 1270 1275
1280Leu Thr Leu Arg Ser Thr Phe Phe Ser Met Val Asn Leu Phe Ala Gly
1285 1290 1295Phe Val Met Pro Lys
Gln Lys Ile Pro Lys Trp Trp Ile Trp Met Tyr 1300
1305 1310Tyr Leu Ser Pro Thr Ser Trp Val Leu Glu Gly Leu
Leu Ser Ser Gln 1315 1320 1325Tyr
Gly Asp Val Glu Lys Glu Ile Thr Val Phe Gly Glu Lys Lys Ser 1330
1335 1340Val Ser Ala Phe Leu Glu Asp Tyr Phe Gly
Tyr Lys His Asp Ser Leu1345 1350 1355
1360Ala Val Val Ala Phe Val Leu Ile Ala Phe Pro Ile Ile Val Ala
Ser 1365 1370 1375Leu Phe
Ala Phe Phe Met Ser Lys Leu Asn Phe Gln Lys Lys 1380
1385 139013305DNAArtificial Sequencea part of AtPDR12
gene for RNAi 13gcaaatcctt ccatcatatt catggatgaa cctacttcag gattggatgc
acgagctgct 60 gccatcgtta tgaggactgt aaggaacaca gttgacactg gtagaacagt
cgtctgcacc 120 attcaccagc ctagcatcga catctttgaa gcctttgatg agttgttcct
acttaagcgt 180 ggaggtgagg agatatacgt tggacctctt ggccacgaat caacccattt
gatcaactat 240 tttgagagta ttcaaggaat caacaagatc acagaaggat acaacccagc
aacctggatg 300 cttga
305 1428DNAArtificial Sequencerestriction site for HindIII
14aagcttacgc cggccgccgc cgcggcag
28 1528DNAArtificial Sequencerestriction site for BamHI 15ggatcctttg
tatccaagaa atcaaagt 28
1645DNAArtificial SequenceAtPDR12-TFF primer 16cccggggggg atccatggag
ggaactagtt ttcaccaagc gagta 45 1746DNAArtificial
SequenceAtPDR12-TFR primer 17ggatccgcgg ccgcctatcg tttttggaaa ttgaaactct
tgattc 46 1862DNAArtificial SequenceRi-F primer
18ggggacaagt ttgtacaaaa aagcaggctt catggcaaac ccttctatag tattcatgga
60 tg
621960DNAArtificial SequenceRi-R primer 19ggggaccact ttgtacaaga
aagctgggtc ttaatcaagc atccatgctg ccggattatg 60 2018DNAArtificial
Sequenceoligo dT primer 20tttttttttt tttttttt
18 2124DNAArtificial SequenceP123rd-F primer
21ctgcttttgg gtcctccaag ttct
24 2223DNAArtificial SequenceP123rd-R primer 22gagattgaat gtctctggcg cag
23 2320DNAArtificial
SequenceTub-F primer 23gctgacgttt tctgtattcc
20 2420DNAArtificial SequenceTub-R primer
24aggctctgta ttgctgtgat
20 2524DNAArtificial SequenceAtPDR4-F primer 25gcattagtgg gagtaagtgg
tgcc 24 2623DNAArtificial
SequenceAtPDR4-R primer 26ttgagtgtcc cttttggagc caa
23 2724DNAArtificial SequenceAtPDR10-F primer
27gaatggatta agcggtgctt ttag
24 2824DNAArtificial SequenceAtPDR10-R primer 28ttgacatcgc gcctacacta
ttga 24 2924DNAArtificial
SequenceAtPDR12-F primer 29ctgcttttgg gtcctccaag ttct
24 3023DNAArtificial SequenceAtPDR12-R primer
30gagattgaat gtctctggcg cag
23 3120DNAArtificial SequenceLP primer 31gccaagatcc aagacaaaga
20 3220DNAArtificial SequenceRP
primer 32ttacgagcaa gcatcatcaa
20
User Contributions:
Comment about this patent or add new information about this topic:
People who visited this patent also read: | |
Patent application number | Title |
---|---|
20120048900 | ANATOMICALLY ADAPTIVE AND ERGONOMIC LOAD DISTRIBUTION STRAP |
20120048899 | Rescue device for rescuing a child |
20120048898 | Hydration Storage and Dispensing Device |
20120048897 | SPARE TIRE LIFT ASSIST APPARATUS |
20120048896 | DISPENSER FOR FOOD DRESSING |