Patent application title: Methods of constructing and screening diverse expression libraries
Inventors:
Paul M. Watt (Mt. Claremont, AU)
Wayne Thomas (Nedlands, AU)
Richard Hopkins (North Perth, AU)
Assignees:
Phylogica Limited
IPC8 Class: AC40B4002FI
USPC Class:
506 14
Class name: Combinatorial chemistry technology: method, library, apparatus library, per se (e.g., array, mixture, in silico, etc.) library contained in or displayed by a micro-organism (e.g., bacteria, animal cell, etc.) or library contained in or displayed by a vector (e.g., plasmid, etc.) or library containing only micro-organisms or vectors
Publication date: 2009-07-02
Patent application number: 20090170722
Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
Patent application title: Methods of constructing and screening diverse expression libraries
Inventors:
Paul M. Watt
Wayne Thomas
Richard Hopkins
Agents:
MORRISON & FOERSTER LLP
Assignees:
Phylogica Limited
Origin: PALO ALTO, CA US
IPC8 Class: AC40B4002FI
USPC Class:
506 14
Abstract:
The present invention provides novel methods for producing nucleic acid
fragment libraries that express highly diverse peptides or protein
domains and, in particular, methods for producing nucleic acid fragment
libraries wherein the nucleic acid fragments of the libraries are derived
from two or more diverse characterized genomes.Claims:
1-90. (canceled)
91. An expression library comprising nucleic acid fragments derived from one or more microorganisms or eukaryotes containing compact genomes, each of said microorganisms or eukaryotes having a substantially sequenced genome, wherein the nucleic acid fragments of the library comprise an open reading frame having an average length of at least about 36-45 nucleotide residues and/or encode a protein domain, and wherein the nucleic acid fragments are inserted into an expression vector thereby producing recombinant constructs wherein each fragment is in operable connection with a promoter sequence that is capable of conferring expression of that fragment.
92. An expression library comprising nucleic acid fragments derived from one or more microorganisms or eukaryotes containing compact genomes, each of said microorganisms or eukaryotes having a substantially sequenced genome, wherein the nucleic acid fragments of the library have substantially different nucleotide sequences and wherein the nucleic acid fragments are inserted into an expression vector thereby producing recombinant constructs wherein each fragment is in operable connection with a promoter sequence that is capable of conferring expression of that fragment.
93. The expression library of claim 91 wherein the nucleic acid fragments are derived from an organism selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima;
94. The expression library of claim 92 wherein the nucleic acid fragments are derived from an organism selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima;
95. The expression library of claim 91 wherein the expression vector is a plasmid, bacteriophage or phagemid.
96 The expression library of claim 95 wherein the expression vector comprises a nucleotide sequence selected from the group consisting of SEQ ID NO: 36, SEQ ID NO: 60 and SEQ ID NO: 61.
97. The expression library of claim 92 wherein the expression vector is a plasmid, bacteriophage or phagemid.
98. The expression library of claim 97 wherein the expression vector comprises the nucleotide sequence selected from the group consisting of SEQ ID NO: 36, SEQ ID NO: 60 and SEQ ID NO: 61.
99. The expression library of claim 91 or 92 wherein the number of genomes of a microorganism or eukaryote that is represented in the library is more than one.
100. The expression library of claim 99 wherein the nucleic acid fragments are represented in an amount proportional to the size of the genome of a microorganism or eukaryote from which the fragments were derived.
101. The expression library of claim 91 or 92 wherein the recombinant vector is in a cellular host.
102. The expression library of claim 101 wherein the cellular host is a bacterium.
103. The expression library of claim 101 wherein the cellular host is a yeast.
104. The expression library of claim 101 wherein the cellular host is a nematode.
105. The expression library of claim 104 wherein the nematode is C. elegans.
106. A database comprising the nucleotide sequences of nucleic acid fragments of the expression library of claim 91 or the amino acid sequences of the peptides encoded by said nucleic acid fragments in computer readable form.
107. A database comprising the nucleotide sequences of nucleic acid fragments of the expression library of claim 92 or the amino acid sequences of the peptides encoded by said nucleic acid fragments in computer readable form.
Description:
RELATED APPLICATION DATA
[0001]The present invention is a continuation-in-part application of U.S. Ser. No. 09/568,229 filed May 5, 2000 which claims the benefit of priority under 35 USC ยง 119(e) from U.S. Provisional Application No. 60/132,711 filed May 5, 1999, both of which are herein incorporated by reference in their entirety.
FIELD OF THE INVENTION
[0002]The present invention relates generally to methods for the production and of nucleic acid fragment libraries that express highly diverse peptides, polypeptides or protein domains and, in particular, methods for producing nucleic acid fragment libraries wherein the nucleic acid fragments of the libraries are derived from one and preferably from two or more prokaryote genomes or compact eukaryote genomes, such as, for example, organisms having diverse characterized genomes. In another embodiment, the nucleic acid fragments are expressed as protein domains capable of assuming a conformation that binds to a target protein or nucleic acid during library screening. The present invention further provides methods of screening such libraries to identify peptides, polypeptides or protein domains that bind to a target protein or nucleic acid such as, for example, to modulate the activity of the target protein or nucleic acid. Also provided are methods for identifying nucleic acid encoding such peptides, polypeptides or protein domains. The present invention extends to the nucleic acids, peptides, polypeptides and protein domains identified by the methods described herein.
BACKGROUND OF THE INVENTION
[0003]1. General Information
[0004]As used herein the term "derived from" shall be taken to indicate that a specified integer is obtained from a particular source albeit not necessarily directly from that source.
[0005]Unless the context requires otherwise or specifically stated to the contrary, integers, steps, or elements of the invention recited herein as singular integers, steps or elements clearly encompass both singular and plural forms of the recited integers, steps or elements.
[0006]Throughout this specification, unless the context requires otherwise, the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated step or element or integer or group of steps or elements or integers but not the exclusion of any other step or element or integer or group of elements or integers.
[0007]Unless specifically stated otherwise, each feature described herein with reference to a particular aspect or embodiment of the invention shall be taken to apply mutatis mutandis to each and every other aspect or embodiment of the invention. For example, any one or more features described herein with respect to methods for expression library construction shall apply to those embodiments relating to methods for screening expression libraries to identify a peptide or protein domain capable of binding a target protein or nucleic acid or nucleic acid encoding same.
[0008]Those skilled in the art will appreciate that the invention described herein is susceptible to variations and modifications other than those specifically described. It is to be understood that the invention includes all such variations and modifications. The invention also includes all of the steps, features, compositions and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations or any two or more of said steps or features.
[0009]The present invention is not to be limited in scope by the specific examples described herein. Functionally equivalent products, compositions and methods are clearly within the scope of the invention, as described herein.
[0010]The present invention is performed without undue experimentation using, unless otherwise indicated, conventional techniques of molecular biology, microbiology, virology, recombinant DNA technology, peptide synthesis in solution, solid phase peptide synthesis, and immunology. Such procedures are described, for example, in the following texts: [0011]1. Sambrook, Fritsch & Maniatis, whole of Vols I, II, and III; [0012]2. DNA Cloning: A Practical Approach, Vols. I and II (D. N. Glover, ed., 1985), IRL Press, Oxford, whole of text; [0013]3. Oligonucleotide Synthesis: A Practical Approach (M. J. Gait, ed., 1984) IRL Press, Oxford, whole of text, and particularly the papers therein by Gait, pp 1-22; Atkinson et al., pp 35-81; Sproat et al., pp 83-115; and Wu et al., pp 135-151; [0014]4. Nucleic Acid Hybridization: A Practical Approach (B. D. Hames & S. J. Higgins, eds., 1985) IRL Press, Oxford, whole of text; [0015]5. Animal Cell Culture: Practical Approach, Third Edition (John R. W. Masters, ed., 2000), ISBN 0199637970, whole of text; [0016]6. Immobilized Cells and Enzymes: A Practical Approach (1986) IRL Press, Oxford, whole of text; [0017]7. Perbal, B., A Practical Guide to Molecular Cloning (1984); [0018]8. Methods In Enzymology (S. Colowick and N. Kaplan, eds., Academic Press, Inc.), whole of series; [0019]9. J. F. Ramalho Ortigao, "The Chemistry of Peptide Synthesis" In: Knowledge database of Access to Virtual Laboratory website (Interactiva, Germany); [0020]10. Sakakibara, D., Teichman, J., Lien, E. Land Fenichel, R. L. (1976). Biochem. Biophys. Res. Commun. 73 336-342 [0021]11. Merrifield, R. B. (1963). J. Am. Chem. Soc. 85, 2149-2154. [0022]12. Barany, G. and Merrifield, R. B. (1979) in The Peptides (Gross, E. and Meienhofer, J. eds.), vol. 2, pp. 1-284, Academic Press, New York. [0023]13. Wunsch, E., ed. (1974) Synthese von Peptiden in Houben-Weyls Metoden der Organischen Chemie (Muler, E., ed.), vol. 15, 4th edn., Parts 1 and 2, Thieme, Stuttgart. [0024]14. Bodanszky, M. (1984) Principles of Peptide Synthesis, Springer-Verlag, Heidelberg. [0025]15. Bodanszky, M. & Bodanszky, A. (1984) The Practice of Peptide Synthesis, Springer-Verlag, Heidelberg. [0026]16. Bodanszky, M. (1985) Int. J. Peptide Protein Res. 25, 449-474. [0027]17. Handbook of Experimental Immunology, Vols. I-IV (D. M. Weir and C. C. Blackwell, eds., 1986, Blackwell Scientific Publications). [0028]18. McPherson et al., In: PCR A Practical Approach., IRL Press, Oxford University Press, Oxford, United Kingdom, 1991. [0029]19. Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual (D. Burke et al., eds) Cold Spring Harbor Press, New York, 2000 (see whole of text). [0030]20. Guide to Yeast Genetics and Molecular Biology. In: Methods in Enzymology Series, Vol. 194 (C. Guthrie and G. R. Fink eds) Academic Press, London, 1991 2000 (see whole of text).
[0031]2. Description of the Related Art
[0032]As a response to the increasing demand for new lead compounds and new target identification and validation reagents, the pharmaceutical industry has increased its screening of various sources for new lead compounds having a unique activity or specificity in therapeutic applications, such as, for example, in the treatment of neoplastic disorders, infection, modulating immunity, autoimmunity, fertility, etc.
[0033]It is known that proteins bind to other proteins, antigens, antibodies, nucleic acids, and carbohydrates. Such binding enables the protein to effect changes in a wide variety of biological processes in all living organisms. As a consequence, proteins represent an important source of natural modulators of phenotype. Accordingly, peptides that modulate the binding activity of a protein represent attractive lead compounds (drug candidates) in primary or secondary drug screening. For example, the formation of a target biological interaction that has a deleterious effect (eg. replication of a pathogen or of a cancer cell), can be assayed to identify lead compounds that antagonize the biological interaction.
[0034]Similarly, the activity or expression of an antimicrobial target (eg., a protein produced by a particular microbe that is required for its survival or propagation), can be screened for novel compounds that modulate the survival or propagation of the microbe by antagonizing an activity or function of the antimicrobial target. Peptides that block the function of specific membrane channels, or disrupt cytoplasmic membranes of some organisms is represent attractive candidates for anti-microbial drugs. Antimicrobial effects have been demonstrated for certain natural peptides produced by animals and insects, and for synthetic cationic peptides (eg., azurocidin, cathepsin G, Cationic Antimicrobial Peptides CAP57 and CAP37, defensin, bactenecin and magainin).
[0035]A virulence determinant of a pathogen also presents an attractive target for identifying lead compounds having antimicrobial activity. For example, a peptide antagonist of an autoinducer of virulence in Staphylococcus aureus that controls the production of bacterial toxins involved in pathogenesis has been determined. The antagonist, designated RIP (RNAIII inhibiting peptide) is produced by a non-pathogenic strain of Staphylococcus aureus and appears to inhibit the RNAIII gene that is induced by a threshold concentration of an endogenous protein, RNA III Activating Protein (RAP), in virulent strains.
[0036]In another example, differential gene expression between normal and diseased (eg., neoplastic or apoptotic) cells, such as, for example, differential expression of cellular receptors, and/or differential signal transduction processes between normal and diseased cells, implicate those differential patterns of gene expression in disease. Accordingly, the genes or proteins that are differentially expressed in diseased and normal cells, or the differential cellular processes between normal and diseased cells, form attractive targets for therapy. Similarly, cyclin proteins such as Cdc2, Cdc25, and cyclin-dependent kinases (CDKs) are attractive targets for cellular proliferation. Peptides that agonize or antagonize the expression of such target genes or target processes are suitable lead compounds for therapeutic applications.
[0037]In yet another example, certain allergen proteins (eg., DerpI) are attractive targets for screens to identify anti-allergenic compounds that prevent or inhibit immune responses to the allergen protein.
[0038]It is widely recognized that there is a need to develop methods for determining novel compounds, including nucleic acid-based products and peptide-based products, that modulate an activity or function of a particular target. In such approaches, an activity of a target protein or nucleic acid is screened in the absence and presence of a potential lead compound, which is a peptide, and modified activity of the target is determined.
[0039]Similarly, peptides can be used as dominant negative inhibitors or the validation of prospective drug targets using assays such as observing the phenotype resulting from over-expression of the peptides in ex-vivo assays or in transgenic mice.
[0040]In one known approach to identify novel lead compounds, random peptide (synthetic mimetic or mimotope) libraries are produced using short random oligonucleotides produced by synthetic combinatorial chemistry. The DNA sequences are cloned into an appropriate vehicle for expression and the encoded peptide is then screened using one of a variety of approaches. However, the ability to isolate active peptides from random fragment libraries can be highly variable with low affinity interactions occurring between the peptide-binding partners. Moreover, the expressed peptides often show little or none of the secondary or tertiary structure required for efficient binding activity, and/or are unstable. This is not surprising, considering that biological molecules appear to recognise shape and charge rather than primary sequence (Yang and Honig J. Mol. Biol. 301(3), 691-711 2000) and that such random peptide aptamers are generally too small to comprise a protein domain or to form the secondary structure of a protein domain. The relatively unstructured `linear` nature of these peptide aptamers also leads to their more rapid degradation and clearance following administration to a subject in vivo, thereby reducing their appeal as therapeutic agents.
[0041]To enhance the probability of obtaining useful bioactive peptides or proteins from random peptide libraries, peptides have previously been constrained within scaffold structures, eg., thioredoxin (Trx) loop (Blum et al. Proc. Natl. Acad. Sci. USA, 97, 2241-2246, 2000) or catalytically inactive staphylococcal nuclease (Norman et al, Science, 285, 591-595, 1999), to enhance their stability. Constraint of peptides within such structures has been shown, in some cases, to enhance the affinity of the interaction between the expressed peptides and its target, presumably by limiting the degrees of conformational freedom of the peptide, and thereby minimizing the entropic cost of binding.
[0042]It is also known to tailor peptide expression libraries for identifying specific peptides involved in a particular process, eg., antigen-antibody-binding activity. For example U.S. Pat. No. 6,319,690 (Dade Behring Marburg GmBH) teaches a PCR-based method of amplifying cDNA sequences encoding a population of antibodies, wherein oligonucleotide primers that are homologous to conserved regions of antibody-encoding cDNAs derived from a mixture of non-activated B-lymphocytes are used to amplify nucleic acids that encode antibody variable regions. The amplified sequences are expressed using a bacterial display system, for screening with selected antigens to determine those antibody fragments that bind the antigens. However, the expression libraries described in U.S. Pat. No. 6,319,690 show limited diversity, because the amplified fragments were all antibody-encoding fragments derived from a single complex eukaryote. Additionally, the antibody-encoding libraries described in U.S. Pat. No. 6,319,690 were screened for antigen-binding activity rather than for a novel bioactivity (ie. the expressed peptides were not mimotopes).
[0043]Several attempts have been made to develop libraries based on naturally occurring proteins (eg genomic expression libraries). Libraries of up to several thousand polypeptides or peptides have been prepared by gene expression systems and displayed on chemical supports or in biological systems suitable for testing biological activity. For example, genome fragments isolated from Escherichia coli MG1655 have been expressed using phage display technology, and the expressed peptides screened to identify peptides that bind to a polyclonal anti-Rec A protein antisera (Palzkill et al. Gene, 221 79-83, 1998). Such expression libraries are generally produced using nucleic acid from single genomes, and generally comprise nucleic acid fragments comprising whole genes and/or multiple genes or whole operons, including multiple linked protein domains of proteins. Additionally, as many bacteria comprise recA-encoding genes, the libraries described by Palzkill et al., were screened for an activity that was known for the organism concerned, rather than for a novel bioactivity (ie. the expressed peptides were not necessarily mimotopes).
[0044]U.S. Pat. No. 5,763,239 (Diversa Corporation) describes a procedure for producing normalized genomic DNA libraries from uncharacterized environmental samples containing a mixture of uncharacterized genomes. The procedure described by Diversa Corp. comprises melting DNA isolated from an environmental sample, and allowing the DNA to reanneal under stringent conditions. Rare sequences, that are less likely to reanneal to their complementary strand in a short period of time, are isolated as single-stranded nucleic acid and used to generate a gene expression library. However, total normalization of each organism within such uncharacterized samples is difficult to achieve, thereby reducing the biodiversity of the library. Such libraries also tend to be biased toward the frequency with which a particular organism is found in the native environment. As such, the library does not represent the true population of the biodiversity found in a particular biological sample. In cases where the environmental sample includes a dominant organism, there is likely to be a significant species bias that adversely impacts on the sequence diversity of the library. Furthermore, as many of the organisms found in such samples are uncharacterized, very little information is known regarding the constitution of the genomes that comprise such libraries. Accordingly, it is not possible to estimate the true diversity of such libraries. Additionally, since the Diversa Corp. process relies upon PCR using random primers to amplify uncharacterized nucleic acids, there is no possibility of accounting for biasing factors, such as, for example, a disproportionate representation of repeated sequences across genomes of the organisms in the environmental sample.
[0045]Accordingly, there remains a need to produce improved methods for constructing highly diverse and well characterized expression libraries wherein the expressed peptides are capable of assuming a secondary structure or conformation sufficient to bind to a target protein or nucleic acid, such as, for example, by virtue of the inserted nucleic acid encoding a protein domain.
SUMMARY OF THE INVENTION
[0046]The present invention is based upon the understanding of the present inventors that, in contrast to random synthetic peptide libraries produced by combinatorial approaches, or short random peptides produced by expression of PCR products, amino acids are not randomly distributed in nature (Pande et al., Proc Natl Acad. Sci. USA 91 12972-12975, 1994). Proteins that fold well in nature have non-random hydrophobicity distributions (Irback et al., Proc Natl Acad. Sci. USA 93, 9533-9538, 1996). In any native peptide, the distribution of amino acid residues according to their chemical properties (eg hydrophobicity, polarity, etc) is also non-random (Baud and Karlin, Proc Natl Acad. Sci. USA 96, 12494-12499, 1999). Accordingly, the present inventors realized that random peptide libraries have a low frequency of naturally occurring or native peptide conformational structures or secondary structures, such as, for example, those structures formed by protein domains.
[0047]In work leading up to the present invention, the inventors sought to take advantage of diverse and well-characterized prokaryotic genomes and/or compact eukaryotic genomes in the construction of highly diverse expression libraries for isolating bioactive peptides or proteins. In particular, the use of combinations of nucleic acid fragments from one or two or more well characterized genomes has allowed the inventors to control the degree the diversity of peptides/proteins expressed in their expression libraries, to enhance the possibility of isolating novel peptides having the ability to bind to a desired protein or nucleic acid. It will be understood from the disclosure herein that the bioactive peptides or proteins expressed by individual library clones of such libraries are screened for an activity of the encoded peptide, particularly a binding activity, which said encoded protein has not been shown to possess in the context of the protein from which it was derived (ie in its native environment). In the screening process, any library clone encoding a peptide that has the same activity as it would have in its native environment is excluded during the screening process, since an objective of the present invention is to isolate novel bioactive peptides or proteins.
[0048]Peptides encoded by genomes which differ from the genome of the drug target organism (eg. humans) are a particularly rich source of high affinity target binding agents. This is because in the evolution of the target organism itself, such high affinity peptide domains have been selected against other than the interaction interfaces which may exist in that organism for functional dimerization with natural partners.
[0049]In one embodiment, the libraries described in the present invention are constructed from nucleic acid fragments comprising genomic DNA, cDNA, or amplified nucleic acid derived from one or two or more well-characterized genomes.
[0050]Preferably, one or more well-characterized genomes is a compact genome of a eukaryote (ie. protist, dinoflagellate, alga, plant, fungus, mould, invertebrate, vertebrate, etc) such as, for example, a eukaryote selected from the group consisting of Arabidopsis thaliana, Anopheles gambiae, Caenorhabditis elegans, Danio rerio, Drosophila melanogaster, Takifugu rubripes, Cryptosporidium parvum, Trypanosoma cruzii, Saccharomyces cerevesiae, and Schizosaccharomyces pombe.
[0051]In another embodiment, one or more well-characterized genomes is a compact genome of a prokaryote (ie. bacteria, eubacteria, cyanobacteria, etc) such as, for example a prokaryote selected from the group consisting of Archaeoglobus fulgidis, Aquifex aeolicus, Aeropyrum pernix, Bacillus subtilis, Bordetella pertussis TOX6, Borrelia burgdorferi, Chlamydia trachomatis, Escherichia coli Kl2, Haemophilus influenzae (rd), Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginlosa, Pyrococcus horikoshii, Synechocystis PCC 6803, Thermoplasma volcanium and Thermotoga maritima.
[0052]In a further embodiment, combinations of nucleic acid fragments from one or more eukaryote genomes and/or one or more prokaryote genomes are used.
[0053]Wherein the nucleic acid fragments are from mixtures of organisms, it is preferred that those organisms are not normally found together in nature. In accordance with this embodiment of the invention, the process of combining nucleic acid fragments derived from diverse organisms not normally found together in nature enhances and controls diversity of the expression library produced using such nucleic acid fragments.
[0054]It is to be understood that the nucleic acid fragments used in the production of the expression libraries of the present invention are generated using art-recognized methods such as, for example, a method selected from the group consisting mechanical shearing, digestion with a nuclease and digestion with a restriction endonuclease. Combinations of such methods can also be used to generate the genome fragments. In a particularly preferred embodiment, copies of nucleic acid fragments from one or two or more genomes are generated using polymerase chain reaction (PCR) using random oligonucleotide primers.
[0055]The nucleic acid fragments or cDNA or amplified DNA derived therefrom are inserted into a suitable vector or gene construct in operable connection with a suitable promoter for expression of each peptide in the diverse nucleic acid sample. The construct used for the expression of the diverse nucleic acid fragment library is determined by the system that will be used to screen for those peptides that have a conformation sufficient for binding to a target protein or nucleic acid. Thus, consideration is generally given to an expression format suitable for screening the library.
[0056]In one embodiment, the vector or gene construct is suitable for in vitro display of an expressed peptide. Preferred in vitro display formats include, ribosome display, mRNA display or covalent display.
[0057]In another embodiment, the vector or gene construct is suitable for expressing a peptide in a cellular host. Preferred cellular hosts in this context are capable of supporting the expression of exogenous or episomal DNA such as, for example, a cellular host selected from the group consisting of a bacterial cell, yeast cell, insect cell, mammalian cell, and plant cell.
[0058]In another embodiment, the vector or gene construct is suitable for expressing a peptide in a multicellular organism. Preferred multicellular organisms for this purpose will include organisms having a compact genome and/or short life cycle to facilitate rapid high throughput screening, such as, for example, a plant (eg., Arabidopsis thaliana or Nicotinia tabaccum) or an animal selected from the group consisting of Caenorhabditis elegans, Danio rerio, Drosophila melanogaster, Takifugu rubripes, Mus sp. and Rattus sp.
[0059]Accordingly, one aspect of the present invention provides a method of constructing an expression library for expressing a peptide having a conformation sufficient for binding to a target protein or nucleic acid, said method comprising: [0060](a) producing nucleic acid fragments from nucleic acids derived from two or more microorganisms or eukaryotes containing compact genomes, each of said microorganisms or eukaryotes having a substantially sequenced genome; and [0061](b) inserting the nucleic acid fragments at (a) into a suitable expression construct thereby producing recombinant constructs, wherein each fragment is in operable connection with a promoter sequence that is capable of conferring expression of that fragment.
[0062]By way of exemplification, FIG. 1 shows one embodiment of the method of generating the expression library of the present invention, wherein nucleic acid fragments are isolated from multiple evolutionary diverse organisms and pooled in such a way as to ensure about equal representation of each of the genomes. Nested PCR using degenerate PCR primers amplifies sequences from the pooled genomes in a first round, and specific PCR amplifies the nucleic acid fragments so as to permit their direct cloning into an expression vector.
[0063]Preferably, the poor representation of low copy number sequences is reduced or minimized by normalizing the nucleic acid according to the complexity and size of the genome of the microorganism or compact eukaryote (ie., relative genome size of content of each contributing genome of the expression library). Thus, where genomes from more than one organism are used in the construction of the library, each of those contributing genomes is preferably used in an amount that is proportional to that complexity and size of the genome (or transcriptome), such as, for example, in comparison to the complexity and size of another genome in the mixture of genomes.
[0064]This process results in about equal representation of the genome fragments in the biodiverse nucleic acid fragment library.
[0065]Accordingly, a preferred embodiment of the present invention provides a method of constructing an expression library for expressing a polypeptide having a conformation sufficient for binding to a target protein or nucleic acid, said method comprising: [0066](a) producing nucleic acid fragments from nucleic acids derived from two or more microorganisms or eukaryotes containing compact genomes, each of said microorganisms or eukaryotes having a substantially sequenced genome; and [0067](b) inserting the selected fragments at (a) into a suitable expression vector in an amount proportional to the size of the genome from which the fragments were derived thereby producing recombinant constructs, wherein each fragment is in operable connection with a promoter sequence that is capable of conferring expression of that fragment.
[0068]Preferably, the nucleic acid fragments are selected such that the encoded peptides have an average length that is about the length of a protein domain, eg., at least about 12-15 amino acids in length and more preferably at least about 15 amino acids in length or at least about 20 amino acids in length or at least about 30 amino acids in length.
[0069]Alternatively, or in addition, the nucleic acid fragments will preferably encode peptides that, on average, comprise or consist of a protein domain. As used herein, the term "protein domain" shall be taken to mean a discrete portion of a protein that assumes a secondary structure or conformation sufficient to permit said portion to perform a specific function in the context of a target protein or target nucleic acid and, in particular, to bind with high affinity to the target protein or nucleic acid. Preferred protein domains are not required to be constrained within a scaffold structure to bind to the target nucleic acid or target protein, or for said binding to be enhanced. Accordingly, it is particularly preferred that nucleic acid fragments used in the generation of the expression libraries of the present invention encode peptides that form stable secondary structures or conformations in the absence of a Trx loop or catalytically inactive staphylococcal nuclease peptide.
[0070]It is also preferred for the nucleic acid fragments of the expression libraries of the invention to encode a single protein domain. Accordingly, in a particularly preferred embodiment, the nucleic acid fragments of the expression libraries of the present invention will encode a peptide having an upper length of about 50 amino acid residues.
[0071]Accordingly, a preferred embodiment of the present invention provides a method of constructing an expression library for expressing a polypeptide having a conformation sufficient for binding to a target protein or nucleic acid, said method comprising: [0072](a) producing nucleic acid fragments from nucleic acids derived from one or two or more microorganisms or eukaryotes containing compact genomes, each of said microorganisms or eukaryotes having a substantially sequenced genome; [0073](b) selecting nucleic acid fragments from the fragments at (a) that encode a peptide having an average length of at least about 12-15 amino acid residues and/or encode a protein domain; and [0074](c) inserting the selected fragments at (b) into a suitable expression vector thereby producing recombinant constructs, wherein each fragment is in operable connection with a promoter sequence that is capable of conferring expression of that fragment.
[0075]In an alternative embodiment, the present invention provides a method of constructing an expression library for expressing a polypeptide having a conformation sufficient for binding to a target protein or nucleic acid, said method comprising: [0076](a) producing nucleic acid fragments from nucleic acids derived from two or more microorganisms or eukaryotes containing compact genomes, each of said microorganisms or eukaryotes having a substantially sequenced genome; [0077](b) selecting nucleic acid fragments from the fragments at (a) that encode a peptide having an average length of at least about 12-15 amino acid residues and/or encode a protein domain; and [0078](c) inserting the selected fragments at (a) into a suitable expression vector in an amount proportional to the size of the genome from which the fragments were derived thereby producing recombinant constructs, wherein each fragment is in operable connection with a promoter sequence that is capable of conferring expression of that fragment.
[0079]In a further preferred embodiment, nucleic acid fragments are selected having sufficiently different nucleotide sequences to thereby enhance the nucleotide sequence diversity between the selected nucleic acid fragments, prior to or following their insertion into an expression vector or gene construct. Preferably, such a selection is performed prior to insertion of the nucleic acid fragments into a vector or gene construct.
[0080]In one embodiment, selecting nucleic acid fragments having sufficiently different nucleotide sequences comprises subjecting a base nucleic acid fragment to mutagenesis to produce a mutated fragment and optionally combining the mutated fragment with the base nucleic acid fragment.
[0081]In another embodiment, selecting nucleic acid fragments having sufficiently different nucleotide sequences comprises mutating a nucleic acid fragment thereby permitting the nucleic acid fragment to be read in any one or more of three forward reading frames. By "mutating" in this context is meant that one or more nucleotide residues are added to the 5'-end or 3'-end of a nucleic acid fragment. Alternatively, or in addition, "mutating" in this context means that the nucleotide sequence of a nucleic acid fragment is subjected to mutation by the insertion of one or more nucleotides into an internal region of the fragment, or by deleting one or more nucleotides from the fragment, or by substituting one or more nucleotides of the nucleic acid fragment. For example, by adding or deleting one or two or three nucleotides from the 5'-end of a base nucleic acid fragment and inserting the base fragment and each mutated fragment produced therefrom into an expression vector, the first codon becomes positioned at different locations relative to the translation start site such that each three forward reading frame is used.
[0082]In another embodiment, selecting nucleic acid fragments having sufficiently different nucleotide sequences comprises cloning a nucleic acid fragment in a reverse orientation relative to the orientation of the fragment in the context of the gene from which it was derived. In accordance with this embodiment, a reverse open reading frame is used.
[0083]In another embodiment, selecting nucleic acid fragments having sufficiently different nucleotide sequences comprises deleting a nucleic acid fragment having a sequence that is over represented in the genome or in the expression library. For example, it is preferred to delete or remove nucleic acid fragments comprising highly repetitive nucleotide sequences, or additional copies of nucleic acid fragments that are repeated in a genome (ie., to remove nucleic acid fragments comprising redundant nucleotide sequences of multiple copy or high copy number genes). It is to be understood that "redundant nucleotide sequences" does not include each and every copy of a repeated sequence, since it is preferred to leave at least one copy of such sequences in the nucleic acid fragment pool used to construct the expression library of the present invention.
[0084]Accordingly, a preferred embodiment of the present invention provides a method of constructing an expression library for expressing a polypeptide having a conformation sufficient for binding to a target protein or nucleic acid, said method comprising: [0085](a) producing nucleic acid fragments from nucleic acids derived from one or two or more microorganisms or eukaryotes containing compact genomes, each of said microorganisms or eukaryotes having a substantially sequenced genome; [0086](b) selecting nucleic acid fragments from the fragments at (a) that have sufficiently different nucleotide sequences thereby enhancing nucleotide sequence diversity among the selected fragments compared to the diversity of sequences in the genome; and [0087](c) inserting the selected fragments at (b) into a suitable expression construct thereby producing recombinant constructs, wherein each fragment is in operable connection with a promoter sequence that is capable of conferring expression of that fragment.
[0088]In an alternative embodiment, the present invention provides a method of constructing an expression library for expressing a polypeptide having a conformation sufficient for binding to a target protein or nucleic acid, said method comprising: [0089](a) producing nucleic acid fragments from nucleic acids derived from two or more microorganisms or eukaryotes containing compact genomes, each of said microorganisms or eukaryotes having a substantially sequenced genome; [0090](b) selecting nucleic acid fragments from the fragments at (a) that have sufficiently different nucleotide sequences thereby enhancing nucleotide sequence diversity among the selected fragments compared to the diversity of sequences in the genome; and [0091](c) inserting the selected fragments at (a) into a suitable expression vector in an amount proportional to the size of the genome from which the fragments were derived thereby producing recombinant constructs, wherein each fragment is in operable connection with a promoter sequence that is capable of conferring expression of that fragment.
[0092]In a particularly preferred embodiment, the present invention provides a method of constructing an expression library for expressing a polypeptide having a conformation sufficient for binding to a target protein or nucleic acid, said method comprising: [0093](a) producing nucleic acid fragments from nucleic acids derived from one or two or more microorganisms or eukaryotes containing compact genomes, each of said microorganisms or eukaryotes having a substantially sequenced genome; [0094](b) selecting nucleic acid fragments from the fragments at (a) that have sufficiently different nucleotide sequences thereby enhancing nucleotide sequence diversity among the selected fragments compared to the diversity of sequences in the genome and selecting nucleic acid fragments from the fragments at (a) that encode a peptide having an average length of at least about 12-15 amino acid residues and/or encode a protein domain; and [0095](c) inserting the selected fragments at (b) into a suitable expression construct thereby producing recombinant constructs, wherein each fragment is in operable connection with a promoter sequence that is capable of conferring expression of that fragment.
[0096]In an alternative particularly preferred embodiment, the present invention provides a method of constructing an expression library for expressing a polypeptide having a conformation sufficient for binding to a target protein or nucleic acid, said method comprising: [0097](a) producing nucleic acid fragments from nucleic acids derived from two or more microorganisms or eukaryotes containing compact genomes, each of said microorganisms or eukaryotes having a substantially sequenced genome; [0098](b) selecting nucleic acid fragments from the fragments at (a) that have sufficiently different nucleotide sequences thereby enhancing nucleotide sequence diversity among the selected fragments compared to the diversity of sequences in the genome and selecting nucleic acid fragments from the fragments at (a) that encode a peptide having an average length of at least about 12-15 amino acid residues and/or encode a protein domain; and [0099](c) inserting the selected fragments at (a) into a suitable expression vector in an amount proportional to the size of the genome from which the fragments were derived thereby producing recombinant constructs, wherein each fragment is in operable connection with a promoter sequence that is capable of conferring expression of that fragment.
[0100]Preferably, if the library is to be expressed in either a cellular system or in an organism then the method of producing an expression library in accordance with the present invention further comprises introducing the recombinant vector or recombinant gene construct into a host cell such that a nucleic acid fragment contained therein is capable of being expressed as a peptide or protein domain having a conformation sufficient for binding to target protein or nucleic acid.
[0101]A second aspect of the present invention relates to an expression library described according to the procedures described herein. Such libraries will comprise isolated nucleic acid fragments from one or two or more prokaryote or compact eukaryote genomes, wherein said fragments comprise, on average, an open reading frame of about 36 to about 150 nucleotides or about 250 nucleotides in length or sufficient to encode a single protein domain having a conformation sufficient to bind to a target nucleic acid or target protein. Preferably, the fragments comprise nucleotide sequences that are non-redundant or alternatively, encode peptides or protein domains comprising non-redundant amino acid sequences.
[0102]Preferably, expression libraries comprising mixtures of nucleic acid fragments from 2 or 3 or 4 or 5 or 6 or 7 or 8 or 9 or 10 or 11 or 12 or 13 or 14 or 15 or 16 or 17 or 18 or 19 or 20 prokaryote or compact eukaryote genomes. Preferably, such mixed libraries are normalized.
[0103]The present invention also relates to the use of the expression libraries to isolate a nucleic acid that encodes a peptide or protein domain, in particular a peptide having a conformation sufficient for binding to a target protein or target nucleic acid. In accordance with this aspect of the invention, the expression library of the present invention is screened to identify a peptide encoded by an inserted nucleic acid fragment of the library that binds to a target protein or target nucleic acid, such as, for example to modulate a specific protein:DNA or protein:protein interaction or a structure such as a cell wall or a membrane transport component.
[0104]Accordingly, a further aspect of the present invention provides a method of determining a peptide that binds to a target nucleic acid or target protein comprising: [0105](a) screening an expression library of the present invention to identify a peptide expressed by the library that binds to the target protein or target nucleic acid; and [0106](b) selecting a peptide from (a) that does not bind to said target protein or nucleic acid in its native environment.
[0107]Screening approaches suitable for performing the invention include for example, a method selected from the group consisting of yeast-2-hybrid, n-hybrid, reverse-2-hybrid, reverse n-hybrid, split two hybrid, bacterial display, phage display, retroviral display, covalent display and in vitro display. In a particularly preferred embodiment, the expression library is screened using a phage display method.
[0108]Another aspect of the present invention provides an isolated peptide or protein domain that binds to an immunoglobulin, wherein said immunoglobulin was not raised against the peptide or protein domain and wherein said peptide or protein domain does not have a native function of the protein against which the immunoglobulin was prepared (ie., it is not functionally homologous and does not have the same primary structure as the peptide against which the immunoglobulin was prepared). In one particularly preferred embodiment, the peptide or protein domain binds to antibodies against an allergen, more preferably a pollen allergen and even more preferably against a Der p1 allergen.
[0109]This aspect of the present invention clearly extends to any isolated nucleic acid encoding the peptide or protein domain that binds to the immunoglobulin.
[0110]Another aspect of the present invention provides an isolated peptide or protein domain that partially or completely inhibits or antagonizes or blocks an interaction between two or more proteins in a cell. Preferably, the isolated peptide or protein domain blocks an interaction between SCL and another protein, or between E47 and another protein. Even more preferably, the isolated peptide or protein domain blocks an interaction between SCL and E47 in a cell. In a particularly preferred embodiment, the isolated peptide comprises an amino acid sequence selected from the group consisting of SEQ ID NO: 63, SEQ ID NO: 65, SEQ ID NO: 67, SEQ ID NO: 69, SEQ ID NO: 71, SEQ ID NO: 73, SEQ ID NO: 75, SEQ ID NO: 79 and SEQ ID NO: 81.
[0111]This aspect of the present invention clearly extends to any isolated nucleic acid encoding the peptide or protein domain that partially or completely inhibits or antagonizes or blocks an interaction between two or more proteins in a cell. Exemplary nucleic acids provided herein comprise a nucleotide sequence selected from the group consisting of: SEQ ID NO: 62, SEQ ID NO: 64, SEQ ID NO: 66, SEQ ID NO: 68, SEQ ID NO: 70, SEQ ID NO: 72, SEQ ID NO: 74, SEQ ID NO: 78 and SEQ ID NO: 80.
[0112]Another aspect of the present invention provides a database comprising the nucleotide sequences of nucleic acid fragments of an expression library of the present invention in computer readable form.
[0113]A related embodiment provides a database comprising amino acid sequences of peptides encoded by nucleic acid fragments of the present invention. Preferably, the database incorporates information regarding the secondary structure of the peptides, including predicted structure or a structure as determined by X-ray crystallography or other empirical means.
[0114]A further aspect of the present invention provides a method for determining or validating a target comprising [0115](a) screening an expression library of the present invention to identify a peptide expressed by the library that binds to a target protein or target nucleic acid; [0116](b) selecting a peptide from (a) that does not bind to said target protein or nucleic acid in its native environment; and [0117](c) expressing the selected peptide in an organism and determining a phenotype of the organism that is modulated by the target protein or target nucleic acid.
[0118]In a preferred embodiment, the target comprises a therapeutic or prophylactic target (eg., an oncoprotein or interaction between oncoproteins, a protein or nucleic acid associated with cancer (eg., a cancer marker) or other disease of an animal or human, or an antibacterial target, antihelminthic target, antiparasitic target, or antiviral target.
[0119]For example, the phenotype of an organism that expresses a tumor is assayed in the presence and absence of a peptide or protein domain that blocks an interaction between SCL and E47 in a screen of the expression library of the invention. Amelioration of the oncogenic phenotype by the expressed peptide indicates that the SCL/E47 is a suitable target for intervention, wherein the peptide is then suitably formulated for therapeutic intervention directly, or alternatively, small molecules are identified that are mimetics of the identified peptide or protein domain.
[0120]Accordingly, a further aspect of the present invention provides a method for identifying a therapeutic or prophylactic compound comprising [0121](a) screening an expression library of the present invention to identify a peptide expressed by the library that binds to a target protein or target nucleic acid; [0122](b) selecting a peptide from (a) that does not bind to said target protein or nucleic acid in its native environment; [0123](c) expressing the selected peptide in an organism and determining a phenotype of the organism that is modulated by the target protein or target nucleic acid; and [0124](d) identifying a mimetic compound of a peptide that modulated the phenotype of the organism.
BRIEF DESCRIPTION OF THE DRAWINGS
[0125]FIG. 1 is a schematic representation showing a simplified method of generating an expression library of the present invention, said library comprising nucleic acid fragments from multiple evolutionary diverse organisms. Initially nucleic acids are isolated from such organisms and pooled in such a way as to ensure equal representation of each of the genomes. Degenerate PCR is then used to amplify sequences from the pool of the genomes, before specific PCR is used to further amplify these nucleic acid fragments in such a way that they may be cloned into an expression vector.
[0126]FIG. 2 is a photographic representation showing amplification products of random PCR amplification of genomic DNA isolated from Archaeoglobus fulgidis, Aquifex aeliticus, Aeropyrum pernix, Bacillus subtilis, Bordetella pertussis TOX6, Borrelia burgdorferi, Chlamydia trachomati, Escherichia coli Kl2, Haemophilus influenzae (rd), Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Synechocystis PCC 6803, Thermoplasma volcanium, and Thermotoga maritima. The molecular weight marker is shown on the far left.
[0127]FIG. 3 is a schematic representation of the pDEATH-Trp vector (SEQ ID NO: 36). The pDEATH-Trp vector comprises a minimal ADH promoter for constitutive expression of a nucleic acid inserted into the vector in yeast cells; a T7 promoter for expression of a nucleic acid fragment in bacterial cells; a nucleic acid encoding a SV-40 nuclear localization signal to force any expressed polypeptide into the nucleus of a yeast cell; a CYC1 terminator, for termination of transcription in yeast cells; a nucleic acid encoding a peptide conferring ampicillin resistance, for selection in bacterial cells; a nucleic acid encoding TRP1 which allows auxotrophic yeast to grow in media lacking tryptophan; a pUC origin of replication, to allow the plasmid to replicate in bacterial cells; and a 2ฮผ origin of replication, to allow the plasmid to replicate in yeast cells.
[0128]FIG. 4 is a photographic representation showing nucleic acid fragments isolated from bacterial clones carrying the pDEATH-Trp vector. The isolated vector was digested with the restriction endonuclease EcoRI and the resulting fragments electrophoresed. The molecular weight marker is shown on the far left and far right, and the text indicates the size range of the nucleic acid fragments in base pairs.
[0129]FIG. 5 is a schematic representation of the pJFK vector (SEQ ID NO: 60). The pJFK vector comprises a GAL1 promoter for inducible expression of a nucleic acid fragment in yeast cells; a nuclear localization signal to force any expressed polypeptide into the nucleus of a yeast cell; a nucleic acid encoding an activation domain derived from the B42 protein, to be expressed as a fusion with a polypeptide of interest in a "n"-hybrid screen; an ADH terminator or termination of transcription in yeast cells; a 2ฮผ origin of replication, to allow the plasmid to replicate in yeast cells; an HIS5 gene to allow auxotrophic yeast to grow in media lacking histidine; a nucleic acid encoding a peptide conferring ampicillin resistance, for selection in bacterial cells; and a nucleic acid encoding a peptide conferring kanamycin resistance.
[0130]FIG. 6 is a schematic representation of the pDD vector (SEQ ID NO: 61). The pDD vector comprises a GAL1 promoter for inducible expression of a nucleic acid fragment in yeast cells; a nucleic acid encoding a LEXA1 protein, to be expressed as a fusion with a polypeptide of interest in a "n"-hybrid screen; an ADH terminator or termination of transcription in yeast cells; a 2ฮผ origin of replication, to allow the plasmid to replicate in yeast cells; an HIS5 gene to allow auxotrophic yeast to grow in media lacking histidine; a nucleic acid encoding a peptide conferring ampicillin resistance, for selection in bacterial cells; and a nucleic acid encoding a peptide conferring kanamycin resistance.
[0131]FIG. 7 is a schematic representation of a reverse two-hybrid screen to identify antagonists of the interaction of SCL/E47. Initially, yeast expressing a library of the present invention is mated to a yeast strain expressing E47 and SCL. From this screen 1000 clones were chosen that were able to grow on FOA plates. These were then screened to identify those clones that were not able to grow on LEU-plates. The plasmids that expressed putative antagonists of the SCL/E47 interaction were then isolated and re-transformed into yeast to confirm their ability to block such an interaction.
[0132]FIG. 8 is a photographic representation showing library clones that have not expressed the URA3 counter selectable marker gene on yeast 0.04% FOA plates, and are able to grow on 5-FOA.
[0133]FIG. 9 is a photographic representation showing yeast colonies isolated from an initial reverse two-hybrid screen grown on media lacking leucine. The circled colonies are those that are not expressing the LEU2 selectable marker. Accordingly, it appears that these colonies express a peptide that inhibits the interaction of SCL and E47.
[0134]FIG. 10 is a photographic representation of yeast colonies expressing the E47 bait and SCL prey proteins in addition to putative peptide inhibitors identified in a reverse two-hybrid screen. These were tested for blocking of the interaction through growing the colonies on media lacking uracil and media lacking leucine. In this way any putative peptide inhibitors were re-tested for the ability to block the interaction between SCL and E47.
[0135]FIG. 11 is a graphical representation of the binding of phage-displayed peptides to the ฮฑ-FLAG antibody using time resolved fluorescence analysis using a europium detection system. The column marked "T7-no insert" refers to a phage carrying a phage display vector with no insert. "T7 FLAG" refers to a phage displaying the FLAG epitope, ie. a positive control. The column marked "BGF lysate" refers to a pool of random phage from the entire phage displayed library, and the columns marked "Amp1. Lys #1-3 refer to pools of phage isolated following consecutive rounds of biopanning with the ฮฑ-FLAG antibody. The remaining columns show the ability of individual phage displayed peptides to bind to the ฮฑ-FLAG antibody, with the first number referring to the round of biopanning from which the phage was isolated, and the second number the clone number.
DETAILED DESCRIPTION OF THE PREFERRED EMBODIMENTS
[0136]One aspect of the present invention provides a method of constructing an expression library for expressing a polypeptide having a conformation sufficient for binding to a target protein or nucleic acid.
[0137]As used herein, the term "expression library" shall be taken to mean a plurality of nucleic acids cloned into a recombinant expression vector such that the cloned DNA fragments are expressed to produce peptides or proteins. As used herein, the terms "expression", "expressed" or "express" shall be taken to mean at least the transcription of a nucleotide sequence to produce a RNA molecule. The term "expression" "expressed" or "express" further means the translation of said RNA molecule to produce a peptide, polypeptide or protein.
[0138]As used herein, the term "having a conformation sufficient for binding to a target protein or nucleic acid" shall be taken to mean that an expressed peptide is capable of achieving a secondary structure or conformation sufficient for it to bind to a particular target protein or peptide or polypeptide, or alternatively, a target nucleic acid, preferably in the absence of a constraining peptide such as, for example a Trx loop. Such an affinity is to be interpreted in its broadest context to include, for example, the formation of a peptide:peptide complex, a peptide:protein complex, an antigen:antibody complex, and a peptide:nucleic acid complex.
[0139]One preferred embodiment of the present invention relates to the production of nucleic acid fragments from the genome of one or two or more prokaryotes or compact eukaryotes, each of said microorganisms or compact eukaryotes having a substantially sequenced genome.
[0140]The term "fragment" as used herein, shall be understood to mean a nucleic acid that is the same as part of, but not all of a nucleic acid that forms a gene.
[0141]As used herein, the term "gene" means the segment of nucleic acid, specifically DNA, capable of encoding a peptide or polypeptide, in the present context, a "nucleic acid fragment" is include regions preceding and/or following the coding region of a naturally occurring gene, eg. 5' untranslated or 3' untranslated sequences, as well as intervening sequences between individual coding sequences.
[0142]It will be apparent from the disclosure herein that the nucleic acid fragments used to produce the expression libraries in accordance with the present invention do not necessarily encode the same protein or peptide as in their native context (ie. the gene from which they were derived). In fact, the nucleic acid fragments will generally encode a hitherto unknown peptide, particularly if derived from a non-coding region of a native gene. All that is required is an open reading frame of sufficient length to encode a peptide or protein domain.
[0143]Nucleic acid fragments are generated by one or more of a variety of methods well known to those skilled in the art. Such methods include, for example, a method of producing nucleic acid fragments selected from the group consisting of mechanical shearing (eg by sonication or passing the nucleic acid through a fine gauge needle), digestion with a nuclease (eg Dnase 1), digestion with one or more restriction enzymes, preferably frequent cutting enzymes that recognize 4-base restriction enzyme sites and treating the DNA samples with radiation (eg. gamma radiation or ultra-violet radiation).
[0144]In another embodiment, copies of nucleic acid fragments isolated from one or two or more organisms are generated by polymerase chain reaction (PCR) using, for example, random or degenerate oligonucleotides. Such random or degenerate oligonucleotides include restriction enzyme recognition sequences to allow for cloning of the amplified nucleic acid into an appropriate nucleic acid vector. Methods of generating oligonucleotides are well known in the art and are described, for example, in Oligonucleotide Synthesis: A Practical Approach (M. J. Gait, ed., 1984) IRL Press, Oxford, whole of text, and particularly the papers therein by Gait, pp 1-22; Atkinson et al., pp 35-81; Sproat et al., pp 83-115; and Wu et al., pp 135-151. Methods of performing PCR are also described in detail by McPherson et al., In: PCR A Practical Approach., IRL Press, Oxford University Press, Oxford, United Kingdom, 1991.
[0145]In a preferred embodiment, the nucleic acid fragment comprises or consists of an open reading frame of nucleotides having a length sufficient to encode a protein domain and preferably, a single protein domain. Examples of protein domains include, for example protein domains selected from the group comprising, helix-loop helix (HLH), leucine zipper, zinc finger, SH2 domain, SH3 domain, WW domain, C2 domain, and proline rich region (PRR), amongst others.
[0146]Several studies have shown that the smallest natural domains that are able to fold autonomously consist of about 30 amino acids to about 50 amino acids in length (Yang, Biochemistry 38, 465, 1999, Horng. Biochemistry, 41:13360, 2002, Neidigh, Nature Structural Biology, 9:425, 2002). In this context, the term "autonomous" means independent of controlling factors, thus a protein that is able to fold autonomously does so in the absence of factors such as, for example disulphide bonds, ligand binding, or the use of a constraint such as, for example a Trx loop. Accordingly, in one preferred embodiment of the present invention, the nucleic acid fragments of the expression library will consist of an open reading frame sufficient to encode a peptide of about 30-50 amino acids in length.
[0147]It is also known that factors such as disulphide bonds control the folding of the peptides. U.S. Pat. No. 6,361,969 and U.S. Pat. No. 6,083,715 describe the expression of protein disulphide isomerases to induce disulphide bond formation in proteins. Studies by Vranken (In: Proteins, 47:14-24, 2002) have suggested that natural protein domains stabilized by disulphide bonding can be as small as 15 to 25 amino acids in length. Accordingly, an alternative embodiment of the present invention uses nucleic acid fragments that consist of an open reading frame sufficient to encode a peptide of about 15 amino acids to about 25 amino acids in length.
[0148]It will be apparent from the preceding description that the present invention preferably utilizes nucleic acid fragments having a length of about 45 to about 150 nucleotides in length or about 250 nucleotides in length. However, it is to be understood that some variation from this range is permitted, the only requirement being that, on average, nucleic acid fragments generated encode a protein domain or a peptide comprising about 15 to about 50 amino acids in length, and more preferably about 20 to about 50 amino acids in length and still more preferably about 30 to about 50 amino acids in length.
[0149]Methods of producing nucleic acid fragments and separating said fragments according to their molecular weight are well known in the art and include, for example, the fragmentation methods supra and a method of separation selected from the group comprising, agarose gel electrophoresis, pulse field gel electrophoresis, polyacrylamide gel electrophoresis, density gradient centrifugation and size exclusion chromatography. A number of other methods for separating DNA fragments by their size are known in the art and are described, for example in Sambrook et al (In:).
[0150]The genomic nucleic acid is isolated from a variety of sources. In one preferred embodiment, genomic DNA is isolated from a prokaryotic organism. Exemplary prokaryotic sources of nucleic acid fragments include, Aeropyrum pernix, Agrobacterium tumeficians, Aquifex aeolicus, Archeglobus fulgidis, Baccilus halodurans, Bacillus subtilis, Borrelia burgdorferi, Brucella melitensis, Brucella suis, Bruchnera sp., Caulobacter crescentus, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia pneumoniae, Chlamydia trachomatis, Chlamydia muridarum, Chlorobium tepidum, Clostridium acetobutylicum, Deinococcus radiodurans, Escherichia coli, Haemophilus influenzae Rd, Halobacterium sp., Helicobacter pylori, Methanobacterium thermoautotrophicum, Lactococcus lactis, Listeria innocua, Listeria monocytogenes, Methanococcus jannaschii, Mesorhizobium loti, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma penetrans, Mycoplasma pneumoniae, Mycoplasma pulmonis, Neisseria meningitidis, Oceanobacillus iheyensis, Pasteurella multocida, Pseudomonas aeruginosa, Pseudomonas putida, Pyrococcus horikoshii, Rickettsia conorii, Rickettsia prowazekii, Salmonella typhi, Salmonella typhimurium, Shewanella oneidensis MR-1, Shigella flexneri 2a, Sinorhizobium meliloti, Staphylococcus aureus, Streptococcus agalactiae, Streptococcus agalactiae, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Streptomyces avermitilis, Streptomyces coelicolor, Sulfolobus solfataricus, Sulfolobus tokodaii, Synechocystis sp., Thermoanaerobacter tengcongensis, Thermoplasma acidophilum, Thermoplasma volcanium, Thermotoga maritima, Treponema pallidum, Ureaplasma urealyticum, Vibrio cholerae, Xanthomonas axonopodis pv., Citri, Xanthomonas campestris pv., Campestris, Xylella fastidiosa, and Yersinia pestis.
[0151]Methods of isolating genomic DNA from prokaryotic organisms are well known in the art and are described in, for example, Ausubel et al (In: Current Protocols in Molecular Biology. Wiley Interscience, ISBN 047 150338, 1987) or (Sambrook et al., In:).
[0152]In an alternative embodiment, genomic nucleic acid is from a compact eukaryote. As used herein the term "compact eukaryote" shall be taken to mean any organism of the superkingdom Eukaryota that has a haploid genome size of less than about 1700 mega base pairs (Mbp), and preferably, less than 100 Mbp. Exemplary compact eukaryotes that are suitable for this purpose include Arabidopsis thaliana, Anopheles gambiae, Brugia malayi, Caenorhabditis elegans, Danio rerio, Drosophila melanogaster, Eimeria tenella, Eimeria acervulina, Entamoeba histolytica, Oryzias latipes, Oryza sativa, Plasmodium falciparum, Plasmodium vivax, Plasmodium yoelii, Sarcocystis cruzi, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Schistosoma mansoni, Takifugu rubripes, Theileria parva, Tetraodon fluviatilis, Toxoplasma gondii, Tryponosoma brucei, and Trypanosoma cruzi.
[0153]Furthermore, it is preferred that said compact eukaryotes contain genomes have less repetitive nucleotide than, for example humans. Such information can be determined from information from NCBI or TIGR.
[0154]As used herein the term "NCBI" shall be taken to mean the database of the National Center for Biotechnology Information at the National Library of Medicine at the National Institutes of Health of the Government of the United States of America, Bethesda, Md., 20894.
[0155]As used herein the term "TIGR" shall be taken to mean the database of The Institute of Genomic Research, Rockville, Md., 20850.
[0156]A preferred example of an organism having a compact genome is the Japanese puffer fish, Takifugu rubripes. T. rubripes has a haploid genome size of approximately 400 Mbp, with a gene density of about 16%. This is compared to the human genome, which has a size in excess of 3000 Mbp of which only about 3% of nucleotide sequences encode proteins. The absolute number of native genes in the T. rubripes genome is comparable to that in the human genome, suggesting fewer repetitive sequences occur in T. rubripes. This feature makes T. rubripes particularly useful as a source of nucleic acid fragments of the expression libraries of the present invention. This is because a nucleic acid fragment derived from the genome of a compact eukaryote has an increased probability of encoding a protein domain that is contained within a naturally occurring protein in its native context, compared to a sequence derived from a non-compact eukaryote.
[0157]It is to be understood that, whilst such native domains of proteins is expressed by the libraries of the invention, the invention is not limited to the expression of known protein domains. Moreover, it is to be understood that the expression libraries of the invention are screened using a process that excludes the selection of clones that encode a known protein domain having its native function. Accordingly, the present invention is directed to products and processes for isolating peptides having new or enhanced functions.
[0158]Methods of isolating genomic DNA from eukaryotic organisms are well known in the art and are described in, for example, Ausubel et al (In: Current Protocols in Molecular Biology. Wiley Interscience, ISBN 047 150338, 1987) or (Sambrook et al (In:).
[0159]In a further embodiment of the present invention, the nucleic acid fragments are derived from complimentary DNA (cDNA). Those skilled in the art will be aware that cDNA is generated by reverse transcription of RNA using, for example, avian reverse transcriptase (AMV) reverse transcriptase or Moloney Murine Leukemia Virus (MMLV) reverse transcriptase. Such reverse transcriptase enzymes and the methods for their use are well known in the art, and are obtainable in commercially available kits, such as, for example, the Powerscript kit (Clontech), the Superscript II kit (Invitrogen), the Thermoscript kit (Invitrogen), the Titanium kit (Clontech), or Omniscript (Qiagen).
[0160]Methods of isolating mRNA from a variety of organisms are well known in the art and are described for example in, Ausubel et al (In: Current Protocols in Molecular Biology. Wiley Interscience, ISBN 047 150338, 1987) or Sambrook et al (In:). Methods of generating cDNA from isolated RNA are also commonly known in the art and are described in for example, Ausubel et al (In: Current Protocols in Molecular Biology. Wiley Interscience, ISBN 047 150338, 1987) or (Sambrook et al (In:).
[0161]In a preferred embodiment, the nucleic acid fragments generated from RNA or cDNA are normalized to reduce any bias toward more highly expressed genes. Methods of normalizing nucleic acids are well known in the art, and are described for example in, Ausubel et al (In: Current Protocols in Molecular Biology. Wiley Interscience, ISBN 047 150338, 1987) or Sambrook et al (In: Molecular Cloning: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Third Edition 2001) and Soares et al Curr. Opinion Biotechnol 8, 542-546, 1997, and references cited therein. One of the methods described by Soares uses reasssociation-based kinetics to reduce the bias of the library toward highly expressed sequences. Alternatively, cDNA is normalized through hybridization to genomic DNA that has been bound to magnetic beads, as described in Kopczynski et al, Proc. Natl. Acad. Sci. USA, 95(17), 9973-9978, 1998. This provides an approximately equal representation of cDNA sequences in the eluant from the magnetic beads. Normalized expression libraries produced using cDNA from one or two or more prokaryotes or compact eukaryotes are clearly contemplated by the present invention.
[0162]In a particularly preferred embodiment, the nucleic acid fragments are derived from a prokaryote and/or compact eukaryote having a substantially sequenced genome. An advantage of using such fragments is that bioinformatic data can be assembled and used to provide more complete information about the composition of a library than would be possible using uncharacterized libraries. This facilitates the generation of DNA arrays containing sequences derived from many or all of the nucleic acid fragments of the library. Methods used in the generation and screening of DNA arrays are well known in the art and are described in for example, Schena (In: Microarray Analysis, John Wiley and Sons, ISBN: 0471414433, 2002). The use of DNA arrays in the high-throughput analysis of the screening of a biodiverse nucleic acid fragment to determine the sequences of positive clones is particularly contemplated.
[0163]As used herein "substantially sequenced genome" shall be taken to mean that at least about 60% of the genome has been sequenced. More preferably at least about 70% of the genome has been sequenced, and more preferably at least about 75% of the genome has been sequenced. Even more preferably at least about 80% of the genome has been sequenced.
[0164]Methods for determining the amount of a genome that has been sequenced are well known in the art. Furthermore, information regarding those sequences that have been sequenced is readily obtained from publicly available sources, such as, for example, the databases of NCBI or TIGR, thereby facilitating determination of the diversity of the genome.
[0165]Organisms having a substantially sequenced genome include, for example, an organism selected from the group consisting of Aeropyrum pernix, Agrobacterium tumeficians, Anopheles gambiae, Aquifex aeolicus, Arabidopsis thaliana, Archeglobus fulgidis, Baccilus halodurans, Bacillus subtilis, Borrelia burgdorferi, Brucella melitensis, Brucella suis, Bruchnera sp., Brugia malayi, Caenorhabditis elegans, Caulobacter crescentus, Campylobacter jejuni, Chlamydia pneumoniae, Chlamydia pneumoniae, Chlamydia trachomatis, Chlamydia muridarum, Chlorobium tepidum, Clostridium acetobutylicum, Danio rerio, Deinococcus radiodurans, Drosophila melanogaster, Eimeria tenella, Eimeria acervulina, Entamoeba histolytica, Escherichia coli, Haemophilus influenzae Rd, Halobacterium sp., Helicobacter pylori, Methanobacterium thermoautotrophicum, Lactococcus lactis, Listeria innocua, Listeria monocytogenes, Methanococcus jannaschii, Mesorhizobium loti, Mycobacterium leprae, Mycobacterium tuberculosis, Mycoplasma genitalium, Mycoplasma penetrans, Mycoplasma pneumoniae, Mycoplasma pulmonis, Neisseria meningitidis, Oceanobacillus iheyensis, Oryzias latipes, Oryza sativa, Pasteurella multocida, Plasmodium falciparum, Plasmodium vivax, Plasmodium yoelii, Pseudomonas aeruginosa, Pseudomonas putida, Pyrococcus horikoshii, Rickettsia conorii, Rickettsia prowazekii, Saccharomyces cerevisiae, Salmonella typhi, Salmonella typhimurium, Sarcocystis cruzi, Schistosoma mansoni, Schizosaccharomyces pombe, Shewanella oneidensis MR-1, Shigella flexneri 2a, Sinorhizobium meliloti, Staphylococcus aureus, Streptococcus agalactiae, Streptococcus agalactiae, Streptococcus mutans, Streptococcus pneumoniae, Streptococcus pyogenes, Streptomyces avermitilis, Streptomyces coelicolor, Sulfolobus solfataricus, Sulfolobus tokodaii, Synechocystis sp., Takifugu rubripes, Tetraodon fluviatilis, Theileria parva, Thermoanaerobacter tengcongensis, Thermoplasma acidophilum, Thermoplasma volcanium, Thermotoga maritima, Toxoplasma gondii, Treponema pallidum, Tryponosoma brucei, Trypanosoma cruzi Ureaplasma urealyticum, Vibrio cholerae, Xanthomonas axonopodis pv, Citri, Xanthomonas campestris pv., Campestris, Xylella fastidiosa, and Yersinia pestis.
[0166]In a particularly preferred embodiment, nucleic acid fragments are selected that have sufficiently different or divergent nucleotide sequences to thereby enhance nucleotide sequence diversity among the selected fragments compared to the diversity of sequences in the genome from which they were derived.
[0167]In one embodiment a nucleic acid fragment is selected such that the encoded polypeptide varies by one or more amino acids with regard to the amino acid sequence of the polypeptide encoded by another fragment in the library, a process that is facilitated using genomes that are substantially sequenced.
[0168]In an alternative embodiment, the nucleotide sequence of a nucleic acid fragment is mutated by a process such that the encoded peptide varies by one or more amino acids compared to the "template" nucleic acid fragment. The "template" may have the same nucleotide sequence as the original nucleic acid fragment in its native context (ie. in the gene from which it was derived). Alternatively, the template may itself be an intermediate variant that differs from the original nucleic acid fragment as a consequence of mutagenesis. Mutations include at least one nucleotide difference compared to the sequence of the original fragment. This nucleic acid change may result in for example, a different amino acid in the encoded peptide, or the introduction or deletion of a stop codon. Accordingly, the diversity of the nucleic acids of the expression library and the encoded polypeptides is enhanced by such mutation processes.
[0169]In one embodiment, the nucleic acid fragments are modified by a process of mutagenesis selected from the group consisting of, mutagenic PCR, expressing the nucleic acid fragment in a bacterial cell that induces a random mutation, site directed mutagenesis and expressing a nucleic acid fragment in a host cell exposed to a mutagenic agent such as for example radiation, bromo-deoxy-uridine (BrdU), ethylnitrosurea (ENU), ethylmethanesulfonate (EMS) hydroxylamine, or trimethyl phosphate amongst others.
[0170]In a preferred embodiment, the nucleic acid fragments are modified by amplifying a nucleic acid fragment using mutagenic PCR. Such methods is include a process selected from the group consisting of: (i) performing the PCR reaction in the presence of manganese; and (ii) performing the PCR in the presence of a concentration of dNTPs sufficient to result in misincorporation of nucleotides.
[0171]Methods of inducing random mutations using PCR are well known in the art and are described, for example, in Dieffenbach (ed) and Dveksler (ed) (In: PCR Primer: A Laboratory Manual, Cold Spring Harbour Laboratories, NY, 1995). Furthermore, commercially available kits for use in mutagenic PCR are obtainable, such as, for example, the Diversify PCR Random Mutagenesis Kit (Clontech) or the GeneMorph Random Mutagenesis Kit (Stratagene).
[0172]In one embodiment, PCR reactions are performed in the presence of at least about 200 ฮผM manganese or a salt thereof, more preferably at least about 300 ฮผM manganese or a salt thereof, or even more preferably at least about 500 ฮผM or at least about 600 ฮผM manganese or a salt thereof. Such concentrations manganese ion or a manganese salt induce from about 2 mutations per 1000 base pairs (bp) to about 10 mutations every 1000 bp of amplified nucleic acid (Leung et al Technique 1, 11-15, 1989).
[0173]In another embodiment, PCR reactions are performed in the presence of an elevated or increased or high concentration of dGTP. It is preferred that the concentration of dGTP is at least about 25 ฮผM, or more preferably between about 50 ฮผM and about 100 ฮผM. Even more preferably the concentration of dGTP is between about 100 ฮผM and about 150 ฮผM, and still more preferably between about 150 ฮผM and about 200 ฮผM. Such high concentrations of dGTP result in the misincorporation of nucleotides into PCR products at a rate of between about 1 nucleotide and about 3 nucleotides every 1000 bp of amplified nucleic acid (Shafkhani et al BioTechniques 23, 304-306, 1997).
[0174]PCR-based mutagenesis is preferred for the mutation of the nucleic acid fragments of the present invention, as increased mutation rates is achieved by performing additional rounds of PCR.
[0175]In another preferred embodiment, the nucleic acid of the expression library is mutated by inserting said nucleic acid into a host cell that is capable of mutating nucleic acid. Such host cells are deficient in one or more enzymes, such as, for example, one or more recombination or DNA repair enzymes, thereby enhancing the rate of mutation to a rate that is rate approximately 5,000 to 10,000 times higher than for non-mutant cells. Strains particularly useful for the mutation of nucleic acids carry alleles that modify or inactivate components of the mismatch repair pathway. Examples of such alleles include alleles selected from the group consisting of mutY, mutM, mutD, mutT, mutA, mutC and mutS. Bacterial cells that carry alleles that modify or inactivate components of the mismatch repair pathway are well known in the art, such as, for example the XL-1Red, XL-mutS and XL-mutS-Kanr bacterial cells (Stratagene).
[0176]Alternatively the nucleic acid fragments are cloned into a nucleic acid vector that is preferentially replicated in a bacterial cell by the repair polymerase, Pol I. By way of exemplification, a Pol I variant strain will induce a high level of mutations in the introduced nucleic acid vector, thereby enhancing sequence diversity of the nucleic acid used to generate the expression library of the present invention. Such a method is described by Fabret et al (In: Nucl Acid Res, 28, 1-5 2000), which is incorporated herein by reference.
[0177]In a further preferred embodiment the mutated nucleic acid fragments are combined with the non-mutated fragments from which they were derived, for subcloning into an expression vector. In this way, the nucleotide diversity of the expression library of the present invention is enhanced, as is the diversity of the conformations of the expressed peptides and proteins.
[0178]In another embodiment, the sequence diversity of a nucleic acid fragment is increased, such as, for example, using a synthetic shuffling technique, such as, for example, the process described by Ness et al, Nature Biotechnology, 20, 1251-1255, 2002, which is incorporated herein by reference. In adapting such a technique to the present invention, functionally homologous nucleic acid fragments are selected from the expression library, using methods described herein. By "functionally homologous" in this context means that the selected fragments bind to the same target protein or target nucleic acid. The amino acid sequence of each peptide that binds to the target is determined using methods well known in the art, and the sequences are aligned using an algorithm well known in the art. A consensus sequence is determined from the alignment that provides for highly conserved residues, as well as elucidating those residues that are structurally similar albeit not strictly conserved. The structural features of the peptides are also derived using X-ray crystallography and/or computer-based modelling procedures. Accordingly, the divergence in the identified peptides from an individual screen permits the identification of both primary and secondary structural features that are required for binding to the target protein or target nucleic acid to occur. Based upon the bioinformatic data obtained, oligonucleotides (eg., degenerate oligonucleotides or non-degenerate oligonucleotides as appropriate) are designed that encode all of the possible peptides that bind to the target protein or target nucleic acid. These oligonucleotides are then assembled using PCR employing multiple rounds of amplification, to generate a plurality of nucleic acids encoding all possible peptide combinations. Accordingly, an amino acid sequence that is not normally found in nature is produced.
[0179]In a further embodiment, a significant proportion of the nucleic acid fragments are cloned into a gene construct in at least two forward open reading frames, and preferably three forward open reading frames, to thereby enhance the number of divergent peptides or proteins that are encoded by a particular nucleic acid fragment. In this context, the term "significant proportion" means at least about 30% to 50%, preferably at least about 40% to 60%, more preferably at least about 50% to 70%, still more preferably at least about 60% to 80% and still more preferably greater than about 70% or 80% of the total nucleic acid fragments that are subcloned successfully into a suitable gene construct such that more than one open reading frame can be utilized for expression. As will be known to those skilled in the art, procedures for cloning a single nucleic acid into a gene construct in multiple reading frames are well known.
[0180]Particularly preferred methods of subcloning a nucleic acid fragment in multiple three reading frames comprise a process selected from the group consisting of: [0181](a) ligating the nucleic acid fragment to a linker or adaptor, such as for example, one or more linkers modified to contain an additional one or two or three base pairs, or a multiple of one or two or three nucleotides; [0182](b) Placing each nucleic acid fragment operably under the control of a Kozak consensus sequence and at different distances therefrom (eg. one or two or three nucleotides or a multiple of one or two or three nucleotides) from said Kozak consensus sequence; [0183](c) Placing a fragment under control of sequences that confer transcriptional and/or translational slippage.
[0184]By ligating the nucleic acid fragment to a linker or adaptor, the number of introduced nucleotides can be varied such that a significant proportion of the nucleic acid fragments are introduced into an expression vector or gene construct in at least two and preferably three reading frames. Linkers or adaptors are ligated to the 5'-end of the nucleic acid fragment such that, on average, a different length linker or adaptor is added to each nucleic acid fragment having the same sequence. This is generally achieved by varying the relative proportions of each linker/adaptor to the nucleic acid fragments. Naturally, each linker/adaptor of differing length is generally in equimolar concentration in the ligation reaction, and the total concentration of linker/adaptor 3'-ends is held in equimolar concentration to the total concentration of 5'-ends of the nucleic acid fragments being ligated. Methods of ligating adaptors to nucleic acids are well known in the art and are described in for example, Ausubel et al (In: Current Protocols in Molecular Biology. Wiley Interscience, ISBN 047 150338, 1987) or Sambrook et al (In: Molecular Cloning: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Third Edition 2001).
[0185]As an alternative to separately adding the linkers/adaptors to the nucleic acid fragments prior to subcloning into a suitable gene construct, a suitable gene construct is used that comprises additional nucleotides 3' of a translation initiation signal, and provides for sub-cloning of nucleic acid fragments in each reading frame. As will be known to those skilled in the art, each reading frame in a gene construct is generally accessed by digesting the gene construct with a different restriction endonuclease and then sub-cloning nucleic acid fragments into the digested, linearized vector. By "sub-cloning" means a process involving or comprising a ligation reaction.
[0186]Alternatively, site directed mutagenesis is used to introduce additional nucleotides after the translation initiation site of the gene construct. Methods of site-directed mutagenesis are well known in the art, and are described for example, in Dieffenbach (eds) and Dveksler (ed) (In: PCR Primer: A Laboratory Manual, Cold Spring Harbour Laboratories, NY, 1995). Furthermore, kits containing instruction and reagents necessary for site-directed mutagenesis are commercially available, such as, for example, the Quikchange site directed mutagenesis kit (Stratagene).
[0187]Furthermore, expression vectors are commercially available that have been modified to include an additional one or two nucleotides after the transcription start codon to allow for cloning of a nucleic acid in at least two and preferably three reading frames. Such vectors include, for example, the pcDNA (A, B, or C) vector suite (Invitrogen).
[0188]By positioning each nucleic acid fragment so that expression is placed operably under the control of a Kozak consensus sequence and at different distances therefrom, a significant proportion of the nucleic acid fragments is inserted into the vector in at least two and preferably three reading frames. A preferred Kozak sequence has the core sequence RNNATG (SEQ ID NO: 1), wherein R is a purine (ie. A or G) and N is any nucleotide. A particularly preferred Kozak sequence for expression of a polypeptide in eukaryotic cells comprises the sequence CCRCCATG (SEQ ID NO: 2) or GCCAGCCATGG (SEQ ID NO: 3). A preferred Kozak sequence for the expression of polypeptides in plants is CTACCATG (SEQ ID NO: 4).
[0189]A Kozak consensus sequence is generated using synthetic oligonucleotides in a process that is well known in the art and described, for example, in, Oligonucleotide Synthesis: A Practical Approach (M. J. Gait, ed., 1984) IRL Press, Oxford, whole of text, and particularly the papers therein by Gait, pp 1-22; Atkinson et al., pp 35-81; Sproat et al., pp 83-115; and Wu et al., pp 135-151. Alternatively a Kozac sequence is isolated from a natural or recombinant source using methods well known in the art, such as for example using from the group, restriction enzyme digestion or PCR.
[0190]In one embodiment, the Kozak sequence is generated as an oligonucleotide or nucleic acid fragment and then ligated 5' of the nucleic acid fragment (ie. the nucleic acid fragment being sub-cloned). Methods of ligating such oligonucleotides or fragments are well known in the art and are described in for example, Ausubel et al (In: Current Protocols in Molecular Biology. Wiley Interscience, ISBN 047 150338, 1987) or (Sambrook et al (In: Molecular Cloning: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Third Edition 2001). As with other ligations, the total concentration of nucleic acid of each ligating species (ie. the Kozak containing fragment and the nucleic acid) should preferably be equimolar. Naturally to ensure that a significant proportion of nucleic acid fragments are ligated in each reading frame, the Kozak-containing fragments of differing length should also be present in approximately equimolar concentration.
[0191]As an alternative to separately adding the Kozak consensus sequence oligonucleotide or fragment to the nucleic acid fragment prior to subcloning into a suitable vector, an expression vector is used that comprises a translation start site and provides for subcloning of nucleic acid fragments in each reading frame. As will be known to those skilled in the art, each reading frame in such a vector is generally accessed by digesting the vector with a different restriction enzyme and then subcloning fragments into the digested, linearized vector.
[0192]When the nucleic acid fragment of the present invention is to be expressed in prokaryotic cells, it is particularly preferred that the Kozak sequence of the above embodiments is replaced with a ribosome binding sequence, or Shine Dalgarno sequence. A particularly preferred Shine Dalgarno sequence consists of nucleic acids having the nucleotide sequence GAAGAAGATA (SEQ ID NO: 5).
[0193]By placing a fragment under control of sequences that confer transcriptional and/or translational slippage is meant that the fidelity of the start site for transcription and/or translation is reduced such that translation is initiated at different sites. Accordingly, such a sequence is cause the expression of several different polypeptides.
[0194]In one embodiment translational slippage (or translational frameshifting) is induced using nucleic acid comprising of the consensus sequence N1N1N1N2N2N2N3, wherein N represents any nucleotide and all nucleotides represented by N1 are the same nucleotide, all nucleotides represented by N2 are the same nucleotide. In accordance with this embodiment, N1 and/or N2 and/or N3 are the same or different. A particularly preferred translational slippage sequence for use in a eukaryote will comprise a sequence selected from the group consisting of: AAAAAAC (SEQ ID NO: 6), AAATTTA (SEQ ID NO: 7), AAATTTT (SEQ ID NO: 8), GGGAAAC. (SEQ ID NO: 9), GGGCCCC (SEQ ID NO: 10), GGGTTTA (SEQ ID NO: 11), GGGTTTT (SEQ ID NO: 12), TTTAAAC (SEQ ID NO: 13), TTTAAAT (SEQ ID NO: 14), TTTTTA (SEQ ID NO: 15), and GGATTTA (SEQ ID NO: 16). In an alternative embodiment, a sequence that induces translational slippage in yeast is CTTAGGC (SEQ ID NO: 17) or GCGAGTT (SEQ ID NO: 18). In yet another embodiment a sequence that induces translational slippage in mammals is TCCTGAT (SEQ ID NO: 19).
[0195]In another embodiment, a translational slippage sequences for use in prokaryotic organisms includes, but is not limited to s sequence selected from the group consisting of AAAAAAG (SEQ ID NO: 20), AAAAAAA (SEQ ID NO: 21), AAAAAAC (SEQ ID NO: 22), GGGAAAG (SEQ ID NO: 23), AAAAGGG (SEQ ID NO: 24), GGGAAAA (SEQ ID NO: 25), TTTAAAG (SEQ ID NO: 26) and AAAGGGG (SEQ ID NO: 27). It is particularly preferred that this translational slippage sequence is positioned about 7 to about 19 nucleotides downstream of a Shine Dalgarno sequence. In an alternative embodiment, a nucleic acid that induces translational slippage in bacterial cells comprises the nucleotide sequence CTT (SEQ ID NO: 28), and is positioned 3 nucleotides upstream of a Shine Dalgarno sequence controlling the expression of the nucleic acid fragment.
[0196]A translational slippage sequence is generated using synthetic oligonucleotides, or isolated from a natural or recombinant source, for example the prfB gene, the dnaX gene, the mammalian ornithine decarboxylase antizyme, in addition to various retroviruses, coronaviruses, retrotransposons, virus-like sequences in yeast, bacterial genes and bacteriophage genes. Such a sequence is isolated using a method that is well known in the art, such as for example, restriction enzyme digestion or PCR.
[0197]It is preferred that sequences that confer translational slippage are ligated to the 5'-end of the nucleic acid fragment in the same manner as for adaptor addition. Methods of ligating adaptors are well known in the art and are described in for example, Ausubel et al (In: Current Protocols in Molecular Biology. Wiley Interscience, ISBN 047 150338, 1987) or (Sambrook et al (In: Molecular Cloning: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Third Edition 2001).
[0198]It is also preferred that the sequences that confer transcriptional or translational slippage are incorporated into the expression vector or gene construct into which the nucleic acid fragment is inserted, such that it is positioned upstream (ie. 5') of the translational start site in the fragment.
[0199]In another embodiment, transcriptional slippage is induced by the introduction of a stretch of nucleotides with a sequence such as, for example, T9 or A9. Transcriptional slippage sequences are preferably cloned downstream (ie. 3') of the site of initiation of transcription. It is also preferred to position a transcriptional slippage sequence upstream (5') of a translational start site in the nucleic acid fragment. Accordingly, the transcriptional slippage sequence is included in the expression vector or gene construct into which the nucleic acid fragment is inserted.
[0200]Accordingly, the nucleic acids that form the transcriptional slippage sequence is ligated to the 5' end of a nucleic acid fragment, in conjunction with a translation start site.
[0201]It will be apparent from the preceding description that the transcriptional slippage sequence is incorporated into the expression vector or gene construct upstream of the translation start site, and downstream of the site of initiation of transcription.
[0202]Preferably, the nucleic acid fragments derived from the prokaryote or compact eukaryote genome are inserted into a gene construct in both the forward and/or reverse orientation, such that 1 or 2 or 3 or 4 or 5 or 6 open reading frames of said nucleic acid fragments are utilized. Methods of bi-directionally inserting fragments into vectors are well known in the art.
[0203]It will be apparent to the skilled artisan that, by sub-cloning the nucleic acid fragments in multiple reading frames into a suitable expression vector, it is possible to encode a peptide or protein domain that does not occur in nature, as well as producing a variety of natural peptide domains. Accordingly, the diversity of the nucleic acids of the expression library and their encoded peptides are greatly enhanced in these modified nucleic acid fragment expression libraries.
[0204]In a preferred embodiment, the expression libraries of the present invention are normalized to remove any redundant nucleic acid from the genome. As cited herein the term "redundant nucleic acid" shall be taken to mean those nucleic acid fragments having the same sequence, such as, for example, high copy number or repetitive sequences. Nucleic acid fragments derived from multiple homologous sequences, whether derived from the same or a different species can be subject to normalization to reduce the presence of redundant sequences in the expression library; Similarly, nucleic acid fragments derived from repetitive DNA and nucleic acid fragments derived from pseudogenes can be subject conveniently to normalization. Methods of normalizing libraries to remove redundant nucleic acid are well known in the art and are described, for example, by Ausubel et al., In: Current Protocols in Molecular Biology. Wiley Interscience, ISBN 047 150338, 1987, or Diversa Corporation (U.S. Pat. No. 5,763,239), or Sambrook et al., In: Molecular Cloning: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Third Edition 2001, or Bonaldo et al., Genome Res. 6(9), 791-806, 1997. In one embodiment, the nucleic acid fragments are subjected to hydroxyapatite chromatography to remove redundant or highly repetitive sequences. The success of such a normalization process can be determined, for example, by hybridizing labelled non-normalized and normalized DNA to Southern blots of genomic DNA and comparing the amount of label bound to each blot. The amount of bound label is comparable to the amount of hybridized DNA. A reduced hybridization signal for normalized libraries indicates that iterative sequences have been reduced in the normalized pool.
[0205]In one embodiment the nucleic acids used to produce the expression libraries of the present invention are isolated from a single organism. In this case, nucleic acid fragments are generated from nucleic acid derived from a distinct prokaryote or compact eukaryote.
[0206]In another embodiment of the present invention the nucleic acids are derived from two or more prokaryotes and/or compact eukaryotes including any and all combinations thereof.
[0207]It is especially preferred that the prokaryote(s) and/or compact eukaryote(s) used to produce expression libraries from combined genomes are evolutionally diverse organisms. As used herein the term "evolutionary diverse" shall be taken to mean those organisms that when compared at the genetic level, show a significant degree of genetic diversity. As used herein the term "significant degree of genetic diversity" shall be taken to mean, that the genes of the prokaryotes or compact eukaryotes differ, by at least about 10% to 30% at the nucleic acid level. More preferably the genetic sequences of the prokaryotes or compact eukaryotes differ by at least about 30% to 40% at the nucleic acid level. More preferably the genetic sequences of the prokaryotes or compact eukaryotes differ by at least about 50% at the nucleic acid level. More preferably the genetic sequences of the prokaryote or compact eukaryotes differ by at least about 70% at the nucleic acid level, or more preferably at least about 80% at the nucleic acid level or 90% at the nucleic acid level.
[0208]In determining whether or not two nucleotide sequences fall within these defined percentage identity limits, those skilled in the art will be aware that it is possible to conduct a side-by-side comparison of the nucleotide sequences. In such comparisons or alignments, differences will arise in the positioning of non-identical residues depending upon the algorithm used to perform the alignment. In the present context, references to percentage identities and similarities between two or more nucleotide sequences shall be taken to refer to the number of identical and similar residues respectively, between said sequences as determined using any standard algorithm known to those skilled in the art. In particular, nucleotide identities and similarities are calculated using software of the Computer Genetics Group, Inc., University Research Park, Maddison, Wis., United States of America, eg., using the GAP program of Devereaux et al., Nucl. Acids Res. 12, 387-395, 1984, which utilizes the algorithm of Needleman and Wunsch, J. Mol. Biol. 48, 443-453, 1970. Alternatively, the CLUSTAL W algorithm of Thompson et al., Nucl. Acids Res. 22, 4673-4680, 1994, is used to obtain an alignment of multiple sequences, wherein it is necessary or desirable to maximize the number of identical/similar residues and to minimize the number and/or length of sequence gaps in the alignment. Nucleotide sequence alignments can also be performed using a variety of other commercially available sequence analysis programs, such as, for example, the BLAST program available at NCBI.
[0209]In an alternative embodiment, the genetic sequences of the prokaryotes or compact eukaryotes fail to cross hybridize in a standard Cot analysis. The skilled artisan will be aware that standard Cot analyzes determine the similarity between two nucleotide sequences at the nucleotide level by using renaturation-kinetics of the corresponding nucleic acids (eg., Britten and Kohne Science, 161, 529-540, 1968).
[0210]Where more than one substantially sequenced genome used to produce the expression library of the present invention, it is also preferred that the fragments from each distinct prokaryote or compact eukaryote are used in an amount proportional to the complexity and size of the genome of said prokaryote or compact eukaryote. As the genomes of the prokaryotes and/or compact eukaryotes are substantially sequenced the approximate size of said genome's is determined. Accordingly, library is normalized to ensure that the amount of nucleic acids from all of the incorporated genomes to the final expression library is equal. In a particularly preferred embodiment, the nucleic acid fragment expression libraries are normalized such that nucleic acid fragments from each of the prokaryotes or compact eukaryotes are incorporated in equimolar amounts. In one exemplified embodiment, the sizes (in Mbp or molecular weight) of the genomes to be used in the expression library are compared and nucleic acid from each genome is used in an amount that is proportional to the ration of genome size to the size of the smallest contributing genome for the library. For example, the genome of T. rubripes is about 400 Mb in size, compared to the genome of A. thaliana, which is only about 120 Mb. Accordingly, for a combination of genomic T. rubripes and A. thaliana nucleic acid fragments, the ration of T. rubripes nucleic acid fragments to A. thaliana nucleic acid fragments would be about 4:1.2 (w/w). The relative contributions of nucleic acid fragments for constructing expression libraries from multiple genomes are readily calculated from the information presented in Table 1.
TABLE-US-00001 TABLE 1 Sizes of genomes of organisms from which nucleic acid fragments are derived for construction of expression libraries Source of nucleic acid fragments Approx genome size (Mb) Aeropyrum pernix 1.6-1.7 Agrobacterium pernix 1.67 Anopheles gambiae 26-27 Arabidopsis thaliana 120 Aquifex aeolicus 1.5-1.6 Archaeoglobus fulgidis 1.7 Bacillus subtilis 4.2 Bordetella pertussis 3.91 Borellia afzelii 0.95 Borellia garinii 0.95 Borrelia burgdorferi 0.91-0.96 Brugia malayi 100 Brucella suis 3.29 Buchnera sp. 0.64 Caenorhabditis elegans 97-102 Campylobacter jejuni 1.64 Caulobacter crescentus 4.01 Chlamydia muridarum 1.07 Chlamydia pneumoniae 1.22 Chlamydia trachomatis 1.0-1.1 Chlorobium tepidum 2.10 Chlostridium acetobutylicum 4.1 Danio rerio 1700 Deinococcus radiodurans 3.28 Drosophila melanogaster 120 Eimeria acervulina 70 Eimeria tenella 70 Entamoeba hystolitica 40 Escherichia coli 4.6-5.6 Haemophilus influenzae 1.83 Halobacterium sp. 2.57 Helicobacter pylori 1.66 Lactococcus lactus 2.36 Listeria innocua 3.01 Listeria monocytogenes 2.94 Mesorhizobium loti 7.59 Methanobacterium thermoautotrophicum 1.75 Methanococcus jannaschii 1.66 Mycobacterium leprae 2.8 Mycobacterium tuberculosis 4.4 Mycoplasma genitalium .58 Mycoplasma penetrans 1.36 Mycoplasma pneumoniae 0.81 Mycoplasma pulmonis 0.96 Neisseria meningitidis 2.18-2.27 Oceanobacillus iheyensis 3.6 Oryza sativa 400 Pasturella multocida 2.4 Plasmodium berghei 25 Plasmodium falciparum 25 Plasmodium yoelii 23 Plasmodium vivax 30 Pseudomonas aeruginosa 6.3 Pseudomonas putida 6.1 Pyrococcus horikoshii 1.74 Ricketsia prowazekii 1.1 Saccharomyces cerevesiae 13.0 Salmonella typhi 4.8 Salmonella typhimurium 4.8 Sarcocystis cruzi 201 Schizosaccharomyces pombe 13.8-14.0 Schistosoma mansoni 270 Shewanalla oneidensis 5.14 Shigella flexneri 4.7 Sinorhizobium meliloti 6.7 Staphylococcu aureus 2.8 Streptococcus agalactiae 2.21 Streptococcus mutans 2.03 Streptococcus pneumoniae 2.2 Streptococcus pyogenes 1.85 Streptomyces avermitilis 9 Streptomyces coelicolor 8.7 Sulfolobus solfataricus 2.99 Sulfolobus tokodaii 2.81 Synechocystis PCC 6803 3.57 Takifugu rubripes 400 Thermoplasma volcanium 1.56-1.58 Thermoanaerobacter tengcongensis 2.69 Thermoplasma acidophilum 1.56 Thermoplasma volcanium 1.58 Thermotoga maritima 1.80 Thermotoga pallidum 1.14 Toxoplasma gondii 89 Trypanosoma brucei 35 Trypanosoma cruzi 40 Ureaplasma urealyticum 0.75 Vibrio cholerae 4 Xanthomonas axonopodis 5.17 Xanthomonas campestris 5.07 Xylella fastidiosa 2.68 Yersinia pestis 4.65
[0211]Preferred combinations of genomes are selected from the group consisting of:
a) nucleic acid fragments derived from two organisms selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima; b) nucleic acid fragments derived from three organisms selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima; c) nucleic acid fragments derived from four organisms selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima; d) nucleic acid fragments derived from five organisms selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima; e) nucleic acid fragments derived from six organisms selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima; f) nucleic acid fragments derived from seven organisms selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima; g) nucleic acid fragments derived from eight organisms selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima; h) nucleic acid fragments derived from nine organisms selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima; i) nucleic acid fragments derived from ten organisms selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima; j) nucleic acid fragments derived from eleven organisms selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima; k) nucleic acid fragments derived from twelve organisms selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima; l) nucleic acid fragments derived from thirteen organisms selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima; m) nucleic acid fragments derived from fourteen organisms selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima; n) nucleic acid fragments derived from fifteen organisms selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima; o) nucleic acid fragments derived from sixteen organisms selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima; p) nucleic acid fragments derived from seventeen organisms selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima; q) nucleic acid fragments derived from eighteen organisms selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima; r) nucleic acid fragments derived from nineteen organisms selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima; s) nucleic acid fragments derived from twenty organisms selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima; t) nucleic acid fragments derived from twenty one organisms selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima; u) nucleic acid fragments derived from twenty two organisms selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima; v) nucleic acid fragments derived from twenty three organisms selected from the group consisting of:
Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima; w) nucleic acid fragments derived from twenty four organisms selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima; x) nucleic acid fragments derived from twenty five organisms selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima; y) nucleic acid fragments derived from twenty six organisms selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima; andz) nucleic acid fragments derived from twenty seven organisms selected from the group consisting of: Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima.
[0212]In a particularly preferred embodiment, the nucleic acid fragments are derived from the organisms Aeropyrum pernix, Anopheles gambiae, Arabidopsis thaliana, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Caenorhabditis elegans, Chlamydia trachomatis, Danio rerio, Drosophila melanogaster, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Saccharomyces cerevesiae, Schizosaccharomyces pombe, Synechocystis PCC 6803, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima.
[0213]In a particularly preferred embodiment, nucleic acid fragments derived from the following bacteria are combined into a single expression library: Aeropyrum pernix, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Chlamydia trachomatis, Escherichia coli, Haemophilus influenzae, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Synechocystis PCC 6803, Thermoplasma volcanium and Thermotoga maritima.
[0214]The nucleic acid fragments, unmodified or modified by the addition of one or more linkers, adaptors, Kozak containing oligonucleotides, Kozak containing fragments, or nucleic acids comprising a sequence that confers transcriptional or translational slippage, are placed in operable connection with a promoter sequence, thereby producing a recombinant gene construct.
[0215]The term "gene construct" is to be taken in its broadest context and includes a promoter sequence that is placed in operable connection with a nucleic acid fragment of the present invention. The nucleic acid comprising the promoter sequence is isolated using techniques well known in the art, such as for example PCR or restriction digestion. Alternatively the nucleic acid comprising the promoter sequence is synthetic, that is an oligonucleotide. The methods of producing oligonucleotides are well known in the art and are described, for example, in Oligonucleotide Synthesis: A Practical Approach (M. J. Gait, ed., 1984) IRL Press, Oxford, whole of text, and particularly the papers therein by Gait, pp 1-22; Atkinson et al., pp 35-81; Sproat et al., pp 83-115; and Wu et al., pp 135-151.
[0216]The term "promoter" is to be taken in its broadest context and includes the transcriptional regulatory sequences of a genomic gene, including the TATA box or initiator element, which is required for accurate transcription initiation, with or without additional regulatory elements (ie. upstream activating sequences, transcription factor binding sites, enhancers and silencers) which alter gene expression in response to developmental and/or external stimuli, or in a tissue specific manner. In the present context, the term "promoter" is also used to describe a recombinant, synthetic or fusion molecule, or derivative which confers, activates or enhances the expression of a nucleic acid molecule to which it is operably linked, and which encodes the peptide or protein. Preferred promoters can contain additional copies of one or more specific regulatory elements to further enhance expression and/or alter the spatial expression and/or temporal expression of said nucleic acid molecule.
[0217]Placing a nucleic acid molecule under the regulatory control of, ie., "in operable connection with", a promoter sequence means positioning said molecule such that expression is controlled by the promoter sequence. Promoters are generally positioned 5' (upstream) to the coding sequence that they control. To construct heterologous promoter/structural gene combinations, it is generally preferred to position the promoter at a distance from the gene transcription start site that is approximately the same as the distance between that promoter and the gene it controls in its natural setting, ie., the gene from which the promoter is derived. As is known in the art, some variation in this distance can be accommodated without loss of promoter function. Similarly, the preferred positioning of a regulatory sequence element with respect to a heterologous gene to be placed under its control is defined by the positioning of the element in its natural setting, ie., the gene from which it is derived. Again, as is known in the art, some variation in this distance can also occur.
[0218]Typical promoters suitable for expression in viruses of bacterial cells and bacterial cells such as for example a bacterial cell selected from the group comprising E. coli, Staphylococcus sp, Corynebacterium sp., Salmonella sp., Bacillus sp., and Pseudomonas sp., include, but are not limited to, the lacz promoter, the Ipp promoter, temperature-sensitive ฮปL or ฮปR promoters, T7 promoter, T3 promoter, SP6 promoter or semi-artificial promoters such as the IPTG-inducible tac promoter or lacUV5 promoter. A number of other gene construct systems for expressing the nucleic acid fragment of the invention in bacterial cells are well-known in the art and are described for example, in Ausubel et al (In: Current Protocols in Molecular Biology. Wiley Interscience, ISBN 047 150338, 1987), U.S. Pat. No. 5,763,239 (Diversa Corporation) and (Sambrook et al (In: Molecular Cloning: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Third Edition 2001).
[0219]Typical promoters suitable for expression in yeast cells such as for example a yeast cell selected from the group comprising Pichia pastoris, S. cerevisiae and S. pombe, include, but are not limited to, the ADH1 promoter, the GAL1 promoter, the GAL4 promoter, the CUP1 promoter, the PHO5 promoter, the nmt promoter, the RPR1 promoter, or the TEF1 promoter.
[0220]Typical promoters suitable for expression in insect cells, or in insects, include, but are not limited to, the OPEI2 promoter, the insect actin promoter isolated from Bombyx muri, the Drosophila sp. dsh promoter (Marsh et al Hum. Mol. Genet. 9, 13-25, 2000) and the inducible metallothionein promoter. Preferred insect cells for expression of the recombinant polypeptides include an insect cell selected from the group comprising, BT1-TN-5B1-4 cells, and Spodoptera frugiperda cells (eg., sf19 cells, sf21 cells). Suitable insects for the expression of the nucleic acid fragments include but are not limited to Drosophila sp. The use of S. frugiperda is also contemplated.
[0221]Promoters for expressing peptides in plant cells are known in the art, and include, but are not limited to, the Hordeum vulgare amylase gene promoter, the cauliflower mosaic virus 35S promoter, the nopaline synthase (NOS) gene promoter, and the auxin inducible plant promoters P1 and P2.
[0222]Typical promoters suitable for expression in a virus of a mammalian cell, or in a mammalian cell, mammalian tissue or intact mammal include, for example a promoter selected from the group consisting of, retroviral LTR elements, the SV40 early promoter, the SV40 late promoter, the cytomegalovirus (CMV) promoter, the CMV IE (cytomegalovirus immediate early) promoter, the EF1ฮฑ promoter (from human elongation factor 1ฮฑ), the EM7 promoter, the UbC promoter (from human ubiquitin C).
[0223]Preferred mammalian cells for expression of the nucleic acid fragments include epithelial cells, fibroblasts, kidney cells, T cells, or erythroid cells, including a cell line selected from the group consisting of COS, CHO, murine 10T, MEF, NIH3T3, MDA-MB-231, MDCK, HeLa, K562, HEK 293 and 293T. The use of neoplastic cells, such as, for example, leukemic/leukemia cells, is also contemplated herein.
[0224]Preferred mammals for expression of the nucleic acid fragments include, but are not limited to mice (ie., Mus sp.) and rats (ie., Rattus sp.).
[0225]In one embodiment, nucleic acid comprising a promoter sequence is ligated to a nucleic acid fragment from the prokaryote or compact eukaryote, or a modified form thereof using techniques well known in the art.
[0226]In another embodiment, nucleic acid comprising a promoter sequence is modified by the addition of one or more linkers, adaptors, Kozak containing oligonucleotides, Kozak containing fragments, or nucleic acids comprising a sequence that confers transcriptional or translational slippage and ligated to a nucleic acid fragment from the prokaryote or compact eukaryote using techniques well known in the art.
[0227]In yet another embodiment, nucleic acid comprising a promoter sequence is incorporated into an oligonucleotide with or without another nucleic acid comprising one or more spacers, Kozak sequences, or nucleic acids comprising a sequence that confers transcriptional or translational slippage.
[0228]Preferably, the oligonucleotide comprises a nucleotide sequence that is complementary or homologous to a region flanking the nucleic acid fragment from the prokaryote or compact eukaryote, such as, for example, an adaptor. Such a complementary or homologous sequence permits oligonucleotide primers to be used for amplifying nucleic acid comprising a promoter region and means for ribosome binding (such as for example a Kozak sequence or Shine-Dalgarno sequence) and the nucleic acid fragment as a single fragment. In this manner, a gene construct comprising a promoter sequence, means for ribosome binding and a nucleic acid fragment is readily constructed using the amplified nucleic acid.
[0229]In an alternative embodiment, a nucleic acid comprising a promoter sequence is incorporated into an oligonucleotide with or without another nucleic acid comprising one or more spacers, Kozak sequences, or nucleic acids comprising a sequence that confers transcriptional or translational slippage, and said oligonucleotide is operably linked to a nucleic acid fragment of the present invention by, for example, ligation. As will be known to the skilled artisan, the promoter is also be positioned in the expression vector or gene construct into which the prokaryote or eukaryote nucleic acid fragment is inserted.
[0230]In one embodiment, the nucleic acid fragments are expressed in vitro. According to this embodiment, the gene construct preferably comprises a nucleic acid fragment of the prokaryote or compact eukaryote, and a promoter sequence and appropriate ribosome binding site which is both be present in the expression vector or added to said nucleic acid fragment before it is inserted into the vector. Typical promoters for the in vitro expression of the nucleic acid fragments of the present invention include, but are not limited to the T3 or T7 (Hanes and Pluckthun Proc. Natl. Acad. Sci. USA, 94 4937-4942 1997) bacteriophage promoters.
[0231]In another embodiment, the gene construct optionally comprises a transcriptional termination site and/or a translational termination codon. Such sequences are well known in the art, and is incorporated into oligonucleotides used to amplify the nucleic acid fragment of the prokaryote or compact eukaryote, or alternatively, present in the expression vector or gene construct before the nucleic acid fragment is inserted.
[0232]In another embodiment, the gene construct is an expression vector. The term "expression vector" refers to a nucleic acid molecule that has the ability confer expression of a nucleic acid fragment to which it is operably connected, in a cell or in a cell free expression system. Within the context of the present invention, it is to be understood that an expression vector may comprise a promoter as defined herein, a plasmid, bacteriophage, phagemid, cosmid, virus sub-genomic or genomic fragment, or other nucleic acid capable of maintaining and or replicating heterologous DNA in an expressible format. Many expression vectors are commercially available for expression in a variety of cells. Selection of appropriate vectors is within the knowledge of those having skill in the art.
[0233]Typical expression vectors for in vitro expression or cell-free expression have been described and include, but are not limited to the TNT T7 and TNT T3 systems (Promega), the pEXP1-DEST and pEXP2-DEST vectors (Invitrogen).
[0234]Numerous expression vectors for expression of recombinant polypeptides in bacterial cells and efficient ribosome binding sites have been described, such as for example, PKC30 (Shimatake and Rosenberg, Nature 292, 128, 1981); pKK173-3 (Amann and Brosius, Gene 40, 183, 1985), pET-3 (Studier and Moffat, J. Mol. Biol. 189, 113, 1986); the pCR vector suite (Invitrogen), pGEM-T Easy vectors (Promega), the pL expression vector suite (Invitrogen) the pBAD/TOPO or pBAD/thio--TOPO series of vectors containing an arabinose-inducible promoter (Invitrogen, Carlsbad, Calif.), the latter of which is designed to also produce fusion proteins with a Trx loop for conformational constraint of the expressed protein; the pFLEX series of expression vectors (Pfizer nc., CT, USA); the pQE series of expression vectors (QIAGEN, CA, USA), or the pL series of expression vectors (Invitrogen), amongst others.
[0235]Expression vectors for expression in yeast cells are preferred and include, but are not limited to, the pACT vector (Clontech), the pDBleu-X vector, the pPIC vector suite (Invitrogen), the pGAPZ vector suite (Invitrogen), the pHYB vector (Invitrogen), the pYD1 vector (Invitrogen), and the pNMT1, pNMT41, pNMT81 TOPO vectors (Invitrogen), the pPC86-Y vector (Invitrogen), the pRH series of vectors (Invitrogen), pYESTrp series of vectors (Invitrogen). Particularly preferred vectors are the pACT vector, pDBleu-X vector, the pHYB vector, the pPC86 vector, the pRH vector and the pYES vectors, which are all of use in various `n`-hybrid assays described herein. Furthermore, the pYD1 vector is particularly useful in yeast display experiments in S. cerevesiae. A number of other gene construct systems for expressing the nucleic acid fragment of the invention in yeast cells are well-known in the art and are described for example, in Giga-Hama and Kumagai (In: Foreign Gene Expression in Fission Yeast: Schizosaccharomyces Pombe, Springer Verlag, ISBN 3540632700, 1997) and Guthrie and Fink (In: Guide to Yeast Genetics and Molecular and Cell Biology Academic Press, ISBN 0121822540, 2002).
[0236]A variety of suitable expression vectors, containing suitable promoters and regulatory sequences for expression in insect cells are well known in the art, and include, but are not limited to the pAC5 vector, the pDS47 vector, the pMT vector suite (Invitrogen) and the pIB vector suite (Invitrogen).
[0237]Furthermore, expression vectors comprising promoters and regulatory sequences for expression of polypeptides in plant cells are also well known in the art and include, for example, a promoter selected from the group, pSS, pB1121 (Clontech), pZ01502, and pPCV701 (Kuncz et al, Proc. Natl. Acad. Sci. USA, 84 131-135, 1987).
[0238]Expression vectors that contain suitable promoter sequences for expression in mammalian cells or mammals include, but are not limited to, the pcDNA vector suite supplied by Invitrogen, the pCI vector suite (Promega), the pCMV vector suite (Clontech), the pM vector (Clontech), the pSI vector (Promega), the VP16 vector (Clontech) and the pDISPLAY vectors (Invitrogen). The pDISPLAY vectors are of particular use in mammalian display studies with the expressed nucleic acid fragment targeted to the cell surface with the Igฮบ leader sequence, and bound to the membrane of the cell through fusion to the PDGFR transmembrane domain. The pM and VP16 vectors are of particular use in mammalian two-hybrid studies.
[0239]Methods of cloning DNA into nucleic acid vectors for expression of encoded polypeptides are well known in the art and are described for example in, Ausubel et al (In: Current Protocols in Molecular Biology. Wiley Interscience, ISBN 047 150338, 1987) or Sambrook et al (In: Molecular Cloning: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Third Edition 2001).
[0240]The nucleic acid fragments of the present invention is also be expressed in the cells of other organisms, or entire organisms including, for example, nematodes (eg C. elegans) and fish (eg D. rerio, and T. rubripes). Promoters for use in nematodes include, but are not limited to osm-10 (Faber et al Proc. Natl. Acad. Sci. USA 96, 179-184, 1999), unc-54 and myo-2 (Satyal et al Proc. Natl. Acad. Sci. USA, 97 5750-5755, 2000). Promoters for use in fish include, but are not limited to the zebrafish OMP promoter, the GAP43 promoter, and serotonin-N-acetyl transferase gene regulatory regions
[0241]In a preferred embodiment, the expression library of the present invention is transcribed and translated in vitro. Methods of transcribing nucleic acid fragments and translating the resulting mRNA are well known in the art and are described for example, in Ausubel et al (In: Current Protocols in Molecular Biology. Wiley Interscience, ISBN 047 150338, 1987), U.S. Pat. No. 5,763,239 (Diversa Corporation) and (Sambrook et al (In: Molecular Cloning: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Third Edition 2001), for example the use of E. coli S30 lysate (available in kit for from Promega).
[0242]In a preferred embodiment the gene construct contains a second nucleic acid in operable connection with a nucleic acid fragment of the present invention. This second nucleic acid encodes a fusion partner. As used herein the term "fusion partner" shall be understood to mean a polypeptide sequence that is associated with a peptide encoded by a nucleic acid fragment of the present invention. Such a fusion partner confers a common function or ability upon all polypeptides encoded by the expression library. Suitable fusion partners include, but are not limited to, presentation structures, polypeptides that facilitate the uptake of peptides into target cells, polypeptides that cause nuclear localisation, polypeptides that cause secretion, polypeptides that cause mitochondrial localisation, polypeptides that cause membrane localisation, or a combination of any of these sequences.
[0243]Without suggesting that such a process is essential to the invention, a peptide encoded by the expression library of the present invention can also be expressed such that it is conformationally constrained, or expressed in a "presentation structure". Such constraint, whilst not generally necessary for expressing protein domains or peptides having a conformation sufficient to bind to a target protein or target nucleic acid, is useful for displaying peptides that comprise more highly flexible sequences, or to enhance stability against proteolytic enzymes (Humphrey et al, Chem Rev 97, 2243-2266, 1997).
[0244]A presentation structure will generally comprise a first component, ie. polypeptide, that is fused to the amino terminus of the polypeptide and a second component fused to the carboxyl-terminus of the peptide. Examples of such presentation structures include, but are not limited to, cysteine-linked (disulfide) structures, zinc-finger domains, cyclic peptides, and transglutaminase linked structures.
[0245]In a preferred embodiment, the presentation structure is a sequence that contains at least two cysteine residues, such that a disulphide bond is formed between the cysteine residues, resulting in a conformationally constrained peptide.
[0246]In another embodiment, a peptide encoded by an expression library of the present invention is expressed within a second polypeptide as a fusion protein. Polypeptides used for such purposes are capable of reducing the flexibility of another protein's amino and/or carboxyl termini. Preferably, such proteins provide a rigid scaffold or platform for the protein. In addition, such proteins preferably are capable of providing protection from proteolytic degradation and the like, and/or are capable of enhancing solubility. Preferably, conformation-constraining proteins are small in size (generally, less than or equal to about 200 amino acids in length), rigid in structure, of known three-dimensional configuration, and are able to accommodate insertions of proteins without undue disruption of their structures. A key feature of such proteins is the availability, on their solvent exposed surfaces, of locations where peptide insertions can be made (eg., the Trx loop). It is also preferable that conformation-constraining protein producing genes be highly expressible in various prokaryotic and eukaryotic hosts, or in suitable cell-free systems, and that the proteins be soluble and resistant to protease degradation.
[0247]Examples of conformation-constraining proteins include the active site of thioredoxin or Trx loop and other thioredoxin-like proteins, nucleases (eg., RNase A), proteases (eg., trypsin), protease inhibitors (eg., bovine pancreatic trypsin inhibitor), antibodies or structurally rigid fragments thereof, conotoxins, and the pleckstrin homology domain. A conformation-constraining peptide can be of any appropriate length and can even be a single amino acid residue.
[0248]This technique has been successfully used for bacterial display of peptides in bacteria using a Trx scaffold (Blum et al Proc. Natl. Acad. Sci. USA 97, 2241-2246 2000) in addition to the use in yeast 2 hybrid screening using either a catalytically inactive form of staphylococcal nuclease, or Trx (Norman et al, Science, 285, 591-595, 1999; and Colas et al, Nature 380, 548-550, 1996).
[0249]In another embodiment the expression vector or gene construct is optionally comprise a transcriptional terminator that is operative in the expression system. Furthermore, the gene construct is also comprise a nucleic acid comprising the sequence of a polyadenylation signal operative in the expression system.
[0250]It is preferred that when the gene constructs are to be introduced to and/or maintained and/or propagated and/or expressed in bacterial cells, either during generation of said gene constructs, or screening of said gene constructs, that the gene constructs contain an origin of replication that is operable at least in a bacterial cell. A particularly preferred origin of replication is the ColE1 origin of replication. A number of gene construct systems containing origins of replication are well-known in the art and are described for example, in Ausubel et al (In: Current Protocols in Molecular Biology. Wiley Interscience, ISBN 047 150338, 1987), U.S. Pat. No. 5,763,239 (Diversa Corporation) and (Sambrook et al (In: Molecular Cloning: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Third Edition 2001).
[0251]It is also preferred that when the gene constructs are to be introduced to and/or maintained and/or propagated and/or expressed in yeast cells, either during generation of said gene constructs, or screening of said gene constructs, that the gene constructs contain an origin of replication that is operable at least in a yeast cell. One preferred origin of replication is the CEN/ARS4 origin of replication. Another particularly preferred origin of replication is the 2-micron origin of replication. A number of gene construct systems containing origins of replication are well-known in the art and are described for example, in Ausubel et al (In: Current Protocols in Molecular Biology. Wiley Interscience, ISBN 047 150338, 1987) and (Sambrook et al (In: Molecular Cloning: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Third Edition 2001).
[0252]In another embodiment, the gene construct containing the nucleic acid fragments of the present invention comprise another nucleic acid cassette comprising a promoter sequence in operable connection with a polynucleotide sequence encoding a selectable marker.
[0253]As used herein the term "selectable marker" shall be taken to mean a protein or peptide that confers a phenotype on a cell expressing said selectable marker that is not shown by those cells that do not carry said selectable marker. Examples of selectable markers include, but are not limited to the dhfr resistance gene, which confers resistance to methotrexate (Wigler, et al., 1980, Natl. Acad. Sci. USA 77:3567; O'Hare, et al., 1981, Proc. Natl. Acad. Sci. USA 78:1527); the gpt resistance gene, which confers resistance to mycophenolic acid (Mulligan & Berg, 1981, Proc. Natl. Acad. Sci. USA 78:2072); the neomycin phosphotransferase gene, which confers resistance to the aminoglycoside G-418 (Colberre-Garapin, et al., 1981, J. Mol. Biol. 150:1); and the hygromycin resistance gene (Santerre, et al., 1984, Gene 30:147). Alternatively, marker genes is catalyse reactions resulting in a visible outcome (for example the production of a blue color when ฮฒ galactosidase is expressed in the presence of the substrate molecule 5-bromo-4-chloro-3-indoyl-ฮฒ-D-galactoside) or confer the ability to synthesise particular amino acids (for example the HIS3 gene confers the ability to synthesize histidine).
[0254]In one embodiment the peptide encoded by the nucleic acid fragment of the present invention is expressed as a fusion protein with a peptide sequence capable of enhancing, increasing or assisting penetration or uptake of the peptide by cells either in vitro or in vivo. For example, the peptide sequence capable of enhancing, increasing or assisting penetration or uptake is the Drosophila penetratin targeting sequence. This peptide sequence at least comprises the amino acid sequence:
[0255]CysArgGlnIleLysIleTrpPheGlnAsnArgArgMetLysTrpLysLys (SEQ ID NO. 29) further comprising (Xaa)n after the final Lys residue and followed by Cys wherein Xaa is any amino acid and n has a value greater than or equal to 1. Alternatively, a homologue, derivative or analogue of said sequence is used. The use of said sequence is particularly useful when peptides encoded by the nucleic acid fragment of the present invention are synthesised in vitro or secreted from a host cell, and must be taken up by a cell for screening said peptide encoded by the nucleic acid fragment of the present invention.
[0256]Those skilled in the art will also be aware of an analogous use of signals such as for example, the tat sequence of HIV to drive import of peptides into cells.
[0257]In an alternative embodiment, the peptide encoded by the nucleic acid fragment of the present invention is mixed with a peptide capable of enhancing, increasing or assisting penetration or uptake by cells in vitro or in vivo. A peptide sequence that is able to increase or assist penetration or uptake of cells is the synthetic peptide Pep 1, which at least comprises the amino acid sequence:
TABLE-US-00002 (SEQ ID NO. 30) LysGluThrTrpTrpGluThrTrpTrpThrGluTrpSerGlnLysLys LysLysArgLysVal.
[0258]The Pep1 peptide does not need to be conjugated to the peptide encoded by the nucleic acid fragments of the present invention. Furthermore, Pep1 dissociates from the peptide encoded by the expression library of the present invention. Thus Pep1 will not interfere with the peptide forming a conformation sufficient for binding to a target protein or nucleic acid. Pep1 is only useful when the peptides encoded by the expression library of the present invention are isolated prior to the addition to a cell or organism for screening. Thus Pep1 is particularly useful when in vitro libraries are screened.
[0259]In one embodiment, the expression library of the present invention are introduced to and preferably expressed within a cellular host or organism to generate the expression library, it is preferred that the gene constructs are introduced into said cellular host or said organism. Methods of introducing the gene constructs into a cell or organism for expression are well known to those skilled in the art and are described for example, in Ausubel et al (In: Current Protocols in Molecular Biology. Wiley Interscience, ISBN 047 150338, 1987), U.S. Pat. No. 5,763,239 (Diversa Corporation) and (Sambrook et al (In: Molecular Cloning: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Third Edition 2001). The method chosen to introduce the gene construct in depends upon the cell type in which the gene construct is to be expressed.
[0260]In one embodiment, the cellular host is a bacterial cell. Means for introducing recombinant DNA into bacterial cells include, but are not limited to electroporation or chemical transformation into cells previously treated to allow for said transformation.
[0261]In another embodiment, the cellular host is a yeast cell. Means for introducing recombinant DNA into yeast cells include a method chosen from the group consisting of electroporation, and PEG mediated transformation.
[0262]In another embodiment, the cellular host is a plant cell. Means for introducing recombinant DNA into plant cells include a method selected from the group consisting of Agrobacterium mediated transformation, electroporation of protoplasts, PEG mediated transformation of protoplasts, particle mediated bombardment of plant tissues, and microinjection of plant cells or protoplasts.
[0263]In yet another embodiment, the cellular host is an insect cell. Means for introducing recombinant DNA into plant cells include a method chosen from the group consisting of, infection with baculovirus and transfection mediated with liposomes such as by using cellfectin (Invitrogen).
[0264]In yet another embodiment, the cellular host is a mammalian cell. Means for introducing recombinant DNA into mammalian cells include a means selected from the group comprising microinjection, transfection mediated by DEAE-dextran, transfection mediated by calcium phosphate, transfection mediated by liposomes such as by using Lipofectamine (Invitrogen) and/or cellfectin (Invitrogen), PEG mediated DNA uptake, electroporation, transduction by Adenoviuses, Herpesviruses, Togaviruses or Retroviruses and microparticle bombardment such as by using DNA-coated tungsten or gold particles (Agacetus Inc., WI, USA).
[0265]In an alternative embodiment, the expression library is an in vitro display library (ie., the peptides encoded by the prokaryote or compact eukaryote nucleic acid fragments of the expression library are displayed using in vitro display wherein the expressed peptide is linked to the nucleic acid from which it was expressed such that said peptide is presented in the absence of a host cell). Accordingly, expression libraries produced by in vitro display technologies are not limited by transformation or transfection efficiencies. Accordingly any such library is of much higher complexity than an in vivo display library. Examples of methods of in vitro display include a method selected from the group comprising but not limited to, ribosome display, covalent display and mRNA display.
[0266]In one embodiment, the in vitro display library is a ribosome display library. The skilled artisan will be aware that a ribosome display library directly links mRNA encoded by the expression library to the peptide that it encodes. Means for producing a ribosome display library require that the nucleic acid fragment be placed in operable connection with an appropriate promoter sequence and ribosome binding sequence, ie. form a gene construct. Preferred promoter sequences are the bacteriophage T3 and T7 promoters.
[0267]Preferably, the nucleic acid fragment is placed in operable connection with a spacer sequence and a modified terminator sequence with the terminator sequence removed.
[0268]As used herein the term "spacer sequence" shall be understood to mean a series of nucleic acids that encode a peptide that is fused to the peptide. The spacer sequence is incorporated into the gene construct, as the peptide encoded by the spacer sequence remains within the ribosomal tunnel following translation, while allowing the peptide to freely fold and interact with another protein or a nucleic acid.
[0269]A preferred spacer sequence is, for example, a nucleic acid that encodes amino acids 211-299 of gene III of filamentous phage M13 mp19.
[0270]The display library is transcribed and translated in vitro using methods well known in the art and are described for example, in Ausubel et al (In: Current Protocols in Molecular Biology. Wiley Interscience, ISBN 047 150338, 1987) and (Sambrook et al (In: Molecular Cloning: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Third Edition 2001).
[0271]Examples of systems for in vitro transcription and translation include, for example, the TNT in vitro transcription and translation systems from Promega. Cooling the expression reactions on ice generally terminates translation. The ribosome complexes are stabilized against dissociation from the peptide and/or its encoding mRNA by the addition of reagents such as, for example, magnesium acetate or chloroamphenicol. Such in vitro display libraries are screened by a variety of methods, as described herein.
[0272]In another embodiment, the expression library of the present invention is a ribosome inactivation display library. In accordance with this embodiment, a nucleic acid fragment is operably linked to a nucleic acid encoding a first spacer sequence. It is preferred that this spacer sequence is a glycine/serine rich sequence that allows a peptide encoded by the expression library of the present invention to freely fold and interact with a target protein or nucleic acid.
[0273]The first spacer sequence is linked to a nucleic acid that encodes a toxin that inactivates a ribosome. It is preferred that the toxin comprises the ricin A chain, which inactivates eukaryotic ribosomes and stalls the ribosome on the translation complex without release of the mRNA or the encoded peptide.
[0274]The nucleic acid encoding the toxin is linked to another nucleic acid that encodes a second spacer sequence. The second spacer is required as an anchor to occupy the tunnel of the ribosome, and allow both the peptide and the toxin to correctly fold and become active. Examples of such spacer sequences are sequences derived from gene III of M13 bacteriophage.
[0275]Ribosome inactivation display libraries are generally transcribed and translated in vitro, using a system such as the rabbit reticulocyte lysate system available from Promega. Upon translation of the mRNA encoding the toxin and correct folding of this protein, the ribosome is inactivated while still bound to both the encoded polypeptide and the mRNA from which it was translated.
[0276]In another embodiment, the expression library of the present invention is an mRNA display library. In accordance with this embodiment, a nucleic acid fragment is operably linked to a nucleic acid encoding a spacer sequence, such as a glycine/serine rich sequence that allows a peptide encoded by the expression library of the present invention to freely fold and interact with a target protein or nucleic acid.
[0277]The nucleic acid encoding the spacer sequence is operably linked to a transcription terminator. mRNA display libraries are generally transcribed in vitro, using methods well known in the art, such as, for example, the HeLaScribe Nuclear Extract in vitro Transcription System available from Promega. Encoded mRNA is subsequently covalently linked to a DNA oligonucleotide that is covalently linked to a molecule that binds to a ribosome, such as, for example, puromycin, using techniques well known in the art and are described in, for example, Roberts and Szostak, Proc. Natl. Acad. Sci. USA, 94, 12297-12302 (1997). Preferably, the oligonucleotide is covalently linked to a psoralen moiety, whereby the oligonucleotide is photo-crosslinked to a mRNA encoded by the expression library of the present invention.
[0278]The mRNA transcribed from the expression library is then translated using methods well known in the art and are described for example, in Ausubel et al (In: Current Protocols in Molecular Biology. Wiley Interscience, ISBN 047 150338, 1987) and (Sambrook et al (In: Molecular Cloning: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Third Edition 2001). When the ribosome reaches the Junction of the mRNA and the oligonucleotide the ribosome stalls and the puromycin moiety enters the phosphotransferase site of the ribosome and thus covalently links the encoded polypeptide to the mRNA from which it was expressed.
[0279]In yet another embodiment, the expression library of the present invention is a covalent display library. In accordance with this embodiment, the nucleic acid fragment is operably linked to a second nucleic acid fragment that encodes a protein that interacts with the DNA from which it was encoded. Examples of a protein that interacts with the DNA from which it interacts include, but are not limited to, the E. coli bacteriophage P2 viral A protein (P2A) and equivalent proteins isolated from phage 186, HP1 and PSP3.
[0280]The P2A protein is particularly preferred. The P2A protein recognizes a defined initiator sequence TCGGA (SEQ ID NO 31) positioned within the nucleic acid encoding the P2A protein and nicks one of the strands while forming a covalent bond with one of the free end nucleotides. Accordingly, it is preferred that at least the sequence TCGGA (SEQ ID NO 31) is included in the gene construct containing the expression library of the present invention.
[0281]It is particularly preferred that the protein attachment site is positioned such that a nucleic acid fragment is covalently linked to the peptide that it encodes.
[0282]A covalent display gene construct is transcribed and translated in vitro, using a system such as the rabbit reticulocyte lysate system available from Promega. Upon translation of the fusion of the peptide and the P2A protein, the P2A protein nicks the nucleic acid of the sequence of SEQ ID NO: 31 and forms a covalent bond therewith. Accordingly, a nucleic acid fragment is covalently linked to the peptide that it encodes.
[0283]In yet another embodiment, the expression library is a phage display library wherein the expressed peptides or protein domains are displayed on the surface of a bacteriophage, as described, for example, in U.S. Pat. No. 5,821,047 and U.S. Pat. No. 6,190,908. The basic principle described relates to the fusion of a first nucleic acid comprising a sequence encoding a peptide or protein to a second nucleic acid comprising a sequence encoding a phage coat protein, such as, for example a phage coat proteins selected from the group, M13 protein-3, M13 protein-7, or M13, protein-8. These sequences are then inserted into an appropriate vector, ie. one that is able to replicate in bacterial cells. Suitable host cells, such as, for example E. coli, are then transformed with the recombinant vector. Said host cells are also infected with a helper phage particle encoding an unmodified form of the coat protein to which a nucleic acid fragment is operably linked. Transformed, infected host cells are cultured under conditions suitable for forming recombinant phagemid particles comprising more than one copy of the fusion protein on the surface of the particle. This system has been shown to be effective in the generation of virus particles such as, for example, a virus particle selected from the group comprising ฮป phage, T4 phage, M13 phage, T7 phage and baculovirus. Such phage display particles are then screened to identify a displayed protein having a conformation sufficient for binding to a target protein or nucleic acid.
[0284]In yet another embodiment, the expression library is a retroviral display library wherein the expressed peptides or protein domains are displayed on the surface of a retroviral particle. Retroviral display is of particular use as the proteins and peptides displayed in such a system are generated in eukaryotic cells that can carry out a number of post-translational modifications to the peptides or protein domains that are required for activity. Such a retroviral display system is described in U.S. Pat. No. 6,297,004 (Cambridge Drug Discovery Holding, Limited). In adapting such a system to the present invention, a nucleic acid fragment is placed in operable connection with an envelope protein of a retrovirus, more preferably a spike glycoprotein. An example of such a protein is the mature envelope protein of Moloney Murine leukemia virus. A gene construct comprising a nucleic acid fragment of the present invention in operable connection with a retroviral envelope protein is also placed in operable connection with long terminal repeat sequences, a tRNA binding site and a polypurine tract to ensure reverse transcription and integration of the encapsid RNA in an infected mammalian cell. Furthermore, such a gene construct should comprise an encapsidated signal sequence. An encapsidated signal sequence is a nucleic acid that is recognised by a component of the viral particle that mediates the inclusion of the nucleic acid into the viral particle. Such a gene construct is then expressed in an appropriate host cell, such as, for example, a COS cell or NIH3T3 cell, that has been previously infected with a retrovirus encoding an unmodified spike glycoprotein. In such a system chimeric retroviral particles are generated, carrying a mixture of modified and unmodified forms of the spike glycoprotein. These recombinant retrovirus particles are used to identify a displayed peptide that binds to a target protein or nucleic acid.
[0285]In yet another embodiment, the expression library is a bacterial display library wherein the expressed peptides or protein domains are displayed on the surface of a bacterial cell. The cells displaying the expressed peptides or protein domains are then used for biopanning as described, for example, in U.S. Pat. No. 5,516,637. Bacterial display is based on the finding that heterologous proteins is expressed as a fusion with bacterial surface proteins and assayed for the ability to bind to a target protein or nucleic acid.
[0286]Accordingly, in such systems a nucleic acid fragment is placed in operable connection with a second nucleic acid that encodes an anchoring motif, or amino acid sequence that directs the incorporation of the encoded peptide on the surface of the bacterial cell surface. Preferred amino acid sequences that direct incorporation of a peptide onto the surface of a bacterial cell include, but are not limited to, the flagella major subedit FliC for localizing a protein on the flagellum of E. coli, the cell sorting signal of the cell wall proteinase PrtP of Lactobacillus casei, the OmpS maltoprotein of Vibrio cholerae, Protein A of Bacillus subtilis, LysA of B. subtilis, and ActA of B. subtilis. Expression libraries comprising such gene constructs are then introduced into an appropriate host cell, such as for example E. coli or B. subtilis and the expressed peptides displayed on the surface of the bacterial cell. Such displayed libraries are of particular use in screening for peptides that have a conformation sufficient for binding a target protein or nucleic acid.
[0287]In an alternative embodiment, the peptides encoded by the nucleic acid fragments of the present invention is also be fused to a second nucleic acid comprising a sequences that encodes a peptide that directs the incorporation of the encoded peptide on the surface of a bacterial spore. Such methods are particularly useful in the display of peptides that are toxic to bacteria when expressed intra cellularly, or when screening conditions are particularly harsh, such as, for example in the presence of organic solvents, or high temperatures.
[0288]In yet another embodiment, the expression library is a phage display library wherein the expressed peptides or protein domains are displayed on the surface of a yeast cell. This method is particularly useful for the display of peptides encoded by nucleic acid derived from eukaryotes, as prokaryotic species are unable to form some structures encoded by eukaryotic sequences. Such a yeast display method is described in U.S. Pat. No. 6,423,538. In adapting this method to the present invention, a nucleic acid fragment is operably linked to a second nucleic acid fragment encoding the membrane-associated alpha-agglutinin yeast adhesion receptor, encoded by the aga2 gene. The expression library is introduced into an appropriate host cell, such as for example S. cerevisiae or S. pombe. Following introduction into an appropriate host cell the fusion protein is secreted from the cell. The fusion protein then binds to the Aga1 protein on the surface of the cell by forming disulfide bonds. Such a yeast cell is screened to determine whether or not it expresses a peptide having a conformation sufficient for binding to a target protein or nucleic acid.
[0289]In yet another embodiment, the expression library is a phage display library wherein the expressed peptides or protein domains are displayed on the surface of a mammalian cell. Such a system is described for example in Strenglin et al EMBO J, 7, 1053-1059, 1988. Mammalian display is particularly useful for the display of peptides derived from eukaryotes, as prokaryotic species and some lower eukaryotic species are unable to form some structures encoded by eukaryotic sequences. The mechanism behind mammalian display relates to the fusion of a nucleic acid fragment to a second nucleotide sequence encoding a peptide leader sequence, which directs the protein to be secreted, such as for example the Ig ฮบ secretion signal. Furthermore, the nucleic acid fragment is placed in operable connection with another nucleic acid, which encodes a peptide that anchors the peptide to the membrane, such as, for example the sequence PDGFR (SEQ ID NO: 32) which corresponds to a transmembrane domain. An example of a vector containing such a sequence is the pDISPLAY vector available from Invitrogen. Proteins expressed by such a vector are displayed upon the surface of the mammalian cell, making these cells particularly useful for screening for peptides that adopt a conformation sufficient for binding to a target protein or nucleic acid.
[0290]A second aspect of the present invention provides an expression library comprising nucleic acid fragments from two or more microorganisms or eukaryotes containing compact genomes, each of said microorganisms or eukaryotes having a substantially sequenced genome, wherein said nucleic acid fragments are inserted into a suitable expression construct thereby producing recombinant constructs, wherein each fragment is in operable connection with a promoter sequence that is capable of conferring expression of that fragment.
[0291]In a preferred embodiment, the present invention provides an expression library comprising nucleic acid fragments derived from two or more microorganisms or eukaryotes containing compact genomes, each of said microorganisms or eukaryotes having a substantially sequenced genome, wherein the fragments are inserted into a suitable expression vector in an amount proportional to the size of the genome from which the fragments were derived thereby producing recombinant constructs and wherein each fragment is in operable connection with a promoter sequence that is capable of conferring expression of that fragment.
[0292]In a further preferred embodiment, the present invention provides an expression library comprising nucleic acid fragments derived from one or two or more microorganisms or eukaryotes containing compact genomes, each of said microorganisms or eukaryotes having a substantially sequenced genome, wherein the nucleic acid fragments of the library comprise an open reading frame having an average length of at least about 36-45 nucleotide residues and/or encode a protein domain, and wherein the nucleic acid fragments are inserted into a suitable expression vector thereby producing recombinant constructs wherein each fragment is in operable connection with a promoter sequence that is capable of conferring expression of that fragment.
[0293]In an alternative embodiment, the present invention provides an expression library comprising nucleic acid fragments derived from one or two or more microorganisms or eukaryotes containing compact genomes, each of said microorganisms or eukaryotes having a substantially sequenced genome, wherein the nucleic acid fragments of the library comprise an open reading frame having an average length of at least about 36-45 nucleotide residues and/or encode a protein domain, and wherein the nucleic acid fragments are inserted into a suitable expression vector in an amount proportional to the size of the genome from which the fragments were derived thereby producing recombinant constructs wherein each fragment is in operable connection with a promoter sequence that is capable of conferring expression of that fragment.
[0294]In a further preferred embodiment, the present invention provides an expression library comprising nucleic acid fragments derived from one or two or more microorganisms or eukaryotes containing compact genomes, each of said microorganisms or eukaryotes having a substantially sequenced genome, wherein the nucleic acid fragments of the library have sufficiently different nucleotide sequences and are inserted into a suitable expression vector thereby producing recombinant constructs wherein each fragment is in operable connection with a promoter sequence that is capable of conferring expression of that fragment.
[0295]In a further preferred embodiment, the present invention provides an expression library comprising nucleic acid fragments derived from one or two or more microorganisms or eukaryotes containing compact genomes, each of said microorganisms or eukaryotes having a substantially sequenced genome, wherein the nucleic acid fragments of the library have sufficiently different nucleotide sequences and are inserted into a suitable expression vector in an amount proportional to the size of the genome from which the fragments were derived thereby producing recombinant constructs wherein each fragment is in operable connection with a promoter sequence that is capable of conferring expression of that fragment.
[0296]In a further preferred embodiment, the present invention provides an expression library comprising nucleic acid fragments derived from one or two or more microorganisms or eukaryotes containing compact genomes, each of said microorganisms or eukaryotes having a substantially sequenced genome, wherein the nucleic acid fragments of the library have sufficiently different nucleotide sequences and comprise an open reading frame having an average length of at least about 36-45 nucleotide residues and/or encode a protein domain, and wherein the nucleic acid fragments are inserted into a suitable expression vector thereby producing recombinant constructs wherein each fragment is in operable connection with a promoter sequence that is capable of conferring expression of that fragment.
[0297]In an alternative embodiment, the present invention provides an expression library comprising nucleic acid fragments derived from one or two or more microorganisms or eukaryotes containing compact genomes, each of said microorganisms or eukaryotes having a substantially sequenced genome, wherein the nucleic acid fragments of the library have sufficiently different nucleotide sequences and comprise an open reading frame having an average length of at least about 36-45 nucleotide residues and/or encode a protein domain, and wherein the nucleic acid fragments are inserted into a suitable expression vector in an amount proportional to the size of the genome from, which the fragments were derived thereby producing recombinant constructs wherein each fragment is in operable connection with a promoter sequence that is capable of conferring expression of that fragment.
[0298]Preferably, if the library is to be expressed in either a cellular system or in an organism, the expression library is further comprise a host comprising the recombinant vectors of the expression library. In accordance with this embodiment, the expression library of the present invention further comprises a host cell comprising the nucleic acid fragments inserted into the expression vector.
[0299]In a particularly preferred embodiment the present invention provides an expression library produced in accordance with a method described herein (ie., it is a direct product of the method if the present invention).
[0300]A further aspect of the present invention provides a method of determining a peptide that binds to a target nucleic acid or target protein comprising: [0301](a) screening an expression library of the present invention to identify a peptide expressed by the library that binds to the target protein or target nucleic acid; and [0302](b) selecting a peptide from (a) that does not bind to said target protein or nucleic acid in its native environment.
[0303]In an alternative embodiment, the present invention provides a method of determining a peptide that binds to a target nucleic acid or target protein comprising: [0304](a) obtaining an expression library of the present invention; [0305](b) screening the expression library to identify a peptide that binds to the target protein or nucleic acid; and [0306](c) selecting a peptide that does not bind to said target protein or nucleic acid in its native environment.
[0307]In a further alternative embodiment, the present invention provides a method of determining a peptide that binds to a target nucleic acid or target protein comprising: [0308](a) producing an expression library of the present invention according to the process described herein; [0309](b) screening the expression library to identify a peptide that binds to the target protein or nucleic acid; and [0310](c) selecting a peptide that does not bind to said target protein or nucleic acid in its native environment.
[0311]The selection step of the screening process is to identify mimotopes or mimetic peptides, rather than merely selecting peptides that perform a known or expected function. Suitable processes for selecting a peptide that does not bind to the target protein or target nucleic acid in its native environment include, for example, determining the amino acid sequence of the peptide or determining the nucleotide sequence of the corresponding nucleic acid encoding said peptide and deriving the amino acid sequence from said nucleotide sequence, determining a known function of the amino acid sequence and excluding a peptide that binds to a target protein or target nucleic acid associated with the known function. Alternatively, or in addition, the selection involves using an expression library that comprises nucleic acid fragments from organisms that do not possess a particular biochemical pathway or signal transduction pathway relevant to the binding reaction being assayed. Alternatively, or in addition, the selection comprises using an expression library that comprises nucleic acid fragments from organisms that do not express one or more of the binding partners of the binding reaction being assayed. The present invention clearly contemplates the combined use of bioinformatic analysis and selection of library components from organisms that are not known to carry out the binding reaction being assayed, to exclude those peptides from the screening process that merely perform their known function. Accordingly, such selection ensures that the selected peptide or protein domain does not bind to the target protein or target nucleic acid in its native environment.
[0312]In one embodiment, the expression library of the present invention is screened using affinity purification. Affinity purification techniques are well known in the art and are described in, for example, Scopes (In: Protein purification: principles and practice, Third Edition, Springer Verlag, 1994). Methods of affinity purification typically involve contacting the peptides encoded by the nucleic acid fragment library of the present invention with a specific target protein or nucleic acid, and, following washing, eluting those peptides that remain bound to the target protein or nucleic acid. Said target protein or nucleic acid is bound to another molecule to allow for ease of purification, such as, for example, a molecule selected from the group consisting of protein A, protein G, agarose, biotin, glutathione S-transferase (GST), and FLAG epitope. Accordingly, the target protein or nucleic acid is isolated simply through centrifugation, or through binding to another molecule, eg. streptavidin, or binding of a specific antibody, eg. anti-FLAG antibodies, or anti-GST antibodies. Methods using target proteins or nucleic acids covalently bound to affinity matrices are particularly preferred.
[0313]In another embodiment, the expression library of the present invention is expressed so as to allow identification of a bound peptide using FACS analysis. The screening of libraries using FACS analysis is described in U.S. Pat. No. 6,455,63 (Rigel Pharmaceuticals Incorporated). In adapting the protocol to the present invention, it is particularly preferred that the expression libraries of the present invention are expressed in such that they are displayed, such as for example, using in vitro display, bacterial surface display, yeast display, or mammalian display.
[0314]Preferably, an in vitro display library is screened by FACS sorting. In vitro displayed proteins are covalently linked to a particle or bead suitable for FACS sorting, such as, for example, glass, polymers such as for example polystyrene, latex or cross-linked dextrans such as Sepharose, cellulose, nylon, teflon, amongst others.
[0315]The displayed library bound to particles or beads is added to a target protein or nucleic acid that has been labelled with a labelling moiety, such as for example a fluorescent molecule, or a molecule which is detected by a second fluorescent molecule. Methods of labelling a target protein or nucleic acid are well known in the art, and include methods using direct linkage or methods using a linker. The beads are then washed and subjected to sorting by FACS, which allows the beads with bound fluorescent target proteins or nucleic acids, to be separated from the beads that have not bound to a fluorescent target protein or nucleic acid.
[0316]Alternatively the library is screened using a biosensor-based assay, such as, for example, Biacore sensor chip technology (Biacore AB, UK). The Biacore sensor chip is a glass surface coated with a thin layer of gold modified with carboxymethylated dextran, to which the target protein or nucleic acid is covalently attached. The peptides encoded by the expression libraries of the present invention are then exposed to the Biacore sensor chip comprising the target protein or nucleic acid. Preferably, the nucleic acid fragment of the present invention and its encoded polypeptide are linked, such as for example using display technology.
[0317]The Biacore sensor chip is further used in the analysis of the kinetics of the interaction of the peptide encoded by the expression library of the present invention and the target protein or nucleic acid, such as for example through analyzing binding affinity using surface plasmon resonance. Essentially surface plasmon resonance detects changes in the mass of the aqueous layer close to the chip surface, through measuring changes in the refractive index. Accordingly, when a peptide encoded by the expression library of the present invention binds to the target protein or nucleic acid the refractive index increases.
[0318]The present invention is also be applied to identifying peptides that bind to any protein or nucleic acid, such as for example, a receptor protein, oncogenic protein, growth factor, cytokine, transcription factor, kinase, a promoter region of a gene, a suppressor region of a gene, a splice donor site, or a splice acceptor site. Alternatively, the libraries are screened to determine a peptide that modulates (inhibits, blocks, disrupts, down regulates, antagonizes, enhances, up regulates, agonizes, etc) a cellular process, biochemical reaction, protein: protein interaction, or a protein: nucleic acid interaction.
[0319]In one particularly preferred embodiment, the nucleic acid fragment expression libraries are screened for encoded peptides that bind to a target immunoglobulin, and preferably to the antigen binding site of a target immunoglobulin. Using standard affinity purification methods or any of the methods described herein, and appropriate antibodies as the target protein, it is possible to isolate peptide mimetics of both linear and discontinuous protein epitopes, in addition to other non-protein antigens, for example an antigen selected from the group consisting of: a carbohydrate, lipid, phospholipid, and protein (eg., Hi-PAL (P6) protein of H. influenzae, D15 protein from H. influenzae, the murM protein from S. aureus, the FemA protein from S. aureus, or the FemAB protein from S. aureus). Using subsequent rounds of screening performed at lower concentrations of the target antibody, those peptides that bind with high affinity are selected.
[0320]In another particularly preferred embodiment, the nucleic acid fragment expression libraries are screened for encoded peptides that inhibit or antagonize or block an interaction between two oncoproteins, such as, for example, SCL and E47. Such peptide antagonists ("peptide blockers") are particularly useful for validating a cellular target in the therapeutic treatment of cancer or for the therapeutic treatment of an individual suffering from a cancer, tumor or neoplastic illness, or alternatively in the prophylactic treatment of a subject having a predisposition or history of cancer, tumor or neoplastic illness. As exemplified herein, reverse two hybrid screens that assay the interaction between SCL and E47, have successfully been used to identify several specific peptide blockers of the SCL/E47 interaction in yeast cells, in addition to a small number of peptide blockers that are not specific for this interaction.
[0321]In a further embodiment, the nucleic acid fragments of the present invention are expressed as fusion proteins to form single-chain Fv (scFv) or Fab antibody fragments as described in McCafferty et al, Nature 348 552-534 (1990) and Hoogenboom et al, Nucleic Acids Res 19, 4133-4137 (1991). In a preferred embodiment the expression library of the present invention is used in the generation of a scFv library. The generation of a scFv library essentially involves generation of a gene construct comprising two or more nucleic acid fragments of the present invention separated by a nucleotide sequence encoding a scFv peptide linker, such as for example (Gly4Ser)3. The resulting gene construct is then expressed in an appropriate system to produce a single chain fragment of an antibody. It is particularly preferred that the expression library is displayed using a system described herein. Displayed library is screened for antibody fragments having a conformation sufficient for binding a specific antigen using techniques well known in the art, such as, for example, affinity purification.
[0322]Using techniques known in the art, scFv fragments are isolated that bind to specific antigens or molecules. Such techniques include, for example, affinity chromatography and `n`-hybrid screening. Furthermore, through selection of increased nucleotide sequence diversity through, for example random mutagenesis, it is possible to select for antibodies with increased affinity for the specific antigen.
[0323]In a further embodiment, the present invention provides a method of identifying a peptide or protein domain that binds to a target protein or nucleic acid wherein said binding modulates a biological activity of the target protein or nucleic acid. As used herein, the term "biological activity" is to be taken in its broadest context and shall be taken to mean any activity of a substance that relates to a cellular process, or alternatively is required for a cellular event to occur. Examples of biological activity include, but are not limited to, an activity selected from the group comprising, protein binding to a target protein or nucleic acid, for example antibody and antigen binding, disruption of protein binding, modulation of cell signalling, modulation of gene expression, cell viability, cell proliferation, degradation of a protein or nucleotide, and/or preservation of a protein or nucleotide.
[0324]In another embodiment, the present invention provides a method of identifying a peptide or protein domain that binds to a target protein or nucleic acid wherein said binding inhibits the growth or viability of a microorganism. For example, comparative computer analysis of the genomes of microorganisms is used to identify those gene products that are specific to the microorganisms. Such information and comparative computer analysis software is available from, for example NCBI. The genome data of several microorganisms that are pathogens of the respiratory tract are compared to identify those sequences that are common to all of these species. These data are subtracted from genomic data of similar microorganisms that are not pathogens of the respiratory tract. Those sequences are specific to respiratory tract pathogens. This form of data analysis has been performed by, for example Read et al, Drug Disc. Today 6, 887-892 (2001). Any of these sequences that encode proteins is then be expressed and the encoded protein isolated, by methods that are well known in the art and are described for example, in Ausubel et al (In: Current Protocols in Molecular Biology. Wiley Interscience, ISBN 047 150338, 1987), U.S. Pat. No. 5,763,239 (Diversa Corporation) and (Sambrook et al (In: Molecular Cloning: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Third Edition 2001). Such proteins are then used as a target for screening the nucleic acid fragment library of the present invention. Any peptides that are identified as having a conformation sufficient for binding to the target protein or nucleic acid, are tested for microbial toxicity, either through directly exposing the microbes to the peptide, or expressing the peptide in the target microorganisms by methods that are well known in the art and are described for example, in Ausubel et al (In: Current Protocols in Molecular Biology. Wiley Interscience, ISBN 047 150338, 1987), U.S. Pat. No. 5,763,239 (Diversa Corporation) and (Sambrook et al (In: Molecular Cloning: Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratories, New York, Third Edition 2001).
[0325]In a related embodiment, the present invention provides a method of identifying a peptide or protein domain that binds to a target protein or nucleic acid wherein said binding inhibits the growth or viability of an microorganism. In one form, the present embodiment relates to the insertion of the nucleic acid fragments that encode a polypeptide into a vector containing a conditional protein cleavage site, such as, for example, the temperature sensitive splicing element intein modified from the element found in the S. cerevesiae VMA1 gene. Such vectors include the IMPACT T7 system from New England Biolabs, for expression of peptides on the surface of T7 phage. Libraries generated using such vectors must be arrayed, such that each nucleic acid fragment is analyzed in isolation from other nucleic acid fragments, such methods are well known in the art, for example arraying individual phage or bacteria clones in a 96 well plate format. Accordingly, the vectors are transformed, transfected or transduced into an appropriate host, and the host cells placed under conditions for cleavage to occur, such as, for example, low temperatures in the case of the intein mutant cleavage. The cleaved peptides are then brought into physical contact with the microorganism. Those peptides that are capable of inhibiting the growth of the microorganism, or killing the microorganism is identified using standard techniques, and directly related to the arrayed nucleic acid fragment library.
[0326]The methods described herein above are readily modified to suit other gene expression systems, such as for example those systems that secrete the peptide encoded by the expression library of the present invention, and those systems that lyse the host cell that express the peptide encoded by the expression library of the present invention, such as for example, the expression of the peptides from different open reading frames of the same nucleic acid fragment in the T7 lytic phage.
[0327]In a related embodiment, libraries that encode peptides in a secretable form, or libraries wherein a host cell is lyzed in preparation for screening, are screened using an assay employing a filter diffusion assay. Such an assay utilises a double faced Petri dish, with the two faces of the dish are separated by a supported semi-permeable membrane which will allow the diffusion of the peptides encoded by the expression library of the present invention, such as for example a membrane selected from the group comprising, nitrocellulose and nylon. A lawn of the microorganism is grown on one side of said double-faced Petri dish. Host cells expressing the expression library are grown on the opposite side of a double-faced Petri dish. The presence of plaques in the lawn of the microorganism is suggestive of the expression and diffusion of a peptide that can inhibit the growth of or kill said microorganism. The nucleic acid is then be isolated from the equivalent region of the phage overlay, using techniques well known in the art.
[0328]In a related embodiment, a library of T7 phage expressing free peptides is transferred to a nylon membrane before being placed on a newly seeded lawn of pathogenic bacteria. Plaques appearing in this lawn are correlated by orientating the filter to plaques on the E. coli/T7 lawn expressing bacteriostatic or antibacterial peptides.
[0329]In another embodiment, the expression library of the present invention is introduced into a plurality of suitable host cells using the methods of introducing recombinant expression vectors described herein. Cells are then monitored for a change in the phenotype such as for example, as described in Xu et al, (In: Nature Genetics 27, 23-29, 2001). Examples of phenotypic changes include, but a not limited to a phenotypic change selected from the group comprising, modulation of cellular proliferation, morphological changes, resistance to toxins, susceptibility to toxins, and gene expression changes. In adapting the described technique to the present invention, appropriate host cells are transformed or transfected with the expression libraries of the present invention, using methods well known in the art, and described above. Alternatively recombinant peptides isolated from the expression libraries of the present invention is incubated with the host cells, in the presence of a polypeptide that facilitates the uptake of peptides into host cells. Said host cells are then monitored for specific phenotype changes, such as for example gene expression changes monitored using DNA microarrays. The nucleic acid encoding the peptide that induces the phenotypic change is then isolated. Further testing of the peptide that induces the desired change in phenotype is clearly envisaged, such as, for example, two-hybrid analysis to determine which proteins the peptides interacts with, and which cellular pathways it is affect.
[0330]Preferably, those peptides that are identified in any of the above-mentioned screens to bind to a target protein or nucleic acid are recovered and analyzed.
[0331]In one embodiment, the nucleotide sequence of the nucleic acid encoding the identified peptide or protein domain is determined. Preferably, the sequences of several distinct peptides identified in a specific screen of a library are aligned and compared, and highly conserved primary and/or secondary structures within the peptides or protein domains are determined. Alternatively, or in addition, less conserved structures are also determined. More preferably, the highly conserved structural features are used to design and/or to produce additional peptides having the same or enhanced binding properties as the peptides identified in the initial screening.
[0332]In an alternative embodiment, the recovered peptide or protein domain and/or nucleic acid encoding same is recovered and used to validate a therapeutic target (ie. it is used as a target validation reagent). By virtue of its ability to bind to a specific target protein or target nucleic acid, it is well within the ken of a skill artisan to determine the in vivo effect of modulating the activity of the target protein or target nucleic acid by expressing the identified peptide or protein domain in an organism (eg., a bacterium, plant or animal such as, for example, an experimental animal or a human). In accordance with this aspect of the present invention, a phenotype of an organism that expresses the identified peptide or protein domain is compared to a phenotype of an otherwise isogenic organism (ie. an organism of the same species or strain and comprising a substantially identical genotype however does not express the peptide or protein domain). This is performed under conditions sufficient to induce the phenotype that involves the target protein or target nucleic acid. The ability of the peptide or protein domain to specifically prevent expression of the phenotype, preferably without undesirable or pleiotropic side-effects indicates that the target protein or target nuclei c acid is a suitable target for development of therapeutic/prophylactic reagents.
[0333]Accordingly, a further aspect of the present invention provides a method for determining a therapeutic or prophylactic target comprising [0334](a) screening an expression library of the present invention to identify a peptide expressed by the library that binds to a target protein or target nucleic acid; [0335](b) selecting a peptide from (a) that does not bind to said target protein or nucleic acid in its native environment; and [0336](c) expressing the selected peptide in an organism and determining a phenotype of the organism that is modulated by the target protein or target nucleic acid.
[0337]Preferably, determining a phenotype of the organism that is modulated by the target protein or target nucleic acid comprises comparing the organism to an otherwise isogenic organism that does not express the selected peptide. For example, the phenotype of an organism that expresses a tumor is assayed in the presence and absence of a peptide or protein domain that blocks an interaction between SCL and E47 in a screen of the expression library of the invention. Amelioration of the oncogenic phenotype by the expressed peptide indicates that the SCL/E47 is a suitable target for intervention, wherein the peptide is then suitably formulated for therapeutic intervention directly, or alternatively, small molecules are identified that are mimetics of the identified peptide or protein domain.
[0338]It is to be understood that any use of an expression library of the present invention extends to the obtaining of said expression library, or the production of the expression library.
[0339]It will also be apparent from the preceding description that the library can be screened using an selected from the group consisting of yeast-2-hybrid, n-hybrid, reverse-2-hybrid, reverse n-hybrid, split two hybrid, bacterial display, phage display, retroviral display, covalent display and in vitro display, or using an affinity purification, such as, for example, an immunoassay that measures the formation of an antigen-antibody complex.
[0340]It will also be apparent from the description herein that the peptide selection may comprise (i) determining the amino acid sequence of the peptide or determining the nucleotide sequence of the corresponding nucleic acid encoding said peptide and deriving the amino acid sequence from said nucleotide sequence or determining a known function of the amino acid sequence; and (ii) excluding a peptide that binds to a target protein or target nucleic acid associated with the known sequence or known function.
[0341]In accordance with this embodiment, a selection is applied (eg., using flow cytometry to sort cells with particular surface expression characteristics) to isolate library transformants which have acquired a desired phenotype. The amino acid sequence of the peptide expressed from such positively selected clones is then be determined by PCR cloning and sequencing. Two hybrid screening, as described herein, using the isolated peptide as a bait protein is used to identify the target proteins which the peptide bound to exert its phenotypic effect.
[0342]By way of an example, the expression library of the present invention is introduced into a cell line and expression induced. After a time sufficient for expression of the peptides encoded by the expression library to occur, the cells are exposed to a toxin to which the wild type cells are susceptible, such as, for example staurosporine. Following such exposure, those cells that are not resistant to the toxin die by apoptosis. Those cells that survive the selection pressure are analyzed further to determine if their survival is a consequence of their expressing a peptide that enables them to survive exposure to the toxin. Preferably, the nucleic acid encoding this peptide is isolated and sub-cloned for further analysis.
[0343]In another embodiment, the expression library of the present invention is arrayed and individual nucleic acid fragments or pools of nucleic acid fragments are introduced into a whole organism, using methods well known in the art, and described herein.
[0344]Particular model organisms include, but are not limited to, Arabidopsis thaliana, Anopheles gambiae, Caenorhabditis elegans, Danio rerio, Drosophila melanogaster, Mus sp., Takifugu rubripes, Rattus sp., Saccharomyces cerevesiae, and Schizosaccharomyces pombe. Array methods described in Hogan et al (In: Manipulating the Mouse Embryo. A Laboratory Manual, 2nd Edition. Cold Spring Harbour Laboratory. ISBN: 0879693843, 1994) are preferred. After a time sufficient for the organisms to develop to a suitable stage in the life cycle for a target phenotype to be expressed, transformed organisms are monitored for a change in the phenotype, using methods well known in the art, such as for example the SHIRPA protocol described in Rogers et al, Mamm. Genome 8(10), 711-713, 1997. Organisms expressing a desired change in phenotype are retained for further analysis. Further testing of the peptide that induces the desired change is clearly encompassed by the present invention.
[0345]A similar method is applied to the identification of those nucleic acids that encode a polypeptide that confers resistance to, for example, toxins, pathogens, or specific forms of cancer. By way of example, fertilized mouse ova are microinjected with individual, or pools of gene constructs comprising nucleic acid fragments of the present invention. After implanting the microinjected ova and allowing transgenic mice to be born and to develop beyond weaning (ie. approximately 21 days), mice are exposed to a challenge by a microorganism, such as for example P. falciparum. Following an exposure to P. falciparum at high dose, mice that are susceptible to P. falciparum die. Mice that do not die are retained and nucleic acid used to produce those mice are recovered (eg., by PCR) and the sequences determined.
[0346]It will also be appreciated by those skilled in the art that the above described method is adapted to monitor any phenotypic changes, for example through methods selected from the group comprising 3H incorporation, measures of apoptosis (eg TUNEL staining), secretion of particular hormones/proteins, and morphological changes, amongst others
[0347]In a related embodiment those peptides that are able to modulate the phenotype are further analyzed to determine those cellular components with which the peptide interacts. Methods used in the analysis of protein interactions are well known in the art and are described in Weber (In: Protein interactions. Chapman and Hall, New York, 1992). Through determining the proteins with which the peptides interact, the gene expression libraries of the present invention is used for the validation of potential drug targets or in determining the proteins involved in specific cellular pathways and processes.
[0348]A particularly preferred embodiment of the present invention relates to the identification of a peptide or protein domain that is able to modulate the biological activity of a target protein or nucleic acid, wherein the modulated biological activity is the ability of the target protein or nucleic acid to bind to another protein or nucleic acid and wherein the modulated binding is determined using a reporter molecule. As used herein, the term "reporter molecule" shall be taken to mean a molecule that displays a physically measurable property that alters in a way that can be measured and correlated with changes in the biological activity or a target protein or nucleic acid. Reporter molecules are well known in the art, and include, but are not limited to, proteins that fluoresce, for example green fluorescence protein, proteins that induce a colour change in the presence of a substrate, for example E. coli ฮฒ-galactosidase, molecules that confer growth characteristics on the host cells, such as for example HIS1, and molecules that induce the death or reduced growth ability of the host cells, such as for example URA3 and CYH1.
[0349]One embodiment of the present invention relates to the identification of nucleic acids that encode peptides having a conformation capable of binding to a DNA sequence. The one-hybrid assay, as described in Chong and Mandel (In: Bartel and Fields, The Yeast Two-Hybrid System, New York, N.Y. pp 289-297, 1997) is used to determine those peptides able to bind to a target DNA sequence. In adapting the standard one-hybrid technique to the present purpose, the target nucleotide sequence is incorporated into the promoter region of a reporter gene(s), the expression of which can be determined as described above. The peptide encoded by the expression library of the present invention is expressed in such a manner that it forms a fusion protein with a transcriptional activation domain (for example from the GAL4 protein, the LexA protein, or the mouse NF KB protein). The transcriptional activation domain is recruited to the promoter through a functional interaction between the expressed peptide and the target nucleotide sequence. The transcriptional activation domain subsequently interacts with the basal transcriptional machinery of the cell, activating expression of the reporter genes.
[0350]In another embodiment a polypeptide is identified that is able to bind a target protein or peptide using the two-hybrid assay described in U.S. Pat. No. 6,316,223 to Payan et al and Bartel and Fields, The Yeast Two-Hybrid System, New York, N.Y., 1997. The basic mechanism described requires that the binding partners are expressed as two distinct fusion proteins in an appropriate host cell, such as for example bacterial cells, yeast cells, and mammalian cells. In adapting the standard two-hybrid screen to the present purpose, a first fusion protein consists of a DNA binding domain fused to the target protein, and a second fusion protein consists of a transcriptional activation domain fused to the peptide encoded by the expression library of the present invention. The DNA binding domain binds to an operator sequence which controls expression of one or more reporter genes. The transcriptional activation domain is recruited to the promoter through the functional interaction between the peptide expressed by the expression library of the present invention and the target protein. Subsequently, the transcriptional activation domain interacts with the basal transcription machinery of the cell, thereby activating expression of the reporter gene(s), the expression of which can be determined.
[0351]The three hybrid assay as described in Zhang et al (In: Bartel and Fields, The Yeast Two-Hybrid System, New York, N.Y. pp 289-297, 1997) is used to determine those peptides that bind target RNA sequences. In adapting the described 3-hybrid technique to the present invention, a first fusion protein consists of a DNA binding domain which is fused to a known RNA binding protein, eg. the coat protein of bacteriophage MS2. An RNA hybrid molecule is also formed, consisting of a fusion between a RNA molecule known to bind the RNA binding protein, eg. MS2 binding sequences, and a target RNA binding sequence. A second fusion protein consists of a transcriptional activation domain fused to the peptide encoded by the expression library of the present invention. The DNA binding domain of the first fusion protein binds to an operator sequence that controls expression of one or more reporter genes. The RNA fusion molecule is recruited to the first fusion protein through the functional interaction between the RNA binding protein and the RNA molecule known to interact with said RNA binding protein. The transcriptional activation domain is recruited to the promoter of one or more reporter molecules through functional interaction between the target RNA sequence of the peptide encoded by the nucleic acid of the present invention.
[0352]Other modifications of the two-hybrid screens are well known in the art, such as for example the PolIll two hybrid system, the Tribrid system, the ubiquitin based split protein sensor system and the Sos recruitment system as described in Vidal and Legrain Nucl. Acid Res. 27(4), 919-929 (1999). All of these systems are particularly contemplated.
[0353]A particularly preferred embodiment of the present invention relates to the identification of peptides that antagonize or inhibit the interaction between the target protein or nucleic acid and another protein or nucleic acid. Accordingly, reverse `n`-hybrid screens are employed to identify agonist molecules. Reverse hybrid screens differ from the forward hybrid screens supra in that they use a counter selectable reporter marker(s), such as for example the URA3 gene, the CYH2 gene or the LYS2 gene, to select against interactions between the target protein or nucleic acid and another protein or nucleic acid. Cell survival or cell growth is reduced or prevented in the presence of a non-toxic substrate of the counter selectable reporter gene product, which is converted by the counter selectable marker to a toxic compound, such as for example the CYH1 gene product which confers lethality in the presence of cycloheximide. Accordingly, cells in which the interaction between the target protein and another protein or nucleic acid is blocked or inhibited survive in the presence of the substrate. This is because the counter selectable reporter molecule will not be expressed, and accordingly, the substrate will not be converted to a toxic product. Such a result suggests that the peptide encoded by the expression library of the present invention is an inhibitor of the interaction between the target protein or nucleic acid and another protein or nucleic acid.
[0354]In a particularly preferred embodiment, the screening method of the present invention identifies an antagonist of a protein: protein interaction or protein: nucleic acid interaction. In accordance with this embodiment, the present invention provides a reverse two hybrid screening process, such as, for example, essentially as described by Watt et al. (U.S. Ser. No. 09/227,652), for identifying an inhibitory amino acid sequence that partially or completely inhibits a target protein-protein interaction or DNA-protein interaction involving one or more protein binding partners said method comprising: [0355](i) providing cells that each comprise: (a) a nucleic acid comprising a counter-selectable reporter gene encoding a polypeptide that is capable of reducing cell growth or viability by providing a target for a cytotoxic or cytostatic compound (eg., CYH2 gene that confers susceptibility to cycloheximide) or by converting a substrate to a cytotoxic or cytostatic product (eg., URA3 gene that converts 5-FOA to a toxic product), said gene being positioned downstream of a promoter comprising a cis-acting element such that expression of said gene is operably under the control of said promoter and wherein a protein binding partner of the protein-protein interaction or the DNA-protein interaction being assayed binds to said cis-acting element; and (b) nucleic acid selected from the group consisting of: (i) nucleic acid encoding a protein of the DNA-protein interaction that binds to said cis-acting element to activate expression of the counter-selectable reporter gene; and (ii) nucleic acids encoding two protein binding partners of the protein-protein interaction wherein a protein binding partner binds to the cis-acting element and the protein binding partners interact, said binding to the cis-acting element and said interaction being required to activate expression of the counter-selectable reporter gene; [0356](ii) transforming or transfecting the cells or a portion of the cells with an expression library of the invention such that a single gene construct of the expression library is present in each transformed or transfected cell; [0357](iii) culturing the transformed or transfected cells for a time and under conditions sufficient for the protein binding partner(s) to activate expression of the counter-selectable reporter gene in the absence of inhibition of the protein-protein interaction or the DNA-protein interaction by an amino acid sequence encoded by the expression library; [0358](iv) culturing the transformed or transfected cells under conditions sufficient for an amino acid sequence of the expression library to be expressed in each of said transformed or transfected cells or a proportion of said transformed or transfected cells; [0359](v) culturing the transformed or transfected cells in the presence of the substrate or the cytotoxic or cytostatic compound such that the expressed counter-selectable reporter gene reduces the growth or viability of the cells unless said expression is reduced by virtue of an amino acid sequence of the expression library inhibiting the target protein-protein interaction or DNA-protein interaction; [0360](vi) selecting a cell having enhanced growth or viability compared to a cell that does not express the amino acid sequence of the expression library wherein the enhanced growth or viability is indicative of a partial or complete inhibition of the protein-protein interaction or a DNA-protein interaction by the amino acid sequence and [0361](vii) selecting a peptide expressed by the cell at (vi) that does not bind to a protein or nucleic acid of the protein-protein interaction or a DNA-protein interaction in its native environment.
[0362]Preferably, wherein a protein-protein interaction is being assayed, the binding of the two protein binding partners reconstitutes a functional transcriptional regulatory protein, such as, for example, by virtue of the binding partners being expressed as fusion proteins wherein each fusion protein comprises a portion of a transcriptional regulatory protein that does not modulate transcription without the other portion (eg., a fusion protein comprising a transcriptional activator domain and a fusion protein comprising a DNA-binding domain). In a particularly preferred embodiment, one fusion protein comprises a Gal4 DNA-binding domain fused to SCL, and another fusion protein comprises the transcriptional activation domain of the LMO2 protein and a domain that interacts with SCL and the URA3 counter selectable reporter gene is operably under the control of a promoter comprising a Gal4 upstream activator sequence (Gal4 UAS), such that docking of the Gal4/SCL fusion to the Gal4 UAS and binding between SCL and LMO2 is required to activate transcription of the URA3 gene, thereby conferring lethality on cells grown in the presence of 5-fluoroorotic acid (5-FOA). In screening the expression library, only those cells that survive in the presence of 5-FOA are selected.
[0363]For example, a specific receptor is expressed as a DNA binding domain fusion protein, such as with the DNA binding domain of GAL4, and the ligand of said receptor is expressed as an activation domain fusion protein, such as with the GAL4 activation domain. These fusion proteins are expressed in yeast cells in operable connection with the CYH1 counter selectable marker, wherein expression of the CYH1 gene requires a physical interaction between the GAL4 DNA binding domain and the GAL4 activation domain. This physical relation is achieved is achieved, for example, by placing the expression of the marker gene under the control of a promoter comprising nucleotide sequences to which the GAL4 DNA binding domain binds. Cells in which the reporter gene is expressed do not grow in the presence of cycloheximide, because the 5-FOA is converted to a toxic compound. The expression libraries of the present invention are expressed in these yeast cells and those cells that then grow in the presence of cycloheximide are further analyzed, such as, for example, analysis of the nucleic acid encoding the candidate peptide inhibitor(s).
[0364]As will be known to the skilled artisan, the reverse `n`-hybrid technique briefly described above is readily modified for use in 1-hybrid, 2-hybrid or 3-hybrid assays.
[0365]In an alternative embodiment, the antagonist is identified using a reverse split two hybrid screening process, such as, for example, essentially as described by Erickson et al. (WO95/26400), wherein a relay gene that is a negative regulator of transcription is employed to repress transcription of a positive readout reporter gene when the interacting proteins (ie., bait and prey) interact, such that reporter gene expression is only induced in the absence of the protein encoded by the relay gene product. In accordance with this embodiment, there is provided a method for identifying an inhibitory amino acid sequence that partially or completely inhibits a target protein-protein interaction or DNA-protein interaction involving one or more protein binding partners said method comprising: [0366](i) providing cells that each comprise: (a) a nucleic acid encoding a negative regulator of transcription (eg., Gal80 or mdm2 oncoprotein-encoding gene), said nucleic acid being positioned downstream of a promoter comprising a cis-acting element and wherein a protein binding partner of the protein-protein interaction or the DNA-protein interaction being assayed binds to said cis-acting element; [0367](b) nucleic acid selected from the group consisting of: (i) nucleic acid encoding a protein of the DNA-protein interaction that binds to said cis-acting element to activate expression of the negative regulator of transcription; and (ii) nucleic acids encoding two protein binding partners of the protein-protein interaction wherein a protein binding partner binds to the cis-acting element and the protein binding partners interact, said binding to the cis-acting element and said interaction being required to activate expression of the negative regulator of transcription; and (c) nucleic acid comprising a positive reporter gene (eg., an antibiotic resistance gene, herbicide resistance gene, or other resistance gene) operably connected to a cis-acting element (eg., a GAL4 binding site capable of binding to Gal80, or Gal80, or the transactivation domain of p53 that binds to mdm2 oncoprotein) to which the negative regulator of transcription binds to thereby inhibit or repress expression of the positive reporter gene; [0368](ii) transforming or transfecting the cells or a portion of the cells with an expression library of the invention such that a single gene construct of the expression library is present in each transformed or transfected cell; [0369](iii) culturing the transformed or transfected cells for a time and under conditions sufficient for the protein binding partner(s) to activate expression of negative regulator of transcription in the absence of inhibition of the protein-protein interaction or the DNA-protein interaction by an amino acid sequence encoded by the expression library; [0370](iv) culturing the transformed or transfected cells under conditions sufficient for an amino acid sequence of the expression library to be expressed in each of said transformed or transfected cells or a proportion of said transformed or transfected cells; [0371](v) culturing the transformed or transfected cells in the presence of a compound to which the positive reporter gene confers resistance on the cells such that the expressed negative regulator of transcription represses expression of the positive reporter gene thereby reducing the growth or viability of the cells unless said expression is reduced by virtue of an amino acid sequence of the expression library inhibiting the target protein-protein interaction or DNA-protein interaction; [0372](vi) selecting a cell having enhanced growth or viability compared to a cell that does not express the amino acid sequence of the expression library wherein the enhanced growth or viability is indicative of a partial or complete inhibition of the protein-protein interaction or a DNA-protein interaction by the amino acid sequence and [0373](vii) selecting a peptide expressed by the cell at (vi) that does not bind to a protein or nucleic acid of the protein-protein interaction or a DNA-protein interaction in its native environment.
[0374]Preferably, wherein a protein-protein interaction is being assayed, the binding of the two protein binding partners reconstitutes a functional transcriptional regulatory protein. In a particularly preferred embodiment, one protein comprises a LexA fusion protein, and another protein comprises a VP16 fusion protein, and the positive reporter gene confers resistance against cycloheximide and is placed operably under the control of a promoter comprising a Gal4 upstream activator sequence (Gal4 UAS), such that docking of a Gal80 negative regulator of transcription to the Gal4 UAS and binding between SCL and LMO2 is required to repress transcription of the positive reporter gene, thereby preventing cells from proliferating. Conversely, repression of the interaction between the LexA-fusion and VP16 fusion prevents Gal80 expression allowing expression of the positive reporter gene to confer resistance on cells in the presence of cycloheximide, particularly in cells that express endogenous Gal4 protein.
[0375]In a preferred embodiment of the present invention, those nucleic acid fragments that encode a polypeptide that binds to a target protein or nucleic acid are exposed to further rounds of selection using, for example, mutagenic PCR or expression of said fragments in "mutator" strains of bacteria. This increases the diversity of the selected nucleic acid. Said selected nucleic acid is again screened for those that encode a peptide having a conformation sufficient for binding a target protein or nucleic acid. Through multiple rounds of screening and selection with lower concentrations of the target protein or nucleic acid, those peptides with the highest affinity for the target protein or nucleic acid are selected.
[0376]In a related embodiment, the sequences of those nucleic acid fragments encoding peptides that bind to the target protein or nucleic acid are optimally aligned and the sequences compared to identify those nucleic acids that encode amino acids that are particularly desired for binding the target protein or nucleic acid. Furthermore, this information is used to generate synthetic nucleotide sequences encoding peptides, or synthetic peptides, containing those amino acids that are particularly desirable for binding to a target protein or nucleic acid.
[0377]Preferably, those peptides that bind to the target protein or nucleic acid, are recovered and used in further analysis, such as for example, determining the nucleotide sequence of the nucleic acid encoding the identified peptide or protein domain. Initially, the nucleic acid fragment encoding the peptide is isolated using methods well known in the art, such as for example, PCR, RT-PCR, and nucleic acid isolation, amongst others. An isolated nucleic acid fragment is then characterized by methods such as nucleic acid sequencing. Such methods are well known in the art.
[0378]In one embodiment, an insolated nucleic acid fragment is placed into an expression vector using methods well known in the art, and described herein. Such a nucleic acid fragment is only expressed in a single reading frame and only in one direction. This method is repeated until all possible open reading frames of the nucleic acid fragment are tested, and that/those that encode a polypeptide having a conformation sufficient for binding a target protein or nucleic acid are identified. As used herein the term "all possible open reading frames" shall include those open reading frames that include the entire nucleic acid fragment, in addition to those open reading frames that is formed within a nucleic acid fragment, such as for example by the inclusion of a second ATG start codon, a Kozak sequence, a Shine-Dalgarno sequence, or an internal ribosome entry sequence, amongst others. All of the expressed peptides are then screened in an appropriate screening system to determine those that have a conformation sufficient for binding to a target protein or nucleic acid. Accordingly, analysis of the nucleic acid encoding such a peptide is used to determine the amino acid sequence of the peptide. Using such software as the Translate tool available at ExPasy. As used herein, the term "ExPasy" shall be understood to mean, the ExPasy proteomics server provided by the Swiss Institute of Bioinformatics at CMU-Rue Michel--Servet 1 1211 Geneve 4 Switzerland
[0379]Following isolation of the nucleic acid that encodes a peptide with a conformation sufficient for binding to a target protein or nucleic acid, it is preferred that all homologues of this sequence are isolated from the genomes of the organisms used to generate the expression library of the present invention. Methods of isolating homologous nucleic acid regions are well known in the art and are described, for example, in Dieffenbach (ed) and Dveksler (ed) (In: PCR Primer: A Laboratory Manual, Cold Spring Harbour Laboratories, NY, 1995). Such methods include PCR and degenerate PCR. Such homologues are then screened in all possible reading frames using a suitable screening system, as are known in the art and described herein.
[0380]It is a further preferred embodiment that an identified nucleotide sequence or amino acid sequence shall be used as a "reference sequence" for a homology search using a database of all known sequences. Such a reference sequence is a nucleotide or amino acid sequence to which all nucleotides or amino acid sequences in a database are compared. A number of source databases are available that contain either a nucleotide sequence and/or a deduced amino acid sequence that are particularly useful to identify all known sequences that are substantially homologous the sequence of nucleic acid or peptide, polypeptide or protein domain identified as positive in the present invention. Such databases are well known in the art and include, for example, Genbank (at NCBI) and SWISS-PROT and TrEMBL (available at ExPasy). A number of different methods of performing such sequence searches are known in the art. The sequence data of the clone is then aligned to the sequences in the database or databases using algorithms designed to measure homology between two or more sequences.
[0381]In one embodiment, a nucleic acid identified in a homology search of the known nucleic acids is isolated using one of a variety of methods well known in the art, such as for example PCR amplification of the specific region of genomic DNA or cDNA of the organism in which the nucleic acid is naturally found. The sequence of the isolated nucleic acid is determined, used to generate a gene construct as described herein, and screened to determine if it encodes a peptide that has a conformation sufficient for binding the target protein or nucleic acid.
[0382]In another embodiment a nucleic acid encoding an amino acid sequence identified in a homology search of known amino acid sequences using techniques well known in the art, such as for example degenerate PCR. An isolated nucleic acid is then used to generate a gene construct as described herein, and screened to determine if it encodes a peptide that has a conformation sufficient for binding the target protein or nucleic acid.
[0383]It is a particularly preferred embodiment of the present invention that those nucleic acids that encode a polypeptide having a conformation that binds to a target protein or nucleic acid are analyzed to select those nucleic acid fragments that encode polypeptides that do not bind to said target protein or nucleic acid in its native environment. As used herein, the term "native environment" of a polypeptide shall be understood to mean the protein encoded by the gene from which the nucleic acid fragment was isolated. Accordingly, it is the aim of the present invention to identify those polypeptides that display a novel function, for example by binding to a target protein or nucleic acid to which it cannot bind in the context of the protein in which it naturally occurs.
[0384]The known function/s of the polypeptides isolated in the screening of the libraries of the present invention are determined using sequence analysis software as is available from, for example NCBI, or Prosite. As used herein the term "Prosite" shall be understood to mean the Prosite protein database which is a part of the ExPasy proteomics server provided by the Swiss Institute of Bioinformatics at CMU-Rue Michel--Servet 1 1211 Geneve 4 Switzerland. Accordingly, those polypeptides that are known to bind to the target protein or nucleic acid in their native environment are excluded from any further analysis. Furthermore, analysis of the bioinformatic information available, for example, at NCBI aids in determining the native function of a protein. Such analysis will determine if, for example, the pathway being modified exists in an organism from which a peptide is identified or if a target protein or nucleic acid is found in any of the organisms used to generate an expression library.
[0385]It is particularly preferred that an expression library of the present invention is generated using nucleic acid fragments isolated from organisms that are distinct from the organism in which the target protein or nucleic acid naturally occurs. For example, to identify a nucleic acid that encodes a peptide that has a conformation sufficient for binding the Hi-PAL (P6) outer membrane protein of Haemophilus influenzae an expression library is generated from the organisms Aeropyrum pernix, Aquifex aeolicus, Archaeoglobus fulgidis, Bacillus subtilis, Bordetella pertussis, Borrelia burgdorferi, Chlamydia trachomatis, Escherichia coli, Helicobacter pylori, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Mycoplasma pneumoniae, Neisseria meningitidis, Pseudomonas aeruginosa, Pyrococcus horikoshii, Synechocystis PCC 6803, Thermoplasma volcanium and Thermotoga maritima. This will reduce the likelihood of identifying a peptide that interacts with the Hi-PAL (P6) protein in its native environment. Even more preferably, an expression library is generated using the organisms Aeropyrum pernix, Aquifex aeolicus, Arabidopsis thaliana, Archaeoglobus fulgidis, Caenorhabditis elegans, Danio rerio, Drosophila melanogaster, Methanobacterium thermoautotrophicum, Methanococcus jannaschii, Pyrococcus horikoshii, Saccharomyces cerevesiae, Takifugu rubripes, Thermoplasma volcanium, and Thermotoga maritima as these organisms are unlikely to occur in the same environment as Haemophilus influenzae, and as such, any peptide isolated from such an expression library would be especially unlikely to interact with Hi-PAL (P6) in its native environment.
[0386]Another aspect of the present invention is a database of nucleic acids that are found in an expression library of the present invention. As the nucleic acid fragments are derived from organisms with substantially sequenced genomes, it is possible to use this information to generate a database of the nucleotide sequences of nucleic acid fragments that is generated in the construction of an expression library of the present invention.
[0387]The utility of the database lies in the ability for a skilled person to search the database for a nucleotide sequence or amino acid sequence determined by screening an expression library of the present invention. In this way, it is possible to identify nucleic acid fragments that encode a peptide that is adopt a conformation sufficient for binding to a specific target protein or nucleic acid. Furthermore, the database allows the user to identify a sequence that is homologous to a nucleic acid, in addition to determining from which species it is derived. Once a sequence is identified, the specific nucleic acid is isolated from the expression library using techniques well known in the art, eg. PCR and the expressed peptide analyzed.
[0388]Nucleotide sequences of the nucleic acid fragments of the expression library are derived from any one of many publicly known databases, such as for example NCBI or TIGR, as the organisms used in the generation of an expression library of the present invention has a substantially sequenced genome.
[0389]Amino acid sequences that are found in the database are derived by conceptual translation of nucleotide sequences that are found in an expression library of the present invention. The conceptual translation of a nucleotide sequence comprises applying the known codon usage rules to obtain hypothetical peptide sequences by translating a nucleotide sequence in both orientations and in all three reading frames for each possible orientation. Software for translation of nucleotide sequence to amino acid sequence is well known in the art, and includes, for example, the Translate tool at ExPasy. Care is taken to translate a nucleotide sequence using the known codon usage of the organism in which a nucleic acid fragment is to be expressed. Such codon usage information is well known in the art. Amino acid sequences are also derived by sequencing the expressed peptides. Methods of sequencing peptides and proteins are well known in the art.
[0390]Alternatively or in addition, various comparisons can be made between the Library database sequences and any other sequence database as would be familiar to those practiced in the art.
[0391]Additionally, the sequence information is used to generate a highly specific probe for isolating both genomic clones from existing databases, as well as cDNA. Additionally, the probe is used to isolate the homologous nucleic acid fragment from sufficiently related species, including humans. Once isolated, the nucleic acid fragment is inserted into a gene construct and screened as herein described.
[0392]In a related embodiment, a database of amino acid sequences of peptides is analyzed to generate a database of potential domain structures, or three-dimensional structures that is formed by a peptide expressed by the expression library of the present invention. Methods for predicting the 3 dimensional structure of a peptide are well known in the art, and are described, for example, in US Patent Application No 20020150906 (California Institute of Technology), or using a computer program or algorithm, such as, for example, MODELLER, (Sali and Blundell, J. Mol. Biol. 234, 779-815, 1993). These techniques rely upon aligning the sequence of a peptide with the sequences of peptides or proteins that have a characterized structure. Such alignment algorithms are well known in the art and are accessed through software packages such as, for example BLAST at NCBI. Structural information, ie. three-dimensional structure, of a query peptide is then be predicted based upon structural information corresponding to the sequence or subsequences aligned in the proteins or peptides that have previously been characterized. In this way it is possible to generate a library of three-dimensional structures of peptides expressed from the expression library of the present invention. This information is used to determine those sequences that is adopt a conformation sufficient for binding to a target protein or nucleic acid. Accordingly, the nucleic acid fragment encoding such a peptide is isolated using methods well known in the art, and inserted into a gene construct. The encoded peptide is then screened using the methods described herein.
[0393]The present invention is further described with reference to the following non-limiting examples.
Example 1
The Construction of a Biodiverse Nucleic Acid Fragment Expression Library in the Vector pDEATH-Trp
[0394]Nucleic acid was isolated from the following bacterial species:
TABLE-US-00003 1 Archaeoglobus fulgidis 2 Aquifex aeliticus 3 Aeropyrum pernix 4 Bacillus subtilis 5 Bordetella pertussis TOX6 6 Borrelia burgdorferi 7 Chlamydia trachomatis 8 Escherichia coli K12 9 Haemophilus influenzae (rd) 10 Helicobacter pylori 11 Methanobacterium thermoautotrophicum 12 Methanococcus jannaschii 13 Mycoplasma pneumoniae 14 Neisseria meningitidis 15 Pseudomonas aeruginosa 16 Pyrococcus horikoshii 17 S nechosistis PCC 6803 18 Thermoplasma volcanium 19 Thermotoga maritima
[0395]Nucleic acid fragments were generated from the genomic DNA of each genome using 2 consecutive rounds of PCR using tagged random oligonucleotides with the sequence:
[0396]5'-GACTACAAGGACGACGACGACAAGGCTTATCAATCAATCAN6-3' (SEQ ID NO: 33). The PCR amplification was completed using the Klenow fragment of E. coli DNA polymerase I in the following PCR reaction:
TABLE-US-00004 Reagent DNA (100-200 ng) Volume Oligonucleotide comprising SEQ ID NO: 33 (25 ฮผM) 4 ฮผl H2O to 17.4 ฮผl.
[0397]Samples were then boiled for 3-5 minutes to denature the nucleic acid isolated from the bacteria, before being snap cooled, to allow the tagged random oligonucleotides to anneal to said nucleic acid. These samples were then added to the following reagents:
TABLE-US-00005 Klenow buffer 3 ฮผl dNTP (2 mM) 3 ฮผl Klenow 0.6 ฮผl Polyethylene Glycol (8,500) 6 ฮผl
[0398]PCR reactions were then incubated at 15ยฐ C. for 30 minutes, then at room temperature for 2 hours, before being heated to 37ยฐ C. for 15 minutes.
[0399]Samples were boiled for 5 minutes to again denature the nucleic acid, before being snap cooled to allow renaturation of said nucleic acid. Another 0.5 ฮผl of the Klenow fragment of E. coli DNA polymerase I was added to each reaction and the samples incubated at 15ยฐ C. for 30 minutes, then at room temperature for 2 hours, before being heated to 37ยฐ C. for 15 minutes.
[0400]Following boiling the samples, following snap cooling another 2 rounds of PCR were completed using the tagged random oligonucleotide:
TABLE-US-00006 (SEQ ID NO: 34) 5'-GACTACAAGGACGACGACGACAAGGCTTATCAATCAATCAN9-3'
[0401]To complete this the following reagents were added to the samples of the previous step:
TABLE-US-00007 Oligonucleotide comprising SEQ ID NO 34 (25 ฮผM) 4 ฮผl Klenow Buffer 1 ฮผl dNTP(2 mM) 3 ฮผl Klenow 0.5 ฮผl H2O to 40 ฮผl
[0402]Samples were then incubated at 15ยฐ C. for 30 minutes, then at room temperature for 2 hours, before being heated to 37ยฐ C. for 15 minutes.
[0403]Samples were boiled for 5 minutes to again denature the nucleic acid, before being snap cooled to allow renaturation of said nucleic acid. Another 0.5 ฮผl of the Klenow fragment of E. coli DNA polymerase I was added to each reaction and the samples incubated at 15ยฐ C. for 30 minutes, then at room temperature for 2 hours, before being heated to 37ยฐ C. for 15 minutes.
[0404]Following completion of the PCR amplification all sample volumes were increased to 500 ฮผl with TE buffer and added to an Amicon spin column. These columns were then centrifuged for 15 minutes at 3,800 rpm in a microcentrifuge. Columns were then inverted and 30 ฮผl of TE buffer was added before the columns were centrifuged for 2 minutes at 3,800 rpm, with this fraction collected for later use. The Klenow amplified DNA was then used in subsequent DNA manipulations.
[0405]The now purified PCR products were then used in a PCR reaction with an oligonucleotide comprising the following sequence: 5'-GAGAGAATTCAGGTCAGACTACAAGGACGACGACGACAAG-3' (SEQ ID NO: 35), wherein an EcoRI restriction endonuclease site is shown in bold text, and three stop codons are underlined. Note that each of the stop codons is in a different reading frame.
[0406]Thus, the following PCR reaction was used:
TABLE-US-00008 Oligonucleotide comprising SEQ ID NO: 35 (10 ฮผM) 12 ฮผl PCR buffer 5 ฮผl dNTP (2 mM) 5 ฮผl Taq polymerase (Boehringer) 5.5 U/ฮผl) 0.4 ฮผl H2O 26.6 ฮผl Klenow amplified DNA 2 ฮผl
[0407]Reactions were then cycled in a thermocycler using the following program: [0408]95ยฐ C. for 2 min; 60ยฐ C. for 30 sec; 72ยฐ C. for 1 min; [0409]95ยฐ C. for 20 sec; 60ยฐ C. for 30 sec; 72ยฐ C. for 1 min (repeated 29 times); and [0410]72ยฐ C. for 5 min.
[0411]PCR products were then purified using Amicon spins columns.
[0412]The PCR products were then analyzed by electrophoresis on standard TAE-agarose gels to determine the approximate size of the nucleic acid fragments generated as shown in FIG. 2. The nucleic acid concentration of the samples was also determined.
[0413]PCR products from each of the 19 bacterial species were then pooled to generate a biodiverse nucleic acid library. To do so, DNA from each organism was added in an equimolar amount when compared to the amount of nucleic acid added to the pool from the organism with the smallest genome. Between 1 ฮผg and 10 ฮผg of DNA from each organism was used, depending on the genome size of the organism from which the DNA was obtained.
[0414]In order to allow efficient cloning of the nucleic acid fragments into the pDEATH-Trp vector (SEQ ID NO: 36; FIG. 3), both the fragments and the vector were digested with the EcoRI restriction endonuclease. Restriction digests were completed in the following reactions:
[0415]Digestion of PCR products used the following reaction conditions:
TABLE-US-00009 PCR products (1 ฮผg) EcoR I Buffer (Promega) 17 ฮผl BSA (10x) 17 ฮผl EcoR I enzyme (20 U/ฮผL) (Promega) 0.9 ฮผl H20 to 170 ฮผl
[0416]Restriction digests were allowed to proceed for 40 minutes at 37ยฐ C. Samples were then purified using QIAquick PCR purification columns as per manufacturer's instructions. Nucleic acid was eluted into 50 ฮผl of H20.
[0417]Digestion of pDEATH-Trp vector used the following reaction conditions:
TABLE-US-00010 pDEATH-Trp (25 ฮผg) EcoR I Buffer (Promega) 100 ฮผl BSA (10X) 100 ฮผl EcoR I enzyme (20 U/ฮผL) 4 ฮผl H20 to 1000 ฮผl
[0418]Restriction digests were allowed to proceed for 5 minutes at 37ยฐ C. Samples were then purified using 3 QIAquick PCR purification columns as per manufacturer's instructions. Nucleic acid was eluted into 150 ฮผl of H20.
[0419]The fragments generated from the PCR products were then ligated into the pDEATH-Trp vector (SEQ ID NO 36) using the following reaction:
TABLE-US-00011 pDEATH-Trp (2 ฮผg) BGF-PCR Fragments (1 ฮผg) Ligation Buffer (10x) (NEB) 20 ฮผl T4 DNA Ligase (NEB) 10 ฮผl H20 to 200 ฮผl
[0420]Ligation reactions were allowed to proceed overnight at 16ยฐ C. The ligase was then heat inactivated by incubating the samples at 65ยฐ C. for 30 minutes. Following completion of the ligation reaction sample volumes were increased to 500 ฮผl with TE buffer and added to an Amicon spin column. These columns were then centrifuged for 15 minutes at 3,800 rpm in a microcentrifuge. Columns were then inverted and 3011 of TE buffer was added before the columns were centrifuged for 2 minutes at 3,800 rpm, with this fraction collected for later use.
[0421]The pDEATH-Trp vector containing the biodiverse nucleic acid fragment was then transformed into E. coli TOP10 cells. Expression vectors were then isolated from bacteria using standard procedures. Restriction enzyme digestion of the isolated vectors using EcoRI was then used to characterise the size of the inserts contained in the library, as shown in FIG. 4.
[0422]Vectors were then pooled and transformed into the yeast strain PRT 51. Yeast strain PRT-51 is characterized by the following genotype: MATฮฑ, his3, trp1, ura3, 6 LexA-LEU2, lys2:3 clop-LYS2, CYH2R, ade2:G418-pZero-ade2, met15:Zeo-pBLUE-met15, his 5::hygro.
[0423]The result of this transformation was a library of 61 million clones. The recombinant clones each express a peptide that is fused to another polynucleotide sequence encoding the FLAG epitope or other marker.
Example 2
Characterization of a Biodiverse Nucleic Acid Fragment Expression Library in the pDEATH-Trp Vector
[0424]Sequence analysis of nucleic acids cloned into pDEATH-Trp vector show that the fragments are derived from a variety of organisms, and encode a variety of proteins, as shown in Table 2.
TABLE-US-00012 TABLE 2 Characterization of nucleic acid fragment cloned into pDEATH-Trp Insert size Genbank No. (bp) Organism ID Function 1 114 P. aeruginosa AAG05339.1 Hypothetical Protein 2 143 Synechocystis BAA10184.1 Fructose PCC6803 3 166 E. coli AAC73742.1 Lipoprotein 4 180 B. subtilis CAB12555.1 methyl-accepting chemotaxis protein 5 150 N. meningitis AAF41991.1 N utilization substance protein A 6 240 E. coli AAC75637.1 Hypothetical protein 7 357 H. pylori AAD08555.1 transcription termination factor NusA 8 83 Z. maritima AAD36283.1 Hypothetical protein
Example 3
Screening of a Biodiverse Nucleic Acid Fragment Library for Inhibitors of the Interaction Between the Polymyositis-Scleroderma Autoantigen (SCL) and Basic Helix-Loop-Helix Transcription Factor E47
[0425]Nucleic acid encoding the SCL protein was cloned into the prey vector pJFK (SEQ ID NO: 60; FIG. 5) in operable connection with a nuclear localisation signal, and a B42 activation domain. The nucleic acid encoding the E47 protein was cloned into the bait vector pDD (SEQ ID NO: 61; FIG. 6) in operable connection with the LexA DNA binding domain. The pDD vector also contains a nucleic acid encoding the HIS3 gene (FIG. 6).
[0426]These vectors were transformed into the PRT 480 yeast strain (which contains two LexA-CYH2 chimeric reporter genes and two LexA-URA3 counter selectable reporter genes).
[0427]The process of screening the library is represented schematically in FIG. 7. Briefly, the PRT 480-SCL/E47 bait prey haploid strain was grown to high density in complete synthetic media lacking histidine and uracil (ie., HU media) and supplemented with 0.03% (w/v) galactose/2% (w/v) raffinose and then mass-mated with the PRT 51-library strain produced as described in Example 1. Approximately 300,000 diploids were plated onto 30 cm plates containing complete synthetic media lacking histidine and tryptophan (ie., HW media), and supplemented with 0.06% (w/v) galactose/0.04% 5-FOA and glucose.
[0428]After growth of these plates at 30ยฐ C. for 2-3 days, 1000 FOA-resistant colonies were isolated and plated onto a master-plate of complete synthetic media lacking histidine and tryptophan (ie., HW media). These cells potentially expressed peptide antagonists (ie., blockers) that prevent the SCL/E47 interaction, however may also include cells that had shut down expression of the URA3 reporter genes, such as, for example, by epistasis.
[0429]Results of this primary reverse two-hybrid screen are shown in FIG. 8.
[0430]The FOA-resistant colonies were replica-plated from the master-plate onto plates containing HWU media, or media lacking histidine, tryptophan and leucine (ie. HWL media). The replica-plate media also contained various concentrations of galactose. By modulating the level of galactose in the media, we were able to discriminate between yeast cells expressing genuine peptide blockers as opposed to those cells that had shut down expression of the URA3 reporter genes, such as, for example, by epistasis.
[0431]Results of this secondary screen are shown in FIG. 9. In summary, 54 colonies (6% of FOA-resistant colonies) were isolated from this screen.
[0432]Yeast colonies that exhibited reduced growth on leucine-containing media were selected and a library plasmid was rescued from each colony. Those plasmids that were from cells wherein the SCL/E47 interaction was antagonized or inhibited were sequenced.
[0433]Library plasmids were re-transformed into strain PRT51, and the resultant yeast cells were again mated with strain PRT 480 SCL/E47 haploids. Diploids were re-screened for their ability to block the SCL/E47 interaction, by plating in the forward direction on plates containing HWU or HWL media supplemented with various concentrations of galactose. The ability of a particular plasmid to recapitulate the blocked phenotype was determined.
[0434]Data shown in FIG. 10 indicate that, for 54 colonies tested, the interaction between SCL and E47 was again inhibited in 26 clones (ie. 2% of FOA-resistant colonies). Seven clones were found to recapitulate the blocking of an interaction between SCL and E47 twice.
[0435]Subsequently, the specificity of blocking was assayed, by mating those strains that did recapitulate the blocked phenotype into a strain PRT480 expressing two interacting proteins selected from the group consisting of: (i) E2,2 2F and SCL; and (ii) ID and E47. The E2-22F protein is a helix-loop-helix protein that is capable of forming heterodimers with other helix-loop-helix proteins, such as, for example, SCL. The ID protein is another helix-loop-helix protein, which has been shown to bind E47 and inhibit the ability of E47 to bind DNA.
[0436]Of the 26 colonies tested, the interaction between SCL and E47 was specifically blocked in 6 colonies (Table 3).
TABLE-US-00013 TABLE 3 Specificity of antagonism of the SCL/E47 interaction Predicted fusion Target interaction.sup.(1) Clone Number peptide size SCL/E47 SCL/E2.22F Id1/E47 BGF 05 55 + + + BGF 06 24 + - - BGF 13 10 + - - BGF 30 + - - BGF 24 26 + - - BGF 35 63 + - - BGF 51 + - - .sup.(1)+, the interaction was blocked; -, the interaction was not blocked.
[0437]The plasmids were isolated from these clones and either the nucleic acid sequence or the predicted peptide sequence of 4 of these clones was analyzed using the BLAST program available from NCBI.
[0438]The results of this analysis are represented in Table 4. Data indicate that we have isolated 6 specific peptide blockers of the interaction of SCL and E47 from a sample screen of a library containing 1ร106 independent clones, there being considerable sequence divergence observed between those peptides blockers. None of the peptide blockers identified was merely performing its native function. Based upon the frequency of peptide blockers identified per library clone, it is estimated that the method described herein is about 100-fold more efficient than a screen of a peptide aptamer library.
TABLE-US-00014 TABLE 4 Characterization of the antagonists of the SCL/E47 interaction Amino acid Nucleotide Nucleotide sequence of fusion sequence of Amino acid sequence of first peptide encoded by inserted nucleic sequence Genome from Protein deduced to be forward ORF in first forward ORF in acid fragment in encoded which fragment was encoded by fragment Clone clone clone clone by fragment isolated in native context (1) BGF 05 SEQ ID NO: 62 SEQ ID NO: 63 SEQ ID NO: 64 SEQ ID NO: 65 H. influenzae ฮฒ-ketoacyl-ACP synthase III BGF 06 SEQ ID NO: 66 SEQ ID NO: 67 SEQ ID NO: 68 SEQ ID NO: 69 A. aeolicus glutamyl-tRNA synthetase BGF 13 SEQ ID NO: 70 SEQ ID NO: 71 SEQ ID NO: 72 SEQ ID NO: 73 H. influenzae DNA repair protein (radA) BGF 24 SEQ ID NO: 74 SEQ ID NO: 75 SEQ ID NO: 76 SEQ ID NO: 77 T. maritima response regulator TM0143 BGF 35 SEQ ID NO: 78 SEQ ID NO: 79 SEQ ID NO: 80 SEQ ID NO: 81 H. influenzae beta-ketoacyl-ACP synthase III (fabH) (1) Native function was obtained by BLAST analysis of the nucleotide sequence of the nucleic acid fragment in each clone.
Example 4
The Construction of a Biodiverse Nucleic Acid Fragment Expression Library in the Vector T7Select415-1
[0439]Nucleic acid was isolated from the following bacterial species:
TABLE-US-00015 1 Archaeoglobus fulgidis 2 Aquifex aeliticus 3 Aeropyrum pernix 4 Bacillus subtilis 5 Bordetella pertussis TOX6 6 Borrelia burgdorferi 7 Chlamydia trachomatis 8 Escherichia coli Kl2 9 Haemophilus influenzae (rd) 10 Helicobacter pylori 11 Methanobacterium thermoautotrophicum 12 Methanococcus jannaschii 13 Mycoplasma pneumoniae 14 Neisseria meningitidis 15 Pseudomonas aeruginosa 16 Pyrococcus horikoshii 17 Synechosistis PCC 6803 18 Thermoplasma volcanium 19 Thermotoga maritima
[0440]Nucleic acid fragments were generated from each of these genomes using multiple consecutive rounds of PCR using tagged random oligonucleotides.
[0441]In the final round of PCR, the sequence of the oligonucleotide primer comprised the sequence:
TABLE-US-00016 (SEQ ID NO: 37) 5'-AGAGGAATTCAGGTCAGACTACAAGGACGACGACGACAAG-3'.
[0442]The PCR products generated were then used as a template for PCR reactions using the following oligonucleotides:
TABLE-US-00017 (SEQ ID NO: 38) 5'-CAGAAGCTTAAGGACGACGACGACAAG-3'; (SEQ ID NO: 39) 5'-CAGGAATTCAAGGACGACGACGACAAG-3'; (SEQ ID NO: 40) 5'-CAGGAATTCCAAGGACGACGACGACAAG-3'; and (SEQ ID NO: 41) 5'-CAGGAATTCACAAGGACGACGACGACAAG-3',
wherein the underlined sequence in SEQ ID Nos: 37-41 permits amplification of the PCR products. Furthermore, the sequence shown in bold highlights a HindIII restriction endonuclease recognition site or EcoRI recognition site. Furthermore, note the addition of one or two nucleotides after the EcoRI restriction site in SEQ ID Nos: 40 and 41, respectively (shown in italics). These nucleotides allow expression of amplified nucleic acid in multiple forward reading frames.
[0443]Each DNA template was amplified by "one armed" (ie. using only 1 oligonucleotide primer) PCR, with each of the oligonucleotides (ie., SEQ ID Nos: 38-41) in separate reactions (ie. 76 reactions).
[0444]Each PCR reaction contained:
TABLE-US-00018 Template DNA 1 ฮผl Taq buffer (10x) (Promega) 5 ฮผl MgCl2 (25 mM) 4 ฮผl dNTP (2 mM) 5 ฮผl a primer selected from the group consisting of 10 ฮผl SEQ ID Nos: 38-41 (10 pmol/ฮผl) Taq DNA polymerase (Promega 5 U/ฮผl) 0.4 ฮผl H2O to 50 ฮผl
[0445]Reactions were then cycled in a Perkin Elmer thermocycler PE 9700 or PE 2400 using the following program: [0446]5 min at 94ยฐ C., followed by 30 cycles wherein each cycle consists of 30 sec at [0447]94ยฐ C., followed by 30 sec at 55ยฐ C., and followed by 1 min at 72ยฐ C.], followed by 5 min at 72ยฐ C.
[0448]A sample of the resulting PCR products was analyzed by electrophoresis using a 2% agarose/TAE gel. The amount of nucleic acid in each of the PCR products was also determined using the picogreen method following instructions provided by the manufacturer.
[0449]PCR products generated with each of the oligonucleotides SEQ ID Nos: 38-41 were pooled. DNA from each organism was added in an equimolar amount when compared to the amount of nucleic acid added to the pool from the organism with the smallest genome.
[0450]Subsequently, the pools generated from PCR products amplified using the oligonucleotides SEQ ID NO: 39, SEQ ID NO: 40 or SEQ ID NO: 41 were combined in equal ratios (ie. equal amounts of nucleic acid) to form one pool.
[0451]The pooled PCR products were then purified using QIAquick PCR purification columns (QIAGEN) as per manufacturer's instructions. This step removes any unincorporated oligonucleotides, dNTPs and contaminating proteins.
[0452]Each of the pools of PCR products (6 ฮผg) was then divided into 3 equal parts and digested with one of the restriction enzymes AluI, HaeII or RsaI (NEB) in the following reaction:
TABLE-US-00019 PCR product (2 ฮผg) Restriction endonuclease buffer (10x) (NEB) 4 ฮผl Restriction endonuclease 1 ฮผl H2O to 40 ฮผl
[0453]Reactions were allowed to proceed for 2 hours at 37ยฐ C., before being heat inactivated by incubating at 65ยฐ C. for 20 minutes. Restriction digests were then re-pooled and purified using QIAquick PCR purification columns (QIAGEN) as per manufacturer's instructions.
[0454]Each of the enzymes AluI, HaeII and RsaI produce blunt ends. Accordingly, it is possible to ligate blunt end adaptors to the restriction digested PCR products to allow directional cloning into the T7Select415-1 vector. Oligonucleotides encoding the blunt-end adaptors were generated comprising the following sequences:
TABLE-US-00020 5'-AATTCGAACCCCTTCG-3' (SEQ ID NO: 42) 5'-CGAAGGGGTTCG-3' (SEQ ID NO: 43) 5'-AATTCGAACCCCTTCGC-3' (SEQ ID NO: 44) 5'-GCGAAGGGGTTCG-3' (SEQ ID NO: 45) 5'-AATTCGAACCCCTTCGCG-3' (SEQ ID NO: 46) 5'-CGCGAAGGGGTTCG-3' (SEQ ID NO: 47) 5'-AGCTCGAAGGGGTTCG-3' (SEQ ID NO: 48) 5'-CGAACCCCTTCG-3'. (SEQ ID NO: 49)
[0455]The adaptor pairs SEQ ID Nos: 42 and 43; SEQ ID Nos: 44 and 45; SEQ ID NOs: 46 and 47; SEQ ID NOs: 48 and 49 were then annealed to one another. This process was completed in H2O with each of the oligonucleotides at a concentration of 50 ฮผM. Pairs of adaptors were incubated at 94ยฐ C. for 10 minutes and then allowed to cool to room temperature slowly.
[0456]The annealed adaptors were then ligated to the pool of amplified PCR products in separate ligation reactions. The adaptor formed through annealing of SEQ ID NOs: 48 and 49 was ligated to the pool of PCR products amplified using the oligonucleotides set forth in SEQ ID NO: 39, SEQ ID NO: 40 and SEQ ID NO: 41.
[0457]Ligations were carried out in the following reactions:
TABLE-US-00021 Pooled PCR product (average length of 200 bp) 2 pmol Annealed adaptor 150 pmol Ligation buffer (10x) (Promega) 1 ฮผl T4 DNA ligase (3 U/ฮผl) (Promega) 1 ฮผl H2O to 10 ฮผl
[0458]Samples were then incubated at 4ยฐ C. overnight before being heat inactivated through incubation at 65ยฐ C. for 20 minutes.
[0459]Samples were then phosphorylated using T4 polynucleotide kinase (Promega) in the following reaction:
TABLE-US-00022 Ligation buffer (10x) (Promega) 1 ฮผl rATP (10 mM) 2 ฮผl T4 polynucleotide kinase (5 U/ฮผl) 1 ฮผl H2O 20 ฮผl
[0460]Samples were incubated at 37ยฐ C. for 30 minutes followed by incubation at 65ยฐ C. for 20 minutes to heat inactivate the T4 polynucleotide kinase.
[0461]Following ligation and phosphorylation each of the three reactions comprising nucleic acid amplified using the oligonucleotide SEQ ID NO: 38 were combined in equal ratios, ie. equal amounts of nucleic acid to form one pool.
[0462]The nucleic acids originally amplified with SEQ ID NO: 38 were then digested with the restriction endonuclease HindIII in the following reaction:
TABLE-US-00023 PCR product (2 ฮผg) HindIII buffer (10x) (Promega) 8 ฮผl HindIII (10 U/ฮผl) (Promega) 1 ฮผl H2O to 80 ฮผl
[0463]The nucleic acids in the pool originally amplified by one of SEQ ID Nos: 39-41 were digested with the restriction endonuclease EcoRI in the following reaction:
TABLE-US-00024 PCR product (2 ฮผg) EcoRI buffer (10x) (Promega) 8 ฮผl EcoRI (10 U/ฮผl) (Promega) 1 ฮผl H2O to 80 ฮผl
[0464]Samples were then purified using a QIAquick PCR purification column (QIAGEN) as per manufacturer's instructions. Nucleic acid concentration was then determined by spectrophotometry measuring UV absorption at 260 nm.
[0465]Both pools of nucleic acid fragments (ie. those digested with EcoRI and those digested with HindIII) were then combined in equal ratios, ie. equal amounts of nucleic acid, to form one pool. This pool of nucleic acid fragments was then suitable for cloning into the peptide display vector T7Select415-1 (Novagen). The T7415-1 vector is provided in a form for nucleic acids to be ligated into EcoRI and HindIII restriction endonuclease sites.
[0466]The nucleic acid fragments were then ligated into the T7Select415-1 vector using the following reaction:
TABLE-US-00025 Ligation buffer (10x) (Novagen) 0.5 ฮผl rATP (10 mM) 0.5 ฮผl DTT (10 mM) 0.5 ฮผl T7Select415-1 EcoRI/HindIII vector arms 1 ฮผl (0.02 pmol) Nucleic acid fragments (0; 0.02; and 0.06 pmol in independent reactions) H2O to 5 ฮผl
[0467]Reactions were incubated at 16ยฐ C. overnight.
Example 5
Packaging and Amplification of a Biodiverse Nucleic Acid Fragment Expression Library
[0468]The ligation reactions of Example 3 were packaged using commercial packaging extract available from Novagen. These reactions were then titered according to manufacturer's instructions by infection of E. coli BL21 cells. By using 1 ฮผl from each of three independent ligations, titers between 1.3ร107 and 7ร107 plaque forming units (pfu)/ml were obtained.
[0469]Pooling of three ligation reactions containing a total of 1 ฮผg of T7Select415-1 vector, and packaging, resulted in a library with 2.75ร107 pfu, ie 2.75ร1 initial recombination events. The library was immediately amplified by "plate lysate amplification" (as per manufacturer's instructions) on 180 LB Petri dishes (14 cm diameter). Titers of the amplified lysates varied between 1 and 5ร1010 pfu/ml. Two liters of lysate were harvested, pooled and the titer determined at 1.5ร1010 pfu/ml, ie 3ร1013 pfu in total. The lysate was stored at 4ยฐ C. over CHCl3 (as per manufacturer's instructions) and glycerol stocks containing 10% glycerol were stored at -80ยฐ C.
Example 6
Characterization of a T7-Displayed Biodiverse Nucleic Acid Fragment Library
[0470]During the amplification of the library described in Example 4, individual plaques from low-density plates were collected and analyzed by PCR with primers specific to T7Select415-1 of the nucleotide sequence.
[0471]Thirty nine plaques with insert sizes larger than 70 bp were analyzed by DNA sequence analysis. The resulting sequences are summarized in the Table 5
[0472]DNA from 13 of the 19 bacterial genomes could be identified in the recombinant phage analyzed. In most cases, the homology was between 96 and 100% in the regions that were derived from the genomic starting material. In addition, primers and adapters were identified, however, there were also many cases of strings of adapters and multiple PCR primers in the insert regions. The inserted DNA of the analyzed phage clones was up to 250 bp long.
TABLE-US-00026 TABLE 5 Characterization of nucleic acid fragments in T7Select-415-1 T7for/ Insert homology to organism Size of Extra amino Natural BGF rev PCR (% homology in the homologous Acids after reading clone fragment (bp) matching region) region (bp) Asn (T7) frame 8 255 B. pertussis (98%) 112 16 14 212 M. thermoautotrophicum (98%) 73 12 15 350 B. pertussis (98%) 171 0 16 263 A. fulgidus (100%) 125 20 18 260 A. fulgidus (100%) 112 0 31 260 A. fulgidus (96%) 118 65 yes 52 240 T. volcanicum (100%) 39 0 61 272 M. jannashii (100%) 90 12 65 230 N. meningiditis (100%) 107 0 73 230 C. trachomatis (98%) 62 10 83 200 B. burgdorferi (100%) 46 8 89 411 B. subtilis (98%) 170 15 100 268 P. aeruginosa 159 11 104 174 no match -- 12 125 250 E. coli K12 (98%) 109 4 126 220 E. coli K12 91 6 139 240 Synechocystis PCC 6803 (100%) 109 26 yes 141 250 E. coli Kl2 126 6 144 170 no match -- 15 152 160 E. coli K12 (100%) 39 13 153 290 C. trachomatis (100%) 131 7 163 260 C. trachomatis (100%) 90 5 166 270 E. coli Kl2 (100%) 112 20 169 240 M. thermoautotrophicum (100%) 112 6 10 180 no match -- 7 17 190 M. jannashii 68 13 20 190 E. coli K12 58 22 25 170 P. horikoshii 40 10 30 200 P. aeruginosa 54 13 40 190 no match -- 24 42 190 B. sublilis 44 0 44 250 B. burgdorferi 130 6 47 210 C. trachomatis 95 13 48 200 Synechocystis PCC 6803 82 20 55 180 no match -- 11 64 190 Synechocystis PCC 6803 46 16 82 180 M. thermoautotrophicum 39 8 87 250 No match -- 51 134 280 M. thermoautotrophicum
Example 7
Screening a T7 Phage Displayed Biodiverse Nucleic Acid Fragment Library for a Mimotope of FLAG
[0473]The library of Example 4 was screened to isolate phage displaying peptides that bound to monoclonal antibodies in a similar way as natural peptides would. The monoclonal antibody was adsorbed to a Petri dish and a lysate of the amplified phage library was allowed to bind to the antibody immobilised on the Petri dish. After rigorous washing to remove non-specifically bound phage, the remaining phage was eluted and amplified for additional rounds of selection.
[0474]Each Petri dish (Nunc, 3.5 cm diameter) was rinsed twice with distilled water. The target antibody in this case was a mouse monoclonal antibody to the FLAG epitope (ฮฑ-FLAG M2, Sigma Aldrich). The antibody was diluted in TBS buffer to 20 ฮผg/ml and 500 ฮผl was added per dish. The antibody was allowed to adsorb for 3 to 4 hours at room temperature or at 4ยฐ C. overnight. The dish was rinsed three times with TBS buffer and filled with 5% skim milk in distilled water. For blocking the skim milk solution was allowed to bind with gentle rocking for 1 hour at room temperature or at 4ยฐ C. overnight. The dish was rinsed five times with double distilled water (ddH20) and filled with ddH20 until use.
[0475]About 3ร1010 pfu to about 4ร1010 pfu of amplified T7 phage library (as described in Example 4) was added to the precoated and blocked Petri dish. The volume was increased to 0.5 ml with ddH20 and 10รTBS buffer to obtain 1รTBS as final concentration. For dilute phage suspensions the total volume can be raised to 1.5 ml without loss of binding, however the volume should be kept as small as possible to avoid spillage of phage. The phage suspension was allowed to bind with gentle rocking for 5 hours at room temperature or at 4ยฐ C. overnight. The phage suspension was discarded and the dish was washed twice with TBS buffer containing Tween-20. TBS-Tween (1 ml) was added to the dish, and the dish incubated for 10 minutes with gentle shaking. This wash step was repeated twice more, without shaking. Bound phage were eluted with 0.5 ml of 1% SDS. The 1% SDS was added to the plates and the plates incubated for 30 minutes with gentle shaking. The eluate was transferred into a reaction tube and the phage titer determined.
[0476]For further rounds of biopanning the eluate was amplified in a 10-40 ml culture. A fresh culture of E. coli BL21 in LB medium was grown at 37ยฐ C. to an optical density of 0.5 and infected 1:200 with eluate. The culture was shaken at 37ยฐ C. for 1 to 2 hours until lysis was observed. The culture was centrifuged at 8000 g for 10 minutes at 4ยฐ C. to pellet remaining E. coli cells and cell debris. The supernatant was transferred into a fresh tube, titered and stored over CHCl3 at 4ยฐ C. until use.
[0477]Three consecutive rounds of biopanning were completed and a binding rate for each round was determined. These binding rates are described in Table 6 below:
TABLE-US-00027 TABLE 6 Panning antibody Round Input (pfu) Output (pfu Binding rate ฮฑFLAG ab 1 4 ร 109 5.5 ร 105 0.014 ฮฑFLAG ab 2 4 ร 109 2.3 ร 108 5.7 ฮฑFLAG ab 3 4 ร 109 1.6 ร 109 40
[0478]The binding rate increased from 0.014% in the first round of biopanning to 40% in the third round indicating enrichment of T7 phage clones with a specificity for the panning antibody. Ten individual plaques from each round of biopanning were grown up and analyzed by TRF ELISA with a FLAG antibody coated wells (100 ng/well). Sixty percent of the clones from the first two rounds and 90% of the clones from the third round of biopanning showed a strong positive signal (FIG. 11). The same clones were tested in an ELISA coated with a monoclonal antibody to papain (3D5) and showed no significant signal. This indicates that the isolated phage clones were specific to the ฮฑ-FLAG antibody.
[0479]As a positive control, oligonucleotides were designed to generate a DNA fragment with EcoRI and HindIII overhangs for cloning into T7Select415-1 EcoRI/HindIII vector arms, in addition to encoding the FLAG epitope (AspTyrLysAspAspAspAspLys; SEQ ID NO: 50). These oligonucleotides comprised the sequences:
TABLE-US-00028 (SEQ ID NO: 51) 5'-AATTCCGACTACAAGGACGACGATGACAAGA-3' (SEQ ID NO: 52) 5'-AGCTTCTTGTCATCGTCGTCCTTGTAGTCGG-3'
[0480]The oligonucleotides comprising SEQ ID NO: 51 and SEQ ID NO: 52 were allowed to anneal as previously described before being ligated into the T7Select415-1 EcoRI/HindIII vector arms as described in Example 3.
[0481]FIG. 11 shows the binding of phage-displayed peptides to the ฮฑ-FLAG antibody using time resolved fluorescence analysis using a europium detection system.
Example 8
Screening a T7 Phage Displayed Biodiverse Nucleic Acid Fragment Library for a Mimotope of the Pollen Antigen DerpI
[0482]The library of Example 4 is screened to isolate phage-displaying peptides, which bind to a monoclonal antibody to the major dustmite allergen DerpI, in a similar way as the natural peptide would. The monoclonal antibody is adsorbed to a Petri dish and a lysate of the amplified phage library allowed to bind to the antibody immobilised on the Petri dish. After rigorous washing to remove non-specifically bound phage, the remaining phage is eluted and amplified for additional rounds of selection.
[0483]Each Petri dish (Nunc, 3.5 cm diameter) is rinsed twice with distilled water. The target antibody in this case is a mouse monoclonal antibody that binds to the dust mite allergen Der PI (Chapman et al, Journal of Immunology, 133(5), 2488-2495, 1984). The antibody is diluted in TBS buffer and allowed to adsorb for 3 to 4 hours at room temperature. The dish is then rinsed three times with TBS buffer. Dishes are blocked overnight at 4ยฐ C. with 5% skim milk in distilled water, before being rinsed five times with double distilled water (ddH20) and filled with ddH20 until use.
[0484]About 3ร1010 pfu to about 4ร1010 pfu of amplified T7 phage library (as described in Example 4) is added pre-prepared Petri dish and the volume increased to 0.5 ml with TBS to obtain 1รTBS as final concentration. The phage suspension is allowed to bind with gentle rocking at 4ยฐ C. overnight. The dish is washed twice with TBS buffer containing 0.1% Tween-20. 1 ml of TBS-Tween is added to the dish, and the dish incubated for 10 minutes with gentle shaking. This is repeated twice more. 1% SDS is added to elute any bound phage.
[0485]For further rounds of biopanning the eluate is amplified in a 10-40 ml culture. A fresh culture of E. coli BL21 in LB medium is grown at 37ยฐ C. to an optical density of 0.5 at and infected 1:200 with eluate. The culture is shaken at 37ยฐ C. for 1 to 2 hours until lysis was observed. The culture is then centrifuged at 8000 g for 10 minutes at 4ยฐ C. to pellet remaining E. coli cells and cell debris. The supernatant is then transferred into a fresh tube, titered and stored over CHCl3 at 4ยฐ C. until use.
Example 9
Development and Screening of a Biodiverse Nucleic Acid Fragment Library for Anti-Parasitic Peptides in Drug Resistant C. elegans
[0486]The modified biodiverse nucleic acid fragment library developed in Example 4 is digested with the restriction enzymes EcoRI and HindIII in the following reaction:
TABLE-US-00029 Biodiverse nucleic acid fragment library (3 ฮผg) EcoRI buffer (10x) (Promega) 8 ฮผl BSA (10x) 8 ฮผl EcoRI (20 U/ฮผl) (Promega) 3 ฮผl HindIII (10 U/ฮผl) (Promega) 3 ฮผl H2O to 80 ฮผl
[0487]Reactions proceed at 37ยฐ C. for 2 hours, before enzymes are heat inactivated by incubating the reactions at 65ยฐ C. for 20 minutes. Reactions are then electrophoresed in a 2% TAE/agarose gel and the bands relating to the nucleic acid fragments isolated using a QIAquick gel extraction kit (QIAGEN).
[0488]At the same time the pGEMEX-1 bacterial expression vector (Promega) is also digested with EcoRI and HindIII in the following reaction:
TABLE-US-00030 pGEMEX-1 (2 ฮผg) EcoRI buffer (10x) (Promega) 3 ฮผl BSA (10x) 3 ฮผl EcoRI (20 U/ฮผl) (Promega) 1 ฮผl HindIII (10 U/ฮผl) (Promega) 1 ฮผl H2O to 30 ฮผl
[0489]Reactions are allowed to proceed at 37ยฐ C. for 2 hours, before enzymes are heat inactivated by incubating the reactions at 65ยฐ C. for 20 minutes. Reactions are then electrophoresed in a 2% TAE/agarose gel and the bands relating to the nucleic acid fragments isolated using a QIAquick gel extraction kit (QIAGEN).
[0490]Nucleic acid concentration is then determined by spectrophotometry measuring UV absorption at 260 nm.
[0491]The biodiverse nucleic acid fragments are then ligated into the pGEMEX-1 vector in the following reaction:
TABLE-US-00031 pGEMEX-1 (1 ฮผg) BGF-PCR Fragments (1 ฮผg) Ligation Buffer (10x) (NEB) 20 ฮผl T4 polynucleotide kinase (5 U/ฮผl) 10 ฮผL H20 to 200 ฮผl
[0492]Ligation reactions are allowed to proceed overnight at 16ยฐ C. The ligase is then heat inactivated by incubating the samples at 65ยฐ C. for 30 minutes. Following completion of the ligation reaction sample volumes are increased to 500 ฮผl with TE buffer and added to an Amicon spin column. These columns are then centrifuged for 15 minutes at 3,800 rpm in a microcentrifuge. Columns are inverted and 30 ฮผl of TE buffer is added before the columns are centrifuged for 2 minutes at 3,800 rpm, with this fraction collected for later use.
[0493]The pGEMEX-1 vector containing the biodiverse nucleic acid fragment is then transformed into E. Coli TOP10 cells.
[0494]Individual colonies of bacteria are then individually picked and plated onto a master plate of LB-agar+ampicillin (50 ฮผg/ml). 100 colonies from each plate are grown in a flask containing 10 ml LB broth until confluent. Approximately 5 drops of the broth is then added to a 9 cm plate containing NG agar (as described in Sulston and Hodgkin (In: The Nematode Caenorhibditis elegans, Cold Spring Harbour Laboratories, New York, 1988)), and gently spread to cover approximately two thirds of the surface area of the agar. These plates are then incubated at 37ยฐ C. overnight or until a bacterial lawn is observed. These plates are then useful for the growth of C. elegans, which feed on the bacterial cells and take up any expressed peptides into their cells. C. elegans provides a model system for testing an effect of a peptide expressed by an isolated clone of the expression library in vivo, eg., in target validation.
[0495]The model system described in Dent et al, Proc. Natl. Acad. Sci. USA 97, 2674-267, 1999, showed that C. elegans is able to develop resistance to the anti-parasitic antibiotic ivomectin, through mutation of the genes avr-14, avr-15 and glc-1. Such a peptide proves invaluable for the screening of anti-parasitic peptides that act through a pathway that is not affected by these genes.
[0496]Approximately 400-500 L4 stage or adult stage C. elegans worms that are resistant to ivomectin are seeded onto the plates containing 2 ฮผg/ml Ivomectin (which is not toxic to the mutant strain) and the bacteria expressing an expression library of the present invention. Plates are incubated at 25ยฐ C. and scored for live worms every 4-6 hours. A worm is considered dead when it no longer responds to touch.
[0497]Plates are scored to determine those that contain a significant portion of dead C. elegans, excluding those that have stuck to the side wall. Those plates that have the majority of worms dead are further analyzed.
[0498]In further analyzing the peptides that kill the ivomectin resistant worms, single bacterial colonies are used to generate the feeder layer for the worms. An individual colony is picked and grown in a flask containing 10 ml LB broth at 37ยฐ C. shaking at 225 rpm, until confluent. Approximately 5 drops of the broth is then added to a 9 cm plate containing NG agar (with 2 ฮผg/ml ivomectin) and gently spread to cover approximately two thirds of the surface area of the agar. Plates are again incubated at 37ยฐ C. overnight or until a bacterial lawn is observed.
[0499]Again resistant C. elegans are seeded onto the plates which are incubated at 25ยฐ C. and scored for live worms every 4-6 hours. Bacteria are isolated from those plates containing a significant proportion of dead worms, and cultured for 16 hours in 10 ml LB broth (+50 ฮผg/ml ampicillin). The expression plasmids are then isolated using a QIAprep spin miniprep kit (QIAGEN) using the method described by the manufacturer. Isolated plasmids are then further analyzed to determine the nucleotide sequence that encodes the peptide that is toxic to ivomectin resistant C. elegans.
Example 10
Development and Screening of a Biodiverse Nucleic Acid Fragment Library from Takifigu rubripes
[0500]Nucleic acid fragments are generated from genomic DNA from the Japanese puffer fish T. rubripes using a restriction enzyme digestion with the enzymes AluI and HaeIII, in the following reaction:
TABLE-US-00032 Genomic DNA (20 ฮผg) Restriction enzyme buffer (10x) 5 ฮผl AluI(XXU/ฮผg) 4 ฮผl HaeIII(XXU/ฮผg) 4 ฮผl H2O to 50 ฮผl
[0501]The DNA fragments are then separated by electrophoresis using a 2% agarose/TAE gel. Fragments in the 90-120 bp range are isolated using the QIAquick Gel Extraction Kit (QIAGEN) following manufacturer's instructions.
[0502]The concentration of DNA is determined using spectrophotometry at 260 nm.
[0503]The adaptor pairs SEQ ID Nos: 42 and 43; SEQ ID Nos: 44 and 45; SEQ ID NOs: 46 and 47; SEQ ID NOs: 48 and 49 are then annealed to one another. This process is completed in H2O with each of the oligonucleotides at a concentration of 50 ฮผM. Pairs of adaptors are incubated at 94ยฐ C. for 10 minutes and then allowed to cool to room temperature slowly.
[0504]The annealed adaptors are then ligated to the isolated nucleic acid fragments in separate ligation reactions.
[0505]Ligations are carried out in the following reactions:
TABLE-US-00033 Pooled PCR product (average fragment length of 100 bp) 2 pmol Annealed adaptor 150 pmol Ligation buffer (10x) (Promega) 1 ฮผl T4 DNA ligase (3 U/ฮผl) (Promega) 1 ฮผl H2O to 10 ฮผl
[0506]Samples are then incubated at 4ยฐ C. overnight before being heat-inactivated through incubation at 65ยฐ C. for 20 minutes.
[0507]Samples are phosphorylated using T4 polynucleotide kinase (Promega) in the following reaction:
TABLE-US-00034 Ligation buffer (10x) (Promega) 1 ฮผl rATP (10 mM) 2 ฮผl T4 polynucleotide kinase (5 U/ฮผl) 1 ฮผl H2O 20 ฮผl
[0508]Samples are incubated at 37ยฐ C. for 30 minutes followed by incubation at 65ยฐ C. for 20 minutes to heat inactivate the enzyme.
[0509]Nucleic acid fragments from each of the ligation reactions are then combined in equal ratios, ie. equal amounts of nucleic acid, to form one pool. This pool of nucleic acid fragments is then suitable for cloning into the peptide display vector T7Select415-1 (Novagen). However, it is first necessary to digest the T7Select415-1 vector with EcoRI in the following reaction:
TABLE-US-00035 T7Select415-1 vector (1 ฮผg) EcoRI buffer (10x) (Promega) 3 ฮผl BSA (10x) 3 ฮผl EcoRI (20 U/ฮผl) (Promega) 2 ฮผl H2O to 30 ฮผl
[0510]Reactions proceed at 37ยฐ C. for 2 hours, before enzymes are heat inactivated by incubating the reactions at 65ยฐ C. for 20 minutes. Samples are then purified using a QIAquick PCR purification column using manufacturer's instructions. Nucleic acid concentration are then determined by spectrophotometry measuring UV absorption at 260 nm, before diluting the DNA to a final concentration of 0.02 ฮผM.
[0511]The nucleic acid fragments are then ligated into the T7Select415-1 vector using the following reaction:
TABLE-US-00036 Ligation buffer (10x) (Novagen) 0.5 ฮผl rATP (10 mM) 0.5 ฮผl DTT (10 mM) 0.5 ฮผl T7Select415-1 (0.02 pmol) 1 ฮผl Nucleic acid fragments (0; 0.02; and 0.06 pmol in independent reactions) H2O to 5 ฮผl
[0512]Reactions are incubated at 16ยฐ C. overnight. Samples are then purified using a QIAquick PCR purification column (QIAGEN), before being diluted in 1 ml of phosphate buffered saline.
[0513]The library generated from T. rubripes is then screened for mimotopes of epitopes of the D15 protein. The D15 protein is a 80 kDa outer membrane protein of Haemophilus influenzae, which are shown to elicit an immune response in rabbits. The antibodies isolated from these rabbits, in turn, are shown to confer resistance to H. influenzae to infant rats. Affinity-purified antibodies isolated from rabbits have also been shown to be protective in screens using infant rats (Thomas et al, Infect Immunol, 58(6), 1909-1915, 1990).
[0514]In an attempt to identify mimotopes of epitopes of the D15 protein, the phage displayed library generated from T. rubripes, is screened for those peptides that have a conformation sufficient for binding the affinity purified antibody described in Thomas et al (1990).
[0515]The phage display library is added to the affinity purified antibody, which is linked to an antibody coated goat anti-rabbit coupled magnetic beads. These beads are generated by incubating 10 ฮผg of the antibody with 5 mg Dynal beads and incubating at 25ยฐ C. for 1 hour, followed by 6 washes with HEG buffer (35 mM HEPES-KOH, pH 7.5/0.1 mM EDTA/100 mM sodium glutamate).
[0516]Phage are incubated with these beads at 0ยฐ C. for 1 hour, before being washing three times with 5 ml cold HEG buffer/0.1% BSA. Beads are then washed a further three times with HEG buffer using a magnet, such as a tesla magnet (Miltenyi Biotec, Bergish Gladbach, Germany) to immobilise the beads. Bound phage are then eluted with 0.5 ml of 1% SDS. Phage isolated by this method are re-screened, or, alternatively, the nucleic acid fragments encoding the binding peptide are isolated from the phage and analyzed. For example, the amino acid sequences of the peptides are determined.
Example 11
Construction of a Biodiverse Nucleic Acid Fragment for Ribosome Display
[0517]Nucleic acid is isolated from the following bacterial species:
TABLE-US-00037 1 Archaeoglobus fulgidis 2 Aquifex aeliticus 3 Aeropyrum pernix 4 Bacillus subtilis 5 Bordetella pertussis TOX6 6 Borrelia burgdorferi 7 Chlamydia trachomatis 8 Escherichia coli Kl2 9 Haemophilus influenzae (rd) 10 Helicobacter pylori 11 Methanobacterium thermoautotrophicum 12 Methanococcus jannaschii 13 Mycoplasma pneumoniae 14 Neisseria meningitidis 15 Pseudomonas aeruginosa 16 Pyrococcus horikoshii 17 Synechosistis PCC 6803 18 Thermoplasma volcanium 19 Thermotoga maritima
[0518]Nucleic acid fragments are generated from each of these genomes using 4 consecutive rounds of PCR using tagged random oligonucleotides with the sequence:
TABLE-US-00038 (SEQ ID NO: 53) 5'TTTCCCGAATTGTGAGCGGATAACAATAGAAATAATTTTGTTTAACTT TAAGAAGGAGATATATCCATGGACTACAAAGAN93'.
[0519]This oligonucleotide introduces a ribosome binding site.
[0520]In order to complete this the following reagents are added to the samples:
TABLE-US-00039 Genomic DNA (100-200 ng) Oligonucleotide comprising 4 ฮผl SEQ ID NO: 53 (25 ฮผM) Klenow Buffer 1 ฮผl dNTP (2 mM) 3 ฮผl Klenow 0.5 ฮผl H2O to 40 ฮผl
[0521]Samples are incubated at 15ยฐ C. for 30 minutes, then at room temperature for 2 hours, before being heated to 37ยฐ C. for 15 minutes.
[0522]Samples are boiled for 5 minutes to again denature the nucleic acid in said sample, before being snap cooled to allow renaturation of said nucleic acid. Another 0.5111 of the Klenow fragment of E. coli DNA polymerase I is added to each reaction, and the samples incubated at 15ยฐ C. for 30 minutes, then at room temperature for 2 hours, before being heated to 37ยฐ C. for 15 minutes.
[0523]The PCR products generated are then used as a template for PCR reactions using the following oligonucleotide:
TABLE-US-00040 (SEQ ID NO: 54) 5'GGGGCCAAGCAGTAATAATACGAGTCACTATAGGGAGACCACAAC GGTTTCCCGAATTGTG-3'.
[0524]This oligonucleotide comprises a T7 promoter and a region that is homologous a region of to SEQ ID NO: 53).
[0525]Each DNA template is amplified by "one armed" PCR, with the oligonucleotide SEQ ID NO: 54 in separate reactions (ie. 19 reactions). Each PCR reaction contains the following:
TABLE-US-00041 Template DNA 1 ฮผl Taq buffer (10x) (Promega) 5 ฮผl MgCl2 (25 mM) 4 ฮผl dNTP (2 mM) 5 ฮผl Oligonucleotide comprising SEQ ID NO: 54 10 ฮผl (10 pmol/ฮผl) Taq DNA polymerase (Promega 5 U/ฮผl) 0.4 ฮผl H2O to 50 ฮผl
[0526]Reactions are then cycled in a Perkin Elmer thermocycler PE 9700 or PE 2400 using the following program: [0527]5 min 94ยฐ C.+30ร[30 sec 94ยฐ C., 30 sec. 55ยฐ C., 1 min 72ยฐ C.]+5 min 72ยฐ C.
[0528]The resulting PCR products are electrophoresed using a 2% agarose/TAE gel, and the nucleic acid fragments between 50 bp to 250 bp extracted using a QIAquick gel extraction kit (QIAGEN) using manufacturer's instructions. Nucleic acid concentration is determined by spectrophotometry measuring UV absorption at 260 nm.
[0529]Pools of PCR products derived from each of the 19 bacterial species are produced. To do so, DNA from each organism is added in an equimolar amount when compared to the amount of nucleic acid added to the pool from the organism with the smallest genome.
[0530]Nucleic acid fragments are then blunt ended using Munga Bean Nuclease (NEB) in the following reaction:
TABLE-US-00042 Nucleic acid fragments (2 ฮผg) Mung bean nuclease buffer (10x) 3 ฮผl Mung bean nuclease (10 U/ฮผl)(NEB) 2 ฮผl H2O to 30 ฮผl
[0531]The reaction proceeds at 30ยฐ C. for 1 hour. The sample is then purified using a QIAquick PCR purification column (QIAGEN) as per manufacturer's instructions.
[0532]Oligonucleotides encoding a blunt-end adaptor are generated comprising the following sequences:
TABLE-US-00043 5'-TTTAAGCAGCTCGATAGCAGCAC-3'; (SEQ ID NO: 55) and 5'-GTGCTGCTATCGAGCTGCTTAAA-3'. (SEQ ID NO: 56)
[0533]The adaptors are annealed to one another. This process is completed in H2O with each of the oligonucleotides at a concentration of 50 ฮผM. Pairs of adaptors are incubated at 94ยฐ C. for 10 minutes and then allowed to cool to room temperature slowly. Annealed adaptors are ligated to the nucleic acid fragments in the following reactions:
TABLE-US-00044 Pooled PCR product (average length of 150 bp) 2 pmol Annealed adaptor 150 pmol Ligation buffer (10x) (Promega) 1 ฮผl T4 DNA ligase (3 U/ฮผl) (Promega) 1 ฮผl H2O to 10 ฮผl
[0534]Samples are then incubated at 4ยฐ C. overnight before being heat inactivated through incubation at 65ยฐ C. for 20 minutes. The ligation reaction is then purified using a QIAquick PCR purification kit (QIAGEN)
[0535]The modified nucleic acid fragments are then amplified in a PCR reaction with oligonucleotides of the sequence SEQ ID NO: 54 and the following sequence: 5'AGACCCGTTTAGAGGCCCCAAGGGGTTATGGAATTCACCTTTAAGCAGCT C-3' (SEQ ID NO: 57). The oligonucleotide of SEQ ID NO: 57 introduces a modified lipoprotein terminator with the stop codon removed.
[0536]The PCR reactions are completed in the following reaction:
TABLE-US-00045 Template DNA 1 ฮผl pfu buffer (10x) (Promega) 5 ฮผl MgCl2 (25 mM) 4 ฮผl dNTP (2 mM) 5 ฮผl oligonucleotide SEQ ID NO: 54 (10 pmol/ฮผl) 10 ฮผl oligonucleotide SEQ ID NO: 57 (10 pmol/ฮผl) 10 ฮผl pfu DNA polymerase (Promega 5 U/ฮผl) 0.4 ฮผl H2O to 50 ฮผl
[0537]The PCR reactions are completed with the following cycling conditions: [0538]5 min 94ยฐ C.+30ร[30 sec 94ยฐ C., 30 sec. 55ยฐ C., 1 min 72ยฐ C.]+5 min 72ยฐ C.
[0539]PCR products are then purified using a QIAquick PCR purification column (QIAGEN).
[0540]In a separate reaction the amino acids 211-299 of gene III of filamentous phage M13 are amplified using the following oligonucleotides:
TABLE-US-00046 (SEQ ID NO: 58) 5'-CGTGAAAAAATTATTATTCGCAATTC-3' (SEQ ID NO: 59) 5'-TTAAGACTCCTTATTACGCAGTATGTTAGC-3'
[0541]The oligonucleotide SEQ ID NO: 58 is phosphorylated using T4 polynucleotide kinase (Promega), to allow for later directional cloning of the PCR product. The phosphorylation proceeds in the following reaction:
TABLE-US-00047 Oligonucleotide (SEQ ID NO: 58) Ligation buffer (10x) (Promega) 1 ฮผl rATP (10 mM) 2 ฮผl T4 polynucleotide kinase (5 U/ฮผl) 1 ฮผl H2O 20 ฮผl
[0542]Samples are incubated at 37ยฐ C. for 30 minutes followed by incubation at 65ยฐ C. for 20 minutes to heat inactivate the T4 polynucleotide kinase.
[0543]The oligonucleotides are then used in the following PCR reaction:
TABLE-US-00048 Template DNA 1 ฮผl pfu buffer (10x) (Promega) 5 ฮผl MgCl2 (25 mM) 4 ฮผl dNTP (2 mM) 5 ฮผl oligonucleotide SEQ ID NO: 58 (10 pmol/ฮผl) 10 ฮผl oligonucleotide SEQ ID NO: 59 (10 pmol/ฮผl) 10 ฮผl pfu DNA polymerase (Promega 5 U/ฮผl) 0.4 ฮผl H2O to 50 ฮผl
[0544]Reactions are then cycled in a Perkin Elmer thermocycler PE 9700 or PE 2400 using the following program: [0545]5 min 94ยฐ C.+30ร[30 sec 94ยฐ C., 30 sec. 59ยฐ C., 1 min 72ยฐ C.]+5 min 72ยฐ C.
[0546]Reactions are electrophoresed in a 2% TAE/agarose gel and the 1276 bp fragment isolated using a QIAquick gel purification kit (QIAGEN).
[0547]The modified nucleic acid fragments and the spacer sequence isolated from M13 phage are then ligated in the following reaction:
TABLE-US-00049 Modified nucleic acid fragment (2 ฮผg) Spacer (2 ฮผg) Ligation buffer (10x) (Promega) 2 ฮผl T4 DNA ligase (3 U/ฮผl) (Promega) 1 ฮผl H2O to 20 ฮผl
[0548]Samples are then incubated at 4ยฐ C. overnight before being heat inactivated through incubation at 65ยฐ C. for 20 minutes. The ligation reaction is then purified using a QIAquick PCR purification kit (Qiagen)
[0549]The resulting gene constructs are transcribed and translated in vitro using the Promega E. coli S 30 Extract system for linear templates as per manufacturer's instructions, which are a modification of the protocol of Leslie et al, J. Biol. Chem. 266, 2632-1991.
[0550]The translation reaction is stopped by adding magnesium acetate [Mg(OAc)2] to a final concentration of 50 mM, chloroamphenicol to a final concentration of 50 ฮผM and cooling the samples on ice. The samples are then diluted 8 fold with ice-cold wash buffer (50 mM Tris-HOAc, pH7.5/150 mM NaCl/50 mM Mg(Oac)2/0.1% Tween 20) and centrifuged for 5 minutes at 4ยฐ C. at 100,000 g to remove any insoluble components.
[0551]The in vitro displayed library is then screened to isolate peptides that bind to ฮฑ-FLAG monoclonal antibody. The monoclonal antibody is first adsorbed to a microtiter plate. Each well of a microtiter plate is rinsed twice with distilled water. The ฮฑ-FLAG monoclonal antibody (ฮฑ-FLAG M2, Sigma Aldrich) is diluted in TBS buffer to 20 ฮผg/ml and 100 ฮผl added per well. The antibody is allowed to adsorb at 4ยฐ C. overnight. The microtiter plate is then rinsed three times with TBS buffer and filled with 5% skim milk in distilled water. For blocking the skim milk solution is allowed to bind with gentle rocking for 1 hour at room temperature. The dish is then rinsed five times with double distilled water (ddH20) and filled with ddH20 until use.
[0552]Prior to use, each well of the microtiter plate is washed with ice-cold wash buffer, and the supernatant from the centrifuged translation mixture applied (200 ฮผl per well). The plate is then gently rocked for 1 hour at room temperature. Each well of the microtiter plate is then washed with ice-cold wash buffer five times, and the bound ribosome displayed peptides eluted using ice cold elution buffer (50 mM Tris-HOAc, pH7.5/150 mM NaCl/10 mM EDTA/50 ฮผg/ml E. coli tRNA). Elution buffer (100 ฮผl) is added per well, and the plates gently rocked for 10 minutes at 4ยฐ C. The released mRNA is recovered using the RNeasy kit (QIAGEN) using manufacturer's instructions.
[0553]Recovered mRNAs are then reverse transcribed using Superscript reverse transcriptase (Invitrogen) according to manufacturer's instructions. The positive nucleic acid fragments are then amplified using PCR with the oligonucleotides (very first ones without random bases). PCR products are electrophoresed in a 2% TAE/agarose gel and the PCR products recovered using QIAquick gel extraction kit. Recovered nucleic acids are then sequenced using a Big Dye Terminator system (Perkin Elmer).
Example 12
Compatibility of S. aureus and E. coli Infected with T7 Growing on Solid Media in Close Proximity
[0554]Initial tests are carried out to establish whether the growth of an E. coli lawn containing T7 bacteriophage plaques is generally inhibitory to the growth of a lawn of S. aureus on top of a semipermeable membrane laid down on top of the phage overlay. The results of this assay suggested that both the E. coli/T7 culture, and the S. aureus culture are able to grow without any apparent interference. Accordingly, this assay format is utilised in determining those peptides that demonstrate antibacterial properties.
Sequence CWU
1
8116DNAArtificial Sequencemisc_feature2, 3n = A,T,C or G 1rnnatg
628DNAArtificial
Sequencesynthetic Kozak consensus sequence 2ccrccatg
8311DNAArtificial
Sequencesynthetic Kozak consensus sequence 3gccagccatg g
1148DNAArtificial
Sequencesynthetic Kozak consensus sequence 4ctaccatg
8510DNAArtificial
Sequencesynthetic Shine Dalgarno sequence 5gaagaagata
1067DNAArtificial
Sequencesynthetic translational slippage sequence 6aaaaaac
777DNAArtificial
Sequencesynthetic translational slippage sequence 7aaattta
787DNAArtificial
Sequencesynthetic translational slippage sequence 8aaatttt
797DNAArtificial
Sequencesynthetic translational slippage sequence 9gggaaac
7107DNAArtificial
Sequencesynthetic translational slippage sequence 10gggcccc
7117DNAArtificial
Sequencesynthetic translational slippage sequence 11gggttta
7127DNAArtificial
Sequencesynthetic translational slippage sequence 12gggtttt
7137DNAArtificial
Sequencesynthetic translational slippage sequence 13tttaaac
7147DNAArtificial
Sequencesynthetic translational slippage sequence 14tttaaat
7156DNAArtificial
Sequencesynthetic translational slippage sequence 15ttttta
6167DNAArtificial
Sequencesynthetic translational slippage sequence 16ggattta
7177DNAArtificial
Sequencesynthetic translational slippage sequence 17cttaggc
7187DNAArtificial
Sequencesynthetic translational slippage sequence 18gcgagtt
7197DNAArtificial
Sequencesynthetic translational slippage sequence 19tcctgat
7207DNAArtificial
Sequencesynthetic translational slippage sequence 20aaaaaag
7217DNAArtificial
Sequencesynthetic translational slippage sequence 21aaaaaaa
7227DNAArtificial
Sequencesynthetic translational slippage sequence 22aaaaaac
7237DNAArtificial
Sequencesynthetic translational slippage sequence 23gggaaag
7247DNAArtificial
Sequencesynthetic translational slippage sequence 24aaaaggg
7257DNAArtificial
Sequencesynthetic translational slippage sequence 25gggaaaa
7267DNAArtificial
Sequencesynthetic translational slippage sequence 26tttaaag
7277DNAArtificial
Sequencesynthetic translational slippage sequence 27aaagggg
7283DNAArtificial
Sequencesynthetic translational slippage sequence 28ctt
32917PRTDrosophila 29Cys Arg
Gln Ile Lys Ile Trp Phe Gln Asn Arg Arg Met Lys Trp Lys 1 5
10 15Lys3021PRTArtificial
Sequencesynthetic Pep1 peptide 30Lys Glu Thr Trp Trp Glu Thr Trp Trp Thr
Glu Trp Ser Gln Lys Lys 1 5 10
15Lys Lys Arg Lys Val 20315DNAArtificial
Sequencesynthetic initiator sequence recognized by P2A protein
31tcgga
5325PRTArtificial Sequencesynthetic membrane anchor sequence 32Pro Asp
Gly Phe Arg 1 53346DNAArtificial Sequencemisc_feature41,
42, 43, 44, 45, 46n = A,T,C or G 33gactacaagg acgacgacga caaggcttat
caatcaatca nnnnnn 463449DNAArtificial
Sequencemisc_feature41, 42, 43, 44, 45, 46, 47, 48, 49n = A,T,C or G
34gactacaagg acgacgacga caaggcttat caatcaatca nnnnnnnnn
493540DNAArtificial Sequencesynthetic oligonucleotide primer 35gagagaattc
aggtcagact acaaggacga cgacgacaag
40365562DNAArtificial Sequencesynthetic pDEATH-TRYP vector 36ctagcgattt
tggtcatgag atcagatcaa cttcttttct ttttttttct tttctctctc 60ccccgttgtt
gtctcaccat atccgcaatg acaaaaaaat gatggaagac actaaaggaa 120aaaattaacg
acaaagacag caccaacaga tgtcgttgtt ccagagctga tgaggggtat 180ctcgaagcac
acgaaacttt ttccttcctt cattcacgca cactactctc taatgagcaa 240cggtatacgg
ccttccttcc agttacttga atttgaaata aaaaaaagtt tgctgtcttg 300ctatcaagta
taaatagacc tgcaattatt aatcttttgt ttcctcgtca ttgttctcgt 360tccctttctt
ccttgtttct ttttctgcac aatatttcaa gctataccaa gcatacaatc 420aactccaagc
ttccccggat cggactacta gcagctgtaa tacgactcac tatagggaat 480attaagctca
ccatgggtaa gcctatccct aaccctctcc tcggtctcga ttctacacaa 540gctatgggtg
ctcctccaaa aaagaagaga aaggtagctg aattcgagct cagatctcag 600ctgggcccgg
taccaattga tgcatcgata ccggtactag tcggaccgca tatgcccggg 660cgtaccgcgg
ccgctcgagg catgcatcta gagggccgca tcatgtaatt agttatgtca 720cgcttacatt
cacgccctcc ccccacatcc gctctaaccg aaaaggaagg agttagacaa 780cctgaagtct
aggtccctat ttattttttt atagttatgt tagtattaag aacgttattt 840atatttcaaa
tttttctttt ttttctgtac agacgcgtgt acgcatgtaa cattatactg 900aaaaccttgc
ttgagaaggt tttgggacgc tcgaaggctt taatttgcgg ccctgcatta 960atgaatcggc
caacgcgcgg ggagaggcgg tttgcgtatt gggcgctctt ccgcttcctc 1020gctcactgac
tcgctgcgct cggtcgttcg gctgcggcga gcggtatcag ctcactcaaa 1080ggcggtaata
cggttatcca cagaatcagg ggataacgca ggaaagaaca tgtgagcaaa 1140aggccagcaa
aagcccagga accgtaaaaa ggccgcgttg ctggcgtttt tccataggct 1200ccgcccccct
gacgagcatc acaaaaatcg acgctcaagt cagaggtggc gaaacccgac 1260aggactataa
agataccagg cgtttccccc tggaagctcc ctcgtgcgct ctcctgttcc 1320gaccctgccg
cttaccggat acctgtccgc ctttctccct tcgggaagcg tggcgctttc 1380tcatagctca
cgctgtaggt atctcagttc ggtgtaggtc gttcgctcca agctgggctg 1440tgtgcacgaa
ccccccgttc agcccgaccg ctgcgcctta tccggtaact atcgtcttga 1500gtccaacccg
gtaagacacg acttatcgcc actggcagca gccactggta acaggattag 1560cagagcgagg
tatgtaggcg gtgctacaga gttcttgaag tggtggccta actacggcta 1620cactagaagg
acagtatttg gtatctgcgc tctgctgaag ccagttacct tcggaaaaag 1680agttggtagc
tcttgatccg gcaaacaaac caccgctggt agcggtggtt tttttgtttg 1740caagcagcag
attacgcgca gaaaaaaagg atctcaagaa gatcctttga tcttttctac 1800ggggtctgac
gctcagtgga acgaaaactc acgttaaggg attttggtca tgagattatc 1860aaaaaggatc
ttcacctaga tccttttaaa ttaaaaatga agttttaaat caatctaaag 1920tatatatgag
taaacttggt ctgacagtta ccaatgctta atcagtgagg cacctatctc 1980agcgatctgt
ctatttcgtt catccatagt tgcctgactc cccgtcgtgt agataactac 2040gatacgggag
cgcttaccat ctggccccag tgctgcaatg ataccgcgag acccacgctc 2100accggctcca
gatttatcag caataaacca gccagccgga agggccgagc gcagaagtgg 2160tcctgcaact
ttatccgcct ccatccagtc tattaattgt tgccgggaag ctagagtaag 2220tagttcgcca
gttaatagtt tgcgcaacgt tgttgccatt gctacaggca tcgtggtgtc 2280acgctcgtcg
tttggtatgg cttcattcag ctccggttcc caacgatcaa ggcgagttac 2340atgatccccc
atgttgtgca aaaaagcggt tagctccttc ggtcctccga tcgttgtcag 2400aagtaagttg
gccgcagtgt tatcactcat ggttatggca gcactgcata attctcttac 2460tgtcatgcca
tccgtaagat gcttttctgt gactggtgag tactcaacca agtcattctg 2520agaatagtgt
atgcggcgac cgagttgctc ttgcccggcg tcaacacggg ataataccgc 2580gccacatagc
agaactttaa aagtgctcat cattggaaaa cgttcttcgg ggcgaaaact 2640ctcaaggatc
ttaccgctgt tgagatccag ttcgatgtaa cccactcgtg cacccaactg 2700atcttcagca
tcttttactt tcaccagcgt ttctgggtga gcaaaaacag gaaggcaaaa 2760tgccgcaaaa
aagggaataa gggcgacacg gaaatgttga atactcatac tcttcctttt 2820tcaatattat
tgaagcattt atcagggtta ttgtctcatg agcggataca tatttgaatg 2880tatttagaaa
aataaacaaa taggggttcc gcgcacattt ccccgaaaag tgccacctga 2940cgtctaagaa
accattatta tcatgacatt aacctataaa aataggcgta tcacgaggcc 3000ctttcgtctt
caagaaattc ggtcgaaaaa agaaaaggag agggccaaga gggagggcat 3060tggtgactat
tgagcacgtg agtatacgtg attaagcaca caaaggcagc ttggagtatg 3120tctgttatta
atttcacagg tagttctggt ccattggtga aagtttgcgg cttgcagagc 3180acagaggccg
cagaatgtgc tctagattcc gatgctgact tgctgggtat tatatgtgtg 3240cccaatagaa
agagaacaat tgacccggtt attgcaagga aaatttcaag tcttgtaaaa 3300gcatataaaa
atagttcagg cactccgaaa tacttggttg gcgtgtttcg taatcaacct 3360aaggaggatg
ttttggctct ggtcaatgat tacggcattg atatcgtcca actgcacgga 3420gatgagtcgt
ggcaagaata ccaagagttc ctcggtttgc cagttattaa aagactcgta 3480tttccaaaag
actgcaacat actactcagt gcagcttcac agaaacctca ttcgtttatt 3540cccttgtttg
attcagaagc aggtgggaca ggtgaacttt tggattggaa ctcgatttct 3600gactgggttg
gaaggcaaga gagccccgag agcttacatt ttatgttagc tggtggactg 3660acgccagaaa
atgttggtga tgcgcttaga ttaaatggcg ttattggtgt tgatgtaagc 3720ggaggtgtgg
agacaaatgg tgtaaaagac tctaacaaaa tagcaaattt cgtcaaaaat 3780gctaagaaat
aggttattac tgagtagtat ttatttaagt attgtttgtg cacttgcctg 3840cagcttctca
atgatattcg aatacgcttt gaggagatac agcctaatat ccgacaaact 3900gttttacaga
tttacgatcg tacttgttac ccatcattga attttgaaca tccgaacctg 3960ggagttttcc
ctgaaacaga tagtatattt gaacctgtat aataatatat agtctagcgc 4020tttacggaag
acaatgtatg tatttcggtt cctggagaaa ctattgcatc tattgcatag 4080gtaatcttgc
acgtcgcatc cccggttcat tttctgcgtt tccatcttgc acttcaatag 4140catatctttg
ttaacgaagc atctgtgctt cattttgtag aacaaaaatg caacgcgaga 4200gcgctaattt
ttcaaacaaa gaatctgagc tgcattttta cagaacagaa atgcaacgcg 4260aaagcgctat
tttaccaacg aagaatctgt gcttcatttt tgtaaaacaa aaatgcaacg 4320cgagagcgct
aatttttcaa acaaagaatc tgagctgcat ttttacagaa cagaaatgca 4380acgcgagagc
gctattttac caacaaagaa tctatacttc ttttttgttc tacaaaaatg 4440catcccgaga
gcgctatttt tctaacaaag catcttagat tacttttttt ctcctttgtg 4500cgctctataa
tgcagtctct tgataacttt ttgcactgta ggtccgttaa ggttagaaga 4560aggctacttt
ggtgtctatt ttctcttcca taaaaaaagc ctgactccac ttcccgcgtt 4620tactgattac
tagcgaagct gcgggtgcat tttttcaaga taaaggcatc cccgattata 4680ttctataccg
atgtggattg cgcatacttt gtgaacagaa agtgatagcg ttgatgattc 4740ttcattggtc
agaaaattat gaacggtttc ttctattttg tctctatata ctacgtatag 4800gaaatgttta
cattttcgta ttgttttcga ttcactctat gaatagttct tactacaatt 4860tttttgtcta
aagagtaata ctagagataa acataaaaaa tgtagaggtc gagtttagat 4920gcaagttcaa
ggagcgaaag gtggatgggt aggttatata gggatatagc acagagatat 4980atagcaaaga
gatacttttg agcaatgttt gtggaagcgg tattcgcaat gggaagctcc 5040accccggttg
ataatcagaa aagccccaaa aacaggaaga ttgtataagc aaatatttaa 5100attgtaaacg
ttaatatttt gttaaaattc gcgttaaatt tttgttaaat cagctcattt 5160tttaacgaat
agcccgaaat cggcaaaatc ccttataaat caaaagaata gaccgagata 5220gggttgagtg
ttgttccagt ttccaacaag agtccactat taaagaacgt ggactccaac 5280gtcaaagggc
gaaaaagggt ctatcagggc gatggcccac tacgtgaacc atcaccctaa 5340tcaagttttt
tggggtcgag gtgccgtaaa gcagtaaatc ggaagggtaa acggatgccc 5400ccatttagag
cttgacgggg aaagccggcg aacgtggcga gaaaggaagg gaagaaagcg 5460aaaggagcgg
gggctagggc ggtgggaagt gtaggggtca cgctgggcgt aaccaccaca 5520cccgccgcgc
ttaatggggc gctacagggc gcgtggggat ga
55623740DNAArtificial Sequencesynthetic oligonucleotide primer
37agaggaattc aggtcagact acaaggacga cgacgacaag
403827DNAArtificial Sequencesynthetic oligonucleotide primer 38cagaagctta
aggacgacga cgacaag
273927DNAArtificial Sequencesynthetic oligonucleotide primer 39caggaattca
aggacgacga cgacaag
274028DNAArtificial Sequencesynthetic oligonucleotide primer 40caggaattcc
aaggacgacg acgacaag
284129DNAArtificial Sequencesynthetic oligonucleotide primer 41caggaattca
caaggacgac gacgacaag
294216DNAArtificial Sequencesynthetic adaptor oligonucleotide
42aattcgaacc ccttcg
164312DNAArtificial Sequencesynthetic adaptor oligonucleotide
43cgaaggggtt cg
124417DNAArtificial Sequencesynthetic adaptor oligonucleotide
44aattcgaacc ccttcgc
174513DNAArtificial Sequencesynthetic adaptor oligonucleotide
45gcgaaggggt tcg
134618DNAArtificial Sequencesynthetic adaptor oligonucleotide
46aattcgaacc ccttcgcg
184713DNAArtificial Sequencesynthetic adaptor oligonucleotide
47gcgaaggggt tcg
134816DNAArtificial Sequencesynthetic adaptor oligonucleotide
48agctcgaagg ggttcg
164912DNAArtificial Sequencesynthetic adaptor oligonucleotide
49cgaacccctt cg
12508PRTArtificial Sequencesynthetic FLAG epitope 50Asp Tyr Lys Asp Asp
Asp Asp Lys 1 55131DNAArtificial Sequencesynthetic
FLAG-encoding oligonucleotide 51aattccgact acaaggacga cgatgacaag a
315231DNAArtificial Sequencesynthetic
FLAG-encoding oligonucleotide 52agcttcttgt catcgtcgtc cttgtagtcg g
315389DNAArtificial Sequencemisc_feature81,
82, 83, 84, 85, 86, 87, 88, 89n = A,T,C or G 53tttcccgaat tgtgagcgga
taacaataga aataattttg tttaacttta agaaggagat 60atatccatgg actacaaaga
nnnnnnnnn 895461DNAArtificial
Sequencesynthetic oligonucleotide 54ggggccaagc agtaataata cgagtcacta
tagggagacc acaacggttt cccgaattgt 60g
615523DNAArtificial Sequencesynthetic
adaptor oligonucleotide 55tttaagcagc tcgatagcag cac
235623DNAArtificial Sequencesynthetic adaptor
oligonucleotide 56gtgctgctat cgagctgctt aaa
235751DNAArtificial Sequencesynthetic lipoprotein
terminator oligonucleotide 57agacccgttt agaggcccca aggggttatg
gaattcacct ttaagcagct c 515826DNAArtificial
Sequencesynthetic M13 gene III oligonucleotide 58cgtgaaaaaa ttattattcg
caattc 265930DNAArtificial
Sequencesynthetic M13 gene III oligonucleotide 59ttaagactcc ttattacgca
gtatgttagc 30607551DNAArtificial
Sequencesynthetic pJFK vector 60ccccattatc ttagcctaaa aaaaccttct
ctttggaact ttcagtaata cgcttaactg 60ctcattgcta tattgaagta cggattagaa
gccgccgagc gggtgacagc cctccgaagg 120aagactctcc tccgtgcgtc ctcgtcttca
ccggtcgcgt tcctgaaacg cagatgtgcc 180tcgcgccgca ctgctccgaa caataaagat
tctacaatac tagcttttat ggttatgaag 240aggaaaaatt ggcagtaacc tggccccaca
aaccttcaaa tgaacgaatc aaattaacaa 300ccataggatg ataatgcgat tagtttttta
gccttatttc tggggtaatt aatcagcgaa 360gcgatgattt ttgatctatt aacagatata
taaatgcaaa aactgcataa ccactttaac 420taatactttc aacattttcg gtttgtatta
cttcttattc aaatgtaata aaagtatcaa 480caaaaaattg ttaatatacc tctatacttt
aacgtcaagg aggaattaag cttatgggtg 540ctcctccaaa aaagaagaga aaggtagctg
gtatcaataa agatatcgag gagtgcaatg 600ccatcattga gcagtttatc gactacctgc
gcaccggaca ggagatgccg atggaaatgg 660cggatcaggc gattaacgtg gtgccgggca
tgacgccgaa aaccattctt cacgccgggc 720cgccgatcca gcctgactgg ctgaaatcga
atggttttca tgaaattgaa gcggatgtta 780acgataccag cctcttgctg agtggagatg
cctcctaccc ttatgatgtg ccagattatg 840cctctcccga attcggccga ctcgagaagc
tttggacttc ttcgccagag gtttggtcaa 900gtctccaatc aaggttgtcg gcttgtctac
cttgccagaa atttacgaaa agatggaaaa 960gggtcaaatc gttggtagat acgttgttga
cacttctaaa taagcgaatt tcttatgatt 1020tatgattttt attattaaat aagttataaa
aaaaataagt gtatacaaat tttaaagtga 1080ctcttaggtt ttaaaacgaa aattcttgtt
cttgagtaac tctttcctgt aggtcaggtt 1140gctttctcag gtatagcatg aggtcgctct
tattgaccac acctctaccg gcatgccgag 1200caaatgcctg caaatcgctc cccatttcac
ccaattgtag atatgctaac tccagcaatg 1260agttgatgaa tctcggtgtg tattttatgt
cctcagagga caacacctgt tgtaatcgtt 1320cttccacacg gatcctctag agtcgactag
cggccgcttc gacctgcagc aattctgaac 1380cagtcctaaa acgagtaaat aggaccggca
attcttcaag caataaacag gaataccaat 1440tattaaaaga taacttagtc agatcgtaca
ataaagcttt gaagaaaaat gcgccttatt 1500caatctttgc tataaaaaat ggcccaaaat
ctcacattgg aagacatttg atgacctcat 1560ttctttcaat gaagggccta acggagttga
ctaatgttgt gggaaattgg agcgataagc 1620gtgcttctgc cgtggccagg acaacgtata
ctcatcagat aacagcaata cctgatcact 1680acttcgcact agtttctcgg tactatgcat
atgatccaat atcaaaggaa atgatagcat 1740tgaaggatga gactaatcca attgaggagt
ggcagcatat agaacagcta aagggtagtg 1800ctgaaggaag catacgatac cccgcatgga
atgggataat atcacaggag gtactagact 1860acctttcatc ctacataaat agacgcatat
aagtacgcat ttaagcataa acacgcacta 1920tgccgttctt ctcatgtata tatatataca
ggcaacacgc agatataggt gcgacgtgaa 1980cagtgagctg tatgtgcgca gctcgcgttg
cattttcgga agcgctcgtt ttcggaaacg 2040ctttgaagtt cctattccga agttcctatt
ctctagaaag tataggaact tcagagcgct 2100tttgaaaacc aaaagcgctc tgaagacgca
ctttcaaaaa accaaaaacg caccggactg 2160taacgagcta ctaaaatatt gcgaataccg
cttccacaaa cattgctcaa aagtatctct 2220ttgctatata tctctgtgct atatccctat
ataacctacc catccacctt tcgctccttg 2280aacttgcatc taaactcgac ctctacattt
tttatgttta tctctagtat tactctttag 2340acaaaaaaat tgtagtaaga actattcata
gagtgaatcg aaaacaatac gaaaatgtaa 2400acatttccta tacgtagtat atagagacaa
aatagaagaa accgttcata attttctgac 2460caatgaagaa tcatcaacgc tatcactttc
tgttcacaaa gtatgcgcaa tccacatcgg 2520tatagaatat aatcggggat gcctttatct
tgaaaaaatg cacccgcagc ttcgctagta 2580atcagtaaac gcgggaagtg gagtcaggct
ttttttatgg aagagaaaat agacaccaaa 2640gtagccttct tctaacctta acggacctac
agtgcaaaaa gttatcaaga gactgcatta 2700tagagcgcac aaaggagaaa aaaagtaatc
taagatgctt tgttagaaaa atagcgctct 2760cgggatgcat ttttgtagaa caaaaaagaa
gtatagattc tttgttggta aaatagcgct 2820ctcgcgttgc atttctgttc tgtaaaaatg
cagctcagat tctttgtttg aaaaattagc 2880gctctcgcgt tgcatttttg ttttacaaaa
atgaagcaca gattcttcgt tggtaaaata 2940gcgctttcgc gttgcatttc tgttctgtaa
aaatgcagct cagattcttt gtttgaaaaa 3000ttagcgctct cgcgttgcat ttttgttcta
caaaatgaag cacagatgct tcgttaacaa 3060agatatgcta ttgaagtgca agatggaaac
gcagaaaatg aaccggggat gcgacgtgca 3120agattaccta tgcaatagat gcaatagttt
ctccaggaac cgaaatacat acattgtctt 3180ccgtaaagcg ctagactata tattattata
caggttcaaa tatactatct gtttcaggga 3240aaactcccag gttcggatgt tcaaaattca
atgatgggta acaagtacga tcgtaaatct 3300gtaaaacagt ttgtcggata ttaggctgta
tctcctcaaa gcgtattcga tctgtctttc 3360gccgaaacct gtttgatgac tacttcatca
attttttttt tttctgccgc attccaaagg 3420tcataacttt gcaaaaataa agggtaaatg
gttaaaaatt gttatcataa ataaggtgac 3480cggttatatt gagacctttc ctggacagta
actaatacag aagccattgg taatgcaata 3540atttatttga tcatgtgact acgatccggg
tgagactatt caaaaaagga gtcaagcatt 3600gaaataatta atgactaatc cgaagttaat
tgttaggagt caattgtttt ttccaatgaa 3660tggaatctga gatgactaaa ctaccaattt
tcaatagttc atggtatagt gacgtagtta 3720gtgctttttt ttcttggatc tgttgactca
cttcaattga tgtttcttac cctgacatga 3780catacttgat attttatctc tcacgttata
taacttgaaa aggatgcaca cagttctgtt 3840caatataccc tccaatatgt aaaaacagtt
tttccattga ttactcttaa tttgtttcct 3900gctaaaccag cagtacgtgt gtgccgtata
tattaaaatt acactatggt ttttgatttg 3960aaaagaattg ttagaccaaa aatttataac
ttggaacctt atcgctgtgc aagagatgat 4020ttcaccgagg gtatattgct agacgccaat
gaaaatgccc atggacctac tccagttgaa 4080ttgagcaaga ccaatttaca tcgttacccg
gatcctcacc aattggagtt caagaccgca 4140atgacgaaat acaggaacaa aacaagcagt
tatgccaatg acccagaggt aaaaccttta 4200actgctgaca atctgtgcct aggtgtggga
tctgatgaga gtattgatgc tattattaga 4260gcatgctgtg ttcccgggaa agaaaagatt
ctggttcttc caccaacata ttctatgtac 4320tctgtttgtg caaacattaa tgatatagaa
gtcgtccaat gtcctttaac tgtttccgac 4380ggttcttttc aaatggatac cgaagctgta
ttaaccattt tgaaaaacga ctcgctaatt 4440aagttgatgt tcgttacttc accaggtaat
ccaaccggag ccaaaattaa gaccagttta 4500atcgaaaagg tcttacagaa ttgggacaat
gggttagtcg ttgttgatga agcttacgta 4560gatttttgtg gtggctctac agctccacta
gtcaccaagt atcctaactt ggttactttg 4620caaactctat ccaagtcatt cggtttagcc
gggattaggt tgggtatgac atatgcaaca 4680gcagagttgg ccagaatttt aaatgcaatg
aaggcgcctt ataatatttc ctccctagcc 4740tctgaatatg cactaaaagc tgttcaagac
agtaatctaa agaagatgga agccacttcg 4800aaaataatca atgaagagaa aatgcgcctc
ttaaaggaat taactgcttt ggattacgtt 4860gatgaccaat atgttggtgg attagatgct
aattttcttt taatacggat caacgggggt 4920gacaatgtct tggcaaagaa gttatattac
caattggcta ctcaatctgg ggttgtcgtc 4980agatttagag gtaacgaatt aggctgttcc
ggatgtttga gaattaccgt tggaacccat 5040gaggagaaca cacatttgat aaagtacttc
aaggagacgt tatataagct ggccaatgaa 5100taaatagacg tcaacaaaat tcagaagaac
tcgtcaagaa ggcgatagaa ggcgatgcgc 5160tgcgaatcgg gagcggcgat accgtaaagc
acgaggaagc ggtcagccca ttcgccgcca 5220agctcttcag caatatcacg ggtagccaac
gctatgtcct gatagcggtc cgccacaccc 5280agccggccac agtcgatgaa tccagaaaag
cggccatttt ccaccatgat attcggcaag 5340caggcatcgc catgggtcac gacgagatcc
tcgccgtcgg gcatgctcgc cttgagcctg 5400gcgaacagtt cggctggcgc gagcccctga
tgctcttcgt ccagatcatc ctgatcgaca 5460agaccggctt ccatccgagt acgtgctcgc
tcgatgcgat gtttcgcttg gtggtcgaat 5520gggcaggtag ccggatcaag cgtatgcagc
cgccgcattg catcagccat gatggatact 5580ttctcggcag gagcaaggtg agatgacagg
agatcctgcc ccggcacttc gcccaatagc 5640agccagtccc ttcccgcttc agtgacaacg
tcgagcacag ctgcgcaagg aacgcccgtc 5700gtggccagcc acgatagccg cgctgcctcg
tcttgcagtt cattcagggc accggacagg 5760tcggtcttga caaaaagaac cgggcgcccc
tgcgctgaca gccggaacac ggcggcatca 5820gagcagccga ttgtctgttg tgcccagtca
tagccgaata gcctctccac ccaagcggcc 5880ggagaacctg cgtgcaatcc atcttgttca
atcatgcgaa acgatcctca tcctgtctct 5940tgatcagatc ttgatcccct gcgccatcag
atccttggcg gcgagaaagc catccagttt 6000actttgcagg gcttcccaac cttaccagag
ggcgccccag ctggcaattc cggttcgctt 6060gctgtccata aaaccgccca gtctagctat
cgccatgtaa gcccactgca agctacctgc 6120tttctctttg cgcttgcgtt ttcccttgtc
cagatagccc agtagctgac attcatccgg 6180ggtcagcacc gtttctgcgg actggctttc
tacgtgaaaa ggatctaggt gaagatcctt 6240tttgataatc tcatgaccaa aatcccttaa
cgtgagtttt cgtgactccc cgtcaggcaa 6300ctatggatga acgaaataga cagatcgctg
agataggtgc ctcactgatt aagcattggt 6360aactgtcaga ccaagtttac tcatatatac
tttagattga tttaaaactt catttttaat 6420ttaaaaggat ctaggtgaag atcctttttg
ataatctcat gaccaaaatc ccttaacgtg 6480agttttcgtt ccactgagcg tcagaccccg
tagaaaagat caaaggatct tcttgagatc 6540ctttttttct gcgcgtaatc tgctgcttgc
aaacaaaaaa accaccgcta ccagcggtgg 6600tttgtttgcc ggatcaagag ctaccaactc
tttttccgaa ggtaactggc ttcagcagag 6660cgcagatacc aaatactgtc cttctagtgt
agccgtagtt aggccaccac ttcaagaact 6720ctgtagcacc gcctacatac ctcgctctgc
taatcctgtt accagtggct gctgccagtg 6780gcgataagtc gtgtcttacc gggttggact
caagacgata gttaccggat aaggcgcagc 6840ggtcgggctg aacggggggt tcgtgcacac
agcccagctt ggagcgaacg acctacaccg 6900aactgagata cctacagcgt gagctatgag
aaagcgccac gcttcccgaa gggagaaagg 6960cggacaggta tccggtaagc ggcagggtcg
gaacaggaga gcgcacgagg gagcttccag 7020ggggaaacgc ctggtatctt tatagtcctg
tcgggtttcg ccacctctga cttgagcgtc 7080gatttttgtg atgctcgtca ggggggcgga
gcctatggaa aaacgccagc aacgcggcct 7140ttttacggtt cctggccttt tgctggcctt
ttgctcacat gttctttcct gcgttatccc 7200ctgattctgt ggataaccgt attaccgcct
ttgagtgagc tgataccgct cgccgcagcc 7260gaacgaccga gcgcagcgag tcagtgagcg
aggaagcgga agagcgccca atacgcaaac 7320cgcctctccc cgcgcgttgg ccgattcatt
aatgcagctg gcacgacagg tttcccgact 7380ggaaagcggg cagtgagcgc aacgcaatta
atgtgagtta gctcactcat taggcacccc 7440aggctttaca ctttatgctt ccggctcgta
tgttgtgtgg aattgtgagc ggataacaat 7500ttcacacagg aaacagctat gacatgatta
cgaattaatt cgagctcggt a 7551617308DNAArtificial
Sequencesynthetic pDD vector 61cttgaatttt caaaaattct tacttttttt
ttggatggac gcaaagaagt ttaataatca 60tattacatgg cattaccacc atatacatat
ccatatacat atccatatct aatcttactt 120atatgttgtg gaaatgtaaa gagccccatt
atcttagcct aaaaaaacct tctctttgga 180actttcagta atacgcttaa ctgctcattg
ctatattgaa gtacggatta gaagccgccg 240agcgggtgac agccctccga aggaagactc
tcctccgtgc gtcctcgtct tcaccggtcg 300cgttcctgaa acgcagatgt gcctcgcgcc
gcactgctcc gaacaataaa gattctacaa 360tactagcttt tatggttatg aagaggaaaa
attggcagta acctggcccc acaaaccttc 420aaatgaacga atcaaattaa caaccatagg
atgataatgc gattagtttt ttagccttat 480ttctggggta attaatcagc gaagcgatga
tttttgatct attaacagat atataaatgc 540aaaaactgca taaccacttt aactaatact
ttcaacattt tcggtttgta ttacttctta 600ttcaaatgta ataaaagtat caacaaaaaa
ttgttaatat acctctatac tttaacgtca 660aggagaaaaa accccggatc aagggtgcga
tatgaaagcg ttaacggcca ggcaacaaga 720ggtgtttgat ctcatccgtg atcacatcag
ccagacaggt atgccgccga cgcgtgcgga 780aatcgcgcag cgtttggggt tccgttcccc
aaacgcggct gaagaacatc tgaaggcgct 840ggcacgcaaa ggcgttattg aaattgtttc
cggcgcatca cgcgggattc gtctgttgca 900ggaagaggaa gaagggttgc cgctggtagg
tcgtgtggct gccggtgaac cacttctggc 960gcaacagcat attgaaggtc attatcaggt
cgatccttcc ttattcaagc cgaatgctga 1020tttcctgctg cgcgtcagcg ggatgtcgat
gaaagatatc ggcattatgg atggtgactt 1080gctggcagtg cataaaactc aggatgtacg
taacggtcag gtcgttgtcg cacgtattga 1140tgacgaagtt accgttaagc gcctgaaaaa
acagggcaat aaagtcgaac tgttgccaga 1200aaatagcgag tttaaaccaa ttgtcgtaga
tcttcgtcag cagagcttca ccattgaagg 1260gctggcggtt ggggttattc gcaacggcga
ctggctggaa ttcccgggga tccgtcgacc 1320atggcggccg ctcgagtcga cctgcagcca
agctaattcc gggcgaattt cttatgattt 1380atgattttta ttattaaata agttataaaa
aaaataagtg tatacaaatt ttaaagtgac 1440tcttaggttt taaaacgaaa attcttgttc
ttgagtaact ctttcctgta ggtcaggttg 1500ctttctcagg tatagcatga ggtcgctctt
attgaccaca cctctaccgg catgccgagc 1560aaatgcctgc aaatcgctcc ccatttcacc
caattgtaga tatgctaact ccagcaatga 1620gttgatgaat ctcggtgtgt attttatgtc
ctcagaggac aacacctgtt gtaatccgtc 1680cgagctccaa ttcgccctat agtgagtcgt
attacaattc actggccgtc gttttacaac 1740gtcgtgactg ggaaaaccct ggcgttaccc
aacttaatcg ccttgcagca catccccctt 1800tcgccagctg gcgtaatagc gaagaggccc
gcaccgatcg cccttcccaa cagttgcgca 1860gcctgaatgg cgaatggcgc gacgcgccct
gtagcggcgc attaagcgcg gcgggtgtgg 1920tggttacgcg cagcgtgacc gctacacttg
ccagcgccct agcgcccgct cctttcgctt 1980tcttcccttc ctttctcgcc acgttcgccg
gctttccccg tcaagctcta aatcgggggc 2040tccctttagg gttccgattt agtgctttac
ggcacctcga ccccaaaaaa cttgattagg 2100gtgatggttc acgtagtggg ccatcgccct
gatagacggt ttttcgccct ttgacgttgg 2160agtccacgtt ctttaatagt ggactcttgt
tccaaactgg aacaacactc aaccctatct 2220cggtctattc ttttgattta taagggattt
tgccgatttc ggcctattgg ttaaaaaatg 2280agctgattta acaaaaattt aacgcgaatt
ttaacaaaat attaacgttt acaatttcct 2340gatgcggtat tttctcctta cgcatctgtg
cggtatttca caccgcatat gatccgtcga 2400gttcaagaga aaaaaaaaga aaaagcaaaa
agaaaaaagg aaagcgcgcc tcgttcagaa 2460tgacacgtat agaatgatgc attaccttgt
catcttcagt atcatactgt tcgtatacat 2520acttactgac attcataggt atacatatat
acacatgtat atatatcgta tgctgcagct 2580ttaaataatc ggtgtcacta cataagaaca
cctttggtgg agggaacatc gttggtacca 2640ttgggcgagg tggcttctct tatggcaacc
gcaagagcct tgaacgcact ctcactacgg 2700tgatgatcat tcttgcctcg cagacaatca
acgtggaggg taattctgct agcctctgca 2760aagctttcaa gaaaatgcgg gatcatctcg
caagagagat ctcctacttt ctccctttgc 2820aaaccaagtt cgacaactgc gtacggcctg
ttcgaaagat ctaccaccgc tctggaaagt 2880gcctcatcca aaggcgcaaa tcctgatcca
aaccttttta ctccacgcgc cagtagggcc 2940tctttaaaag cttgaccgag agcaatcccg
cagtcttcag tggtgtgatg gtcgtctatg 3000tgtaagtcac caatgcactc aacgattagc
gaccagccgg aatgcttggc cagagcatgt 3060atcatatggt ccagaaaccc tatacctgtg
tggacgttaa tcacttgcga ttgtgtggcc 3120tgttctgcta ctgcttctgc ctctttttct
gggaagatcg agtgctctat cgctagggga 3180ccacccttta aagagatcgc aatctgaatc
ttggtttcat ttgtaatacg ctttactagg 3240gctttctgct ctgtcatctt tgccttcgtt
tatcttgcct gctcattttt tagtatattc 3300ttcgaagaaa tcacattact ttatataatg
tataattcat tatgtgataa tgccaatcgc 3360taagaaaaaa aaagagtcat ccgctaggtg
gaaaaaaaaa aatgaaaatc attaccgagg 3420cataaaaaaa tatagagtgt actagaggag
gccaagagta atagaaaaag aaaattgcgg 3480gaaaggactg tgttatgact tccctgacta
atgccgtgtt caaacgatac ctggcagtga 3540ctcctagcgc tcaccaagct cttaaaacgg
aattatggtg cactctcagt acaatctgct 3600ctgatgccgc atagttaagc cagccccgac
acccgccaac acccgctgac gcgccctgac 3660gggcttgtct gctcccggca tccgcttaca
gacaagctgt gaccgtctcc gggagctgca 3720tgtgtcagag gttttcaccg tcatcaccga
aacgcgcgag acgaaagggc ctcgtgatac 3780gcctattttt ataggttaat gtcatgataa
taatggtttc ttaggacgga tcgcttgcct 3840gtaacttaca cgcgcctcgt atcttttaat
gatggaataa tttgggaatt tactctgtgt 3900ttatttattt ttatgttttg tatttggatt
ttagaaagta aataaagaag gtagaagagt 3960tacggaatga agaaaaaaaa ataaacaaag
gtttaaaaaa tttcaacaaa aagcgtactt 4020tacatatata tttattagac aagaaaagca
gattaaatag atatacattc gattaacgat 4080aagtaaaatg taaaatcaca ggattttcgt
gtgtggtctt ctacacagac aagatgaaac 4140aattcggcat taatacctga gagcaggaag
agcaagataa aaggtagtat ttgttggcga 4200tccccctaga gtcttttaca tcttcggaaa
acaaaaacta ttttttcttt aatttctttt 4260tttactttct atttttaatt tatatattta
tattaaaaaa tttaaattat aattattttt 4320atagcacgtg atgaaaagga cccaggtggc
acttttcggg gaaatgtgcg cggaacccct 4380atttgtttat ttttctaaat acattcaaat
atgtatccgc tcatgagaca ataaccctga 4440taaatgcttc aataaattgg tcacccggcc
agcgacatgg aggcccagaa taccctcctt 4500gacagtcttg acgtgcgcag ctcaggggca
tgatgtgact gtcgcccgta catttagccc 4560atacatcccc atgtataatc atttgcatcc
atacattttg atggccgcac ggcgcgaagc 4620aaaaattacg gctcctcgct gcagacctgc
gagcagggaa acgctcccct cacagacgcg 4680ttgaattgtc cccacgccgc gcccctgtag
agaaatataa aaggttagga tttgccactg 4740aggttcttct ttcatatact tccttttaaa
atcttgctag gatacagttc tcacatcaca 4800tccgaacata aacaaccatg ggtaaggaaa
agactcacgt ttcgaggccg cgattaaatt 4860ccaacatgga tgctgattta tatgggtata
aatgggctcg cgataatgtc gggcaatcag 4920gtgcgacaat ctatcgattg tatgggaagc
ccgatgcgcc agagttgttt ctgaaacatg 4980gcaaaggtag cgttgccaat gatgttacag
atgagatggt cagactaaac tggctgacgg 5040aatttatgcc tcttccgacc atcaagcatt
ttatccgtac tcctgatgat gcatggttac 5100tcaccactgc gatccccggc aaaacagcat
tccaggtatt agaagaatat cctgattcag 5160gtgaaaatat tgttgatgcg ctggcagtgt
tcctgcgccg gttgcattcg attcctgttt 5220gtaattgtcc ttttaacagc gatcgcgtat
ttcgtctcgc tcaggcgcaa tcacgaatga 5280ataacggttt ggttgatgcg agtgattttg
atgacgagcg taatggctgg cctgttgaac 5340aagtctggaa agaaatgcat aagcttttgc
cattctcacc ggattcagtc gtcactcatg 5400gtgatttctc acttgataac cttatttttg
acgaggggaa attaataggt tgtattgatg 5460ttggacgagt cggaatcgca gaccgatacc
aggatcttgc catcctatgg aactgcctcg 5520gtgagttttc tccttcatta cagaaacggc
tttttcaaaa atatggtatt gataatcctg 5580atatgaataa attgcagttt catttgatgc
tcgatgagtt tttctaatca gtcctcggag 5640atccgtcccc cttttccttt gtcgatatca
tgtaattagt tatgtcacgc ttacattcac 5700gccctccccc cacatccgct ctaaccgaaa
aggaaggagt tagacaacct gaagtctagg 5760tccctattta tttttttata gttatgttag
tattaagaac gttatttata tttcaaattt 5820ttcttttttt tctgtacaga cgcgtgtacg
catgtaacat tatactgaaa accttgcttg 5880agaaggtttt gggacgctcg aaggctttaa
tttgcaagct ggggtctcgc ggtcggtatc 5940attgcagcac tggggccaga tggtaagccc
tcccgtatcg tagttatcta cacgacgggc 6000agtcaggcaa ctatggatga acgaaataga
cagatcgctg agataggtgc ctcactgatt 6060aagcattggt aactgtcaga ccaagtttac
tcatatatac tttagattga tttaaaactt 6120catttttaat ttaaaaggat ctaggtgaag
atcctttttg ataatctcat gaccaaaatc 6180ccttaacgtg agttttcgtt ccactgagcg
tcagaccccg tagaaaagat caaaggatct 6240tcttgagatc ctttttttct gcgcgtaatc
tgctgcttgc aaacaaaaaa accaccgcta 6300ccagcggtgg tttgtttgcc ggatcaagag
ctaccaactc tttttccgaa ggtaactggc 6360ttcagcagag cgcagatacc aaatactgtc
cttctagtgt agccgtagtt aggccaccac 6420ttcaagaact ctgtagcacc gcctacatac
ctcgctctgc taatcctgtt accagtggct 6480gctgccagtg gcgataagtc gtgtcttacc
gggttggact caagacgata gttaccggat 6540aaggcgcagc ggtcgggctg aacggggggt
tcgtgcacac agcccagctt ggagcgaacg 6600acctacaccg aactgagata cctacagcgt
gagcattgag aaagcgccac gcttcccgaa 6660gggagaaagg cggacaggta tccggtaagc
ggcagggtcg gaacaggaga gcgcacgagg 6720gagcttccag gggggaacgc ctggtatctt
tatagtcctg tcgggtttcg ccacctctga 6780cttgagcgtc gatttttgtg atgctcgtca
ggggggccga gcctatggaa aaacgccagc 6840aacgcggcct ttttacggtt cctggccttt
tgctggcctt ttgctcacat gttctttcct 6900gcgttatccc ctgattctgt ggataaccgt
attaccgcct ttgagtgagc tgataccgct 6960cgccgcagcc gaacgaccga gcgcagcgag
tcagtgagcg aggaagcgga agagcgccca 7020atacgcaaac cgcctctccc cgcgcgttgg
ccgattcatt aatgcagctg gcacgacagg 7080tttcccgact ggaaagcggg cagtgagcgc
aacgcaatta atgtgagtta gctcactcat 7140taggcacccc aggctttaca ctttatgctt
ccggctcgta tgttgtgtgg aattgtgagc 7200ggataacaat ttcacacagg aaacagctat
gaccatgatt accccaagct cgaaattaac 7260cctcactaaa gggaacaaaa gctggtaccg
ggccccccct cgaaattc 730862289DNAArtificial
SequenceCDS(1)...(165)synthetic clone BGF05 with first open reading
frame 62atg ggt aag cct atc cct aac cct ctc ctc ggt ctc gat tct aca caa
48Met Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr Gln 1
5 10 15gct atg ggt gct cct
cca aaa aag aag aga aag gta gct gaa ttc gca 96Ala Met Gly Ala Pro
Pro Lys Lys Lys Arg Lys Val Ala Glu Phe Ala 20
25 30agg acg acg acg aca agg ctt atc aat caa tca gtg
gtt aga aaa ata 144Arg Thr Thr Thr Thr Arg Leu Ile Asn Gln Ser Val
Val Arg Lys Ile 35 40 45tgg cta
tat cga gat gca agg taacgaaacg ttcaaattgg cagttcgtga 195Trp Leu
Tyr Arg Asp Ala Arg 50 55actttcaaat gtggtggaag
aaacactttt agccaataat ttagataaaa aagatttaga 255ctggcttgtc gtcgtcgtcc
ttgtagtctg acct 2896355PRTArtificial
Sequencesynthetic clone BGF05 with first open reading frame 63Met
Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr Gln 1
5 10 15Ala Met Gly Ala Pro Pro Lys
Lys Lys Arg Lys Val Ala Glu Phe Ala 20 25
30Arg Thr Thr Thr Thr Arg Leu Ile Asn Gln Ser Val Val Arg
Lys Ile 35 40 45Trp Leu Tyr Arg
Asp Ala Arg 50 5564196DNAArtificial Sequencesynthetic
BGF05 H. influenzae insertion 64gcaaggacga cgacgacaag gcttatcaat
caatcagtgg ttagaaaaat atggctatat 60cgagatgcaa ggtaacgaaa cgttcaaatt
ggcagttcgt gaactttcaa atgtggtgga 120agaaacactt ttagccaata atttagataa
aaaagattta gactggcttg tcgtcgtcgt 180ccttgtagtc tgacct
1966524PRTArtificial Sequencesynthetic
SCL-E47 antagonist encoded by BGF05 H. influenzae insertion 65Ala
Arg Thr Thr Thr Thr Arg Leu Ile Asn Gln Ser Val Val Arg Lys 1
5 10 15Ile Trp Leu Tyr Arg Asp Ala
Arg 2066419DNAArtificial Sequencesynthetic clone BGF06 with
first open reading frame 66atg ggt aag cct atc cct aac cct ctc ctc
ggt ctc gat tct aca caa 48Met Gly Lys Pro Ile Pro Asn Pro Leu Leu
Gly Leu Asp Ser Thr Gln 1 5 10
15gct atg ggt gct cct cca aaa aag aag aga aag gta gct gaa ttc agg
96Ala Met Gly Ala Pro Pro Lys Lys Lys Arg Lys Val Ala Glu Phe Arg
20 25 30tca gac tac aag gac gac
gac gac aag gct tat cac ata att gct gtt 144Ser Asp Tyr Lys Asp Asp
Asp Asp Lys Ala Tyr His Ile Ile Ala Val 35 40
45tgt ttt tta atc aag gta tca tgacatgtcc caacctcgcc
cactgctctc 195Cys Phe Leu Ile Lys Val Ser 50
55tcctcccgaa actgaagaac agttgttagc gcaagcacag caactttctg gttatacatt
255gggagaactg gcggcacttg tcgggctggt tacgccagag aatttaaaac gngataaagg
315ctggattggc gtgttactgg agatctggct aggtgccagn gnagggagta aacctgagca
375agattttgct gttgaataca cctgattgat tgataacctt gtcg
4196755PRTArtificial Sequencesynthetic clone BGF06 with first open
reading frame 67Met Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp
Ser Thr Gln 1 5 10 15Ala
Met Gly Ala Pro Pro Lys Lys Lys Arg Lys Val Ala Glu Phe Arg 20
25 30Ser Asp Tyr Lys Asp Asp Asp Asp
Lys Ala Tyr His Ile Ile Ala Val 35 40
45Cys Phe Leu Ile Lys Val Ser 50
5568326DNAArtificial Sequencemisc_feature214, 262, 264n = A,T,C or G
68aggtcagact acaaggacga cgacgacaag gcttatcaca taattgctgt ttgtttttta
60atcaaggtat catgacatgt cccaacctcg cccactgctc tctcctcccg aaactgaaga
120acagttgtta gcgcaagcac agcaactttc tggttataca ttgggagaac tggcggcact
180tgtcgggctg gttacgccag agaatttaaa acgngataaa ggctggattg gcgtgttact
240ggagatctgg ctaggtgcca gngnagggag taaacctgag caagattttg ctgttgaata
300cacctgattg attgataacc ttgtcg
3266924PRTArtificial Sequencesynthetic SCL-E47 antagonist encoded by
clone BGF06 A. aeolicus insertion 69Arg Ser Asp Tyr Lys Asp Asp Asp
Asp Lys Ala Tyr His Ile Ile Ala 1 5 10
15Val Cys Phe Leu Ile Lys Val Ser
2070220DNAArtificial SequenceCDS(1)...(123)synthetic clone BGF13 with
first open reading frame 70atg ggt aag cct atc cct aac cct ctc ctc
ggt ctc gat tct aca caa 48Met Gly Lys Pro Ile Pro Asn Pro Leu Leu
Gly Leu Asp Ser Thr Gln 1 5 10
15gct atg ggt gct cct cca aaa aag aag aga aag gta gct gaa ttc gga
96Ala Met Gly Ala Pro Pro Lys Lys Lys Arg Lys Val Ala Glu Phe Gly
20 25 30ttt tgc tct aat caa atg
aga gaa atg taaaatgaag ccacgaacat 143Phe Cys Ser Asn Gln Met
Arg Glu Met 35 40attaataata gcctaccact
gcaaccatta gttcctgatc aggagaacaa aaataagaga 203aatgaagaga aatccgt
2207141PRTArtificial
Sequencesynthetic clone BGF13 with first open reading frame 71Met
Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr Gln 1
5 10 15Ala Met Gly Ala Pro Pro Lys
Lys Lys Arg Lys Val Ala Glu Phe Gly 20 25
30Phe Cys Ser Asn Gln Met Arg Glu Met 35
4072127DNAArtificial Sequencesynthetic clone BGF13 H. influenzae
insertion 72ggattttgct ctaatcaaat gagagaaatg taaaatgaag ccacgaacat
attaataata 60gcctaccact gcaaccatta gttcctgatc aggagaacaa aaataagaga
aatgaagaga 120aatccgt
1277310PRTArtificial Sequencesynthetic SCL-E47 antagonist
encoded by clone BGF13 H. influenzae insertion 73Gly Phe Cys Ser Asn
Gln Met Arg Glu Met 1 5
1074273DNAArtificial SequenceCDS(1)...(171)synthetic clone BGF24 with
first open reading frame 74atg ggt aag cct atc cct aac cct ctc ctc
ggt ctc gat tct aca caa 48Met Gly Lys Pro Ile Pro Asn Pro Leu Leu
Gly Leu Asp Ser Thr Gln 1 5 10
15gct atg ggt gct cct cca aaa aag aag aga aag gta gct gaa ttc agg
96Ala Met Gly Ala Pro Pro Lys Lys Lys Arg Lys Val Ala Glu Phe Arg
20 25 30tca gac tac aag gac gac
gac gac aag ctt atc aaa cat cac tgg gtg 144Ser Asp Tyr Lys Asp Asp
Asp Asp Lys Leu Ile Lys His His Trp Val 35 40
45ctt tca atc atc acc acc gcg tct cgc taacctgttt caaataccac
191Leu Ser Ile Ile Thr Thr Ala Ser Arg 50
55catgaactcc tctccaccgt atcttgacta caagggatga ttgattgata agccttgtcg
251tcgtcgtcct tgtagtctga ct
2737557PRTArtificial Sequencesynthetic clone BGF24 with first open
reading frame 75Met Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp
Ser Thr Gln 1 5 10 15Ala
Met Gly Ala Pro Pro Lys Lys Lys Arg Lys Val Ala Glu Phe Arg 20
25 30Ser Asp Tyr Lys Asp Asp Asp Asp
Lys Leu Ile Lys His His Trp Val 35 40
45Leu Ser Ile Ile Thr Thr Ala Ser Arg 50
5576180DNAArtificial Sequencesynthetic clone BGF24 T. maritima insertion
76aggtcagact acaaggacga cgacgacaag cttatcaaac atcactgggt gctttcaatc
60atcaccaccg cgtctcgcta acctgtttca aataccacca tgaactcctc tccaccgtat
120cttgactaca agggatgatt gattgataag ccttgtcgtc gtcgtccttg tagtctgact
1807726PRTArtificial Sequencesynthetic SCL-E47 antagonist encoded by
clone BGF24 T. maritima insertion 77Arg Ser Asp Tyr Lys Asp Asp Asp
Asp Lys Leu Ile Lys His His Trp 1 5 10
15Val Leu Ser Ile Ile Thr Thr Ala Ser Arg 20
2578288DNAArtificial SequenceCDS(1)...(282)synthetic clone
BGF35 with first open reading frame 78atg ggt aag cct atc cct aac
cct ctc ctc ggt ctc gat tct aca caa 48Met Gly Lys Pro Ile Pro Asn
Pro Leu Leu Gly Leu Asp Ser Thr Gln 1 5
10 15gct atg ggt gct cct cca aaa aag aag aga aag gta gct
gaa ttc caa 96Ala Met Gly Ala Pro Pro Lys Lys Lys Arg Lys Val Ala
Glu Phe Gln 20 25 30gga cga
cga cga caa ggc tta tca atc aat cag tgg tta gaa aaa tat 144Gly Arg
Arg Arg Gln Gly Leu Ser Ile Asn Gln Trp Leu Glu Lys Tyr 35
40 45ggc tat atc gag atg caa ggt aac gaa acg
ttc aaa ttg gca gtt cgt 192Gly Tyr Ile Glu Met Gln Gly Asn Glu Thr
Phe Lys Leu Ala Val Arg 50 55 60gaa
ctt tca aat gtg gtg gaa gaa aca ctt tta gcc aat aat tta gat 240Glu
Leu Ser Asn Val Val Glu Glu Thr Leu Leu Ala Asn Asn Leu Asp 65
70 75 80aaa aaa gat tta gac tgg
ctt gtc gtc gtc gtc ctt gta gtc 282Lys Lys Asp Leu Asp Trp
Leu Val Val Val Val Leu Val Val 85
90tgacct
2887994PRTArtificial Sequencesynthetic clone BGF35 with first open
reading frame 79Met Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp
Ser Thr Gln 1 5 10 15Ala
Met Gly Ala Pro Pro Lys Lys Lys Arg Lys Val Ala Glu Phe Gln 20
25 30Gly Arg Arg Arg Gln Gly Leu Ser
Ile Asn Gln Trp Leu Glu Lys Tyr 35 40
45Gly Tyr Ile Glu Met Gln Gly Asn Glu Thr Phe Lys Leu Ala Val Arg
50 55 60Glu Leu Ser Asn Val Val Glu Glu
Thr Leu Leu Ala Asn Asn Leu Asp65 70 75
80Lys Lys Asp Leu Asp Trp Leu Val Val Val Val Leu Val
Val 85 9080195DNAArtificial
Sequencesynthetic clone BGF35 H. influenzae insertion 80caaggacgac
gacgacaagg cttatcaatc aatcagtggt tagaaaaata tggctatatc 60gagatgcaag
gtaacgaaac gttcaaattg gcagttcgtg aactttcaaa tgtggtggaa 120gaaacacttt
tagccaataa tttagataaa aaagatttag actggcttgt cgtcgtcgtc 180cttgtagtct
gacct
1958163PRTArtificial Sequencesynthetic SCL-E47 antagonist encoded by
clone BGF35 H. influenzae insertion 81Gln Gly Arg Arg Arg Gln Gly
Leu Ser Ile Asn Gln Trp Leu Glu Lys 1 5 10
15Tyr Gly Tyr Ile Glu Met Gln Gly Asn Glu Thr Phe Lys
Leu Ala Val 20 25 30Arg Glu
Leu Ser Asn Val Val Glu Glu Thr Leu Leu Ala Asn Asn Leu 35
40 45Asp Lys Lys Asp Leu Asp Trp Leu Val Val
Val Val Leu Val Val 50 55 60
User Contributions:
comments("1"); ?> comment_form("1"); ?>Inventors list |
Agents list |
Assignees list |
List by place |
Classification tree browser |
Top 100 Inventors |
Top 100 Agents |
Top 100 Assignees |
Usenet FAQ Index |
Documents |
Other FAQs |
User Contributions:
Comment about this patent or add new information about this topic: