Patent application title: Methods for Genotyping
Inventors:
Michael H. Shapero (Sunnyvale, CA, US)
Keith W. Jones (Sunnyvale, CA, US)
Keith W. Jones (Sunnyvale, CA, US)
Assignees:
AFFYMETRIX, INC.
IPC8 Class: AC40B2000FI
USPC Class:
506 2
Class name: Combinatorial chemistry technology: method, library, apparatus method specially adapted for identifying a library member
Publication date: 2012-01-12
Patent application number: 20120010087
Abstract:
Novel methods and kits are disclosed for reducing the complexity of a
nucleic acid sample to interrogate a collection of target sequences, for
example, to discriminating between alleles at polymorphic positions in a
genome. Complexity reduction can be accomplished by extension of a
capture probes followed by amplification of the extended capture probe
using common primers. The capture probes may be locus specific and
allele-specific. The amplified sample may be hybridized to an array
designed to interrogate the desired fragments for the presence or absence
of a polymorphism. In some aspects the methods employ allele-specific
extension of oligonucleotides that are complementary to one of the
alleles at the 3' end of the oligonucleotide. The allele-specific
oligonucleotides are resistant to proof reading activity from a
polymerase and may be extended in an allele-specific manner by a DNA
polymerase with a functional 3' to 5' exonuclease activity.Claims:
1. A method of amplifying a collection of target sequences from a nucleic
acid sample the method comprising: generating a collection of capture
probes comprising a plurality of different species of primers wherein
each species comprises a first common sequence that is common to each
capture probe in the collection of capture probes and a 3' variable
region that is specific for a target sequence in the collection of target
sequences; fragmenting the nucleic acid sample; ligating an adaptor
comprising a second common sequence to the fragments, wherein the adaptor
is ligated to the fragments so that the strand that is ligated to the 5'
end of the fragment strands comprises the second common sequence and the
strand that is ligated to the 3' end of the fragments lacks the
complement of the second common sequence and is blocked from extension at
the 3' end; hybridizing the adaptor-ligated fragments to the collection
of capture probes; extending the capture probes to obtain extension
products; and amplifying the extended capture probes with first and
second common sequence primers to obtain an amplified collection of
target sequences.
2. The method of claim 1 wherein an amino group is used to block extension at the 3' end of the adaptor strand that is ligated to the 3' end of the fragments.
3. A method of analyzing a nucleic acid sample comprising: amplifying a collection of target sequences from the nucleic acid sample according to the method of claim 1; hybridizing the amplified collection of target sequences to an array; and analyzing the hybridization pattern to detect the presence or absence of target sequences from the collection of target sequences.
4. A method of genotyping one or more polymorphic locations in a sample comprising: preparing an amplified collection of target sequences from the sample according to the method of claim 1; hybridizing the amplified collection of target sequences to an array designed to interrogate at least one polymorphic location in the collection of target sequences; and analyzing the hybridization pattern to determine the identity of the allele or alleles present at one or more polymorphic location in the collection of target sequences.
5. A method for analyzing sequence variations in a population of individuals comprising; obtaining a nucleic acid sample from each individual; amplifying a collection of target sequences from each nucleic acid sample according to the method of claim 1; hybridizing each amplified collection of target sequences to an array designed to interrogate sequence variation in the collection of target sequences to generate a hybridization pattern for each sample; and analyzing the hybridization patterns to determine the presence or absence of sequence variation in the population of individuals.
6. The method of claim 1 wherein the nucleic acid sample is fragmented by digestion with one or more restriction enzymes.
7. The method of claim 1 wherein prior to amplification the extension products are enriched in the sample to be amplified.
8. The method of claim 1 wherein labeled nucleotides are incorporated into the extension products and the extension products are enriched by affinity chromatography.
9. The method of claim 8 wherein the labeled nucleotides are labeled with biotin and avidin, streptavidin or an anti-biotin antibody is used to isolate extension products.
10. The method of claim 1 wherein prior to amplification the extended capture probes are made double stranded and single stranded nucleic acid in the sample is digested.
11. The method of claim 10 wherein the single stranded nucleic acid in the sample is digested with a nuclease.
12. The method of claim 11 wherein the nuclease is Exonuclease I.
13. The method of claim 1 wherein prior to amplification the extended capture probes are circularized and uncircularized nucleic acid in the sample is digested.
14. The method of claim 13 wherein extended capture probes are circularized by a method comprising: hybridizing an oligonucleotide splint to the extended capture probes, wherein the splint is complementary to the first and second common sequences, thereby juxtaposing the 5' and 3' ends of extended capture probes; and ligating the ends of the extended capture probes to form circular extended capture probes.
15. The method of claim 13 wherein the uncircularized nucleic acid remaining in the sample is digested with a nuclease.
16. The method of claim 15 wherein the nuclease is Exonuclease III.
17. The method of claim 1 wherein there are 100 to 1,500 different target sequences in the collection of target sequences.
18. The method of claim 1 wherein there are 1,000 to 10,000 different target sequences in the collection of target sequences.
19. The method of claim 1 wherein there are 10,000 to 1,000,000 different target sequences in the collection of target sequences.
20. A method of reducing the genetic complexity of a population of nucleic acid molecules and analyzing the sequence of nucleic acids in the reduced complexity sample, the method comprising the steps of: (a) providing on a solid support target fragments of the population captured by hybridization of a fragmented nucleic acid sample to a plurality of capture probes that are covalently attached to a solid support in known locations; (b) separating unbound and non-specifically hybridized nucleic acids from the captured target fragments; (c) amplifying the captured target fragments to obtain a reduced complexity sample; and (d) analyzing a plurality of the amplified target fragments in the reduced complexity sample to determine at least some sequence of the nucleic acids.
22. The method according to claim 20 further comprising the step of ligating an adaptor molecule to at least one end of the target fragments prior to step (a).
23. The method according to claim 22 further comprising the step of amplifying the nucleic acid molecules with at least one primer that comprises a sequence that specifically hybridizes to the sequence of the adaptor molecule.
24. The method according to claim 23 wherein the probes are selected from the group consisting of a plurality of probes that defines a plurality of exons, introns or regulatory sequences from a plurality of genetic loci, a plurality of probes that defines a complete sequence of at least one single genetic locus, a plurality of probes that defines sites known to contain single nucleotide polymorphisms (SNPs), and a plurality of probes that defines an array designed to capture the complete sequence of at least one complete chromosome.
25. The method according to claim 24 wherein the at least one single genetic locus has a size selected from the group consisting of between 100 and 10,000 base pairs or between 4,000 and 500,000 base pairs.
26. A method for determining nucleic acid sequence information about at least one region of nucleic acid, the method comprising the steps of (i) reducing the genetic complexity of a population of nucleic acid molecules according to a method comprising the steps of: (a) providing on a solid support target fragments of the population captured by specific hybridization to a plurality of capture probes wherein the fragmented target molecules are between 100 and 10,000 base pairs in size, by hybridizing fragmented target molecules to a solid support having a plurality of capture probes covalently attached thereto, (b) separating unbound and non-specifically hybridized nucleic acids from the captured target molecules; (c) amplifying the captured target molecules and eluting the captured target molecules from the solid support; and (ii) determining the nucleic acid sequence of the captured target molecules by sequencing at least a portion of the amplified target molecules.
27. The method according to claim 26 wherein the fragmented target molecules are ligated to an adaptor molecule prior to hybridization to the capture probes and wherein the amplification is performed with at least one primer that comprises a sequence that specifically hybridizes to the sequence of the adaptor molecule.
28. A kit comprising adaptor molecules, and a plurality of capture probes on a solid support, wherein the targets are selected from the group consisting of a plurality of coding regions or regulatory sequences from a plurality of genetic loci and a plurality of sites known to contain SNPs and further comprising at least one additional component selected from the group consisting of DNA polymerase, T4 polynucleotide kinase, T4 DNA ligase, a hybridization buffer, a wash buffer, and an elution buffer.
29. A method for reducing the complexity of a genomic sample to obtain a sample that is enriched for a collection of target sequences comprising: (i) hybridizing a collection of target-specific primers to a genomic DNA sample comprising adaptor modified fragments, wherein each target-specific primer comprises a 5' first common sequence that is not complementary to the target sequence and a 3' region that is complementary to the target sequence; (ii) extending the target-specific primers using the adaptor modified fragments as template to obtain primer extension products that have a second common sequence at the 3' end of at least some of the extension products; (iii) annealing a splint oligonucleotide that comprises the complement of the first common sequence and the complement of the second common sequence to the extension products, wherein the splint oligonucleotide brings the 5' and 3' ends of the extension product together; (iv) ligating the 5' and 3' ends of the extension products to form a circular extension product; (v) treat with exonuclease VII to remove uncircularized nucleic acid; and (vi) amplify with PCR.
30. A method of genotyping a plurality of polymorphisms in a nucleic acid sample comprising: (a) mixing the nucleic acid sample with a plurality of pairs of capture probes wherein each pair of capture probes consists of a first and a second allele-specific primer, wherein the first allele-specific primer is complementary to a first allele of a selected polymorphism and includes the polymorphic position and the second allele-specific primer is complementary to a second allele of the selected polymorphism and includes the polymorphic position, wherein said first and second allele-specific primers are resistant to 3' exonuclease activity; (b) subjecting the mixture from a) to a primer extension reaction, wherein said first and second allele-specific primers are extended with a DNA polymerase comprising a proofreading activity to generate first and second allele-specific extension products in the presence of the first and second alleles, respectively; and (c) detecting the presence of said first and second allele-specific extension products, wherein the presence of a first allele-specific extension product is indicative of the presence of the first allele of a selected polymorphism and presence of a second allele-specific extension product is indicative of the presence of the second allele.
31. The method of claim 30 wherein said first and second allele-specific primers comprise 1, 2 or 3 phosphorothioate linkages at the 3' end.
32. The method of claim 30 wherein said first and second allele-specific primers comprise a locked nucleic acid linkage at the 3' end, wherein said linkage is between the terminal 3' base and the penultimate base or between the penultimate base and the base immediately 5' of the penultimate base.
33. The method of claim 30 wherein the nucleic acid sample is an amplified genomic DNA sample obtained by amplifying the nucleic acid sample using random primers and DNA polymerase in an isothermal amplification reaction to obtain an amplified nucleic acid sample and further comprising fragmenting the amplified nucleic acid sample prior to step (a).
34. A method for genotyping a plurality of polymorphisms in a nucleic acid sample, where each polymorphism has a first and a second allele, comprising: incubating the nucleic acid sample with a plurality of beads attached to allele-specific capture probes to allow formation of complexes between target fragments and allele-specific capture probes, wherein the allele-specific capture probes comprise: (i) a linker, (ii) a cleavage region, (iii) a tag region, wherein each different allele-specific probe has a different sequence tag region and wherein the tag region is at least 15 bases; and, (iv) a target-specific region that terminates at its 3' end with a base that is complementary to a polymorphic base in the target; extending the allele-specific capture probes in the presence of labeled nucleotides using the target fragment as template to obtain labeled allele-specific capture probes, wherein extension of the allele-specific capture probes is blocked if there is a mismatch between the polymorphic position and the 3' end of the allele-specific capture probe; separating the target fragment from the labeled allele-specific capture probes; cleaving at least a portion of the labeled allele-specific capture probes from the beads; detecting the released labeled allele-specific capture probes by hybridization to an array of tag probes, wherein said tag probes of known sequence are present at known or determinable locations on said array and each tag probe is complementary to a different tag region present in the allele-specific capture probes; and determining the genotype of said plurality of polymorphisms by determining which alleles are present, wherein the presence of hybridized labeled allele-specific capture probes is indicative of the presence of a particular allele in the nucleic acid sample.
35. The method of claim 34 wherein said step of cleaving comprises an enzymatic step.
36. The method of claim 35 wherein the cleavage region comprises one or more uracil bases and cleavage comprises incubation with a uracil DNA glycosylase to generate abasic sites and the abasic sites are cleaved with an AP endonuclease or with acid or heat treatment.
37. The method of claim 35 wherein the cleavage region comprises one or more inosines and cleavage comprises incubation with an Endonuclease V.
38. The method of claim 34 wherein said step of cleaving comprises photo cleavage of a light sensitive linkage in the capture probe.
39. A method for genotyping a plurality of polymorphisms in a nucleic acid sample comprising: fragmenting the nucleic acid sample to generate fragments; hybridizing a collection of capture probes to target fragments, wherein said capture probes are attached to a solid support at a 5' end and each comprises: (i) a spacer sequence near said 5' end, (ii) a dU region comprising a plurality of uracil residues, (iii) a tag sequence of at least 15 bases that is unique for each species of capture probe, (iv) a target-specific sequence, and (v) an allele-specific nucleotide corresponding to one allele of a polymorphism in said plurality of polymorphisms, wherein the capture probes terminates at its 3' end with said allele-specific nucleotide; extending said capture probes with a DNA polymerase to generate extended capture probes in an allele-specific extension reaction; washing the solid support to remove the target fragments; cleaving the extended capture probes from the solid support by a method comprising photo cleavage or enzymatic cleavage; hybridizing the extended capture probes to an array comprising a plurality of tag probe features, wherein each tag probe feature comprises a different tag probe and wherein said tag probes are complementary to the tag sequences of the capture probes; and detecting the presence of capture probes wherein the presence of an extended capture probe complementary to a selected allele is indicative of the presence of that allele in the nucleic acid sample.
40. The method of claim 39 wherein the solid support comprises a plurality of beads.
41. The method of claim 40 wherein the beads are coated with anti-digoxigenin, and the capture probes comprise a digoxigenin label.
42. The method of claim 39 wherein the capture probes are exonuclease resistant at the 3' end and the DNA polymerase has 3' to 5' exonuclease proof-reading activity.
43. The method of claim 42 wherein the DNA polymerase is selected from the group consisting of T4 DNA polymerase, E coli Klenow fragment, and T7 DNA polymerase.
44. The method of claim 39 wherein the cleavage from the solid support is enzymatic and comprises cleavage with an endonuclease.
45. The method of claim 39 wherein the cleavage from the solid support is enzymatic and comprises treatment with uracil DNA glycosylase and heat or acid treatment.
46. The method of claim 39, wherein the cleavage from the solid support is photocleavage and comprises exposure to UV light with a wavelength between 200 and 400 nanometers.
47. The method of claim 39 wherein the dU region comprises a plurality of inosine residues and the cleavage step comprises cleavage with Endonuclease V.
48. The method of claim 47 wherein the dU region comprises UIUI.
49. The method of claim 39 wherein the 3' end of the capture probes comprises 0, 1, or 3 phosphorothioate linkages.
Description:
RELATED APPLICATIONS
[0001] This application is a continuation-in-part of U.S. application Ser. No. 11/614,948, filed, Dec. 21, 2006, which claims the priority of U.S. Provisional Application No. 60/752,782, filed Dec. 21, 2005 and is a continuation-in-part of U.S. application Ser. No. 11/133,750, filed on May 19, 2005, now abandoned, which is a continuation of U.S. application Ser. No. 11/022,099, filed on Dec. 23, 2004, now abandoned, which is a divisional of U.S. application Ser. No. 10/272,155, filed on Oct. 14, 2002, now U.S. Pat. No. 7,108,976, which claims the priority of U.S. Provisional Application No. 60/389,747, filed on Jun. 17, 2002. Each of these applications is incorporated herein in its entirety by reference for all purposes.
FIELD OF THE INVENTION
[0002] The invention relates to methods for selectively reducing the complexity of a nucleic acid sample and for determining the genotype of one or more polymorphisms using allele-specific primer extension.
BACKGROUND OF THE INVENTION
[0003] The past years have seen a dynamic change in the ability of science to comprehend vast amounts of data. Pioneering technologies such as nucleic acid arrays allow scientists to delve into the world of genetics in far greater detail than ever before. Exploration of genomic DNA has long been a dream of the scientific community. Held within the complex structures of genomic DNA lies the potential to identify, diagnose, or treat diseases like cancer, Alzheimer disease or alcoholism. Exploitation of genomic information from plants and animals may also provide answers to the world's food distribution problems.
[0004] Recent efforts in the scientific community, such as the publication of the draft sequence of the human genome in February 2001, have changed the dream of genome exploration into a reality. Genome-wide assays, however, must contend with the complexity of genomes; the human genome for example is estimated to have a complexity of 3×109 base pairs. Novel methods of sample preparation and sample analysis that reduce complexity may provide for the fast and cost effective exploration of complex samples of nucleic acids, particularly genomic DNA.
[0005] Single nucleotide polymorphisms (SNPs) have emerged as the marker of choice for genome wide association studies and genetic linkage studies. Building SNP maps of the genome will provide the framework for new studies to identify the underlying genetic basis of complex diseases such as cancer, mental illness and diabetes as well as normal phenotypic variation. Due to the wide ranging applications of SNPs there is a continued need for the development of increasingly robust, flexible, and cost-effective technology platforms that allow for genotype scoring of many polymorphisms in large numbers of samples.
[0006] Allele-specific primer extension is one method of analysis of point mutations (Newton et al., Nucleic Acids Res., 17, 2503-2516 (1989). For SNP genotyping the method uses two allele-specific extension primers that differ in their 3'-positions. Each primer matches one allele perfectly but has a 3' mismatch with the other allele. The DNA polymerase has much higher extension efficiency for the perfect match than for the mismatch.
SUMMARY OF THE INVENTION
[0007] The present invention provides for novel methods of sample preparation and analysis comprising managing or reducing the complexity of a nucleic acid sample by amplification of a collection of target sequences using target-specific capture probes. In some embodiments the extended capture probes are attached to a solid support such as beads; in some embodiments the extended capture probes are attached to an array. In some embodiments the amplified collection of target sequences is analyzed by hybridization to an array that is designed to interrogate sequence variation in the target sequences. In some embodiments the amplified collection of target sequences is analyzed by hybridization to an array of tag probes.
[0008] In one embodiment a method of generating a collection of target sequences from a nucleic acid sample is disclosed. The nucleic fragment is fragmented to generate a plurality of fragments. A collection of capture probes is hybridized to the fragments wherein the capture probes are attached to a solid support at a 5' end and comprise a spacer sequence near the 5 end, multiple dU residues, a tag sequence for each species of capture probe, a target sequence, and the 3' end of the capture probes terminates with a specific nucleotide corresponding to the polymorphism. The capture probes are extended in the presence of one or more DNA polymerase. The solid support is washed to remove the fragments. The extended capture probes are cleaved from the solid support via photo or enzymatic cleavage. The tag sequence of the extended capture probes is hybridized to an array comprising a plurality of tag probes. The target sequences are generated containing the polymorphism on the solid support.
[0009] In some embodiments the capture probes are attached to the solid support through a covalent interaction. In another embodiment the solid support comprises a plurality of beads. In some embodiments the beads further comprises anti-digoxigenin, thereby capturing the capture probes with a digoxigenin label at the 5' end.
[0010] In another embodiment the DNA polymerase has a 3' to 5' Exonuclease proofreading activity. In some embodiments the DNA polymerase comprises a mesophilic polymerase. In another embodiment, the DNA polymerase comprises TAQ GOLD polymerase (Life Technologies), VENT polymerase (New England Biolabs), DEEP VENT polymerase (New England Biolabs), T4 DNA Polymerase, E. Coli Klenow fragment, and T7 DNA polymerase. In some embodiments, the beads are washed with 0.15N NaOH to remove fragments of the nucleic acid sample.
[0011] In another embodiment the enzymatic cleavage of the extended capture probes from the solid support uses an endonuclease. In some embodiments the endonuclease comprises uracil DNA glycosylase (UDG). In another embodiment, the enzymatic cleavage of the extended capture probes from the solid support is by heat. In some embodiments, the photo cleavage is accomplished by UV light. In another embodiment, the UV light has a wavelength is between 200 and 400 nanometers.
[0012] In some embodiments, in each extension reaction there is at least one species of labeled dNTP. In another embodiment, one or more species of dNTPs is labeled with biotin. In some embodiment, the labeled nucleotides are incorporated into the extended capture probes. In another embodiment there is one extension reaction wherein four differentially labeled dNTPs are present in the extension reaction.
[0013] In some embodiments the capture probes are extended on a solid support in a 5' to 3' direction. In another embodiment the spacer sequence comprise a run of 2 to 12 T residues. In some embodiments the dU region comprises UIUI and UIUIUI. In another embodiment, Endonuclease V cleaves dI residues. In some embodiments, the 3' end of the capture probes comprises 0, 1, 2 or 3 phosphorothioate linkages.
[0014] In another embodiment, a method for genotyping one or more polymophisms in a nucleic acid sample is disclosed. A collection of target sequences from the sample is generated. The collection of target sequences is hybridized to an array comprising a plurality of tag probes that hybridize to the tag sequences in the extended capture probes. The hybridization pattern is analyzed on each of the arrays to determine at least one genotype.
[0015] In one embodiment, a method of generating a collection of target sequences containing one or more polymorphisms from a nucleic acid sample is disclosed. A collection of capture probes is synthesized comprising a plurality of different species of primers wherein a 5' end of the collection of capture probe is attached to a solid support and a 3' variable region is specific for a target sequence in the collection target sequences and terminates with a specific nucleotide corresponding to the polymorphism. The nucleic acid sample is amplified with a whole genome amplification method. The nucleic acid sample is fragmented to generate fragments. The fragments are hybridized to the collection of capture probes on a solid support. The solid support is washed to remove the fragments. The target sequences containing the polymorphism are generated by extending the capture probes using DNA polymerases.
[0016] In some embodiments, the whole genome amplification method comprises multiple displacement amplification. In another embodiment the primer extension reaction comprises full or partial substitution of one or more labeled dNTPs. In some embodiments, the polymorphism comprises a SNP.
[0017] In another embodiment a method of genotyping one or more polymorphic locations in a sample is disclosed. A collection of target sequences from the sample is generated. The collection of target sequences is hybridized to an array designed to interrogate at least one polymorphic location in the collection of target sequences. The hybridization pattern is analyzed to determine the identity of an allele or alleles present at one or more polymorphic location in the collection of target sequences.
[0018] In one embodiment a method of amplifying a collection of target sequences from a nucleic acid sample is disclosed. A collection of capture probes is generated that has different species of primers each species including a first common sequence and a 3' variable region that is specific for a target sequence in a collection of target sequences. Each target sequence is represented by at least one species of primer which hybridizes to the target sequence and the collection of capture probes is attached to a solid support so that the 3' end of the capture probes is available for extension. The nucleic acid sample is fragmented and an adaptor that has a second common sequence is ligated to the fragments. The adaptor-ligated fragments are hybridized to the collection of capture probes and the capture probes are extended using the hybridized adaptor-ligated fragments as template for extension and thereby incorporating the target sequence and the second common sequence into the 3' end of the extended capture probe. The extended capture probes are then amplified using first and second common sequence primers.
[0019] In some embodiments the capture probes are attached to the solid support through a covalent interaction. In another embodiment there is a tag sequence in the capture probes that is unique for each species of capture probe and the capture probes are attached to the solid support by hybridization to a collection of tag probes that are covalently attached to the solid support. In some embodiments each species of capture probe is attached to the solid support in a discrete location.
[0020] In another embodiment the extended capture probes are released from the solid support prior to amplification. Prior to releasing the extended capture probes from the solid support nucleic acids that are not covalently attached to the solid support may be removed.
[0021] In another embodiment the extended capture probes are enriched prior to amplification. In some embodiments capture probes are enriched by incorporation of labeled nucleotides into the extended capture probes followed by isolation of labeled capture probes by affinity chromatography. In some embodiments capture probes are labeled with biotin and avidin, streptavidin or an anti-biotin antibody, which may be monoclonal, may be used to isolate extended capture probes. In another embodiment extended capture probes are made double stranded and single stranded nucleic acid in the sample is digested by, for example a nuclease, such as, for example Exonuclease I. In another embodiment the extended capture probes are circularized prior to amplification and uncircularized nucleic acid in the sample is digested by, for example, a nuclease, such as, for example, Exonuclease III. In some embodiments the extended capture probes are circularized by hybridizing an oligonucleotide splint to the extended capture probes so that the 5' and 3' ends of extended capture probes are juxtaposed and then ligating the ends of the extended capture probes.
[0022] In one embodiment a method of genotyping one or more polymorphic locations in a sample is disclosed. An amplified collection of target sequences from the sample is prepared and hybridized to an array designed to interrogate at least one polymorphic location in the collection of target sequences. The hybridization pattern is analyzed to determine the identity of the allele or alleles present at one or more polymorphic location in the collection of target sequences.
[0023] In another embodiment a method for analyzing sequence variations in a population of individuals is disclosed. A nucleic acid sample is obtained from each individual and a collection of target sequences from each nucleic acid sample is amplified. Each amplified collection of target sequences is hybridized to an array designed to interrogate sequence variation in the collection of target sequences to generate a hybridization pattern for each sample and the hybridization patterns are analyzed or compared to determine the presence or absence of sequence variation in the population of individuals.
[0024] In another embodiment a method of amplifying a collection of target sequences from a nucleic acid sample in solution is disclosed. A collection of capture probes is generated. The collection includes different species of primers having a first common sequence and a 3' variable region that is specific for a target sequence wherein each target sequence in a collection of target sequences is represented by at least one species of primer which hybridizes to the target sequence. The nucleic acid sample is fragmented and an adaptor is ligated to the fragments so that the strand that is ligated to the 5' end of the fragment strands has a second common sequence and the strand that is ligated to the 3' end of the fragments lacks the second common sequence and is blocked from extension at the 3' end. The adaptor-ligated fragments are hybridized to the collection of capture probes and the capture probes are extended using the hybridized adaptor-ligated fragments as template for extension and thereby incorporating the target sequence and the complement of the second common sequence into the extended capture probes. The extended capture probes are then amplified with first and second common sequence primers.
[0025] In one embodiment an amino group is used to block extension at the 3' end of the adaptor strand.
[0026] In another embodiment a method for genotyping one or more polymorphisms in a nucleic acid sample is disclosed. The nucleic acid sample is fragmented and an adaptor comprising a first common priming sequence is ligated to the fragments. A collection of capture probes is ligated to the fragments. The capture probes have a second common priming sequence, a tag sequence unique for each species of capture probe, a first locus specific sequence, a Type IIs restriction enzyme recognition sequence, and a second locus specific sequence. The Type IIs restriction enzyme recognition sequence is positioned so that the enzyme will cut immediately 5' of the polymorphic base in a target sequence. The capture probes are extended to generate single-stranded extension products and then amplified using the first and second common sequence primers. The amplified product is digested with a Type IIs restriction enzyme and the fragments are extended in the presence of one or more type of labeled ddNTP. In one embodiment the extension is done is four separate reactions, one for each ddNTP and the ddNTPs may be labeled with the same label. The extended fragments are then hybridized to four separate arrays. In another embodiment the ddNTPs are differentially labeled with at least two different labels and the extension reactions may be done in less than four reactions and each reaction may be hybridized to a separate array. The arrays are arrays of tag probes that hybridize to the tag sequences in the capture probes. The hybridization pattern on each of the arrays is analyzed to determine at least one genotype.
[0027] In another embodiment one of the common sequence primers is resistant to nuclease digestion and the sample is treated with a nuclease that cleaves 5' to 3' after the fragments are extended in the presence of labeled ddNTP. In one embodiment the primer is resistant to nuclease digestion because it contains phosphorothioate linkages. In some embodiments the nuclease is T7 Gene 6 Exonuclease. In some embodiments the ddNTPs are labeled with biotin.
[0028] In another embodiment a method for screening for sequence variations in a population of individuals is disclosed. A nucleic acid sample from each individual is provided and the sample is amplified and genotyped by one of the method of the invention and the genotypes from the samples are compared to determine the presence or absence of sequence variation in the population of individuals.
[0029] In another embodiment a kit for amplifying a collection of target sequences is disclosed. The kit has a collection of capture probes that is specific for a collection of target sequences and has a first common sequence that is common to all of the capture probes, an adaptor that has a second common sequence; and a pair of first and second common sequence primers. In another embodiment the collection of capture probes in the kit is covalently attached to a solid support so that the 3' end of the capture probes is available for extension. In another embodiment the kit also provides a restriction enzyme, buffer, DNA polymerase and dNTPs. In some embodiments the restriction enzyme is a Type IIs restriction enzyme. In another embodiment the kit also contains a ligase, dNTPs, ddNTPs, buffer and DNA polymerase. In some embodiments one of the common sequence primers is resistant to nuclease digestion.
[0030] In another embodiment the capture probes also have a tag sequence unique for each species of capture probe and a Type IIs restriction enzyme recognition sequence. In another embodiment the adaptor has a first strand comprising a common sequence and a second strand that does not contain the complement of that common sequence and the second strand is blocked from extension at the 3' end by, for example, an amino group.
[0031] In another embodiment a collection of capture probes attached to a solid support is disclosed. The solid support may be arrays, beads, microparticles, microtitre dishes or gels.
[0032] In another embodiment a plurality of oligonucleotides attached to a solid support is disclosed. The solid support may be arrays, beads, microparticles, microtitre dishes or gels. The oligonucleotides may be released and used for a variety of analysis. The plurality of oligonucleotides may include a collection of capture probes.
BRIEF DESCRIPTION OF THE FIGURES
[0033] FIG. 1 shows a schematic of allele-specific primer extension. Allele-specific primers may be designed to hybridize to either strand.
[0034] FIG. 2 shows a bead-based allele-specific primer extension method.
[0035] FIG. 3 shows a method of detection of tagged extension products on an array of tag probes.
[0036] FIG. 4A shows an array of allele-specific probes with nuclease resistant linkages at the 3' ends of the probes.
[0037] FIG. 4B shows genomic DNA hybridized to the array of allele-specific probes with complementarity between the polymorphic base and the 3' end of the probes.
[0038] FIG. 4C shows genomic DNA hybridized to the array of allele-specific probes with a mismatch between the polymorphic base and the 3' end of the probes.
[0039] FIG. 4D shows extension of the allele-specific probes with a perfect match at the 3' end and absence of extension of allele-specific probes with a mismatch at the 3' end.
[0040] FIG. 5 shows a method of amplifying specific target sequences using a capture probe that is locus specific and genomic DNA that has been ligated to an adaptor. The capture probes are attached to a solid support and extended to incorporate the sequence of interest and the adaptor sequence. The extended capture probes are released from the solid support and amplified with a single primer pair.
[0041] FIG. 6 shows a method where the capture probes are attached to a solid support by hybridization to a probe that is covalently attached to the solid support. The probes on the array are complementary to a tag sequence in the 5' region of the capture probe. The capture probe hybridizes so that the 3' end is available for extension.
[0042] FIG. 7 shows a schematic of solution-based multiplexed SNP genotyping. A sample is fragmented and ligated to an adaptor so that the adaptor sequence that hybridizes to the 3' end of the strands of the fragments is blocked from extension. Locus specific capture probes are hybridized to the fragments and extended in solution then amplified by PCR using primers to A1 and A2. Prior to amplification the extended capture probes may be enriched by, for example, removal of non-extended products or by positive selection of extended products.
[0043] FIGS. 8A and 8B show a method of multiplexed anchored runoff amplification wherein the alleles present at different polymorphic positions are analyzed by hybridization to an array of tag probes. The capture probe includes a recognition site for a Type IIs restriction enzyme so that the enzyme cuts immediately upstream of the polymorphic locus. The capture probe is extended by one labeled nucleotide and the identity of the nucleotide is determined by hybridization to an array or probes that are complementary to the tag sequences in the capture probes.
[0044] FIG. 9 shows an enrichment scheme. Biotin is incorporated into the extended capture probes and biotin labeled extended capture probes are selected by affinity chromatography.
[0045] FIG. 10 shows another enrichment scheme using nuclease that is specific for single stranded nucleic acid. Capture probes that are fully extended through the adaptor site on the genomic DNA fragment are converted to double stranded DNA by annealing and extension of a primer that hybridizes to the adaptor sequence.
[0046] FIG. 11 shows another enrichment scheme. The ends of the extended capture probes are ligated together to form a circle using a splint oligonucleotide that is complementary to the primer sites at the ends of the extended capture probes. The sample is digested with an exonuclease so circularized sequences are protected from digestion.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
(A) General
[0047] The present invention has many preferred embodiments and relies on many patents, applications and other references for details known to those of the art. Therefore, when a patent, application, or other reference is cited or repeated below, it should be understood that it is incorporated by reference in its entirety for all purposes as well as for the proposition that is recited.
[0048] As used in this application, the singular form "a," "an," and "the" include plural references unless the context clearly dictates otherwise. For example, the term "an agent" includes a plurality of agents, including mixtures thereof.
[0049] An individual is not limited to a human being but may also be other organisms including but not limited to mammals, plants, bacteria, or cells derived from any of the above.
[0050] Throughout this disclosure, various aspects of this invention can be presented in a range format. It should be understood that the description in range format is merely for convenience and brevity and should not be construed as an inflexible limitation on the scope of the invention. Accordingly, the description of a range should be considered to have specifically disclosed all the possible sub-ranges as well as individual numerical values within that range. For example, description of a range such as from 1 to 6 should be considered to have specifically disclosed sub-ranges such as from 1 to 3, from 1 to 4, from 1 to 5, from 2 to 4, from 2 to 6, from 3 to 6 etc., as well as individual numbers within that range, for example, 1, 2, 3, 4, 5, and 6. The same holds true for ranges in increments of 105, 104, 103, 102, 10, 10-1, 10-2, 10-3, 10-4, or 10-5, for example. This applies regardless of the breadth of the range.
[0051] The practice of the present invention may employ, unless otherwise indicated, conventional techniques and descriptions of organic chemistry, polymer technology, molecular biology (including recombinant techniques), cell biology, biochemistry, and immunology, which are within the skill of the art. Such conventional techniques include polymer array synthesis, hybridization, ligation, and detection of hybridization using a label. Specific illustrations of suitable techniques can be had by reference to the example herein below. However, other equivalent conventional procedures can, of course, also be used. Such conventional techniques and descriptions can be found in standard laboratory manuals such as Genome Analysis: A Laboratory Manual Series (Vols. I-IV), Using Antibodies: A Laboratory Manual, Cells: A Laboratory Manual, PCR Primer: A Laboratory Manual, and Molecular Cloning: A Laboratory Manual (all from Cold Spring Harbor Laboratory Press), Stryer (anyone have the cite), Gait, "Oligonucleotide Synthesis: A Practical Approach" 1984, IRL Press, London, Nelson and Cox (2000), Lehninger, Principles of Biochemistry 3rd Ed., W.H. Freeman Pub., New York, N.Y. and Berg et al. (2002) Biochemistry, 5th Ed., W.H. Freeman Pub., New York, N.Y. all of which are herein incorporated in their entirety by reference for all purposes.
[0052] The present invention can employ solid substrates, including arrays in some preferred embodiments. Methods and techniques applicable to polymer (including protein) array synthesis have been described in U.S. Patent Publication No. 20050074787, International Publication No. WO 00/58516, U.S. Pat. Nos. 5,143,854, 5,242,974, 5,252,743, 5,324,633, 5,384,261, 5,424,186, 5,451,683, 5,482,867, 5,491,074, 5,527,681, 5,550,215, 5,571,639, 5,578,832, 5,593,839, 5,599,695, 5,624,711, 5,631,734, 5,795,716, 5,831,070, 5,837,832, 5,856,101, 5,858,659, 5,936,324, 5,968,740, 5,974,164, 5,981,185, 5,981,956, 6,025,601, 6,033,860, 6,040,193, 6,090,555, 6,136,269, 6,269,846 and 6,428,752, in PCT Applications Nos. PCT/US99/00730 (International Publication Number WO 99/36760) and PCT/US 01/04285, which are all incorporated herein by reference in their entirety for all purposes.
[0053] Patents that describe synthesis techniques in specific embodiments include U.S. Pat. Nos. 5,412,087, 6,147,205, 6,262,216, 6,310,189, 5,889,165 and 5,959,098 which are each incorporated herein by reference in their entirety for all purposes. Nucleic acid arrays are described in many of the above patents, but the same techniques are applied to polypeptide arrays.
[0054] The present invention also contemplates many uses for polymers attached to solid substrates. These uses include gene expression monitoring, profiling, library screening, genotyping, and diagnostics. Gene expression monitoring and profiling methods can be shown in U.S. Pat. Nos. 5,800,992, 6,013,449, 6,020,135, 6,033,860, 6,040,138, 6,177,248 and 6,309,822. Genotyping and uses therefore are shown in U.S. Pat. Nos. 5,856,092, 6,300,063, 5,858,659, 6,284,460, 6,361,947, 6,368,799, 6,333,179 and 6,872,529 which are each incorporated herein by reference. Other uses are embodied in U.S. Pat. Nos. 5,871,928, 5,902,723, 6,045,996, 5,541,061, and 6,197,506 which are incorporated herein by reference.
[0055] The present invention also contemplates sample preparation methods in certain preferred embodiments. For example, see the patents in the gene expression, profiling, genotyping and other use patents above, as well as U.S. Pat. Nos. 6,582,938, 5,437,990, 5,215,899, 5,466,586, and 4,357,421, and Gubler et al., 1985, Biochemica et Biophysica Acta, Displacement Synthesis of Globin Complementary DNA: Evidence for Sequence Amplification.
[0056] Prior to or concurrent with analysis, the nucleic acid sample may be amplified by a variety of mechanisms, some of which may employ PCR. See, e.g., PCR Technology: Principles and Applications for DNA Amplification (Ed. H. A. Erlich, Freeman Press, NY, N.Y., 1992); PCR Protocols: A Guide to Methods and Applications (Eds. Innis, et al., Academic Press, San Diego, Calif., 1990); Mattila et al., Nucleic Acids Res. 19, 4967 (1991); Eckert et al., PCR Methods and Applications 1, 17 (1991); PCR (Eds. McPherson et al., IRL Press, Oxford); and U.S. Pat. Nos. 4,683,202, 4,683,195, 4,800,159 4,965,188, and 5,333,675, each of which is incorporated herein by reference in their entireties for all purposes. The sample may be amplified on the array. See, for example, U.S. Pat. No. 6,300,070 which is incorporated herein by reference.
[0057] Other suitable amplification methods include the ligase chain reaction (LCR) (e.g., Wu and Wallace, Genomics 4, 560 (1989), Landegren et al., Science 241, 1077 (1988) and Barringer et al. Gene 89:117 (1990)), transcription amplification (Kwoh et al., Proc. Natl. Acad. Sci. USA 86, 1173 (1989) and WO88/10315), self-sustained sequence replication (Guatelli et al., Proc. Nat. Acad. Sci. USA, 87, 1874 (1990), WO/88/10315 and WO90/06995), selective amplification of target polynucleotide sequences (U.S. Pat. No. 6,410,276), consensus sequence primed polymerase chain reaction (CP-PCR) (U.S. Pat. No. 4,437,975), arbitrarily primed polymerase chain reaction (AP-PCR) (U.S. Pat. Nos. 5,413,909, 5,861,245), degenerately primed PCR (DOP-PCR) (See, Telenius et al. Genomics 13: 718-725, 1992 and Cheung and Nelson Proc. Natl. Acad. Sci. 93: 14676-14679, 1996), primer extension PCR (PEP) (See, Zhang et al. Proc. Natl. Acad. Sci. 89: 5847-5851, 1992), and nucleic acid based sequence amplification (NABSA). (See, U.S. Pat. Nos. 5,409,818, 5,554,517, and 6,063,603, each of which is incorporated herein by reference). Other amplification methods that may be used are described in, U.S. Pat. Nos. 6,582,938, 5,242,794, 5,494,810, and 4,988,617, each of which is incorporated herein by reference. In preferred aspects, the sample may be amplified using multiple-displacement amplification (MDA) or OMNIPLEX amplification. MDA uses a highly processive DNA polymerase and random exonuclease resistant primers in an isothermal amplification reaction (Dean et al., Proc. Natl. Acad. Sci. 99: 5261-5266, 2002). The method is based on strand displacement synthesis and generally results in products that are greater than 10 kb in length. The OMNIPLEX amplification method uses random fragmentation of the DNA to form a library of fragments of defined size. The fragments can be amplified using a DNA polymerase (Langmore, Pharmacogenomics 3:557-60, 2002 and US Patent Pub. No. 20030040620).
[0058] Additional methods of sample preparation and techniques for reducing the complexity of a nucleic sample are described in Dong et al., Genome Research 11, 1418 (2001), in U.S. Pat. Nos. 6,300,070, 6,361,947, 6,391,592, 6,958,225, 6,632,611 and 6,872,529 and U.S. Patent Pub. No. 20050260628, and, which are incorporated herein by reference in their entireties.
[0059] The present invention also contemplates detection of hybridization between ligands in certain preferred embodiments. See U.S. Pat. Nos. 5,143,854, 5,578,832; 5,631,734; 5,834,758; 5,936,324; 5,981,956; 6,025,601; 6,141,096; 6,185,030; 6,201,639; 6,218,803; and 6,225,625 and in PCT Application PCT/US99/06097 (published as WO99/47964), each of which also is hereby incorporated by reference in its entirety for all purposes.
[0060] The practice of the present invention may also employ conventional biology methods, software and systems. Computer software products of the invention typically include computer readable medium having computer-executable instructions for performing the logic steps of the method of the invention. Suitable computer readable medium include floppy disk, CD-ROM/DVD/DVD-ROM, hard-disk drive, flash memory, ROM/RAM, magnetic tapes and etc. The computer executable instructions may be written in a suitable computer language or combination of several languages. Basic computational biology methods are described in, e.g. Setubal and Meidanis et al., Introduction to Computational Biology Methods (PWS Publishing Company, Boston, 1997); Salzberg, Searles, Kasif, (Ed.), Computational Methods in Molecular Biology, (Elsevier, Amsterdam, 1998); Rashidi and Buehler, Bioinformatics Basics: Application in Biological Science and Medicine (CRC Press, London, 2000) and Ouelette and Bzevanis Bioinformatics: A Practical Guide for Analysis of Gene and Proteins (Wiley & Sons, Inc., 2nd ed., 2001).
[0061] The present invention may also make use of various computer program products and software for a variety of purposes, such as probe design, management of data, analysis, and instrument operation. See, U.S. Pat. Nos. 5,593,839, 5,795,716, 5,733,729, 5,974,164, 6,066,454, 6,090,555, 6,185,561, 6,188,783, 6,223,127, 6,229,911 and 6,308,170. Computer methods related to genotyping using high density microarray analysis may also be used in the present methods, see, for example, US Patent Pub. Nos. 20050250151, 20050244883, 20050108197, 20050079536 and 20050042654.
[0062] Methods for analysis of genotype using array data are described, for example, in Di, X., et al. (2005) Bioinformatics, 21, 1958-1963, Liu, W., et al. (2003) Bioinformatics, 19, 2397-2403 and Rabbee and Speed (2006) Bioinformatics 22:7-12. Methods for copy number analysis based on hybridization to arrays of oligonucleotides have been disclosed, for example, in US Patent Pub. Nos. 20040157243, 20060134674, 20050130217, and 20050064476.
[0063] Additionally, the present invention may have preferred embodiments that include methods for providing genetic information over networks such as the Internet as shown in U.S. Patent applications 20020183936, 20030100995, 20030120432, 20040002818, and. 20040049354.
[0064] The present invention provides a flexible and scalable method for analyzing complex samples of nucleic acids, such as genomic DNA. These methods are not limited to any particular type of nucleic acid sample: plant, bacterial, animal (including human) total genome DNA, RNA, cDNA and the like may be analyzed using some or all of the methods disclosed in this invention. The word "DNA" may be used below as an example of a nucleic acid. It is understood that this term includes all nucleic acids, such as DNA and RNA, unless a use below requires a specific type of nucleic acid. This invention provides a powerful tool for analysis of complex nucleic acid samples. From experimental design to isolation of desired fragments and hybridization to an appropriate array, the invention provides for fast, efficient and inexpensive methods of complex nucleic acid analysis.
(B) Definitions
[0065] An "array" comprises a support, preferably solid, with nucleic acid probes attached to the support. Preferred arrays typically comprise a plurality of different nucleic acid probes that are coupled to a surface of a substrate in different, known locations. These arrays, also described as "microarrays" or colloquially "chips" have been generally described in the art, for example, U.S. Pat. Nos. 5,143,854, 5,445,934, 5,744,305, 5,677,195, 5,800,992, 6,040,193, 5,424,186 and Fodor et al., Science, 251:767-777 (1991). Each of which is incorporated by reference in its entirety for all purposes.
[0066] Arrays may generally be produced using a variety of techniques, such as mechanical synthesis methods or light directed synthesis methods that incorporate a combination of photolithographic methods and solid phase synthesis methods. Techniques for the synthesis of these arrays using mechanical synthesis methods are described in, e.g., U.S. Pat. Nos. 5,384,261, and 6,040,193, which are incorporated herein by reference in their entirety for all purposes. Although a planar array surface is preferred, the array may be fabricated on a surface of virtually any shape or even a multiplicity of surfaces. Arrays may be nucleic acids on beads, gels, polymeric surfaces, fibers such as fiber optics, glass or any other appropriate substrate. (See U.S. Pat. Nos. 5,770,358, 5,789,162, 5,708,153, 6,040,193 and 5,800,992, which are hereby incorporated by reference in their entirety for all purposes.)
[0067] Arrays may be packaged in such a manner as to allow for diagnostic use or can be an all-inclusive device; e.g., U.S. Pat. Nos. 5,856,174 and 5,922,591 incorporated in their entirety by reference for all purposes.
[0068] Preferred arrays are commercially available from Affymetrix under the brand name GeneChip® and are directed to a variety of purposes, including genotyping and gene expression monitoring for a variety of eukaryotic and prokaryotic species. (See Affymetrix Inc., Santa Clara and their website at affymetrix.com.)
[0069] Nucleic acids according to the present invention may include any polymer or oligomer of pyrimidine and purine bases, preferably cytosine, thymine, and uracil, and adenine and guanine, respectively. (See Albert L. Lehninger, Principles of Biochemistry, at 793-800 (Worth Pub. 1982) which is herein incorporated in its entirety for all purposes). Indeed, the present invention contemplates any deoxyribonucleotide, ribonucleotide or peptide nucleic acid component, and any chemical variants thereof, such as methylated, hydroxymethylated or glucosylated forms of these bases, and the like. The polymers or oligomers may be heterogeneous or homogeneous in composition, and may be isolated from naturally occurring sources or may be artificially or synthetically produced. In addition, the nucleic acids may be DNA or RNA, or a mixture thereof, and may exist permanently or transitionally in single-stranded or double-stranded form, including homoduplex, heteroduplex, and hybrid states.
[0070] An "oligonucleotide" or "polynucleotide" is a nucleic acid ranging from at least 2, preferably at least 8, 15 or 20 nucleotides in length, but may be up to 50, 100, 1000, or 5000 nucleotides long or a compound that specifically hybridizes to a polynucleotide. Polynucleotides of the present invention include sequences of deoxyribonucleic acid (DNA) or ribonucleic acid (RNA) or mimetics thereof which may be isolated from natural sources, recombinantly produced or artificially synthesized. A further example of a polynucleotide of the present invention may be a peptide nucleic acid (PNA). (See U.S. Pat. No. 6,156,501 which is hereby incorporated by reference in its entirety.) The invention also encompasses situations in which there is a nontraditional base pairing such as Hoogsteen base pairing which has been identified in certain tRNA molecules and postulated to exist in a triple helix. "Polynucleotide" and "oligonucleotide" are used interchangeably in this application.
[0071] A genome is all the genetic material of an organism. In some instances, the term genome may refer to the chromosomal DNA. Genome may be multichromosomal such that the DNA is cellularly distributed among a plurality of individual chromosomes. For example, in human there are 22 pairs of chromosomes plus a gender associated XX or XY pair. DNA derived from the genetic material in the chromosomes of a particular organism is genomic DNA. The term genome may also refer to genetic materials from organisms that do not have chromosomal structure. In addition, the term genome may refer to mitochondria DNA. A genomic library is a collection of DNA fragments representing the whole or a portion of a genome. Frequently, a genomic library is a collection of clones made from a set of randomly generated, sometimes overlapping DNA fragments representing the entire genome or a portion of the genome of an organism.
[0072] The term "chromosome" refers to the heredity-bearing gene carrier of a living cell which is derived from chromatin and which comprises DNA and protein components (especially histones). The conventional internationally recognized individual human genome chromosome numbering system is employed herein. The size of an individual chromosome can vary from one type to another with a given multi-chromosomal genome and from one genome to another. In the case of the human genome, the entire DNA mass of a given chromosome is usually greater than about 100,000,000 bp. For example, the size of the entire human genome is about 3×109 bp. The largest chromosome, chromosome no. 1, contains about 2.4×108 bp while the smallest chromosome, chromosome no. 22, contains about 5.3×107 bp.
[0073] A "chromosomal region" is a portion of a chromosome. The actual physical size or extent of any individual chromosomal region can vary greatly. The term "region" is not necessarily definitive of a particular one or more genes because a region need not take into specific account the particular coding segments (exons) of an individual gene.
[0074] An "allele" refers to one specific form of a genetic sequence (such as a gene) within a cell, an individual or within a population, the specific form differing from other forms of the same gene in the sequence of at least one, and frequently more than one, variant sites within the sequence of the gene. The sequences at these variant sites that differ between different alleles are termed "variances", "polymorphisms", or "mutations". At each autosomal specific chromosomal location or "locus" an individual possesses two alleles, one inherited from one parent and one from the other parent, for example one from the mother and one from the father. An individual is "heterozygous" at a locus if it has two different alleles at that locus. An individual is "homozygous" at a locus if it has two identical alleles at that locus.
[0075] The term "fragment," "segment," or "DNA segment" refers to a portion of a larger DNA polynucleotide or DNA. A polynucleotide, for example, can be broken up, or fragmented into, a plurality of segments. Various methods of fragmenting nucleic acid are well known in the art. These methods may be, for example, either chemical or physical in nature. Chemical fragmentation may include partial degradation with a DNase; partial depurination with acid; the use of restriction enzymes; intron-encoded endonucleases; DNA-based cleavage methods, such as triplex and hybrid formation methods, that rely on the specific hybridization of a nucleic acid segment to localize a cleavage agent to a specific location in the nucleic acid molecule; or other enzymes or compounds which cleave DNA at known or unknown locations (see, for example, U.S. Ser. No. 09/358,664). Physical fragmentation methods may involve subjecting the DNA to a high shear rate. High shear rates may be produced, for example, by moving DNA through a chamber or channel with pits or spikes, or forcing the DNA sample through a restricted size flow passage, e.g., an aperture having a cross sectional dimension in the micron or submicron scale. Other physical methods include sonication and nebulization. Combinations of physical and chemical fragmentation methods may likewise be employed such as fragmentation by heat and ion-mediated hydrolysis. See for example, Sambrook et al., "Molecular Cloning: A Laboratory Manual," 3rd Ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (2001) ("Sambrook et al.) which is incorporated herein by reference for all purposes. These methods can be optimized to digest a nucleic acid into fragments of a selected size range. Useful size ranges may be from 100, 200, 400, 700 or 1000 to 500, 800, 1500, 2000, 4000 or 10,000 base pairs. However, larger size ranges such as 4000, 10,000 or 20,000 to 10,000, 20,000 or 500,000 base pairs may also be useful.
[0076] A number of methods disclosed herein require the use of restriction enzymes to fragment the nucleic acid sample. In general, a restriction enzyme recognizes a specific nucleotide sequence of four to eight nucleotides and cuts the DNA at a site within or a specific distance from the recognition sequence. For example, the restriction enzyme EcoRI recognizes the sequence GAATTC and will cut a DNA molecule between the G and the first A. The length of the recognition sequence is roughly proportional to the frequency of occurrence of the site in the genome. A simplistic theoretical estimate is that a six base pair recognition sequence will occur once in every 4096 (46) base pairs while a four base pair recognition sequence will occur once every 256 (44) base pairs. In silico digestions of sequences from the Human Genome Project show that the actual occurrences may be more or less frequent, depending on the sequence of the restriction site. Because the restriction sites are rare, the appearance of shorter restriction fragments, for example those less than 1000 base pairs, is much less frequent than the appearance of longer fragments. Many different restriction enzymes are known and appropriate restriction enzymes can be selected for a desired result. (For a description of many restriction enzymes see, New England BioLabs Catalog which is herein incorporated by reference in its entirety for all purposes).
[0077] Type-IIs endonucleases are a class of endonuclease that, like other endonucleases, recognize specific sequences of nucleotide base pairs within a double stranded polynucleotide sequence. Upon recognizing that sequence, the endonuclease will cleave the polynucleotide sequence, generally leaving an overhang of one strand of the sequence, or "sticky end." The Type-IIs endonucleases are unique because they generally do not require palindromic recognition sequences and they generally cleave outside of their recognition sites. For example, the Type-IIs endonuclease EarI recognizes and cleaves in the following manner:
TABLE-US-00001 ↓ 5'-C-T-C-T-T-C-N-N-N-N-N-3' (SEQ ID NO: 1) 3'-G-A-G-A-A-G-n-n-n-n-n-5' (SEQ ID NO: 2) ↑
[0078] where the recognition sequence is -C-T-C-T-T-C-, N and n represent complementary, ambiguous base pairs and the arrows indicate the cleavage sites in each strand. As the example illustrates, the recognition sequence is non-palindromic, and the cleavage occurs outside of that recognition site.
[0079] Type-IIs endonucleases are generally commercially available and are well known in the art. Specific Type-IIs endonucleases which are useful in the present invention include, e.g., BbvI, BceAI, BfuAI, EarI, AlwI, BbsI, BsaI, BsmAI, BsmBI, BspMI, HgaI, SapI, SfaNI, BsmFI, FokI, and PleI. Other Type-IIs endonucleases that may be useful in the present invention may be found, for example, in the New England Biolabs catalogue. In some embodiments Type-IIs enzymes that generate a recessed 3' end are particularly useful.
[0080] "Adaptor sequences" or "adaptors" are generally oligonucleotides of at least 5, 10, or 15 bases and preferably no more than 50 or 60 bases in length; however, they may be even longer, up to 100 or 200 bases. Adaptor sequences may be synthesized using any methods known to those of skill in the art. For the purposes of this invention they may, as options, comprise primer binding sites, recognition sites for endonucleases, common sequences and promoters. The adaptor may be entirely or substantially double stranded. A double stranded adaptor may comprise two oligonucleotides that are at least partially complementary. The adaptor may be phosphorylated or unphosphorylated on one or both strands. Adaptors may be more efficiently ligated to fragments if they comprise a substantially double stranded region and a short single stranded region which is complementary to the single stranded region created by digestion with a restriction enzyme. For example, when DNA is digested with the restriction enzyme EcoRI the resulting double stranded fragments are flanked at either end by the single stranded overhang 5'-AATT-3', an adaptor that carries a single stranded overhang 5'-AATT-3' will hybridize to the fragment through complementarity between the overhanging regions. This "sticky end" hybridization of the adaptor to the fragment may facilitate ligation of the adaptor to the fragment but blunt ended ligation is also possible. Blunt ends can be converted to sticky ends using the exonuclease activity of the Klenow fragment. For example when DNA is digested with PvuII the blunt ends can be converted to a two base pair overhang by incubating the fragments with Klenow in the presence of dTTP and dCTP. Overhangs may also be converted to blunt ends by filling in an overhang or removing an overhang.
[0081] Methods of ligation will be known to those of skill in the art and are described, for example in Sambrook et at. (2001) and the New England BioLabs catalog both of which are incorporated herein by reference for all purposes. Methods include using T4 DNA Ligase which catalyzes the formation of a phosphodiester bond between juxtaposed 5' phosphate and 3' hydroxyl termini in duplex DNA or RNA with blunt and sticky ends; Taq DNA Ligase which catalyzes the formation of a phosphodiester bond between juxtaposed 5' phosphate and 3' hydroxyl termini of two adjacent oligonucleotides which are hybridized to a complementary target DNA; E. coli DNA ligase which catalyzes the formation of a phosphodiester bond between juxtaposed 5'-phosphate and 3'-hydroxyl termini in duplex DNA containing cohesive ends; and T4 RNA ligase which catalyzes ligation of a 5' phosphoryl-terminated nucleic acid donor to a 3' hydroxyl-terminated nucleic acid acceptor through the formation of a 3'->5' phosphodiester bond, substrates include single-stranded RNA and DNA as well as dinucleoside pyrophosphates; or any other methods described in the art.
[0082] When a fragment has been digested on both ends with the same enzyme or two enzymes that leave the same overhang, the same adaptor may be ligated to both ends. Digestion with two or more enzymes can be used to selectively ligate separate adaptors to either end of a restriction fragment. For example, if a fragment is the result of digestion with EcoRI at one end and BamHI at the other end, the overhangs will be 5'-AATT-3' and 5'GATC-3', respectively. An adaptor with an overhang of AATT will be preferentially ligated to one end while an adaptor with an overhang of GATC will be preferentially ligated to the second end.
[0083] An adaptor may be ligated to one or both strands of the fragmented DNA. In some embodiments a double stranded adaptor is used but only one strand is ligated to the fragments. Ligation of one strand of an adaptor may be selectively blocked. Any known method to block ligation of one strand may be employed. For example, one strand of the adaptor can be designed to introduce a gap of one or more nucleotides between the 5' end of that strand of the adaptor and the 3' end of the target nucleic acid. Adaptors can be designed specifically to be ligated to the termini produced by restriction enzymes and to introduce gaps or nicks. For example, if the target is an EcoRI digested fragment an adaptor with a 5' overhang of TTA could be ligated to the AATT overhang left by EcoRI to introduce a single nucleotide gap between the adaptor and the 3' end of the fragment. Phosphorylation and kinasing can also be used to selectively block ligation of the adaptor to the 3' end of the target molecule. Absence of a phosphate from the 5' end of an adaptor will block ligation of that 5' end to an available 3'OH. For additional adaptor methods for selectively blocking ligation see U.S. Pat. 6,197,557 and U.S. Ser. No. 09/910,292 which are incorporated by reference herein in their entirety for all purposes.
[0084] Adaptors may also incorporate modified nucleotides that modify the properties of the adaptor sequence. For example, phosphorothioate groups may be incorporated in one of the adaptor strands. A phosphorothioate group is a modified phosphate group with one of the oxygen atoms replaced by a sulfur atom. In a phosphorothioated oligo (often called an "S-Oligo"), some or all of the internucleotide phosphate groups are replaced by phosphorothioate groups. The modified backbone of an S-Oligo is resistant to the action of most exonucleases and endonucleases. Phosphorothioates may be incorporated between all residues of an adaptor strand, or at specified locations within a sequence. A useful option is to sulfurize only the last few residues at each end of the oligo. This results in an oligo that is resistant to exonucleases, but has a natural DNA center.
[0085] The term "genotyping" refers to the determination of the genetic information an individual carries at one or more positions in the genome. For example, genotyping may comprise the determination of which allele or alleles an individual carries for a single SNP or the determination of which allele or alleles an individual carries for a plurality of SNPs. For example, a particular nucleotide in a genome may be an A in some individuals and a C in other individuals. Those individuals who have an A at the position have the A allele and those who have a C have the C allele. In a diploid organism the individual will have two copies of the sequence containing the polymorphic position so the individual may have an A allele and a C allele or alternatively two copies of the A allele or two copies of the C allele. Those individuals who have two copies of the C allele are homozygous for the C allele, those individuals who have two copies of the A allele are homozygous for the C allele, and those individuals who have one copy of each allele are heterozygous. The array may be designed to distinguish between each of these three possible outcomes. A polymorphic location may have two or more possible alleles and the array may be designed to distinguish between all possible combinations.
[0086] Polymorphism refers to the occurrence of two or more genetically determined alternative sequences or alleles in a population. A polymorphic marker or site is the locus at which divergence occurs. Preferred markers have at least two alleles, each occurring at frequency of preferably greater than 1%, and more preferably greater than 10% or 20% of a selected population. A polymorphism may comprise one or more base changes, an insertion, a repeat, or a deletion. A polymorphic locus may be as small as one base pair. Polymorphic markers include restriction fragment length polymorphisms, variable number of tandem repeats (VNTR's), hypervariable regions, minisatellites, dinucleotide repeats, trinucleotide repeats, tetranucleotide repeats, simple sequence repeats, insertion elements such as Alu or small insertions or deletions, for example, deletions or insertions of 1-10 bases. The first identified allelic form is arbitrarily designated as the reference form and other allelic forms are designated as alternative or variant alleles. The allelic form occurring most frequently in a selected population is sometimes referred to as the wild type form. Diploid organisms may be homozygous or heterozygous for allelic forms. When an organism carries two identical alleles the organism is homozygous at that position. When an organism carries two different alleles the organism is heterozygous at that position. Normal cells that are heterozygous at one or more loci may give rise to tumor cells that are homozygous at those loci. This loss of heterozygosity may result from structural deletion of normal genes or loss of the chromosome carrying the normal gene, mitotic recombination between normal and mutant genes, followed by formation of daughter cells homozygous for deleted or inactivated (mutant) genes; or loss of the chromosome with the normal gene and duplication of the chromosome with the deleted or inactivated (mutant) gene.
[0087] Single nucleotide polymorphisms (SNPs) are positions at which two alternative bases occur at appreciable frequency (generally greater than 1%) in the human population, and are the most common type of human genetic variation. The site is usually preceded by and followed by highly conserved sequences of the allele (e.g., sequences that vary in less than 1/100 or 1/1000 members of the populations).
[0088] A single nucleotide polymorphism usually arises due to substitution of one nucleotide for another at the polymorphic site. A transition is the replacement of one purine by another purine or one pyrimidine by another pyrimidine. A transversion is the replacement of a purine by a pyrimidine or vice versa. Single nucleotide polymorphisms can also arise from a deletion of a nucleotide or an insertion of a nucleotide relative to a reference allele.
[0089] A diallelic polymorphism has two forms in a population. A triallelic polymorphism has three forms. A polymorphism between two nucleic acids can occur naturally, or be caused by exposure to or contact with chemicals, enzymes, or other agents, or exposure to agents that cause damage to nucleic acids, for example, ultraviolet radiation, mutagens or carcinogens.
[0090] The design and use of allele-specific probes for analyzing polymorphisms is described by e.g., Saiki et al., Nature 324, 163-166 (1986); Dattagupta, EP 235,726, Saiki, and WO 89/11548. Allele-specific probes can be designed that hybridize to a segment of target DNA from one individual but do not hybridize to the corresponding segment from another individual due to the presence of different polymorphic forms in the respective segments from the two individuals. Hybridization conditions should be sufficiently stringent that there is a significant difference in hybridization intensity between alleles, and preferably an essentially binary response, whereby a probe hybridizes to only one of the alleles.
[0091] The term "linkage" as used herein describes the tendency of genes, alleles, loci or genetic markers to be inherited together as a result of their location on the same chromosome. Linkage can be measured in various ways.
[0092] "Linkage disequilibrium", or LD", as used herein, refers to the preferential association of a particular allele or genetic marker with a specific allele, or genetic marker at a nearby chromosomal location more frequently than expected by chance for any particular allele frequency in the population. For example, if locus X has alleles a and b, which occur equally frequently, and linked locus Y has alleles c and d, which occur equally frequently, one would expect the combination ac to occur with a frequency of 0.25. If ac occurs more frequently, then alleles a and c are in linkage disequilibrium.
[0093] Linkage disequilibrium may result from natural selection of certain combination of alleles or because an allele has been introduced into a population too recently to have reached equilibrium with linked alleles. A marker in linkage disequilibrium can be particularly useful in detecting susceptibility to disease (or other phenotype) notwithstanding that the marker does not cause the disease. For example, a marker (X) that is not itself a causative element of a disease, but which is in linkage disequilibrium with a gene (including regulatory sequences) (Y) that is a causative element of a phenotype, can be detected to indicate susceptibility to the disease in circumstances in which the gene Y may not have been identified or may not be readily detectable.
[0094] Linkage can be analyzed by calculation of LOD (log of the odds) values. A lod value is the relative likelihood of obtaining observed segregation data for a marker and a genetic locus when the two are located at a recombination fraction (θ), versus the situation in which the two are not linked, and thus segregating independently (Thompson & Thompson, Genetics in Medicine (5th ed, W. B. Saunders Company, Philadelphia, 1991); Strachan, "Mapping the human genome" in The Human Genome (BIOS Scientific Publishers Ltd, Oxford), Chapter 4). A series of likelihood ratios are calculated at various recombination fractions (θ), ranging from θ.=0.0 (coincident loci) to θ.=0.50 (unlinked). Thus, the likelihood at a given value of θ is: probability of data if loci linked at 0 to probability of data if loci unlinked. The computed likelihoods are usually expressed as the log 10 of this ratio (i.e., a lod score). For example, a lod score of 3 indicates 1000:1 odds against an apparent observed linkage being a coincidence. The use of logarithms allows data collected from different families to be combined by simple addition. Computer programs are available for the calculation of lod scores for differing values of θ (e.g., LIPED, MLINK (Lathrop, Proc. Nat. Acad. Sci. (USA) 81:3443-3446 (1984)). For any particular lod score, a recombination fraction may be determined from mathematical tables. See Smith et al., Mathematical tables for research workers in human genetics (Churchill, London, 1961); Smith, Ann. Hum. Genet. 32:127-150 (1968). The value of θ at which the lod score is the highest is considered to be the best estimate of the recombination fraction.
[0095] Positive lod score values suggest that the two loci are linked, whereas negative values suggest that linkage is less likely (at that value of θ) than the possibility that the two loci are unlinked. By convention, a combined lod score of +3 or greater (equivalent to greater than 1000:1 odds in favor of linkage) is considered definitive evidence that two loci are linked. Similarly, by convention, a negative lod score of -2 or less is taken as definitive evidence against linkage of the two loci being compared. Negative linkage data are useful in excluding a chromosome or a segment thereof from consideration. The search focuses on the remaining non-excluded chromosomal locations.
[0096] The term "target sequence", "target nucleic acid" or "target" refers to a nucleic acid of interest. The target sequence may or may not be of biological significance. As non-limiting examples, target sequences may include regions of genomic DNA which are believed to contain one or more polymorphic sites, DNA encoding or believed to encode genes or portions of genes of known or unknown function, DNA encoding or believed to encode proteins or portions of proteins of known or unknown function, and DNA encoding or believed to encode regulatory regions such as promoter sequences, splicing signals, polyadenylation signals, etc. The number of sequences to be interrogated can vary, but preferably are from about 1000, 2,000, 5,000, 10,000, 20,000 or 100,000 to 5000, 10,000, 100,000, 1,000,000 or 3,000,000 target sequences.
[0097] Statistical and computational methods for mapping of complex traits are disclosed, for example, in McKeigue et al., Am. J. Hum. Genet. 76:1-7 (2005), Lander and Shork, Science 265:2037-2048 (1994), McKeigue, Am. J. Hum. Genet. 63:241-251 (1998), and Patterson et al., Am. J. Hum. Genet. 74:979-1000 (2004).
[0098] Capture probes are oligonucleotides that have a 5' common sequence and a 3' locus or target-specific region or primer. The locus or target-specific region is designed to hybridize near a region of nucleic acid that includes a region of interest so that the locus or target-specific region of the capture probe can be used as a primer and be extended through the region of interest to make a copy of the region of interest. The common sequence in the capture probe may be used as a priming site in subsequent rounds of amplification using a common primer or a limited number of common primers. The same common sequence may be present in many or all or the capture probes in a collection of capture probes. Capture probes may also comprise other sequences, for example, tag sequences that are unique for different species of capture probes, and endonuclease recognition sites.
[0099] A tag or tag sequence is a selected nucleic acid with a specified nucleic acid sequence. A tag probe has a region that is complementary to a selected tag. A set of tags or a collection of tags is a collection of specified nucleic acids that may be of similar length and similar hybridization properties, for example similar Tm. The tags in a collection of tags bind to tag probes with minimal cross hybridization so that a single species of tag in the tag set accounts for the majority of tags which bind to a given tag probe species under hybridization conditions. For additional description of tags and tag probes and methods of selecting tags and tag probes see U.S. Pat. Nos. 6,458,530 and 7,157,564 and EP 0799897, each of which is incorporated herein by reference in their entirety.
[0100] A collection of capture probes may be designed to interrogate a collection of target sequences. The collection would comprise at least one capture probe for each target sequence to be amplified and preferably one capture probe for each allele of each polymorphism being interrogated. There may be multiple different capture probes for a single target sequence in a collection of capture probes, for example, there may be a capture probe that hybridizes to one strand of the target sequence and a capture probe that hybridizes to the opposite strand of the target sequence, these may be referred to as a forward locus or target-specific primer and a reverse locus or target-specific primer. In preferred embodiments the capture probes have a region that is complementary to the region immediately 3' of the polymorphic position.
(C) Generating Target Sequences Containing One or More Polymorphisms
[0101] Generally, the invention provides methods for generating a collection of target sequences containing one or more polymorphisms from a nucleic sample using extension of allele-specific probes (capture probes) that are modified to resist proof-reading activity. This allows for the use of a DNA polymerase that has a functional 3' to 5' proof reading activity as described in Lin-Ling et al., J Biochem Mol. Biol. 38:24-7 (2005), Liao et al., Acta Pharmacol Sin. 26:302-6 (2005), and Zhang et al., Trends Biotechnol. 23:92-96 (2005). The extension may be performed using capture probes that are attached to solid supports, such as beads or glass substrates or capture probes in solution. Modifications that may be used include, for example, phosphorothioate linkages and locked nucleic acid (LNA) modifications that block mismatch excision during proofreading--otherwise the mismatched base would simply be excised and the primer would be extended. Preferably the LNA residue is at the penultimate position of the primer. LNA is further described, for example, in Jepsen et al., Oligonucleotides 14:130-146 (2004) and Petersen and Wengel, Trends Biotechnol 21:74-81 (2003). The methods are related to those disclosed in U.S. Pat. No. 7,108,976, which is incorporated herein by reference in its entirety.
[0102] FIG. 1 shows a schematic of allele-specific amplification of a selected polymorphic locus. The polymorphism [101] in a double stranded segment of DNA is hybridized with an allele-specific primer that is complementary to one strand or the other [103 and 105]. ASF designates the allele-specific forward primer and ASR the allele-specific reverse primer. Similarly, LSF and LSR refer to the locus specific forward and reverse primers. In preferred aspects both strands are interrogated, but one of skill in the art will appreciate that either strand may be interrogated individually. The allele-specific primer is extended and the extension product is further amplified using the allele-specific primer and a locus specific primer [107 and 109] that is complementary to a region downstream of the polymorphism. A separate allele-specific primer is designed for each possible allele of the polymorphism. For example, for a biallelic polymorphism there are two allele-specific probes, an A and a B allele probe, for each strand being interrogated. If the polymorphism is a SNP with alleles C or T, the allele-specific probe to detect the C allele preferably terminates at the 3' end with a G and the allele-specific probe to detect the T allele preferably terminates at the 3' end with an A. In preferred aspects the 3' terminal base in the allele-specific probe is complementary to the variable position or positions of the polymorphism. In another aspect the penultimate position in the probe is complementary to the variable position.
[0103] FIG. 2 shows a method of allele-specific primer extension using primers attached to beads [201]. The primer has a poly T region [207], a cleavage region [209], a tag region [211] and an allele-specific primer region [213] that is complementary to the target with the 3' base being complementary to the interrogation position [203] in the target [205]. The target hybridizes to the allele-specific primer and if there is a perfect match between the 3' end of the primer and the target, the primer is extended using a polymerase with exonuclease activity. Labeled nucleotides are present in the extension reaction and are incorporated into the extension product [215]. Following extension, the extension products may be separated from bound target by denaturation and from other nucleic acid in the sample by separation of the beads from the solution. The target strand may be removed, for example, by washing with 0.15 N NaOH, and the extension product may be cleaved in the cleavage region to release a portion [217] of the extension product that has the tag region, the allele-specific region and the labeled extended region. The released product may be detected by hybridization to a tag array. Each different allele to be detected has a different associated tag sequence which hybridizes to a different location on an array of tag probes. In some embodiments the cleavage region [209] includes one or more dU residues, one or more dI residues, a photo cleavable residue or an enzymatic cleavage site. In another embodiment capture probes and target form hybrids in solution and the hybrids are captured using a bead that has affinity for the capture probe. For example, the capture probe may be labeled at the 5' end with dignoxigenin and captured using a bead coated with anti-digoxigenin or the capture probe may be labeled at the 5' end with biotin and captured with a streptavidin coated bead.
[0104] After release from the bead or solid support, the product [217] may then be analyzed by, for example, hybridization to an array as shown in FIG. 3. The figure shows two different extension products [301 and 302] hybridized to different features [311 and 312] of and array. Each feature contains many copies of a different oligonucleotide [307]. The oligonucleotide is complementary to the tag region [303 and 315] of the extended capture probes [301 and 302]. Different features have probes of different sequence so that each feature hybridizes to a different tag sequence. The allele-specific primer region of the capture probes [305 and 309] remain single stranded. Information about the region of interest can be determined by analysis of the hybridization pattern. Detection of labeled capture probes at a feature indicates that the allele-specific portion of the capture probe attached to a specific tag sequence has been extended so that allele is present in the sample. Additional features [325] are shown. Preferably the array will have more than 1,000, more than 10,000 or more than 100,000 different features each with many copies of a different oligonucleotide probe sequence complementary to a different tag sequence. For a bialleleic SNP, for example, each allele will have a distinct (allele-specific) capture probe that is labeled with a unique tag sequence so that the capture probe for each allele can be separately detected by hybridization to a distinct feature on the array. Individual features may also be beads and features may be present in multiples, for example, 2 or more beads or features with the same probe.
[0105] In FIG. 4A the allele-specific capture probes [405, 407, 409 and 411] are attached to individual features [413] of an array. The 5' end of the probes is associated with the solid support. In this example allele-specific probes are shown for each strand and each allele of the biallelic SNP [401]. Each feature associated with a given SNP interrogates one allele in a strand-specific manner. The discrimination position [415] changes according to the allele to be detected. A single phosphorothioate linkage [403] is shown immediately 5' to the discrimination position.
[0106] In FIG. 4B genomic DNA is shown hybridized to the array in a locus specific manner. The capture probes are hybridized with perfectly matched target sequence. In preferred aspect the target is prepared for hybridization by amplifying genomic DNA with an unbiased whole genome amplification method such as Multiple Displacement Amplification or OMNIPLEX amplification. Amplified DNA is fragmented to a size range optimal for hybridization using chemical or enzymatic means prior to hybridization to an array. Increasingly stringent washing conditions are used to remove non-specifically hybridized target and target that has a mismatch at the 3' end of the probe. As shown in FIG. 4C some target may hybridize with a mismatch at the interrogation position, but as shown in FIG. 4D target hybridized with a mismatch should not be extended. FIG. 4D shows extension of the probes that are hybridized in a locus specific manner [441] with incorporation of label (B) and failure to extend and label the probes hybridized with a mismatch at the interrogation position [443]. The mismatch at the terminal base of the capture probe prevents extension of the probe by the DNA polymerase. The extension is performed on the array using a DNA polymerase with 3' to 5' enxonuclease proof reading activity. The primer extension reactions may contain one or more labeled dNTPs, for example a biotinylated nucleotide such as DLR.
[0107] The amplified sample may be analyzed by any method known in the art, for example, MALDI-TOF mass spec, capillary electrophoresis, OLA, LCR, RCA, dynamic allele-specific hybridization (DASH) or TAQMAN® assays (Applied Biosystems, Foster City, Calif.). For other methods of genotyping analyses see Syvanen, Nature Rev. Gen. 2:930-942 (2001) which is incorporated by reference in its entirety.
[0108] In one embodiment a method for generating a collection of target sequences containing 3' ends specific for each allele for a given SNP using a bead-based solid support is disclosed. (For a description of a bead-based solid support for amplifying complex genomic DNA, see Gunderson et al, Nat. Gen. 37:549-554 (2005) and U.S. Patent Pub. 20050059048, each of which is herein incorporated by reference in its entirety). Each capture probe is attached covalently to a solid support and comprises a spacer sequence, multiple dU residues, a tag sequence that is unique for each species of capture probe, and a target-specific sequence. The solid support is preferably beads but any suitable solid support known in the art may be used, for example, arrays, microparticles, microtitre dishes and gels. In one aspect the bead-based solid support comprises anti-digoxigenin antibodies. The 3' end of the capture probes terminates with a specific nucleotide corresponding to a polymorphism, including the SNP. The 3' end of the capture comprises 0, 1, or 3 phosphorothioate linkages. The spacer sequence may comprise multiple T residues, such as T2 through T12. Preferably, the spacer sequence is a T6. It serves as a linker to move the multiple dU sequences away from the solid support. The multiple dU residues may comprise UIUI or UIUIUI wherein dI represents an inosine base.
[0109] The multiple dU residues serve as a mechanism to release the oligonucleotides, such as the capture probes, from the solid support. The dU residues can be used with UNG to create an abasic site and then this can lead to back bone cleavage under conditions of high temperature and basic pH. An endonuclease comprising uracil DNA glycosylase (UDG) may be used to cleave the dU residues. Alternatively, dI residues can be used in conjunction with E. coli Endonuclease V to cleave the phosphodiester backbone. Beads with capture probes are loaded and hybridized with fragmented nucleic acid. The fragmented nucleic acid comprises genomic DNA. The beads are then washed and primer extension reaction of the capture probes is carried out using DNA polymerases with exo activity, including exo plus or minus, in combination with capture probes with the phosphorothioate linkage to achieve high allelic specificity. Such DNA polymerases may include mesophilic polymerases, such as T4 DNA polymerase, E. coli Klenow fragment, T7 DNA polymerase, or thermophilic DNA polymerases such as TAQ GOLD polymerase (Life Technologies), VENT polymerase and DEEP VENT polymerase (both New England Biolabs). The DNA polymerase preferably has a 3'→5' exo proofreading activity. There is at least one species of labeled dNTP in each extension reaction. Biotin is one of the labels in one or more species of dNTPs. The labeled nucleotides are incorporated into the extended capture probes. There is one extension reaction wherein four differentially labeled dNTPs are present in the extension reaction. The capture probes are extended on the solid support in a 5' to 3' direction. Nucleic acid fragments, such as genomic DNA, hybridized to the extended capture probes are removed by washing the beads with 0.15 N NaOH. This condition denatures any DNA duplex and results in single stranded DNA. The extended capture probes are then cleaved from the beads either via photo or enzymatic cleavage and hybridized to an array-based solid support comprising a plurality of tag probes. For example, the extended capture probes may contain a photo cleavable biotin modification. Upon exposure to UV light, photo cleavage occurs. The wavelength of the UV light can range from 200 nanometers to 400 nanometers. Enzymatic cleavage includes use of heat or an endonuclease. The tag sequence of the extended capture probes is hybridized to an array comprising a plurality of tag probes. The hybridization pattern is analyzed on each of the arrays to determine at least one genotype. Target sequences containing the polymorphism on the solid support are generated. Each allele-specific capture probe is related to a unique tag array probe.
[0110] In another embodiment, a method of generating a collection of target sequences containing a polymorphism, such as a SNP, from a nucleic acid sample on an array-based solid support is disclosed. A collection of capture probes comprises a plurality of different species of primers. A 5' end of the capture probes is bound to an array surface with a spacer sequence and a 3' variable region that is specific for a target sequence in a collection of target sequence. Optionally, the spacer sequence at the 5' end of the capture probes may contain multiple T residues, ranging from T2 to T12. The 3' end of the capture probes terminate with a specific nucleotide corresponding to a location of SNP. This terminal base is associated with a 0, 1, or 3 phosphorothioate linkage to make the target sequences resistant to proof-reading activity from the DNA polymerases. Each corresponding SNP location interrogates one allele in a strand-specific manner. Nucleic acid sample, such as genomic DNA, is first amplified using a whole genome amplification method, including MDA (using φ29 DNA polymerase) or OMNIPLEX amplification (Rubicon Genomics). The amplified genomic DNA is then fragmented to a size range optimal to array hybridization. The fragmented genomic DNA is hybridized to the array containing capture probes. After the hybridization reaction, the array with extended capture probes is washed under a series of increasingly stringent conditions. The wash conditions for the array-based solid support to reduce non-specific hybridization could be from two times of SSC in 0.1% SDS at room temperature to 0.2 times of SSC and 0.1% SDS at an elevated temperature, such as 68° C. Such stringent conditions may prevent target sequences with a mismatch to the 3' end of the capture probes from forming. The hybridization pattern may be analyzed to determine the identity of an allele or alleles present at one or more polymorphic location in the collection of target sequences.
[0111] In many embodiments, the nucleic acid samples containing a SNP are amplified in solution without any adapters. The allele-specific forward primers and standard reverse primers for each strand are used to amplify a target-specific sequence. The allele-specific forward primers have 0, 1, and 3 phosphorothioate linkages. The DNA polymerases used have 3' to 5' Exo proof-reading activity. These polymerases may comprise mesophilic polymerases. The DNA polymerases may include TAQ GOLD polymerase (Life Technologies), VENT polymerase, DEEP VENT polymerase (both New England Biolabs), T4 DNA polymerase, E coli Klenow fragment, or T7 DNA polymerase. The primer extension reaction comprises full or partial substitution of one or more labeled dNTPs. The labeled dNTPs comprise biotin-labelled dNTPs. The array may be substituted for another solid support such as beads, microparticles, microtitre dishes, and gels. The capture probes are extended on a solid support in a 5' to 3' direction. The polymorphism comprises an SNP.
[0112] The hybridization and extension of capture probes are done while the capture probes are attached to a solid support. Following extension of the capture probes nucleic acids that are not covalently attached to the solid support may be washed away. The extended capture probes are released from the solid support prior to amplification. Amplification takes place while the extended capture probes are attached to the solid support. The extended capture probes may be released from the solid support by, for example, using a reversible linker or an enzymatic release, such as an endonuclease or by a change in conditions that results in disruption of an interaction between the capture probe and the solid support, for example, when capture probes are associated with the solid support through base pairing between a tag in the capture probe and a tag probe on the solid support, disruption of the base pairing interaction releases the capture probes from the solid support. Enzymatic methods include, for example, use of uracil DNA glycosylase (UDG) or (UNG). UNG catalyzes the hydrolysis of DNA that contains deoxyuridine at the site the uridine is incorporated. UNG generates abasic sites and the abasic sites can be cleaved with an AP endonuclease, with acid or with heat treatment. Incorporation of one or more uridines in the capture probe followed by treatment with UNG will result in release of the capture probe from the solid support. A thermolabile UNG may also be used.
[0113] Many amplification methods are most efficient at amplification of smaller fragments. For example, PCR most efficiently amplifies fragments that are smaller than 2 kb (see, Saiki et al. 1988). The capture probes and fragmentation conditions are selected for efficient amplification of a selected collection of target sequences. The size of the amplified fragments is dependent on where the target-specific region of the capture probe hybridizes to the target sequence and the 5' end of the fragment strand that the capture probe is hybridized to. In some embodiments of the present methods capture probes and fragmentation methods are designed so that the target sequence of interest can be amplified as a fragment that is, for example, less than 20,000, 2,000, 800, 500, 400, 200 or 100 base pairs long. The capture probe can be designed so that the 3' end of the target-specific region hybridizes to the base that is just 3' of a position to be interrogated in the target sequence. For example, if the sequence to be interrogated is a polymorphism and the sequence is 5'-GCTXATCGG-3', where X is the polymorphic position, the target-specific region of the capture probe may have the sequence 5'---CCGAT-3'. When the sample is fragmented with site specific restriction enzymes the length of the fragments will also depend on the position of the nearest recognition site for the enzyme or enzymes used for fragmentation. A collection of target sequences may be selected based on proximity to restriction sites. The target sequences are selected for amplification and analysis based on the presence of a sequence of interest, such as a SNP, and proximity to a cleavage site for a selected restriction enzyme. For example, SNPs that are within 200, 500, 800, 1,000, 1,500, 2,000 or 20,000 base pairs of either a restriction site, such as, for example, an EcoRI site, a BglI site, an XbaI site or any other restriction enzyme site may be selected to be target sequences in a collection of target sequences. In another method a fragmentation method that randomly cleaves the sample into fragments that are 30, 100, 200, 500 or 1,000 to 100, 200, 500, 1,000 or 2,500 base pairs on average may be used.
[0114] To detect the allele or alleles present the amplified fragments are digested with a Type IIs restriction endonuclease and the fragments are extended in the presence of labeled ddNTPs. The fragments will be extended by a single ddNTP which corresponds to the allele present at the polymorphic position. The extended fragments are hybridized to an array of tag probes and the labeled nucleotide or nucleotides present at each location are determined. The ddNTPs are all labeled with the same label, for example, biotin and the fragments are extended in four separate reactions, one for each of the four different ddNTPs. Each reaction is hybridized to a different array so four arrays are used. In another embodiment the ddNTPs are labeled with differentially detectable labels. There are four different labels and the extension reaction may be done in a single reaction and the hybridization may be to a single array. There can be two different labels and extension reaction may be done in two reactions and the hybridization may be to two different arrays.
[0115] In the present methods one or more enrichment step may be included to generate a sample that is enriched for extended capture probes prior to amplification with common sequence primers. It is desirable to separate extended capture probes from fragments from the starting nucleic acid sample, adapter-ligated fragments, adapter sequences or non-extended capture probes, for example. In one embodiment the capture probes are extended in the presence of a labeled dNTP, for example dNTPs labeled with biotin. The labeled nucleotides are incorporated into the extended capture probes and the labeled extended capture probes are then separated from non-extended material by affinity chromatography. When the label is biotin the labeled extended capture probes can be isolated based on the affinity of biotin for avidin, streptavidin or a monoclonal anti-biotin antibody. In one embodiment the antibody may be coupled to protein-A agarose, protein-A sepharose or any other suitable solid support known in the art. Those of skill in the art will appreciate that biotin is one label that may be used but any other suitable label or a combination of labels may also be used, such as fluorescein which may be incorporated in the extended capture probe and an anti-fluorescein antibody may be used for affinity purification of extended capture probes. Other labels such as, digoxigenin, Cyanine-3, Cyanine-5, Rhodamine, and TEXAS RED (Molecular Probes) may also be used. Antibodies to these labeling compounds may be used for affinity purification. Also, other haptens conjugated to dNTPs may be used, such as, for example, dinitrophenol (DNP).
[0116] The extension products may be enriched by circularization followed by digestion with a nuclease such as Exonuclease VII or Exonuclease III. The extended capture probes may be circularized, for example, by hybridizing the ends of the extended capture probe to an oligonucleotide splint so that the ends are juxtaposed and ligating the ends together. The splint will hybridize to the A1 and A2 sequences in the extended capture probe and bring the 5' end of the capture probe next to the 3' end of the capture probe so that the ends may be ligated by a ligase, for example DNA Ligase or Ampligase Thermostable DNA. See, for example, U.S. Pat. No. 5,871,921 which is incorporated herein by reference. The circularized product will be resistant to nucleases that require either a free 5' or 3' end.
[0117] A variety of nucleases may be used in one or more of the embodiments. Nucleases that are commercially available and may be useful in the present methods include: Mung Bean Nuclease, E. Coli Exonuclease I, Exonuclease III, Exonuclease VII, T7 Exonuclease, BAL-31 Exonuclease, Lambda Exonuclease, RecJf, and Exonuclease T. Different nucleases have specificities for different types of nucleic acids making them useful for different applications. Exonuclease I catalyzes the removal of nucleotides from single-stranded DNA in the 3' to 5' direction. Exonuclease I degrades excess single-stranded primer oligonucleotide from a reaction mixture containing double-stranded extension products. Exonuclease III catalyzes the stepwise removal of mononucleotides from 3'-hydroxyl termini of duplex DNA. A limited number of nucleotides are removed during each binding event, resulting in coordinated progressive deletions within the population of DNA molecules. The preferred substrates are blunt or recessed 3'-termini, although the enzyme also acts at nicks in duplex DNA to produce single-strand gaps. The enzyme is not active on single-stranded DNA, and thus 3''-protruding termini are resistant to cleavage. The degree of resistance depends on the length of the extension, with extensions 4 bases or longer being essentially resistant to cleavage. This property can be exploited to produce unidirectional deletions from a linear molecule with one resistant (3 overhang) and one susceptible (blunt or 5''-overhang) terminus. Exonuclease VII is a single-strand directed enzyme with 5' to 3'- and 3' to 5'-exonuclease activities making it the only bi-directional E. coli exonuclease with single-strand specificity. The enzyme has no apparent requirement for divalent cation, and is fully active in the presence of EDTA. Initial reaction products are acid-insoluble oligonucleotides which are further hydrolyzed into acid-soluble form. The products of limit digests are small oligomers (dimers to dodecamers). For additional information about nucleases see catalogs from manufacturers such as New England Biolabs, Beverly, Mass.
[0118] In some embodiments one of the primers added for PCR amplification is modified so that it is resistant to nuclease digestion, for example, by the inclusion of phosphorothioate. Prior to hybridization to an array one strand of the double stranded fragments may be digested by a 5' to 3' exonuclease such as T7 Gene 6 Exonuclease.
[0119] In some embodiments the nucleic acid sample, which may be, for example, genomic DNA, is fragmented, using for example, a restriction enzyme, DNase I or a non-specific fragmentation method such as that disclosed in U.S. Pat. No. 6,495,320, which is incorporated herein by reference in its entirety. Adaptors containing at least one priming site are ligated to the fragmented DNA. Locus-specific primers are synthesized which contain a different adaptor sequence at the 5' end. The adaptor-ligated genomic DNA is hybridized to the locus-specific primers and the locus specific primer is extended. This may be done for example, by the addition of DNA polymerase and dNTPs. Extension products may be amplified with primers that are specific for the adaptor sequences. This allows amplification of a collection of many different sequences using a limited set of primers. For example, a single set of primers may be used for amplification. In another embodiment a second amplification step is carried out using the same or different primers.
[0120] In some embodiments a collection of target sequences is analyzed. A plurality of capture probes is designed for a plurality of target sequences. In some embodiments target sequences contain or are predicted to contain a polymorphism, for example, a SNP. The polymorphism may be, for example, near a gene that is a candidate marker for a phenotype, useful for diagnosis or a disorder or for carrier screening or the polymorphism may define a haplotype block (see, Daly et al. Nat. Genet. 29:229-32 (2001), and Rioux et al. Nat. Genet. 29:223-8 (2001) and U.S. Patent Publication Number 20030170665 each of which is incorporated herein by reference in its entirety). A collection of capture probes may be designed so that capture probes hybridize near a polymorphism, for example, within 1, 5, 10, or 100 to 5, 10, 100, 1000, 10,000 or 100,000 bases from the polymorphism. The capture probes hybridize to one strand of the target sequence and can be extended through the polymorphic site or region so that the extension product comprises a copy of the polymorphic region.
[0121] The amplified products are analyzed by hybridization to an array of probes attached to a solid support. In some embodiments an array of probes is specifically designed to interrogate a collection of target sequences. The array of probes may interrogate, for example, from 1,000, 5,000, 10,000 or 100,000 to 2,000, 5,000, 10,000, 100,000, 1,000,000 or 3,000,000 different target sequences. In one embodiment the target sequences contain SNPs and the array of probes is designed to interrogate the allele or alleles present at one or more polymorphic location. The array may comprise a collection of probes that hybridize specifically to one or more SNP containing sequences. The array may comprise probes that correspond to different alleles of the SNP. One probe or probe set may hybridize specifically to a first allele of a SNP, but not hybridize significantly to other alleles of the SNP and a second probe set may be designed to hybridize to a second allele of a SNP but not hybridize significantly to other alleles. A hybridization pattern from the array indicates which of the alleles are present in the sample. An array may contain probe sets to interrogate, for example, from 1,000, 5,000, 10,000 or 100,000 to 2,000, 5,000, 10,000, 100,000, 1,000,000 or 3,000,000 different SNPs.
[0122] An array of probes that are complementary to tag sequences present in the capture probes is used to interrogate the target sequences. In some embodiments the amplified targets are analyzed on an array of tag sequences, for example, the Affymetrix GENFLEX® array or Universal Tag Array (3K, 5K, 10K or 25K) (Affymetrix, Inc., Santa Clara, Calif.). In this embodiment the capture probes comprise a tag sequence that is unique for each species of capture probe. A detectable label that is indicative of the allele present at the polymorphic site of interest is associated with the tag. The labeled tags are hybridized to the one or more arrays and the hybridization pattern is analyzed to determine which alleles are present.
(D.) Multiplexed Anchored Runoff Amplification
[0123] Generally, the invention provides methods for highly multiplexed locus specific amplification of nucleic acids and methods for analysis of the amplified products. In some embodiments the invention combines the use of capture probes that comprise a common sequence and a locus-specific region with adaptor-modified sample nucleic acid; the adaptor comprises a second common sequence. The capture probes are extended to produce copies of the sample DNA that contain common priming sequences flanking the target sequence. The copies are amplified with a generic set of primers that recognize the common sequences. The amplified product may be analyzed by hybridization to an array of probes.
[0124] In one embodiment the steps of the invention comprise: generating capture probes; digesting a nucleic acid sample; ligating adaptors to the fragmented sample; mixing the fragments and the capture probes under conditions that will allow hybridization of the fragments and the capture probes; extending the capture probes in the presence of dNTPs and polymerase; amplifying the extended capture probes; and detecting the presence or absence of target sequences of interest.
[0125] One embodiment of the methods is illustrated in FIG. 5. Capture probes are designed with a locus specific region (LS1F and LS1R) that hybridizes near a target sequence of interest and a common sequence (A1) that is 5' of the locus specific region. The common priming site may be present in a plurality of capture probes so that a primer to A1 may be used for amplification of a plurality of different targets in subsequent steps. The capture probes are attached to a solid support so that they have a free 3' end. A plurality of a single species of capture probes may be synthesized at a discreet location on an array and may form a discrete feature of an array. Each feature of the array may contain a different species of locus specific capture probe.
[0126] Genomic DNA is fragmented and adaptors comprising a second common sequence (A2) are ligated to the fragments. The adaptor-ligated fragments are then mixed with the capture probes under conditions that allow hybridization of the fragments to the capture probes on the array. The capture probes are then extended using the adaptor-ligated fragments as template. The extension product has a common sequence, A1, near its 5' end and a second common sequence A2 near its 3' end. These common sequences flank a region of interest. The capture probes are then released from the array and extended capture probes are amplified by PCR using primers to the common sequences A1 and A2. The amplified product may then be analyzed by, for example, hybridization to an array. Information about the region of interest can be determined by analysis of the hybridization pattern.
[0127] A second embodiment of the methods is illustrated in FIG. 6. Capture probes are designed with a locus specific region (LS1 or LS2) and a common sequence (A1) as in FIG. 5. In this embodiment the capture probes further comprise a tag sequence that is unique for each species of capture probe designed. (For a description of tags and tag probes, see, U.S. Ser. No. 08/626,285.) The capture probes are attached to the array through hybridization of the tag sequence to a substantially complementary tag probe sequence that is attached to the array. The tag probes may be attached to the array in discrete locations. Different species of tag probes are present at different discrete, spatially addressable locations. Adaptor-ligated genomic DNA is hybridized to the array so that the capture probes hybridize to target sequences in the sample. The capture probes are extended as in FIG. 5 to incorporate the target sequence and common sequence A2. The extended capture probes are released and amplified using primers A1 and A2. The amplified product may then be analyzed by, for example, hybridization to an array. Information about the region of interest can be determined by analysis of the hybridization pattern. The amplified sample may be analyzed by any method known in the art, for example, MALDI-TOF mass spec, capillary electrophoresis, OLA, dynamic allele-specific hybridization (DASH) or TaqMan® (Applied Biosystems, Foster City, Calif.). For other methods of genotyping analyses see Syvanen, Nature Rev. Gen. 2:930-942 (2001) which is herein incorporated by reference in its entirety.
[0128] In some embodiments the capture probes are attached to a solid support prior to hybridization and hybridization takes place while the capture probes are attached to the solid support. In some embodiments the capture probes are synthesized on a solid support. Any suitable solid support known in the art may be used, for example, arrays, beads, microparticles, microtitre dishes and gels may be used. In some embodiments the capture probes are synthesized on an array in a 5' to 3' direction.
[0129] In some embodiments hybridization and extension of capture probes are done while the capture probes are attached to a solid support. Following extension of the capture probes nucleic acids that are not covalently attached to the solid support may be washed away. In some embodiments the extended capture probes are released from the solid support prior to amplification. In another embodiment amplification takes place while the extended capture probes are attached to the solid support. The extended capture probes may be released from the solid support by, for example, using a reversible linker or an enzymatic release, such as an endonuclease or by a change in conditions that results in disruption of an interaction between the capture probe and the solid support, for example, when capture probes are associated with the solid support through base pairing between a tag in the capture probe and a tag probe on the solid support, disruption of the base pairing interaction releases the capture probes from the solid support. Enzymatic methods include, for example, use of uracil DNA glycosylase (UDG) or (UNG). UNG catalyzes the hydrolysis of DNA that contains deoxyuridine at the site the uridine is incorporated. Incorporation of one or more uridines in the capture probe followed by treatment with UNG will result in release of the capture probe from the solid support. A thermolabile UNG may also be used
[0130] In some embodiments a collection of target sequences is analyzed. A plurality of capture probes is designed for a plurality of target sequences. In some embodiments target sequences contain or are predicted to contain a polymorphism, for example, a SNP. The polymorphism may be, for example, near a gene that is a candidate marker for a phenotype, useful for diagnosis or a disorder or for carrier screening or the polymorphism may define a haplotype block (see, Daly et al. Nat. Genet. 29:229-32 (2001), and Rioux et al. Nat. Genet. 29:223-8 (2001) and U.S. patent application Ser. No. 10/213,272, now abandoned, each of which is incorporated herein by reference in its entirety). A collection of capture probes may be designed so that capture probes hybridize near a polymorphism, for example, within 1, 5, 10, or 100 to 5, 10, 100, 1000, 10,000 or 100,000 bases from the polymorphism. The capture probes hybridize to one strand of the target sequence and can be extended through the polymorphic site or region so that the extension product comprises a copy of the polymorphic region.
[0131] Many amplification methods are most efficient at amplification of smaller fragments. For example, PCR most efficiently amplifies fragments that are smaller than 2 kb (see, Saiki et al. 1988). In one embodiment capture probes and fragmentation conditions are selected for efficient amplification of a selected collection of target sequences. The size of the amplified fragments is dependent on where the target-specific region of the capture probe hybridizes to the target sequence and the 5' end of the fragment strand that the capture probe is hybridized to. In some embodiments of the present methods capture probes and fragmentation methods are designed so that the target sequence of interest can be amplified as a fragment that is, for example, less than 20,000, 2,000, 800, 500, 400, 200 or 100 base pairs long. The capture probe can be designed so that the 3' end of the target-specific region hybridizes to the base that is just 3' of a position to be interrogated in the target sequence. For example, if the sequence to be interrogated is a polymorphism and the sequence is 5'-GCTXATCGG-3', where X is the polymorphic position, the target-specific region of the capture probe may have the sequence 5'---CCGAT-3'. When the sample is fragmented with site specific restriction enzymes the length of the fragments will also depend on the position of the nearest recognition site for the enzyme or enzymes used for fragmentation. A collection of target sequences may be selected based on proximity to restriction sites. In some embodiments target sequences are selected for amplification and analysis based on the presence of a sequence of interest, such as a SNP, and proximity to a cleavage site for a selected restriction enzyme. For example, SNPs that are within 200, 500, 800, 1,000, 1,500, 2,000 or 20,000 base pairs of either a restriction site, such as, for example, an EcoRI site, a BglI site, an XbaI site or any other restriction enzyme site may be selected to be target sequences in a collection of target sequences. In another method a fragmentation method that randomly cleaves the sample into fragments that are 30, 100, 200, 500 or 1,000 to 100, 200, 500, 1,000 or 2,500 base pairs on average may be used.
[0132] In another embodiment, illustrated in FIG. 7, the capture probes are in solution and hybridization and extension take place in solution. In this embodiment the nucleic acid sample is fragmented and adaptor containing common sequences A2 and A3 is ligated to the fragments. In some embodiments one strand of the adaptor, the strand that is ligated to the 3' end of the fragment strands lacks common sequence A2 and is blocked from extension at the 3' end. Ligation of the blocked adaptor strand to the 3' end of the fragment strands prevents the fragments from being extended to incorporate A2 at both ends, thus preventing amplification of the fragments by primer A2 in the subsequent PCR amplification step. Capture probes with locus specific regions and common sequence A1 are mixed with the adaptor-ligated fragments under conditions that allow hybridization of the capture probes to the adaptor ligated fragments. The capture probes are extended in the presence of polymerase and dNTPs. In some embodiments the extended capture probes are positively selected to generate a sample that is enriched for extended capture probes. In another embodiment extended capture probes are enriched by depleting non-extended products.
[0133] In another embodiment the capture probes comprise a first common sequence, a tag sequence, a target sequences and a recognition sequence for a Type IIs restriction enzyme (see, FIGS. 8A and 8B, SEQ ID NOS: 4-12). The Type IIs recognition site is inserted within the target-specific region so that there is target-specific sequence on either side of the Type IIs recognition sequence and the tag sequence is 3' of the common sequence. In many embodiments there will be one or more mismatches between the probe and the target at the site of the Type IIs site. In some embodiments the Type IIs site is positioned so that when the fragment is digested the enzyme cuts between the polymorphic position and the base just 5' of the polymorphic position. The nucleic acid sample is fragmented and ligated to adaptors comprising a second common sequence. The capture probes and adaptor-ligated fragments are mixed under conditions that allow hybridization and the capture probes are extended. The extended capture probes are then made double stranded using a primer that is complementary to the adaptor. The double stranded extended capture probes are amplified using primers to the common sequence in the capture probe and the common sequence in the adaptor.
[0134] To detect the allele or alleles present the amplified fragments are digested with a Type IIs restriction endonuclease and the fragments (FIG. 8B) are extended in the presence of labeled ddNTPs. The fragments will be extended by a single ddNTP which corresponds to the allele present at the polymorphic position. The extended fragments are hybridized to an array of tag probes and the labeled nucleotide or nucleotides present at each location are determined. In one embodiment the ddNTPs are all labeled with the same label, for example, biotin and the fragments are extended in four separate reactions, one for each of the four different ddNTPs. Each reaction is hybridized to a different array so four arrays are used. In another embodiment the ddNTPs are labeled with differentially detectable labels. In one embodiment there are four different labels and the extension reaction may be done in a single reaction and the hybridization may be to a single array. In another embodiment there are two different labels and extension reaction may be done in two reactions and the hybridization may be to two different arrays.
[0135] In many embodiments of the present methods one or more enrichment step may be included to generate a sample that is enriched for extended capture probes prior to amplification with common sequence primers (see, FIGS. 9-11). In some embodiments it is desirable to separate extended capture probes from fragments from the starting nucleic acid sample, adaptor-ligated fragments, adaptor sequences or non-extended capture probes, for example. In one embodiment (FIG. 9) the capture probes are extended in the presence of a labeled dNTP, for example dNTPs labeled with biotin. The labeled nucleotides are incorporated into the extended capture probes and the labeled extended capture probes are then separated from non-extended material by affinity chromatography. When the label is biotin the labeled extended capture probes can be isolated based on the affinity of biotin for avidin, streptavidin or a monoclonal anti-biotin antibody. In one embodiment the antibody may be coupled to protein-A agarose, protein-A sepharose or any other suitable solid support known in the art. Those of skill in the art will appreciate that biotin is one label that may be used but any other suitable label or a combination of labels may also be used, such as fluorescein which may be incorporated in the extended capture probe and an anti-fluorescein antibody may be used for affinity purification of extended capture probes. Other labels such as, digoxigenin, Cyanine-3, Cyanine-5, Rhodamine, and Texas Red may also be used. Antibodies to these labeling compounds may be used for affinity purification. Also, other haptens conjugated to dNTPs may be used, such as, for example, dinitrophenol (DNP).
[0136] In another embodiment (FIG. 10) capture probes that have been extended through the adaptor sequence (A2) on the adaptor modified DNA are made double stranded by hybridizing and extending A2 primer. Only the fully extended capture probes will have the A2 priming site so partially extended capture probes will remain single-stranded. The sample is then digested with a nuclease that selectively digests single stranded nucleic acid, such as E. Coli Exonuclease I. The sample is then amplified with primers A1 and A2.
[0137] In another embodiment (FIG. 11) extension products may be enriched by circularization followed by digestion with a nuclease such as Exonuclease VII or Exonuclease III. The extended capture probes may be circularized, for example, by hybridizing the ends of the extended capture probe to an oligonucleotide splint so that the ends are juxtaposed and ligating the ends together. The splint will hybridize to the A1 and A2 sequences in the extended capture probe and bring the 5' end of the capture probe next to the 3' end of the capture probe so that the ends may be ligated by a ligase, for example DNA Ligase or Ampligase Thermostable DNA. See, for example, U.S. Pat. No. 5,871,921 which is incorporated herein by reference. The circularized product will be resistant to nucleases that require either a free 5' or 3' end.
[0138] A variety of nucleases may be used in one or more of the embodiments. Nucleases that are commercially available and may be useful in the present methods include: Mung Bean Nuclease, E. Coli Exonuclease I, Exonuclease III, Exonuclease VII, T7 Exonuclease, BAL-31 Exonuclease, Lambda Exonuclease, RecJf, and Exonuclease T. Different nucleases have specificities for different types of nucleic acids making them useful for different applications. Exonuclease I catalyzes the removal of nucleotides from single-stranded DNA in the 3' to 5' direction. Exonuclease I degrades excess single-stranded primer oligonucleotide from a reaction mixture containing double-stranded extension products. Exonuclease III catalyzes the stepwise removal of mononucleotides from 3'-hydroxyl termini of duplex DNA. A limited number of nucleotides are removed during each binding event, resulting in coordinated progressive deletions within the population of DNA molecules. The preferred substrates are blunt or recessed 3'-termini, although the enzyme also acts at nicks in duplex DNA to produce single-strand gaps. The enzyme is not active on single-stranded DNA, and thus 3'-protruding termini are resistant to cleavage. The degree of resistance depends on the length of the extension, with extensions 4 bases or longer being essentially resistant to cleavage. This property can be exploited to produce unidirectional deletions from a linear molecule with one resistant (3'-overhang) and one susceptible (blunt or 5'-overhang) terminus. Exonuclease VII is a single-strand directed enzyme with 5' to 3'- and 3' to 5'-exonuclease activities making it the only bi-directional E. coli exonuclease with single-strand specificity. The enzyme has no apparent requirement for divalent cation, and is fully active in the presence of EDTA. Initial reaction products are acid-insoluble oligonucleotides which are further hydrolyzed into acid-soluble form. The products of limit digests are small oligomers (dimers to dodecamers). For additional information about nucleases see catalogues from manufacturers such as New England Biolabs, Beverly, Mass.
[0139] In some embodiments one of the primers added for PCR amplification is modified so that it is resistant to nuclease digestion, for example, by the inclusion of phosphorothioate. Prior to hybridization to an array one strand of the double stranded fragments may be digested by a 5' to 3' exonuclease such as T7 Gene 6 Exonuclease.
[0140] In some embodiments the nucleic acid sample, which may be, for example, genomic DNA, is fragmented, using for example, a restriction enzyme, DNase I or a non-specific fragmentation method such as that disclosed in U.S. Pat. No. 6,495,320, which is incorporated herein by reference in its entirety. Adaptors containing at least one priming site are ligated to the fragmented DNA. Locus-specific primers are synthesized which contain a different adaptor sequence at the 5' end. The adaptor-ligated genomic DNA is hybridized to the locus-specific primers and the locus specific primer is extended. This may be done for example, by the addition of DNA polymerase and dNTPs. Extension products may be amplified with primers that are specific for the adaptor sequences. This allows amplification of a collection of many different sequences using a limited set of primers. For example, a single set of primers may be used for amplification. In another embodiment a second amplification step is carried out using the same or different primers.
[0141] In some embodiments the amplified products are analyzed by hybridization to an array of probes attached to a solid support. In some embodiments an array of probes is specifically designed to interrogate a collection of target sequences. The array of probes may interrogate, for example, from 1,000, 5,000, 10,000 or 100,000 to 2,000, 5,000, 10,000, 100,000, 1,000,000 or 3,000,000 different target sequences. In one embodiment the target sequences contain SNPs and the array of probes is designed to interrogate the allele or alleles present at one or more polymorphic location. The array may comprise a collection of probes that hybridize specifically to one or more SNP containing sequences. The array may comprise probes that correspond to different alleles of the SNP. One probe or probe set may hybridize specifically to a first allele of a SNP, but not hybridize significantly to other alleles of the SNP and a second probe set may be designed to hybridize to a second allele of a SNP but not hybridize significantly to other alleles. A hybridization pattern from the array indicates which of the alleles are present in the sample. An array may contain probe sets to interrogate, for example, from 1,000, 5,000, 10,000 or 100,000 to 2,000, 5,000, 10,000, 100,000, 1,000,000 or 3,000,000 different SNPs.
[0142] In another embodiment an array of probes that are complementary to tag sequences present in the capture probes is used to interrogate the target sequences. In some embodiments the amplified targets are analyzed on an array of tag sequences, for example, the Affymetrix GenFlex® array (Affymetrix, Inc., Santa Clara, Calif.). In this embodiment the capture probes comprise a tag sequence that is unique for each species of capture probe. A detectable label that is indicative of the allele present at the polymorphic site of interest is associated with the tag. The labeled tags are hybridized to the one or more arrays and the hybridization pattern is analyzed to determine which alleles are present.
[0143] In another embodiment methods for generating a plurality of different oligonucleotides are disclosed. Oligonucleotides are synthesized in parallel on a solid support. The oligonucleotides are then released from the solid support and used for further analysis. The released probes may be used, for example, for multiplex PCR amplification of a collection of target sequences, for probes, for primers for reverse transcription or amplification or for any other use of oligonucleotides known in the art. In one embodiment the oligonucleotides on the solid support comprise a collection of capture probes.
[0144] In another embodiment kits that are useful for the present methods are disclosed. In one embodiment a kit for amplifying a collection of target sequences is disclosed. The kit may comprise one or more of the following: a collection of capture probes as disclosed, one or more adaptor, one or more generic primers for common sequences, one or more restriction enzymes, buffer, one or more polymerase, a ligase, buffer, dNTPs, ddNTPs, and one or more nucleases. The restriction enzyme of the kit may be a type-IIs enzyme. The capture probes may be attached to a solid support.
[0145] The methods of the presently claimed invention can be used for a wide variety of applications. Any analysis of genomic DNA may be benefited by a reproducible method of complexity management. Furthermore, the methods and enriched fragments of the presently claimed invention are particularly well suited for study and characterization of extremely large regions of genomic DNA.
[0146] In a preferred embodiment, the methods of the presently claimed invention are used for SNP discovery and to genotype individuals. For example, any of the procedures described above, alone or in combination, could be used to isolate the SNPs present in one or more specific regions of genomic DNA. Selection probes could be designed and manufactured to be used in combination with the methods of the invention to amplify only those fragments containing regions of interest, for example a region known to contain a SNP. Arrays could be designed and manufactured on a large scale basis to interrogate only those fragments containing the regions of interest. Thereafter, a sample from one or more individuals would be obtained and prepared using the same techniques which were used to prepare the selection probes or to design the array. Each sample can then be hybridized to an array and the hybridization pattern can be analyzed to determine the genotype of each individual or a population of individuals. Methods of use for polymorphisms and SNP discovery can be found in, for example, in U.S. Pat. No. 6,361,947 and co-pending U.S. application Ser. No. 08/813,159 which are herein incorporated by reference in their entirety for all purposes).
EXAMPLES
Example 1
[0147] Msp Digestions of HTR2A PCR Product. HTR2A PCR products were taken from 16 individuals, digested with the restriction enzyme Msp and the samples were run on a gel. The genotypes of the 16 individuals were the following: 1 individual with a TT genotype, 7 individuals with a CT genotype, and 8 individuals with a CC genotype. Individuals with a CT genotype produce two distinct bands on the gel in which the second band is aligned equally with one band produced for individuals with CC genotype. The first band of the CT genotype is higher on the gel than CC genotype band. Individuals with TT genotype have one distinct band that is higher on the gel than the individuals with CC genotype. The experiment showed that Msp digestion worked on individuals with a CT genotype.
Example 2
[0148] Exonuclease Sensitivity of Primers. Allele-specific forward primers were run with different polymerases and phosphorothioate linkages. The primers were incubated with no enzyme, VENT polymerase, DEEP VENT polymerase, and DEEP VENT (exo-) polymerase with 0, 1 and 3 phosphorothioate linkages (all polymerases from New England Biolabs). All products were incubated at 72° C. for 45 minutes. The products were run on a 8M urea 15% acrylamide gel and stained with SYBR Green dye (Molecular Probes). No distinct bands were observed in the lanes where the primers had 0 phosphorothioate linkages in the VENT polymerase or DEEP VENT polymerase lanes. Distinct bands were found in other lanes. The experiment showed that allele-specific forward primers are resistant to 3' to 5' exonuclease activity only if they contain at least one phosphorathioate linkage.
Example 3
[0149] Phosphorothioate Linkages increase specificity of PCR. Samples were run on a gel with individuals with CC genotype, TT genotype, and no DNA and these samples varied with 0, 1, and 3 phosphorothioate linkages. The gels were on Pfu Ultra at 55° C., 60° C., and 65° C. The results showed that no bands in the no DNA lanes at all temperatures. Bands were visible in lanes with 1 or 3 phosphorothioate linkages with respect to CC genotype and TT genotype at all temperatures. However, no band was visible in the TT genotype lane with 0 phosphorothioate linkages at all temperatures. The results indicate phosphorothioate linkages help to increase the specificity of standard solution phase PCR.
Example 4
[0150] Cleavage from Solid Support. Two long allele-specific oligonucleotides necessary for the bead based approach were treated and run on a gel. The products were treated with no treatment, Streptavidin, UV light, Streptavidin+UV light, E. Coli Endo V, and Endo V+Streptavidin. The products were run on a 6%, 8M urea acrylamide gel and stained with SYBR Green. This gel uses SA gel shift after various types of treatments to show the modular nature of the oligos. The results showed that two bands were observed in the UV light+streptavidin and Endo V+Streptavidin lanes. The two bands indicated that photocleavage (UV light) and enzymatic cleavage (Endo V) worked in the presence of streptavidin on those particular DNA strands. Multiple bands were observed in the streptavidin lanes while single distinct bands were observed in all other lanes.
Example 5
[0151] Multiplexed Anchored Runoff Amplification. Genomic DNA was digested with Msel and ligated to an adaptor containing T7 promoter sequence as a priming site. The final concentration of the genomic DNA was 10 ng/μl in 1× T4 DNA Ligase Buffer. To generate extended capture probes 2.5 μl of adaptor ligated DNA, 2.5 μl 10× Taq Gold Buffer, 2 μl 25 mM MgCl2, 2.5 μl 10× dNTPs, 5 μl of a 500 nM mixture of 150 different capture probes in TE buffer corresponding to 150 different forward primers from the HuSNP assay, 0.25 μl Perfect Match Enhancer, 0.25 μl AMPLITAQ GOLD enzyme (Applied Biosystems, Foster City, Calif.) and 10 μl of water were mixed to give a final reaction volume of 25 μl. The reaction was incubated at 95° C. for 6 min followed by 26 cycles of 95° C. for 30 sec, 68° C. for 2.5 min (decreasing 0.5° C. on each subsequent cycle) and 72° C. for 1 min, then to 4° C.
[0152] The extended capture probes were made double stranded by the addition of 0.25 μl of 1 μM T7 primer and incubation at 95° C. for 2 min, 55° C. for 2 min, 72° C. for 6 min, then to 4° C. The reaction was passed over a G-25 Sephadex column and 5 μl of 10× Exonuclease I Buffer (NEB) and 2 μl of Exonuclease I (NEB) were added and the reaction was incubated at 37° C. for 60 min, 80° C. for 20 min, then to 4° C. The products were purified over a Qiagen (Valencia, Calif.) mini-elute column and eluted with 10 μl EB Buffer.
[0153] Generic PCR was done as follows: 65.5 μl water, 10 μl 10× Taq Gold Buffer, 8 μl 25 mM MgCl2, 10 μl 10× dNTPs, 1 μl 1 μM T3 primer, 1 μl 1 μM T7 primer 3 μl DNA, 0.5 μl Perfect Match Enhancer and 1 μl AMPLITAQ GOLD enzyme (Applied Biosystems, Foster City, Calif.) were mixed in a 100 μl final reaction volume and incubated at 95° C. for 8 min, 40 cycles of 95° C. for 30 sec, 55° C. for 1 min, and 72° C. for 1 min, then 72° C. for 6 min followed and finally to 4° C.
[0154] An aliquot of the reaction was analyzed on a 2% agarose gel. The products were concentrated using Qiagen QIAquick columns and eluted with 10 μl EB Buffer. The products were fragmented, labeled and hybridized to an array under standard conditions and hybridization patterns were analyzed.
Example 6
[0155] Multiplexed Anchored Runoff Amplification with Biotin Enrichment. Prepare adaptor ligated genomic DNA as above. To generate extended capture probes 2.5 μl of adaptor ligated DNA, 2.5 μl 10× Taq Gold Buffer, 2 μl 25 mM MgCl2, 0.5 μl 50× acGT (6 mM dATP, 6 mM dCTP, 10 mM dGTP, 10 mM dTTP), 5 μl of a 500 nM mixture of 150 different capture probes in TE buffer corresponding to 150 different forward primers from the HuSNP assay, 0.25 μl Perfect Match Enhancer, 0.25 μl AMPLITAQ GOLD enzyme (Applied Biosystems, Foster City, Calif.), 2 μl 1 mM Biotin-N6-dATP (Perkin Elmer, Boston, Mass.), 2 μl 1 mM Biotin-N4-dCTP (Perkin Elmer) and 8 μl of water were mixed to give a final reaction volume of 25 μl. The reaction was incubated at 95° C. for 6 min followed by 26 cycles of 95° C. for 30 sec, 68° C. for 2.5 min (decreasing 0.5° C. on each subsequent cycle) and 72° C. for 1 min, then to 4° C. Pass reaction over G-25 Sephadex column to remove unincorporated biotin-dNTPs.
[0156] Enrich for biotinylated extension products. Adjust the G-25 eluate to 1×PCR buffer and 2 mM MgCl2. Add 15 μl monoclonal anti-biotin agarose (Clone BN-34, Sigma). Incubate at room temperature for 30 min with gentle agitation. Spin down agarose resin for 3 min at 5,000 rpm. Aspirate away supernatant and wash agarose resin with 250 μl 1×PCR buffer with 2 mM MgCl2. Aliquot agarose resin into PCR tubes for generic PCR with T3 and T7 primers.
[0157] Generic PCR was done as follows: 65.5 μl water, 10 μl 10× Taq Gold Buffer, 8 μl 25 mM MgCl2, 10 μl 10× dNTPs, 1 μl 1 μM T3 primer, 1 μl 1 μM T7 primer, 3 μl DNA, 0.5 μl Perfect Match Enhancer and 1 μl AMPLITAQ GOLD enzyme (Applied Biosystems, Foster City, Calif.) were mixed in a 100 μl final reaction volume and incubated at 95° C. for 8 min, 40 cycles of 95° C. for 30 sec, 55° C. for 1 min, and 72° C. for 1 min, then 72° C. for 6 min and finally to 4° C.
[0158] An aliquot of the reaction was analyzed on a 2% agarose gel. The products were concentrated using Qiagen QIAQUICK columns and eluted with 30 μl EB Buffer. The products were fragmented with DNase I, labeled with biotin-ddATP using TdT, and hybridized to an array under standard conditions. Hybridization patterns were analyzed.
Example 7
[0159] Multiplexed Anchored Runoff Amplification with Exo III Enrichment. Prepare adaptor ligated genomic DNA as above. Kinase capture probes by incubating 12 μl of a 150-plex stock of either forward or reverse HUSNP primers (Affymetrix) with 12.7 μl H2O, 3 μl 10× T4 polynucleotide kinase buffer, 0.3 μl 100 mM ATP, and 2 μl T4 Polynucleotide Kinase. Incubate the reaction at 37° C. for 30 min. Adjust reaction volume to 50 μl and pass reaction over G-25 column to exchange buffer.
[0160] To generate extended capture probes 5 μl of adaptor ligated DNA, 5 μl 10× Taq Gold Buffer, 4 μl 25 mM MgCl2, 5 μl 10× dNTPs, 20 μl of the kinased mixture of 150 different capture probes, 1 μl Perfect Match Enhancer, 0.5 μl AMPLITAQ GOLD enzyme (Applied Biosystems, Foster City, Calif.) and 9.5 μl of water were mixed to give a final reaction volume of 50 μl. The reaction was incubated at 95° C. for 6 min followed by 26 cycles of 95° C. for 30 sec, 68° C. for 2.5 min (decreasing 0.5° C. on each subsequent cycle) and 72° C. for 1 min, then finally to 4° C. Pass the reaction over a G-25 column to exchange buffer.
[0161] Convert the single strand extension products to single strand circles using splint oligonucleotides and AMPLIGASE Thermostable DNA Ligase (Epicenter, Madison, Wis.). The sequence of the T3-T7 splint oligo is (SEQ ID NO: 3)
TABLE-US-00002 5'TCTCCCTTTAGTGAGGGTTAATTTGTAATACGACTCACTATA GGGCA-3'.
Mix 39.75 μl water, 7.5 μl 10× AMPLIGASE Buffer, 1.25 μl 70 μM splint oligo, 25 μl 5' phosphorylated single strand extension products and 1.5 μl AMPLIGASE Thermostable DNA Ligase 5 U/μl. Incubate the mixture at 95° C. for 3 min, then 10 cycles of 95° C. for 30 sec and 72° C. for 3 min, then 10 cycles of 95° C. for 30 sec and 70° C. for 3 min, then 10 cycles of 95° C. for 30 sec and 68° C. for 3 min, then 10 cycles of 95° C. for 30 sec and 66° C. for 3 min, then 10 cycles of 95° C. for 30 sec and 64° C. for 3 min, then 10 cycles of 95° C. for 30 sec and 62° C. for 3 min. Hold at 4° C. Pass reaction over G-25 column to exchange buffer. Digest uncircularized nucleic acids. Mix 13 μl water, 10 μl 10× Exo III Buffer, 75 μl AMPLIGASE splint reaction and 2 μl Exonuclease III 100 U/μl (NEB, Beverly, Mass.). Incubate at 37° C. for 1 hour. Heat inactivate at 70° C. for 20 min. Fragment, label and hybridize as above.
[0162] From the foregoing it can be seen that the present invention provides a flexible and scalable method for analyzing complex samples of DNA, such as genomic DNA. These methods are not limited to any particular type of nucleic acid sample: plant, bacterial, animal (including human) total genome DNA, RNA, cDNA and the like may be analyzed using some or all of the methods disclosed in this invention. This invention provides a powerful tool for analysis of complex nucleic acid samples. From experiment design to isolation of desired fragments and hybridization to an appropriate array, the above invention provides for fast, efficient and inexpensive methods of complex nucleic acid analysis.
[0163] All patents, publications and patent applications cited above are incorporated by reference in their entirety for all purposes to the same extent as if each individual patent, publication or patent application were specifically and individually indicated to be so incorporated by reference. Although the present invention has been described in some detail by way of illustration and example for purposes of clarity and understanding, it will be apparent that certain changes and modifications may be practiced within the scope of the appended claims.
Sequence CWU
1
12111DNAArtificialSynthetic 1ctcttcnnnn n
11211DNAArtificialSynthetic 2nnnnngaaga g
11347DNAArtificialSynthetic 3tctcccttta gtgagggtta atttgtaata cgactcacta
tagggca 47430DNAArtificialSynthetic 4aagattctaa
taacctcgca gcgtgaaaac
30537DNAArtificialSynthetic 5cttttttgag gcatgttmgt tttcacctta agaggtt
37648DNAArtificialSynthetic 6aagattctaa
taacctcgca gcgtgaaaac kaacatgcct caaaaaag
48748DNAArtificialSynthetic 7aagattctaa taacctcgca gcgtgaaaac kaacatgcct
caaaaaag 48848DNAArtificialSynthetic 8cttttttgag
gcatgttmgt tttcacgctg cgaggttatt agaatctt
48979DNAArtificialSynthetic 9aattaaccct cactaaaggg agacgttcct aaagctgagt
ctgaagattc taataacctc 60gcagcgtgaa aacknnnnn
791079DNAArtificialSynthetic 10nnnnnmgttt
tcacgctgcg aggttattag aatcttcaga ctcagcttta ggaacgtctc 60cctttagtga
gggttaatt
791173DNAArtificialSynthetic 11aattaaccct cactaaaggg agacgttcct
aaagctgagt ctgaagattc taataacctc 60gcagcgtgaa aac
731274DNAArtificialSynthetic
12aattaaccct cactaaaggg agacgttcct aaagctgagt ctgaagattc taataacctc
60gcagcgtgaa aack
74
User Contributions:
Comment about this patent or add new information about this topic: